Home

BD RevTet System

Contents

1. Morgenstern J P amp Land H 1990 Advanced mammalian gene transfer high titre retroviral vectors with multiple drug selection markers and a complementary helper free packaging cell line Nucleic Acids Res 18 3587 3590 Sambrook J Fritsch E F amp Maniatis T 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Cold Spring Harbor NY Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 29 BD RevTet System User Manual XIII Related Products For a complete listing of all BD Biosciences Clontech products please visit www bdbiosciences com clontech Cat New Cat Premade Tet Off and Tet On Cell Lines many AmphoPack 293 Cell Line C3201 1 631505 Pantropic Retroviral Expression System K1063 1 631512 pRevTet Off IN Vector 6134 1 631001 pRevTet Off Vector 6140 1 631003 pRevTet On Vector 6159 1 631007 pRevTRE Vector 6137 1 631002 BD Tet Off Gene Expression System K1620 1 630921 BD Tet On Gene Expression System K1621 1 630922 pBI Bidirectional Tet Vector 6152 1 631006 pBI G Bidirectional Tet Vector 6150 1 631004 e pBI L Bidirectional Tet Vector 6151 1 631005 pBI EGFP Tet Vector 6154 1 632345 pTet Off Vector K1620 A 631017 pTet On Vector K1621 A 631018 pTK Hyg Selection Vector 6152 1 631006 pTRE2 Vector 6241 1 631008 pTRE Sequencing PCR Primers 9131 1 631104 BD Retro X System K1060 1 631508 BD
2. C3201 1 Generate amphotropic virus to infect a broad range of mammalian cells GP2 293 Cell Line Available as part of our Pantropic Retroviral Expression System K1063 1 GP2 293 cells produce virus that can infect the broadest possible range of mammalian and nonmammalian cells Constructing a stable expression cell line using PT67 packaging cells To create a stable cell line that expresses your gene of interest upon induction you perform a series of transfections and infections as diagrammed in Figure 3 The first step is to make two different retroviruses one to deliver the pRevTet Off or pRevTet On regulator construct to the target cells and one to deliver the pRevTRE response construct containing your gene of interest Gene X To produce the former virus pRevTet Off On Vector is transfected into the packag ing cell line In parallel you can package pRevTRE Gene X by performing a second transfection Although you can use virus that is transiently produced by these cell lines for subsequent steps we recommend that you use antibiotic selection to create stable virus producing cell populations Viral titers of stable clones are not dependent on the efficiency of transfection and can be frozen and used for subsequent experiments When packaging is complete supernatant containing pRevTet Off On virus is used to infect the target cells Neomycin selection of this culture yields a population of cells that have integrated r tTA I
3. for propagation Then proceed to determine viral titer as described below in Section IX C Typically clones can be isolated that produce titers of 109 106 virus particles per ml If selection of individual clones is not required we recommend that you prepare frozen cultures of your stable virus producing cell population as described in Section VII C Determining the Viral Titer It is necessary to determine the viral titer so that you can confirm that virus is viable and estimate the multiplicity of infection MOI or number of viral particles per target cell The viral titer produced by transiently transfected or stable virus producing packaging cell lines is determined as follows 1 Collect virus containing medium from packaging cells 2 Add polybrene to a final concentration of 4 ug ml and filter medium through a 0 45 um filter Note The filter used should be cellulose acetate or polysulfonic low protein binding but not nitrocellulose Nitrocellulose binds proteins present in the membrane of retrovirus and destroys the virus 3 Prepare serial dilutions six 10 fold serial dilutions are usually pre pared To dilute virus use fresh medium containing 4 ug ml of polybrene 4 Infect target cells NIH 3T3 plated one day before in 6 well plates 5 x 10 1 x 10 cells per well in 4 ml of medium by adding virus containing medium to the wells 5 48 hours post infection subject cells to G418 selection 0 5 mg ml for one week
