ABI PRISM SNaPshot™ Multiplex Kit
Contents
1. Step Action 1 Label two 0 2 mL MicroAmp tubes one for the positive control reaction and one for the negative control reaction 2 Thaw the SNaPshot Multiplex Ready Reaction Mix Control Template and Control Reaction Primer Mix on ice Prepare the following reaction mix on ice Positive Negative Control Control Item HL HL SNaPshot Multiplex Ready 5 5 Reaction Mix SNaPshot Multiplex Control 2 0 Template SNaPshot Multiplex Control 1 1 Primer Mix Deionized water Total 10 10 3 Mix and spin briefly Note Keep the SNaPshot mixture on ice before putting it into the thermal cycler Leaving the mixture at ambient temperature for 20 minutes or longer may result in a higher background 4 Proceed to Thermal Cycling and Post Extension Treatmen on page 16 13 Preparing Your Sample Reactions Overview SNaPshot Primer Design Pooling PCR Amplified SNaPshot Templates Pooling SNaPshot 14 Primers This section describes how you set up multiplex SNaPshot reactions using your templates and primers See SNaPshot Primer Design and Evaluation Recommendations on page 29 for recommendations on designing and evaluating primers If you have multiple purified PCR amplified samples to run in a single SNaPshot reaction mix equal volumes e g 2 UL each of these products in a tube and place the tube on ice Note SNaPshot Multiplex Ready Mix gives satisfactory results over a rang2. DNA strand if the positive DNA strand is difficult to assay 29 30 Run a negative control reaction lacking template DNA when evaluating a new primer Certain primer template combinations may require adjusting the annealing temperature or annealing time Refer to Appendix C on page 32 For an illustration of the use of multiplexed primers in a SNP validation application see the following reference Lindblad Toh K et a Large scale discovery and genotyping of single nucleotide polymorphisms in the mouse 2000 Nature Genetics 24 381 386 Appendix B Converting Nanograms to Picomoles Procedure To convert nanograms per microliter A gt g9 to picomoles per microliter Step Action 1 Measure the absorbance of your sample and multiply by a dilution factor a Using a spectrophotometer measure the DNA sample absorbance at 260 nm A249 It may be necessary to dilute the sample for an accurate measurement b Multiply the A249 by any dilution factor used For example if the A249 sample reading is 0 060 and the dilution factor is 10 then A260 0 060 x 10 0 600 Multiply the Asg value by 50 pg mL 50 ng L to obtain nanograms per microliter of double stranded DNA For example if the A243 0 600 then 0 600 x 50 ug mL 30 ng pL Note 1 0 OD 50 ug mL of double stranded DNA Determine the molecular weight of the PCR product by multiplying the number of base pairs by 650 daltons
3. end Dye Assignments The fluorescent dyes are assigned to the individual ddNTPs as follows ddNTP Dye Label Color of Analyzed Data A dR6G Green C dTAMRA Black G dR110 Blue T U dROX Red Platforms and Products generated using the ABI PRISM SNaPshot Multiplex Kit can be Software analyzed with GeneScan Analysis Software version 3 1 or higher The kits can be run on the following platforms ABI PRISM 310 Genetic Analyzer ABI PRISM 3100 Genetic Analyzer ABI PRISM 3700 DNA Analyzer About This This protocol describes how to Protocol Prepare sample reactions using your own template s and primer s or the control template and control primers Perform SNaPshot reactions by thermal cycling and conduct post extension treatment of the products Electrophorese the samples and analyze the data To view a flowchart of the procedure refer to Overview of the Procedure on page 9 Kit Contents and Storage SNaPshot The ABI PRISM SNaPshot Multiplex Kit is available in three reaction Multiplex Kit sizes Using this kit you can perform your own reactions and also perform 30 control reactions with the control template and primers provided One Kit Available in Three Formats Number of Kit Reactions Part Number ABI PRISM SNaPshot Multiplex Kit 100 4323151 1000 4323154 5000 4323155 control reactions The kit contains the following items
4. b Click MSDSs If you have Then The MSDS document Enter one of these number or the Document numbers in the on Demand index number appropriate field on this page The product part number Select Click Here then enter the part number or keyword s in the field on this page Keyword s c You can open and download a PDF using Adobe Acrobat Reader of the document by selecting it or you can choose to have the document sent to you by fax or email By automated telephone Use Documents on Demand under Technical Support service By telephone in the United Dial 1 800 327 3002 then press 1 States By Riephone tom Ganada Teorder ina Dial 1 800 668 6913 and English Press 1 then 2 then 1 again French Press 2 then 2 then 1 By telephone from any other See Regional Offices Sales and Service under Technical country Support Overview of the Procedure Amplify genomic DNA l Remove dNTPs and primers l al a PCR Purification Kit SAP and Exol Target nucleotide NNAGCATGCTCAATCGAATCCAGNNNNN Template Preparation GeneScan Analysis Post Extension Treatment Reaction Preparation Obtain purified template Prepare sample reaction Combine e Your template e Your primer SNaPshot Multiplex Ready Reaction Mix Perform thermal cycling Analyze data with GeneScan software NNTCGTACGAGTTAGCTTAGGTCNN
5. 650 638 5981 DNA Synthesis 1 800 831 6844 then press 21 1 650 638 5981 Fluorescent DNA Sequencing 1 800 831 6844 then press 22 1 650 638 5981 Fluorescent Fragment Analysis includes GeneScan applications 1 800 831 6844 then press 23 1 650 638 5981 Integrated Thermal Cyclers ABI PRISM 877 and Catalyst 800 instruments 1 800 831 6844 then press 24 1 650 638 5981 ABI PRISM 3100 Genetic Analyzer 1 800 831 6844 then press 26 1 650 638 5981 Biolnformatics includes BioLIMS BioMerge and SQL GT applications 1 800 831 6844 then press 25 1 505 982 7690 Peptide Synthesis 433 and 43X Systems 1 800 831 6844 then press 31 1 650 638 5981 Protein Seguencing Procise Protein Seguencing Systems 1 800 831 6844 then press 32 1 650 638 5981 PCR and Seguence Detection 1 800 762 4001 then press 1 for PCR 2 for the 7700 or 5700 6 for the 6700 or dial 1 800 831 6844 then press 5 1 240 453 4613 Product or Product Area Telephone Dial Fax Dial Voyager MALDI TOF Biospectrometry and Mariner ESI TOF Mass Spectrometry Workstations 1 800 899 5858 then press 13 1 508 383 7855 Biochromatography BioCAD Workstations and Poros Perfusion Chromatography Products 1 800 899 5858 then press 14 1 508 383 7855 Expedite Nucleic acid Synthesis Systems 1 800 8