4. or 0 2 0 4 mg ml hygromycin if working with pRevTRE 6 The titer of virus corresponds to the number of colonies present at the highestdilution which contains colonies multiplied by the dilution factor For example the presence of 4 colonies in the 105 dilution would represent a viral titer of 4 x 105 colony forming units 7 After isolating a high titer clone prepare frozen cultures Section VII BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 22 Version PR33666 BD RevTet System User Manual X Establishing a Stable BD Tet Off or BD Tet On Cell Line This section describes how to infect your target cells with your RevTet Off On retrovirus to create a stable Tet cell line To establish the Tet line you will infect target cells with the RevTet Off On virus select with G418 and isolate individual clones If desired you may use the Tet Off On cells as a mixed population however stable cell lines with the lowest background and highest inducibility are obtained after isolating individual clones In Section XI you will proceed to infect the Tet cell line with RevTRE Gene X virus and select with hygromycin to incorporate the response construct containing your gene of interest As an alternative strategy you may simultaneously infect with both viruses using the protocol below and perform a double selection to create the double stable cell line However this method produces less reliable results and should on
5. the cell Fresh Dox should be added every two days A Infection of Adherent Cells and Selection of Stable Clones Note Except for the selection marker used this section is identical to Section X A 1 Plate target cells 12 18 hr before infection in a 100 mm plate Plate a sufficient number of cells to attain a confluency of 40 60 at the time of infection 2 For infection collect medium from the packaging cells filter through a 0 45 um filter Note Use a cellulose acetate or polysulfonic low protein binding filter but not nitrocellulose Nitrocellulose binds proteins present in the membrane of retrovirus and destroys the virus To obtain approximately one insert per cell use a multiplicity of infection MOI of 0 5 3 colony forming units per cell If you have not determined the viral titer use as much virus containing medium as possible 3 Add polybrene to the culture to a final concentration of 4 ug ml Note The concentration of polybrene may be titrated from 2 12 ug ml to optimize the infection efficiency 4 Replace medium after 24 hr of incubation Optional To further increase the efficiency of infection you may infect cells a second time 12 24 hr after the initial infection Note Half maximal infection occurs after 5 6 hr of exposure of cells to virus maximal infection occurs after 24 hr of exposure Expression can first be observed at 24 hr and reaches a maximum at 48 hr 5 Two to three days after
6. 1 which has been tested and shown to not inhibit the full range of induction possible with tet inducible cell lines Procedure 1 3 4 Plate 6 aliquots of 5 x 10 1 x 10 CHO AA8 Luc Tet Off cells each into 5 ml of complete alpha MEM culture medium no additives in 6 well culture dishes To titrate Tc add Tc to final concentrations of 0 0 0001 0 001 0 01 0 1 1 0 and 10 0 ug ml To titrate Dox add Dox to final concentrations of 0 0 001 0 01 0 1 1 0 10 and 100 ng ml Allow the cells to grow for 48 hr Assay each sample for luciferase activity Plot your results logarithmi cally and compare to Figure 6 B Titrating G418 and Hygromycin Concentrations Prior to using G418 or hygromycin to establish stable and double stable cell lines itis importantto titrate your G41 8 and hygromycin stocks to determine the optimal concentration for selection with your target cell line This is also BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 18 Version PR33666 BD RevTet System User Manual VIII Pilot Experiments continued 107 4 e Dox o Tc Luciferase activity arbitrary units 10 T T T T T T 1 001 01 4 1 10 100 1000 10000 Doxycycline or tetracycline ng ml Figure 6 Dose response curve for the CHO AA8 Luc Control Cell Line Results of an experiment comparing Tc open circles and Dox closed circles dose response curves for the CHO AA8 Luc Con
7. Institute of Health and Center for Disease Control have designated retroviruses such as Moloney murine leukemia virus MoMuLV as Level 2 organisms This requires the maintenance of a Biosafety Level 2 facility for work involving this virus and others like it MoMuLV does not naturally infect human cells however virus packaged from the MoMuLV based vectors described here is capable of infecting human cells The viral supernatants produced by these retroviral systems could depending on your retroviral insert contain potentially hazardous recombinant virus Similar vectors have been approved for human gene therapy trials attesting to their potential ability to express genes n vivo Forthese reasons due caution must be exercised in the production and handling of any recombinant retrovirus The user is strongly advised not to create retroviruses capable of expressing known oncogenes in amphotropic or polytropic host range viruses For more information on Biosafety Level 2 see the following reference Biosafety in Microbiological and Biomedical Laboratories Third Edition May 1993 HHS Pub No CDC 93 8395 U S Department of Health and Human Services PHS CDC NIH available on the web at http ombl od nih gov Biosafety Level 2 The following information is a brief description of Biosafety Level 2 t is neither detailed nor complete Details of the practices safety equipment and facilities that combine to produce a Biosafety Level 2 a
8. Pilot Experiment with the CHO AA8 Luc Tet Off Control Cell Line The CHO AA8 Luc Tet Off Control Cell Line is a premade double stable Tet Off Cell Line that exhibits over 10 fold induction of luciferase upon removal of Tc or Dox from the culture medium Figure 6 We recommend that you perform a dose response curve with these cells This experiment serves two critical functions Determination of effective concentrations of Tc or Dox stocks The concentrations of Tc and Dox listed throughout this protocol are approximate The optimal concentration may vary with different cell lines and with different lots of antibiotic In general full suppression of gene expression in Tet Off cell lines can be obtained with 1 2 ug ml Tc or 10 ng 1 ug ml Dox Full activation of gene expression in Tet On cell lines can be obtained with 100 ng 1 ug ml Dox Testing of serum for Tc contamination As shown in Figure 7 different lots of FBS exhibit significant variation in their effect on Tet System expression presumably due to the widespread use of tetracy clines in the diet of cattle The 14 000 fold induction of luciferase in CHO AA8 Luc Tet Off Control Cells in response to Tc or Dox is highly reproducible If you see a significantly lower level of induction e g 100 1 000 fold or less this may suggest that your serum contains Tc This test should be repeated with each different lot of serum Alterna tively use BD Tet System Approved Fetal Bovine Serum 8630
9. ml stock solution by dissolving 1 g of powder in approximately 70 ml of DMEM without supplements Filter sterilize and store at 4 C G418 can also be purchased as a premade solution Geneticing GIBCO 10131 019 50 mg ml Hygromycin for selection of double stable Tet Off and Tet On Cell Lines Hygromycin Bis available from BD Biosciences Clontech Cat No 631309 Prior to use determine the optimal concentration for selection as described in Section VIII Notes on antibiotic selection For maintenance of most cell lines 100 ug ml of G418 or hygromycin is a suitable concentration For selecting stable transformants in HeLa and NIH 3T3 cells we have found 400 500 ug ml G418 sometimes up to 1 mg ml and 200 ug ml hygromycin to be optimal For either purpose we recommend determining the optimal concentration for your specific cell line Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 11 BD RevTet System User Manual lll Additional Materials Required continued Trypsin EDTA Trypsin Sigma T3924 Dulbecco s phosphate buffered saline DPBS Sigma D8662 Cell Freezing Medium Sigma C6164 with or without Dimethyl sulfoxide DMSO Sigma D2650 Tissue culture plates and flasks Cloning cylinders PGC Scientific 62 6150 40 45 or Cloning discs PGC Scientific 62 6151 14 12 0 45 um filters Use cellulose acetate or polysulfonic low protein binding filters Do not use nitrocellul
10. of 4 ug ml Note The concentration of polybrene may be titrated from 2 12 ug ml to optimize the infection efficiency 4 Centrifuge the plate at 1 200 x g for 60 90 min at 32 C A room temperature centrifuge is acceptable if a 32 C unit is not available 5 Incubate cells for 6 8 hr 6 To remove virus containing supernatant transfer cell culture to a 15 ml conical tube and centrifuge at500 x gfor 10 min Carefully collect supernatant 7 Resuspend cells in a 50 50 mixture of conditioned and fresh media Incubate cells overnight 8 Optional To further increase the efficiency of infection you may infect cells a second time 12 24 hr after the initial infection Note Half maximal infection occurs after 5 6 hr of exposure of cells to virus maximal infection occurs after 24 hr of exposure Expression can first be observed at 24 hr and reaches a maximum at 48 hr 9 Two to three days after the last infection of target cells subject cells to hygromycin treatment for 7 days changing medium as needed 10 Isolate individual clones using the limiting dilution technique Continue with Section C Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 27 BD RevTet System User Manual XI Establishing a Double Stable Inducible Cell Line cont C Screening for Inducible Clones 1 Test hygromycin resistant clones for Dox regulated gene expression by assaying for Gene X expression in t