6. SNaPshot control primer is 50 C the melting temperature for the complementary region between any primer and its corresponding template should be at least 50 C Poly dT poly dA poly dC and poly dGACT are 5 non homologous tails which are predicted to have minimal secondary structures They have all been used successfully Generally the signal patterns are not affected by the kinds of tails that are used The 5 poly dT tails however may interfere with the addition of 3 ddA The mobility of an oligonucleotide in capillary electrophoresis is determined by its size nucleotide composition and dye Thus the effect of nucleotide composition on mobility can be significant when the primer is short We strongly recommend that primers shorter than 36 nucleotides be tested before being multiplexed to ensure that the final products are spatially resolved when analyzed on the instrument Check primers for possible extendable hairpin structures within each primer and for extendable dimer formation between primers HPLC purification of primers is recommended for oligonucleotides longer than 30 nucleotides Heterogenous primer mixtures containing mixed molecular weight oligonucleotides may yield undesired products that will confuse analysis Since SNP interrogation using primer extension does not permit any flexibility with respect to the location of the 3 end of the primer use primers that are complementary to the negative
7. a Each kit contains Multiplex Control Template and Multiplex Control Primers for 30 Kit Components Contents SNaPshot Multiplex Ready Reaction Mix AmpliTag DNA Polymerase FS Fluorescently labeled ddNTPs Reaction buffer SNaPshot Multiplex Control Primer Mix 30 uL total 20A primer 0 05 pmol uL 28G A primer 0 10 pmol uL 36G primer 0 05 pmol L 44T primer 0 30 pmol uL 52C T primer 0 30 pmol uL 60C primer 0 30 pmol pL SNaPshot Multiplex Control Template 60 uL total Amplicon from CEPH DNA Protocol P N 4323357 Quick Reference Card P N 4323975 Storing the Upon receipt store the ABI PRISM SNaPshot Multiplex Kit at 15 to Reagents 25 C in a constant temperature freezer Required Software and Materials Overview GeneScan 120 LIZ Size Standard Recommended Data Collection Software and or GeneScan Run Module Required This section describes the software and materials necessary for using the ABI PRISM SNaPshot Multiplex Kit Primers used in a single reaction for multiloci interrogation need to differ significantly in length to avoid overlap between the final SNaPshot products To analyze the final products successfully and robustly a 5th dye labeled internal size standard specifically designed for small fragments should be used The GeneScan M 120 LIZ size standard has been designed specifically for use with the SNa
8. base pair For example if the oligo is 120 base pairs in length then 120 x 650 Da bp 78 000 Da Convert nanograms per microliter to picomoles per microliter by a dividing the molecular weight into 103 b multiplying by the concentration determined in step 2 For example 103 78 000 Da x 30 ng uL 0 38 pmol uL 31 Appendix C Troubleshooting Troubleshooting Here are some possible causes of Low Signal Low Signal Observation Possible Cause s Recommended Action Low signal Insufficient concentration of annealed primer possibly because of low annealing and extension efficiency Increase the primer concentration to 1 pmol per reaction Combined primer concentrations greater then 4 pmol are not recommended as they may cause ddNTP mis incorporation Suboptimized thermal cycling conditions Primers annealing to templates occur at a much slower rate than that of ddNTP incorporation by Taq DNA Polymerase at the suggested temperature If you consistently observe low signals try optimizing the annealing temperature and or the annealing time The annealing temperature may be the same as the extension temperature Insufficient amplification of template DNA Measure the absorbance of the DNA template at 260 nm to confirm the DNA concentration in the amplification products Satisfactory results have been obtained using 0 01 pmol of DNA template per reaction Note This is a
9. 1128 USA P N 4323357 Rev A
10. 200 22 Running Matrix Standards 00 0 ee eee 22 Preparing the Samples 00 0 0 eee ee eee eee ee 22 GeneScan Run Parameters 0000 ee eee 23 Electrophoresis on the ABI PRISM 3700 DNA Analyzer 24 Setting Up the Analyzer sireni enera a eee eee 24 Running Matrix Standards 0 0 0 eee ee eee 24 Preparing the Samples 0 0c cee eee ee eee 24 Setting Up GeneScan Parameters 00 0 0 00 000s eee 25 Data Analysis e ea i U oes Debus Malco tere a aa 27 OVETVICW o oa o ee Ak oe belek pe ee aT Sig tke ES aye viene ga ee 27 Analyzing Sample Files on the 310 Instrument 27 Analyzing Sample Files on the 3100 and 3700 Instruments 2 Example of Control Reaction 0000 eee eee eee 28 Allele Calling i i 32 3 ace Seite faked OAH age Ge yea we aS 28 Appendix A SNaPshot Primer Design and Evaluation Recommendations 29 Appendix B Converting Nanograms to Picomoles 31 Procedures sic itd see Sire nh airing gee Manet wee careers 31 Appendix C Troubleshooting 0 0 eee u 32 Troubleshooting Low Signal 00 0 0c eee ee eee eee 32 Troubleshooting Extraneous Peaks 02 0000008 33 Troubleshooting Sizing Problems 0005 36 Appendix D Technical Support 0 0 00 eee eee eee eee 37 Contacting Technical Support 00 0 0 cee eee eee 37
11. 99 5858 then press 15 1 508 383 7855 Peptide Synthesis Pioneer and 9050 Plus Peptide Synthesizers 1 800 899 5858 then press 15 1 508 383 7855 PNA Custom and Synthesis 1 800 899 5858 then press 15 1 508 383 7855 FMAT 8100 HTS System and CytoFluor 4000 Fluorescence Plate Reader 1 800 899 5858 then press 16 1 508 383 7855 Chemiluminescence Tropix 1 800 542 2369 U S only or 1 781 271 0045 1 781 275 8581 Applied Biosystems MDS Sciex 1 800 952 4716 1 650 638 6223 Outside North America Telephone Fax Region Dial Dial Africa and the Middle East Africa English Speaking and West Asia Fairlands South Africa 27 11 478 0411 27 11 478 0349 South Africa Johannesburg 27 11 478 0411 27 11 478 0349 Middle Eastern Countries and North Africa Monza Italia 39 0 39 8389 481 39 0 39 8389 493 39 Telephone Fax Region Dial Dial Eastern Asia China Oceania Australia Scoresby 61 3 9730 8600 61 3 9730 8799 Victoria China Beijing 86 10 64106608 86 10 64106617 Hong Kong 852 2756 6928 852 2756 6968 Korea Seoul 82 2 593 6470 6471 82 2 593 6472 Malaysia Petaling Jaya 60 3 758 8268 60 3 754 9043 Singapore 65 896 2168 65 896 2147 Taiwan Taipei Hsien 886 2 2358 2838 886 2 2358 2839 Thailand Bangkok 66 2 719 6405 66 2 319 9788 Europe Austria Wie