11. viral packaging signal tTA and Neo The vector also contains the E coli Amp gene for propagation and selection in bacteria pRevTet Off IN can be used to establish stable Tet Off cell lines via retrovirus mediated gene transfer A gene of interest cloned into pRevTRE can be inducibly expressed when delivered to these Tet Off cells tTA binds to the Tet response element TRE thus activating transcription in the absence of Tc or Dox As Tc or Dox is added to the culture medium transcription from the TRE is turned off in a highly dose dependent manner BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 Version PR33666 BD RevTet System User Manual Appendix Vector Information continued Ssp 6157 pRevTRE Col E1 6 5 kb orl 3 tetO J LTR P incMN Xho 2835 MCS 3300 3310 3320 3330 3340 3350 ACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTAACATCGATAAAA Bam Sall Sphl Hind Hpal Clal Figure 11 pRevTRE Vector map and MCS pRevTRE is a retroviral Tet response vector that expresses a gene of interest from the Tet response element TRE This vector is derived from pLNCX a Moloney murine leukemia virus MoMuL V derived retroviral vector The TRE contains seven direct repeats of the 42 bp tetO operator sequence upstream of a minimal CMV promoter which can be bound by the tTA and rtTA transactivators The 5 viral LTR controls expression of the transcript that contains Y the extende
12. BD RevTet System User Manual e BD Cat No 631020 or K1626 1 RJ 631021 or K1627 1 PT3223 1 PR33666 BD Biosciences Published 27 March 2003 BD RevTet System User Manual Table of Contents I Introduction 4 ll List of Components 10 Ill Additional Materials Required 11 IV RevTet Procedural Overview 13 V Plasmid Manipulations 14 VI Guidelines for Working with Retroviruses 15 VII Cell Culture Guidelines 16 VIII Pilot Experiments 18 IX Virus Production 21 X Establishing a Stable BD Tet Off or BD Tet On Cell Line 23 XI Establishing a Double Stable Inducible Cell Line 26 XII References 29 XIII Related Products 30 Appendix Vector Information 31 Note The viral supernatants produced by these retroviral systems could de pending on your DNA insert contain potentially hazardous recombinant virus Due caution must be exercised in the production and handling of recombinant retrovirus The user is strongly advised not to create retroviruses capable of expressing known oncogenes in amphotropic or polytropic host range viruses Appropriate NIH regional and institutional guidelines apply as well as guidelines specific to other countries In the U S NIH guidelines require that retroviral production and transduction be performed in a Biosafety Level 2 facility For more information see appropriate HHS publications Section VI in this User Manual contains a brief description of Biosafety Level 2 as well as ot
13. Kozak 1987 may improve expression levels however many genes have been efficiently expressed in mammalian systems without the addition of a Kozak sequence The cDNA should not contain a polyadenylation signal The inclusion of such sequences between retroviral LTRs can cause premature polyadenylation during virus transcription which interferes with the production of vector containing virions Coffin amp Varmus 1996 The fragment can be generated using compatible restriction sites that are present on either side of the gene and in the cloning vector If no such sites are present the gene fragment can be generated by PCR with suitable restriction sites incorporated into the primers 2 Digest pRevTRE with the appropriate restriction digestion enzyme s treat with phosphatase optional and purify 3 Ligate the digested vector and the target Gene X fragment 4 Transform ligation mixtures into E coli 5 Identify the desired recombinant plasmid by restriction analysis and confirm orientation and junctions by sequencing BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 14 Version PR33666 BD RevTet System User Manual VI Guidelines for Working with Retroviruses The protocols in this User Manual require the production handling and storage of infectious retrovirus It is imperative to fully understand the potential hazards of and necessary precautions for the laboratory use of retroviruses The National
14. Protocols in Molecular Biology ed by F M Ausubel et al 1994 Greene Publishing Associates and Wiley amp Sons B Maintenance of RetroPack PT67 Packaging Cell Line 1 To thaw the packaging cells transfer the vial of frozen cells from liquid No to a 37 C water bath until just thawed Transfer the cells to a plate containing fresh medium The cells should be maintained in DMEM medium containing 10 Tet System Approved FBS 100 U ml streptomycin penicillin 4 mM L glutamine and high glucose 4 5 g L Ideally cells should be plated at 3 5 x 10 per 100 mm plate and split every 2 3 days when they reach 70 80 confluency confluency is 3 4 x 108 per 100 mm plate Note These cells have a very short doubling time 16 hours They should be split before they reach confluence Splitthe cells as follows Remove the medium and wash the cells once with PBS Add 1 2 ml of trypsin EDTA solution and treat for 0 5 1 min until cells dislodge with minimal agitation Then add 5 10 ml of medium serum to stop trypsinization and resuspend the cells gently but thoroughly Transfer the desired number of cells to a 100 mm plate containing 10 ml of medium Rotate or shake the plate to evenly distribute the cells Change the medium 12 24 hr after trypsinization D Preparing Frozen Cultures of Cell Lines We strongly recommend that you prepare frozen aliquots of early passages of the packaging and Tet cell lines to ensure a renew