12. ABI PRISM SNaPsho Multiplex Kit Protocol For Research Use Only Not for use in diagnostic procedures BS 25 APP ais Copyright 2000 Applied Biosystems For Research Use Only Not for use in diagnostic procedures PE Corporation is committed to providing the world s leading technology and information for life scientists PE Corporation consists of the Applied Biosystems and Celera Genomics businesses These products may be covered under U S Patents 5 366 860 5 188 934 5 654 442 5 840 000 5 885 778 5 936 087 6 008 379 6 020 481 6 051 719 their foreign counterparts other patents and patents pending Notice to Purchaser Limited License The purchase of this product includes a limited nontransferable license under U S Patent 5 075 216 or its foreign counterparts owned by Roche Molecular Systems Inc and F Hoffmann La Roche Ltd Roche to use only this amount of the product for DNA sequencing and related processes described in said patent solely for the research and development activities of the purchaser No license under these patents to use the PCR process is conveyed expressly or by implication to the purchaser by the purchase of this product A license to use the PCR process for certain research and development activities accompanies the purchase of certain reagents from licensed suppliers such as PE when used in conjunction with an Authorized Thermal Cycler or is available from Applied Biosystems 850 Linc
13. Biosystems instruments and protocols are potentially hazardous and can cause injury illness or death Site Preparation and Safety Guide Read and understand the material safety data sheets MSDSs provided by the chemical manufacturer before you store handle or work with any chemicals or hazardous materials Minimize contact with and inhalation of chemicals Wear appropriate personal protective equipment when handling chemicals e g safety glasses gloves or protective clothing For additional safety guidelines consult the MSDS Do not leave chemical containers open Use only with adequate ventilation Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended on the MSDS Comply with all local state provincial or national laws and regulations related to chemical storage handling and disposal A site preparation and safety guide is a separate document sent to all customers who have purchased an Applied Biosystems instrument Refer to the guide written for your instrument for information on site preparation instrument safety chemical safety and waste profiles Ordering MSDSs You can order free additional copies of MSDSs for chemicals manufactured or distributed by Applied Biosystems using the contact information below To order MSDSs Then Over the Internet a Go to our Web site at www appliedbiosystems com techsupp
14. ICAL HAZARD POP 4 polymer may cause eye skin and respiratory tract irritation Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Use for research and development purposes only The GeneScan E5 Run Module encodes the following parameters on the 310 instrument Control Module Parameter GS POP 4 1mL E5 Injection time 5 seconds Electrophoresis voltage 15 kV Collection time 24 minutes EP voltage 15 kV Heat plate temperature 60 C Syringe pump time 150 seconds Preinjection EP 120 seconds Adjusting the Run Time Depending upon primer length the peaks of interest may appear well before the run ends For this reason you may want to shorten the collection time Adjusting the Injection Time for Signal Variability If increased or decreased signal is routinely observed you may want to decrease or increase injection times respectively For a description of Running Matrix Standards how to adjust the injection time on the 310 Genetic Analyzer refer to the ABI PRISM 310 Genetic Analyzer User s Manual P N 903565 If you are running the ABI PRISM SNaPshot Multiplex Kit reactions for the first time you will need a Matrix Standard Set DS 02 dR110 dRGG dTAMRA dROX LIZ for the 310 Genetic Analyzer system Run the ABI PRISM DS 02 Matrix Standards Kit P N 4323050 along with the other control and sample reactions Refer to the D
15. IP USB Corporation P N 70092X 5000 Units P N 70092Z 1000 Units P N 70092Y 500 Units New England BioLabs P N 290L 5000 Units P N 290S 1000 Units Safety Documentation User Attention Words Chemical Hazard Warning The following materials are required but not included continued Item Source Exo USB Corporation or Exonuclease I P N 70073Z PCR Clean Up Kit Roche Molecular Biochemicals k P N 1696513 100 reactions High Pure PCR Product Roche Molecular Biochemicals Purification Kit P N 1732668 50 reactions P N 1732676 250 reactions Five user attention words appear in the text of all Applied Biosystems user documentation Each word implies a particular level of observation or action as described below Note Calls attention to useful information IMPORTANT Indicates information that is necessary for proper instrument operation prvej NUR eN Indicates a potentially hazardous situation which if not avoided may result in minor or moderate injury It may also be used to alert against unsafe practices PMG Indicates a potentially hazardous situation which if not avoided could result in death or serious injury Peli Indicates an imminently hazardous situation which if not avoided will result in death or serious injury This signal word is to be limited to the most extreme situations NULULIL IE CHEMICAL HAZARD Some of the chemicals used with Applied
16. NNN fr Denature the template Anneal TCGTAC GAGTTAGCTTAGGT unlabeled NNAGCATGCTCAATCGAATCCAGNNNNN primer Extend primer Target nucleotide NNAGCATGCTCAATCGAATCCAGNNNNN NNTCGTACGAGTTAGCTTAGGTCNNNNN dTAMRA o c Tr with target TCGTACGAGTTAGCTTAGGTC S complementary NNAGCATGCTCAATCGAATCCAGNNNNN O ddNTP 4 dTAMRA Remove TCGTACGAGTTAGCTTAGGTC o Remove unincorporated unincorporated lt ddNTPs ddNTPs and h L denature NNAGCATGCTCAATCGAATCCAGNNNNN V SAP or CIP Electrophorese samples on 310 3100 or 3700 instrument ey i m v xv 310 or 3100 or 3700 Preparing Your PCR Template for Primer Extension Purpose This section describes how to prepare your PCR product template before primer extension About the There are two kinds of templates that you can use in primer extension Templates reactions Plasmid templates PCR products While plasmid templates do not require cleanup before primer extension PCR product templates must be purified Depending on the specific template 0 01 to 0 40 pmol of the template should be used in the SNaPshot reactions Methods for After PCR amplification the resulting template is in solution along with Preparing PCR primers dNTPs and enzyme and buffer components To avoid Templates Participation in the subsequent primer extension reaction primers and unincorpo
17. Pshot Muiltiplex Kit One of the following Data Collection Software and or GeneScan Run Modules is required 310 Genetic Analyzer 310 Data Collection version 2 1 GS STR POP4 1 mL E5 3100 Genetic Analyzer 3100 Data Collection version 1 0 SNP36_POP4 default module 3700 DNA Analyzer 3700 Data Collection version 1 1 enabled with 3700 Data Collection 5 Dye Update File P N 4324208 SNP1_1POP5 Materials The following materials are required but not included Required but Not Included Item Source One of the following instruments with 5 dye capability ABI PRISM 310 Genetic Analyzer ABI PRISM 3100 Genetic Analyzer with POP 4 polymer and 36 cm array ABI PRISM 3700 DNA Analyzers with POP 5 polymer and 50 cm array GeneAmp PCR System 9600 thermal cycler with appropriate tubes or plate and caps GeneScan software v 3 1 or higher Applied Biosystems Matrix Standard Set DS 02 dR110 dRGG dTAMRA dROX LIZ 310 3100 3700 GeneScan M 120 LIZ size standard Applied Biosystems 4323050 4323014 4323785 4324211 Hi Di formamide 25 mL bottle Applied Biosystems P N 4311320 1X TE pH 7 0 Major laboratory supplier MLS Centrifuge with 96 well plate adapter MLS Deionized water MLS Disposable gloves MLS Pipette tips aerosol resistant MLS Shrimp Alkaline Phosphatase SAP or Calf Intestinal Phosphatase C
18. R primers Incomplete removal of F JddNTPs by SAP digestion results in comigration of F JddNTPs with the fragments of interest The undigested F ddNTPs normally appear as peaks larger than 70 bp Excess F JddNTPs also result in peaks of smaller sizes In this case use fresh CIP or SAP 33 Causes of extraneous peaks continued Observation Possible Cause Recommended Action Extraneous PCR amplified templates To determine if the peaks are from templates peaks N Th run a SNaPshot reaction using the templates ote ese products are without SNaPshot primers Any peaks that usually longer than 60 base appear will be from the PCR amplification of pairs the templates To decrease the amount of these extraneous peaks try decreasing the amount of Exo used If you are using column purification try a more stringent elution condition to minimize short fragment recovery Alternatively you can decrease the concentration of templates in the SNaPshot reaction See Figure 3 Be m m 1 m m a z No dilution LEO SH 1 2 i 1 4 zi 17 sind 1 8 i _ fae Cowes z5 pmo ass t t SNP Background Peaks ZR Hu No dilution CES E z 1 2 4 P 5 si 1 8 more diluted Figure 3 Electropherogram of SNaPshot products Two microliters of PCR amplified templates undiluted 1 2 diluted 1 4 diluted 1 8 diluted was used in the SN
19. S 02 Matrix Standards Kit product insert for directions on how to prepare the DS 02 matrix standards 19 Preparing Samples Follow the instructions below if you are using an ABI PRISM 310 Genetic Analyzer to run your samples 20 To prepare samples for the 310 Genetic Analyzer Step Action 1 Thaw Hi Di formamide SNaPshot products and the GeneScan 120 LIZ size standard Vortex to mix and spin briefly CHEMICAL HAZARD Formamide is harmful if absorbed through the skin and may cause irritation to the eyes skin and respiratory tract It may cause damage to the central nervous system and the male and female reproductive systems and is a possible birth defect hazard Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Add 9 uL of Hi Di formamide into each tube Add 0 5 uL of the SNaPshot product and 0 5 UL GeneScan 120 LIZ size standard into each tube Note Total volume for injection is 10 UL Note Dilute the control reaction 1 2 Mix 0 5 uL of the diluted products with 0 5 UL of GeneScan 120 LIZ size standard Note If you want to use volumes greater than 0 5 uL the following mixing steps are suggested a Dilute 2 UL of SNaPshot product in 6 uL of Hi Di formamide b Dilute 2 UL of GeneScan 120 LIZ in 6 UL of Hi Di formamide enough for 4 samples c Mix 2 uL of diluted SNaPshot product 2 uL of diluted GeneScan 120 LIZ size stand
20. To Contact Technical Support by E Mail 0 37 Hours for Telephone Technical Support 00 37 To Contact Technical Support by Telephone or Fax 38 In North Ameria sine csi TA hate sees ne aT 38 To Reach Technical Support Through the Internet 41 To Obtain Documents on Demand 00 42 iii Product and Protocol Overview About the Kit Product Overview Kit Chemistry Based on Single Base Extension The ABI PRISM SNaPshot Multiplex Kit is designed to interrogate up to ten single nucleotide polymorphisms SNPs at known locations on one to ten DNA templates in a single tube Control Template DNA and Primer Mix included in the SNaPshot Multiplex Kit provides reagents for control reactions Single nucleotide polymorphisms detection using the ABI PRISM SNaPshot Multiplex Kit requires the following components SNaPshot Multiplex Ready Reaction Mix Your template and primers The ABI PRISM SNaPshot Multiplex Control Template DNA and Primer Mix provides Control Primers and Control Template to perform control reactions only The chemistry is based on the dideoxy single base extension of an unlabeled oligonucleotide primer or primers Each primer binds to a complementary template in the presence of fluorescently labeled ddNTPs and AmpliTaq DNA Polymerase FS The polymerase extends the primer by one nucleotide adding a single ddNTP to its 3
21. aPshot reaction with a SNaPshot primer top panel or without a SNaPshot primer bottom panel Background peaks green peaks are the same in samples with or without SNaPshot primers and decrease as the templates become 34 Causes of extraneous peaks continued Observation Possible Cause Recommended Action Extraneous peaks that resemble a conventional Sanger sequencing reaction The peak of interest has significantly reduced amplitude Incomplete removal of dNTPs from PCR reactions This enables dNTPs to participate in the ddNTP extension reaction Refer to Figure 4 Use fresh SAP Use an alternate means of PCR reaction purification such as those listed on page 9 under PCR Purification Kits GeneScan Project 7 8 99 Display 1 N Figure 4 Electropherogram resulting from the presence of residual dNTPs Extraneous peaks Primer hairpin extension Primer dimer extension Carefully analyze the primer sequence Avoid using primers that are capable of annealing to themselves and leaving a recessed 3 end Use primer analysis software to help identify problems associated with primer design Try designing primers using the complementary DNA strand 35 Troubleshooting Use the following table to troubleshoot sizing problems Sizing Problems Observation Possible Cause Recommen
22. amples on ice or at 4 C until you are ready to load the analyzer GeneScan Run To start the run Parameters Step Action 1 In the New Plate setup select Dye Set E5 and SNP36_POP4 default module 2 Start the run Note To set up the GeneScan 120 LIZ size standard automatic analysis refer to the instructions in the GeneScan 120 LIZ size standard product insert 23 Electrophoresis on the ABI PRISM 3700 DNA Analyzer Setting Up the Analyzer Running Matrix Standards Preparing the Samples 24 Before any run make sure that the 3700 DNA Analyzer is set up with a 50 cm capillary array and POP 5 polymer If you are running the ABI PRISM SNaPshot Multiplex Kit reactions for the first time you will need a Matrix Standard Set DS 02 for the 3700 DNA Analyzer P N 4323785 Refer to the DS 02 Matrix Standards Kit product insert for directions on how to prepare the DS 02 matrix standards To prepare samples for the 3700 DNA Analyzer Step Action 1 Thaw Hi Di formamide SNaPshot products and the GeneScan 120 LIZ size standard Vortex to mix and spin briefly CHEMICAL HAZARD Formamide is harmful if absorbed through the skin and may cause irritation to the eyes skin and respiratory tract It may cause damage to the central nervous system and the male and female reproductive systems and is a possible birth defect hazard Please read the MSDS and follow the handling instr