15. Retro X Vectors many Transfection selection amp induction BD Tet System Approved Fetal Bovine Serum 8630 1 631101 BD Clonfectin Transfection Reagent 8020 1 631301 G418 8056 1 631307 Hygromycin B 8057 1 631309 Doxycycline 8634 1 631311 BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 30 Version PR33666 Appendix Vector Information BD RevTet System User Manual TABLE I REVTET SYSTEMS VECTOR INFORMATION Mammalian Diagnostic Fragment Expressed selectable Size restriction sizes Name protein marker bp enzyme s kb pRevTet On rtTA neomycin 7649 BamH 7 6 Vector pRevTet Off tTA neomycin 7822 BamH 5 8 amp 2 0 Vector pRevTet Off IN tTA neomycin 7107 EcoR BamH 6 0 amp 1 0 Vector pRevTRE gene of hygromycin 7649 BamH Ssp 3 6 amp 2 8 Vector interest pRevTRE Luc luciferase hygromycin 8215 BamH 6 4 amp 1 8 Vector Protocol PT3223 1 Version PR33666 www bdbiosciences com BD Biosciences Clontech 31 BD RevTet System User Manual Appendix Vector Information continued coet pRevTet On Neo ori 7 6 kb BamH 2654 Figure 8 pRevTet On Vector map pRevTet On is a retroviral vector expressing the reverse tetracycline controlled transactivator rtTA from the CMV promoter This vector is derived from pLNCX a Moloney murine leukemia virus MoMuLV based retroviral vector The 5 viral LTR controls expression of the transcript that contain
16. The separate introduction and integration of the viral genes into the packaging cell line minimizes the chances of producing replication competent virus due to recombination events during cell proliferation Morgenstern amp Land 1990 Miller amp Chen 1996 Packaging Cell produces viral proteins from stably integrated genes 1 Transfection Q Retroviral vector 2 Integration Q transient s expression l wt Gene X Neo 3 Transcription wt Gene X_ Neo RNA oxi viral a 1 Proteins 4 Viral proteins recognize 5 Packaging 6 Budding of infectious but O replication incompetent virus Figure 2 Packaging of infectious replication incompetent retroviral particles The retroviral vector containing the gene of interest an antibiotic selection gene Neo in this example and the packaging signal necessary for retrovirus particle formation can stably integrate or be transiently expressed The packaging cell line provides the genes necessary for particle formation which have been deleted from the vector gag core structural proteins pol reverse transcriptase integrase and env coat glycoproteins Virus released from this cell line contains the products of these genes and is infectious but lacks the genes themselves thus preventing retroviral production from subsequently infected cell lines BD Biosciences Clontech www bdbiosciences com Pr
17. able source of cells 1 Expand the cell line in the desired number of flasks or plates 2 When the desired number of flasks plates have reached 80 confluence wash the cells once with PBS trypsinize add 2 4 volumes complete medium to dilute trypsin and harvest cells Count your cells and collect by centrifugation 71500 x g for 10 min Resuspend in 4 C Cell Freezing Medium Sigma C6164 or 1096 DMSO 50 90 serum at 1 2 x 108 cells ml BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 16 Version PR33666 BD RevTet System User Manual Vil Cell Culture Guidelines continued 5 Dispense 1 ml aliquots into labeled freezing vials and place in a cell freezing container reduces temperature 1 C min at 80 C overnight Alternatively place the vials on ice or at 20 C for 1 2 hr transfer to an insulated container foam ice chest and place container in a 80 C freezer for several hours to overnight 6 Transfer vials to liquid nitrogen 7 Two or more weeks later To confirm viability of frozen stocks start a fresh culture of each type of frozen cells as described in Section B above Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 17 BD RevTet System User Manual VIII Pilot Experiments Before you perform any other experiments we strongly recommend that you perform pilot experiments with the control vector and cell line A
18. ated gene expression systems in a wide variety of cell types Each RevTet System is a complete retroviral gene expression system containing a retroviral regulator r tTA vector a retroviral response vector a control vector and a packaging cell line Like our BD Retro X System 631508 the RevTet Systems contain the BD RetroPack PT67 Packaging Cell Line 631510 for the safe efficient production of infectious replication incompetent retrovirus The RevTet Systems provide a powerful and convenient approach to setting up the tetracycline Tc inducible high level gene expression systems first described by Gossen and Bujard 1992 Retroviral mediated tet regulation The Tet Systems are based on two elements from the tet operon of the E coli Tn10 transposon the Tet repressor protein TetR and the tet operator DNA sequence tetO The gene to be expressed is cloned into the pRevTRE response vector downstream of the tetracycline responsive element TRE which con tains seven direct repeats of the 42 bp tetO sequence and the minimal immedi ate early promoter of cytomegalovirus P incmv The two systems differ in their regulatory vector Figure 1 The RevTet Off System uses the pRevTet Off Vec tor which contains the tTA regulatory element a fusion of TetR and the VP16 activation domain The BD RevTet On System uses pRevTet On based on the reverse tTA rtTA Both systems use the pRevTRE response vector All the RevTet Vectors ar