23. ard 6 uL of Hi Di formamide Vortex briefly and quick spin Denature the samples by placing them at 95 C for 5 minutes Place the samples on ice or at 4 C until you are ready to load them on the 310 Genetic Analyzer Quick spin or tap the tubes or plates to bring liquid to the bottom of the tubes To prepare samples for the 310 Genetic Analyzer continued Step Action 8 Refer to the ABI PRISM 310 User s Manual for specific directions on the following a Verify that you have chosen GeneScan Run Module E5 b Confirm the injection time c Verify that you have selected the DS 02 GeneScan Matrix Set for the 310 Genetic Analyzer system d Verify that you have selected the GeneScan 120 LIZ size standard analysis parameter for automatic data analysis Note To set up the GeneScan 120 LIZ size standard automatic analysis refer to the instructions in the GeneScan 120 LIZ size standard product insert 21 Electrophoresis on the ABI PRISM 3100 Genetic Analyzer Setting Up the Before any run make sure that the 3100 Genetic Analyzer is set up with Analyzer a 36 cm capillary array and POP 4 polymer Running Matrix If you are running the ABI PRISM SNaPshot Multiplex Kit reactions for Standards the first time you will need a Matrix Standard Set DS 02 dR110 dRGG dTAMRA dROX LIZ for the 3100 Genetic Analyzer P N 4323014 Refer to the DS 02 Matrix Standards Kit product insert fo
24. atment irens r ena a R l 11 Preparing the Control Reactions 0 0 0 e eee eee ee ees 12 About the Control Reactions 000 ee eee ee eee 12 Negative Control Reaction 0 0 0 eee eee ee eee 12 Preparing the Control Reactions 0 00 0 0 ee eee 13 Preparing Your Sample Reactions 0 0c eee eee eee ees 14 CQVET VIC Ws eset a uae Hed wie agp Rea pte aceon eMac ap UR 14 SNaPshot Primer Design 0 0 00 eee eee eee eee 14 Pooling PCR Amplified SNaPshot Templates 14 Pooling SNaPshot Primers 0 00 0 e cece eee eee 14 Setting Up Your Sample Reaction 00 00 0000 15 Thermal Cycling and Post Extension Treatment 16 COVERVICW sess atte ca le trea to Saas o lott toile ahs 16 Thermal Cycling oered irera a r ecg aes 16 Post Extension Treatment 0 0 00 cece eee ee eee 16 Electrophoresis on the ABI PRISM 310 Genetic Analyzer 18 OVEIVIEW spina gine Rea guests ale o ov 18 TLE Polymer sais tows O Ta 18 GeneScan E5 Run Module Parameters 000 18 Adjusting the Run Time 2 20 18 Adjusting the Injection Time for Signal Variability 18 Running Matrix Standards 0 0 0 eee eee eee 19 Preparing Samples 46 54 sa tates ah obs cee Mea S Se Heed es 20 Electrophoresis on the ABI PRISM 3100 Genetic Analyzer 22 Setting Up the Analyzer
25. col Overview 2 0 0c cece cee eee eee 1 About the Kath ss 23 304 085 pale a Ge 1 Product Overview s resas Misna aias u 1 Kit Chemistry Based on Single Base Extension 1 Dy ASSIENMEN S 2 tocna eee Vel Aes Ss a ea 2 Platforms and Software 0 2c ee eee eee 2 About This Protocol s sta ila Sue de ni eek et 2 Kit Contents and Storage 0 0 0000 3 SNaPshot Multiplex Kit 00 ee eee 3 One Kit Available in Three Formats 3 Storing the Reagents 2 0 0 eee eee ee eee 3 Required Software and Materials 00 eee eee ee eee 4 DVERVIC Wire Sides Sioa o U RA 4 GeneScan 120 LIZ Size Standard Recommended 4 Data Collection Software and or GeneScan Run Module Required 4 Materials Required but Not Included 5 PATTY i A there ai Tae Say Sey feed Wed oa eA ea 6 Documentation User Attention Words 000005 6 Chemical Hazard Warning 0 cece cece ee ene eens 6 Site Preparation and Safety Guide 0008 7 Ordering MSDSS ic acaceek te stein ce N a 8 Overview of the Procedure 00 0 eee eee cee eee ee 9 Preparing Your PCR Template for Primer Extension 10 PUTP S sir aie nO Ree A K a nn 10 About the Templates 0 10 Methods for Preparing PCR Templates 10 PCR Purification Kits 0 0 eee nes 10 SAP and Exo I Tre
26. concentration in undiluted SAP and Exo vortex briefly to mix Incubate at 75 C for 15 minutes to inactivate the enzymes Keep on ice or at 4 C For longer storage store at 20 C 11 Preparing the Control Reactions About the Control Included in each kit are a Multiplex Control Primer Mix tube containing Reactions Six distinct primers and a Multiplex Control Template tube containing an amplicon from CEPH DNA The control primers are listed in the table below Length of Multiplex Control Final Products Primer Mix nt Signal Color Heterozygosity 20A primer 21 Green Homozygote 28G A primer 29 Blue green Heterozygote 36G primer 37 Blue Homozygote 44T primer 45 Red Homozygote 52C T primer 53 Black red Heterozygote 60C primer 61 Black Homozygote Note Due to the influence of the dye on the mobility shift of the DNA 32C T fragments the reported sizes will differ by a few bases from the actual sizes the dye is greater 36G 44T 60C Relative size of SNaPshot 24 29 39 46 53 62 This is particularly true with the shorter fragments as the relative contribution of Primer 20A 28G A product 1 As determined by sizing against GeneScan 120 Liz size standard Negative Control Run one negative control reaction without control template DNA Reaction 12 Preparing the To prepare the control reactions Control Reactions
27. ded Action The fragment sizes observed are different from the expected sizes Incorporation of dye greatly effects the mobility of the extension products Often shorter fragments will appear to be nearly five bases longer than their actual size No action required The sizes of identical fragments vary between runs or capillaries Size standard improperly called due to low intensity peaks being called instead of the real peaks Reanalyze the samples after increasing the minimum peak height value Make sure that you change the analysis parameter settings used for your analysis refer to the GeneScan User s Manual for more information Off scale peaks in the region of a size standard peak is causing that size standard peak to fail to be recognized Older versions of GeneScan earlier than GS 3 52 have a size matching algorithm that can cause this problem Get the new patch from the Applied Biosystems web site 36 Appendix D Technical Support Contacting Technical Support You can contact Applied Biosystems for technical support by telephone or fax by e mail or through the Internet You can order Applied Biosystems user documents MSDSs certificates of analysis and other related documents 24 hours a day In addition you can download documents in PDF format from the Applied Biosystems Web site please see the section To Obtain Documents on Demand following the telephone informa
28. e of 0 01 to 0 40 pmol of PCR products depending on template in a 10 uL reaction Note For a description of how to convert nanograms per microliter to picomoles per microliter refer to Appendix B on page 31 All the primers to be used in a single SNaPshot reaction should be premixed to give a final concentration of 0 2 uM for each primer Place the primer mixture on ice Note SNaPshot Multiplex Ready Mix has been designed to exhaust all primers in the reaction The recommended starting concentration for each primer is 0 2 uM If a particular primer has a consistently low or high signal increase or decrease the concentration of that primer Successful results have been obtained using primers with concentrations that range between 0 05 uM and 1 uM in a six primer mixture Adjusting the template concentration is usually not required Setting Up Your To set up your sample reaction Sample Reaction Step Action 1 Thaw the SNaPshot Multiplex Ready Reaction Mix on ice Note Adjust the volume of deionized water to accommodate any changes in primer or template volumes Note Make a master mix if you are running several samples containing common components Combine the following Volume Item HL Sample SNaPshot Multiplex Ready Reaction Mix 5 Pooled PCR products 3 Pooled SNaPshot primers 1 Deionized water 1 Total 10 2 Mix thoroughly and spin briefly Aliquot 10 uL into each MicroAmp tube well No
29. ice of this product includes a limited non transferable license under U S Patent Nos 5 888 819 6 004 744 and their foreign counterparts owned by Orchid BioSciences Inc of Princeton New Jersey to perform 1000 10 000 or 50 000 Genotypes For purposes of this End User License Genotype means the detection or quantification of an individual SNP within a single sample solely for the detection and analysis of SNPs in samples for research purposes only and only on automated electrophoresis nucleotide sequencers This license specifically excludes performing services for a third party and any and all medical diagnostic or therapeutic uses Information about purchasing licenses to practice primer extension technology covered by Orchid BioSciences Inc patents for any other use may be obtained by contacting the Senior Director for Business Development at Orchid BioSciences Inc Princeton New Jersey U S A at 650 750 2200 ABI PRISM and its design Applied Biosystems GeneScan Genotyper MicroAmp BioLIMS and BioMerge are registered trademarks and AB Design ABI LIZ POP 4 POP 5 POP 6 ROX TAMRA and SNaPshot are trademarks of PE Corporation or its subsidiaries in the U S and certain other countries AmpliTaq GeneAmp and TaqMan are registered trademarks of Roche Molecular Systems Inc GBA is a registered trademark of Molecular Tools Inc All other trademarks are the sole property of their respective owners Contents Product and Proto
30. less likely cause of low signal than insufficient concentration of primers Inappropriate injection time Increase the injection time 32 Troubleshooting Use the following table to troubleshoot extraneous peaks Extraneous Peaks Causes of Extraneous Peaks Observation Possible Cause s Recommended Action Extraneous peaks Incomplete removal of PCR primers Note PCR primers that have not been removed can participate in the SNaPshot primer extension reaction and resemble signal derived from the Since the primer size and sequence is known look at the data to determine if the peak observed is the expected size primer 1 nt and color of the expected peak SNaPshot interrogation primer Use fresh SAP and Exo or employ an alternative method of primer removal Note There have been some reports of PCR primers that are refractive to digestion by Exo See Figure 1 H 1000 s o 20 200 3000 x L ba 0 01 unit of Exol m a O S VON SKY he 9B 0605 ameka tsa 7 0 00 9 Ji 26 08 0 Hysong rsa 00 0 O M 2Y 06 03 sarge 452 06 00 9 2 0 Ophargtes rsa 80 0 SA 0 025 unit of Exo w i Ee e CON Al NET FEAE E 1 mit of Exol w AH 6300 380830 is 2 units of Exol 3 b TI H NASA a lz PCR Tenplaterelated Prime background peak SNP Figure 2 Electropherogram of SNaPshot products Increasing the amount of Exo resulted in less peaks from PC
31. n 43 0 1 867 35 750 43 0 1 867 35 75 11 Belgium 32 0 2 712 5555 32 0 2 712 5516 Czech Republic and Slovakia Praha 420 2 61 222 164 420 2 61 222 168 Denmark Naerum 45 45 58 60 00 45 45 58 60 01 Finland Espoo 358 0 9 251 24 250 358 0 9 251 24 243 France Paris 33 0 1 69 59 85 85 33 0 1 69 59 85 00 Germany Weiterstadt 49 0 6150 101 0 49 0 6150 101 101 Hungary Budapest 36 0 1 270 8398 36 0 1 270 8288 Italy Milano 39 0 39 83891 39 0 39 838 9492 Norway Oslo 47 23 12 06 05 47 23 12 05 75 Poland Lithuania Latvia 48 22 866 40 10 48 22 866 40 20 and Estonia Warszawa Portugal Lisboa 351 0 22 605 33 14 351 0 22 605 33 15 Russia Moskva 7 095 935 8888 7 095 564 8787 South East Europe Zagreb Croatia 385 1 34 91 927 385 1 34 91 840 Spain Tres Cantos 34 0 91 806 1210 34 0 91 806 1206 Sweden Stockholm 46 0 8 619 4400 46 0 8 619 4401 Switzerland Rotkreuz 41 0 41 799 7777 41 0 41 790 0676 The Netherlands Nieuwerkerk a d IJssel 31 0 180 331400 31 0 180 331409 To Reach Technical Support Through the Internet Telephone Fax Region Dial Dial United Kingdom 44 0 1925 825650 44 0 1925 282502 Warrington Cheshire All other countries not listed 44 0 1925 282481 44 0 1925 282509 Warrington UK Japan Japa
32. n Hacchobori 81 3 5566 6006 81 3 5566 6505 Chuo Ku Tokyo Latin America Del A Obregon Mexico 305 670 4350 305 670 4349 We strongly encourage you to visit our Web site for answers to frequently asked questions and for more information about our products You can also order technical documents or an index of available documents and have them faxed or e mailed to you through our site The Applied Biosystems Web site address is http www appliedbiosystems com techsupp To submit technical questions from North America or Europe Step Action 1 Access the Applied Biosystems Technical Support Web site 2 Under the Troubleshooting heading click Support Request Forms then select the relevant support region for the product area of interest 3 Enter the requested information and your question in the displayed form then click Ask Us RIGHT NOW blue button with yellow text 4 Enter the required information in the next form if you have not already done so then click Ask Us RIGHT NOW You will receive an e mail reply to your question from one of our technical experts within 24 to 48 hours 41 42 To Obtain Free 24 hour access to Applied Biosystems technical documents Documents on including MSDSs is available by fax or e mail or by download from our Demand Web site To order documents Then by index number a Access the Applied Biosystems Technical S
33. need to extend the data delay time from 900 seconds to 1200 seconds and the data collection time from 900 seconds to 1800 seconds refer to step 3 for information on modifying the module Note To set up the GeneScan 120 LIZ size standard automatic analysis refer to the instructions in the GeneScan 120 LIZ size standard product insert Start the run 25 26 Setting up the GeneScan application continued Step Action 3 Use the table below to adjust the signal intensity using the Module Editor Possible Observation Cause Recommended Action Signal varies The run Adjust the run conditions in across the temperature the following order capillary and the run a Lower the temperature to array voltage need 50 C adjusting b Lower the run voltage to 6 KV c Increase the data delay and run times to accommodate the slower run times caused by a and b above The cuvette Test in increments of 5 C temperature through the range 35 50 C is not until you identify the optimized temperature that produces the best signal uniformity across the array Data Analysis Overview Analyzing Sample Files on the 310 Instrument Analyzing Sample Files on the 3100 and 3700 Instruments This section describes how to perform GeneScan data analysis Analyze the files using GeneScan Analysis Software version 3 1 and GeneScan 120 LIZ size standard analysi
34. oln Centre Drive Foster City California 94404 or at Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda California 94501 Notice to Purchaser Limited License This kit reagent is sold pursuant to a limited sublicense from Amersham International plc under one or more U S Patent Nos 5 498 523 4 994 372 U S Patent Application Serial Nos 08 324437 08 337615 and corresponding foreign patents and patent applications The purchase of this kit reagent includes a limited nonexclusive sublicense without the right to resell repackage or further sublicense under such patent rights to use this reagent for DNA sequencing or fragment length analysis solely with an Applied Biosystems commercial automated sequencing machine or other authorized DNA sequencing machines that have been authorized for such use by Applied Biosystems or for manual sequencing No license is hereby granted for the use of this kit or the reagents therein in any other automated sequencing machine Such sublicense is granted solely for research and other uses that are not unlawful No other license is granted expressly implied or by estoppel For information concerning the availability of additional license to practice the patented methodologies contact Amersham Life Science Inc Vice President Regulatory Affairs P O Box 22440 Cleveland Ohio 44122 Patents are pending in countries outside the United States Notice to Purchaser End User License The purchase pr
35. our Note Because of the high glycerol concentration in the undiluted SAP vortex briefly to mix 1 0 Unit of Shrimp Alkaline Phosphatase SAP or 1 0 Unit of Calf Intestinal Phosphatase CIP To conduct post extension treatment continued Step Action 2 Deactivate the enzyme by incubating at 75 C for 15 minutes 3 Samples may be placed at 4 C for up to 24 hours prior to electrophoresis on the 310 3100 3700 systems For storage longer than 24 hours store the samples at 20 C 4 If you are running an Then proceed to ABI PRISM 310 Genetic Analyzer Electrophoresis on the ABI PRISM 310 Genetic Analyzer on page 18 ABI PRISM 3100 Genetic Analyzer Electrophoresis on the ABI PRISM 3100 Genetic Analyzer on page 22 ABI PRISM 3700 DNA Analyzer Electrophoresis on the ABI PRISM 3700 DNA Analyzer on page 24 17 Electrophoresis on the ABI PRISM 310 Genetic Analyzer Overview The Polymer GeneScan E5 Run Module Parameters 18 This section describes electrophoresis of SNaPshot products on the ABI PRISM 310 Genetic Analyzer using the 310 Data Collection version 2 1 Note For more information about using the ABI PRISM 310 Genetic Analyzer refer to the ABI PRISM 310 Genetic Analyzer Users Manual P N 903565 The SNaPshot kits may be used with POP 4 polymer in conjunction with GS POP 4 1mL E5 module CHEM
36. r directions on how to prepare the DS 02 matrix standards Preparing the To prepare samples for the 3100 Genetic Analyzer Samples Step Action 1 Thaw Hi Di formamide SNaPshot products and the GeneScan 120 LIZ size standard Vortex to mix and spin briefly CHEMICAL HAZARD Formamide is harmful if absorbed through the skin and may cause irritation to the eyes skin and respiratory tract It may cause damage to the central nervous system and the male and female reproductive systems and is a possible birth defect hazard Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves 2 Add 9 uL of Hi Di formamide to each well 3 Add 0 5 uL of the SNaPshot products and 0 5 uL of GeneScan 120 LIZ size standard into each well and seal the plates Note Total volume for injection is 10 uL Note If you want to use volumes greater than 0 5 uL the following mixing steps are suggested a Dilute 2 UL of SNaPshot product in 6 uL of Hi Di formamide b Dilute 2 UL of GS120 in 6 uL of Hi Di formamide enough for four samples c Mix 2 uL of diluted SNaPshot product 2 uL of diluted GeneScan 120 LIZ size standard 6 uL of Hi Di formamide 22 To prepare samples for the 3100 Genetic Analyzer continued Step Action 4 Vortex briefly and spin briefly 5 Denature the samples by placing them at 95 C for 5 minutes 6 Place the s
37. rated dNTPs must be removed We recommend the following methods for purifying PCR products Topic See Page PCR Purification Kits 10 SAP and Exo Treatment 11 PCR Purification High Pure PCR Product Purification P N 1732668 50 reactions Kits 1732676 250 reactions or PCR Clean Up Kits P N 1696513 100 reactions can be purchased from Roche Molecular Biochemicals Refer to the manufacturer s instructions for the procedure 10 SAP and Exo I To treat PCR products using SAP and Exo Treatment Step Action 1 Add the following to 15 UL of PCR product 5units of SAP 2unit of Exo Use the following guidelines for enzyme treatment Reaction volume can be adjusted up or down PCR products can be from a single PCR reaction or multiple PCR reactions We recommend that you purify individual PCR products and combine the purified products in the next step To ensure a low background we strongly recommend that the relative ratio of PCR product SAP and Exo be kept constant i e 5 units of SAP and 2 units of Exo for every 15 UL of PCR product Because of the high glycerol concentration in undiluted SAP and Exo add each enzyme into the PCR mixture one at a time Exo can be freshly diluted in a buffer containing 80 mM Tris HCl pH 9 05 and 2 mM MgCl Do not store diluted Exo Mix thoroughly and incubate at 37 C for 1 hour Note Because of the high glycerol
38. s parameter files For a detailed explanation refer to the ABI PRISM GeneScan Analysis Software User s Manual P N 4303242 and the GeneScan 120 LIZ size standard product insert Analyze the files using GeneScan Analysis Software version 3 5 and GeneScan 120 LIZ size standard analysis parameter files For a detailed explanation refer to the ABI PRISM GeneScan Analysis Software User s Manual P N 4303242 and the GeneScan 120 LIZ size standard product insert 27 Example of Control Reaction Allele Calling GeneScan TM 120 Lu TM size standard 110 1 Figure 1 Electropherogram of the Multiplex Control Reaction products along with GeneScan 120 LIZ size standard Genotyper 3 7 can be used to analyze this data Please refer to the Genotyper User s Manual for more information Applied Biosystems is constantly developing new software solutions particularly for SNP analysis Please check our web site Appendix A SNaPshot Primer Design and Evaluation Recommendations Follow these recommendations for designing and evaluating primers Primers included in a single reaction need to differ significantly in lengths in order to avoid overlap between the final SNaPshot products A difference of 4 6 nucleotides between primer lengths is recommended as a starting point The length of a primer can be modified by the addition of nonhomologous polynucleotides at the 5 end Since the recommended annealing temperature for a
39. te Itis important to keep the reaction mixture on ice before putting it into the thermal cycler Leaving the mixture at ambient temperature for 20 minutes or longer may lead to higher background 3 Proceed to Thermal Cycling and Post Extension Treatment on page 16 15 Thermal Cycling and Post Extension Treatment 16 Overview This section describes how to conduct thermal cycling and how to remove unincorporated ddNTPs after thermal cycling Thermal Cycling To conduct thermal cycling Step Action 1 Place the tubes in a GeneAmp 9600 thermal cycler and set the volume to 10 pL Repeat the following for 25 cycles Rapid thermal ramp to 96 C 96 C for 10 seconds Rapid thermal ramp to 50 C 50 C for 5 seconds Rapid thermal ramp to 60 C 60 C for 30 seconds A gt Note Thermal cycling takes approximately 1 hour and 10 minutes to complete Rapid thermal ramp to 4 C and hold until ready for post extension treatment Post Extension IMPORTANT Left untreated the unincorporated F JddNTPs will co migrate Treatment With the fragment s of interest Removal of the 5 phosphoryl groups by phosphatase treatment alters the migration of the unincorporated F JddNTPs and thus prohibits interference To conduct post extension treatment Step Action 1 Add one of the following to the reaction mixture mix thoroughly and incubate at 37 C for 1 h
40. tion below To Contact Contact technical support by e mail for help in the following product Technical Support by E Mail Hours for Telephone Technical Support areas Product Area E mail address Genetic Analysis DNA Sequencing galab appliedbiosystems com Sequence Detection Systems and pcrlab appliedbiosystems com PCR Protein Sequencing corelab appliedbiosystems com Peptide and DNA Synthesis Biochromatography PerSeptive tsupport appliedbiosystems com DNA PNA and Peptide Synthesis systems CytoFluor FMAT Voyager and Mariner Mass Spectrometers Applied Biosystems MDS Sciex api3 support sciex com Chemiluminescence Tropix tropix appliedbiosystems com In the United States and Canada technical support is available at the following times Product Hours Chemiluminescence 8 30 a m to 5 30 p m Eastern Time Framingham support 8 00 a m to 6 00 p m Eastern Time All Other Products 5 30 a m to 5 00 p m Pacific Time 37 To Contact Technical Support by Telephone or Fax 38 In North America To contact Applied Biosystems Technical Support use the telephone or fax numbers given below To open a service call for other support needs or in case of an emergency dial 1 800 831 6844 and press 1 Product or Product Area Telephone Dial Fax Dial ABI PRISM 3700 DNA Analyzer 1 800 831 6844 then press 8 1
41. uctions Wear appropriate protective eyewear clothing and gloves Add 9 uL of Hi Di formamide to each well Add 0 5 uL of SNaPshot products and 0 5 uL of GeneScan 120 LIZ size standard to each well and seal the plates Note Total volume for injection is 10 uL Note If you want to use volumes greater than 0 5 uL the following mixing steps are suggested a Dilute 2 UL of SNaPshot product in 6 uL of Hi Di formamide b Dilute 2 UL of GeneScan 120 LIZ in 6 UL of Hi Di formamide enough for four samples c Mix 2 uL of diluted SNaPshot product 2 uL of diluted GeneScan 120 LIZ size standard 6 uL of Hi Di formamide Vortex briefly and spin briefly To prepare samples for the 3700 DNA Analyzer continued Step Action 5 Denature the samples by placing them at 95 C for 5 minutes Place the samples on ice or at 4 C until you are ready to load the analyzer Setting Up Setting up the GeneScan application GeneScan Parameters Step Action 1 In the New Plate setup select Dye Set E5 and SNP1_1POP5 module Note Data collection time in the default SNP1_1POP5 module is 900 seconds To ensure that all 9 peaks in GeneScan 120 LIZ size standard are collected extend the data collection time to 1100 seconds Note Ifthe signal variation from the left to the right side of the array becomes a concern try lowering the running voltage to 6 KV You will also
42. upport Web site at http www appliedbiosystems com techsupp b Click the Index link for the document type you want then find the document you want and record the index number c Use the index number when reguesting documents following the procedures below by phone for fax delivery a From the U S or Canada call 1 800 487 6809 or from outside the U S and Canada call 1 858 712 0317 b Follow the voice instructions to order the documents you want Note There is a limit of five documents per request through the Internet for fax or e mail delivery a Access the Applied Biosystems Technical Support Web site at http www appliedbiosystems com techsupp b Under Resource Libraries click the type of document YOU Want c Enter or select the reguested information in the displayed form then click Search d In the displayed search results select a check box for the method of delivery for each document that matches your criteria then click Deliver Selected Documents Now or click the PDF icon for the document to download it immediately e Fill in the information form if you have not previously done so then click Deliver Selected Documents Now to submit your order Note There is a limit of five documents per request for fax deliver but no limit on the number of documents you can order for e mail delivery Applied KS Biosystems 850 Lincoln Centre Drive Foster City California 94404
Download Pdf Manuals
Related Search