19. clones Prepare frozen cultures Proceed with experiments Prepare frozen cultures Optional Use mixed population Optional Instead of sequential infection you may simultaneously coinfect and perform double selection for instance when using primary cell cultures Figure 5 Overview of the RevTet Procedure Be sure to read entire protocol before starting Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 13 BD RevTet System User Manual V Plasmid Manipulations A Propagation of Plasmids 1 Transform each of the plasmids provided in this kit into a suitable E coli host strain e g DH5a to ensure that you have a renewable source of DNA 2 You will need to perform large scale plasmid preparations of any plasmid that will be introduced into mammalian cells To ensure the purity of the DNA isolate all plasmids for transfection using a NucleoBond Plasmid Maxi Kit Cat No 635933 Cat No 635934 Cat No 635935 or by banding on a CsCl gradient Sambrook et al 1989 B Generating Your Gene Specific Expression Vector Generate your pRevTRE Gene X construct using standard molecular biology techniques as described below For more detailed information see Sambrook et al 1989 1 Purify the target Gene X fragment by any standard method The cDNA or gene fragment must contain an ATG initiation codon In some cases addition of a Kozak consensus ribosome binding site
20. clones capable of high induction in NIH 3T3 cells Cunningham et al 1998 pRevTet Off IN is sold separately and can be used in place of pRevTet Off in the RevTet Off System Tet Inducible Retroviral Libraries BD Biosciences Clontech offers Tet Inducible Retroviral Libraries that allow you to efficiently screen cDNA libraries directly in human cells Furthermore because the system is inducible and the inserts are not expressed in the packaging cell line you can recover toxic or apoptosis related genes See Related Products Section XIII for a list of currently available libraries Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 9 BD RevTet System User Manual ll List of Components Store cell lines in liquid nitrogen 196 C Store all plasmids at 20 C Store Tet System Approved Fetal Bovine Serum at 20 C BD RevTet On System 631021 10 10 10 1 50 ug ug ug ml ml pRevTet On Vector 0 5 ug ul pRevTRE Vector 0 5 ug ul pRevTRE Luc Vector 0 5 ug ul RetroPack PT67 Cell Line 2 x 109 ml Tet System Approved Fetal Bovine Serum BD RevTet Off System 631020 10 10 10 1 50 The following kit components are also available separately ug ug ug ml ml pRevTet Off Vector 0 5 ug ul pRevTRE Vector 0 5 ug ul pRevTRE Luc Vector 0 5 ug ul RetroPack PT67 Cell Line 2 x 109 ml Tet System Approved Fetal Bovine Serum pRevTet On Vecto
21. d induction Dox RLU Dox RLU For Tet On Fold induction Dox RLU Dox RLU 7 Select clones with the highest fold induction highest expression with lowest background for propagation and furthertesting In general only select clones that exhibit gt 20 fold induction 8 Freeze stocks of each clone as soon as possible after expanding the culture as described in Section VII D Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 25 BD RevTet System User Manual XI Establishing a Double Stable Inducible Cell Line This section describes how to infect your target cells with your RevTRE retrovirus to create a double stable inducible expression line To establish the line you will infect target cells with the RevTRE virus select with hygromycin and isolate individual clones If desired you may use the stable cells as a mixed population however expression systems with the lowest background and highest inducibil ity are obtained after isolating individual clones Additionally adapt the following steps to infect with control viruses as required for your experiments Proceed with Section A for adherent cells proceed with Section B for non adherent cells Note For Tet Off cells only When establishing a double stable Tet Off cell line you may wish to culture the cells in the presence of 2 ug ml Tc or 1 ug ml Dox in order to prevent transcription of Gene X This is essential if Protein X is toxic to
22. d viral packaging signal and the hygromycin resistance Hyg gene for antibiotic selection in mammalian cells The TRE is derived from vectors described previously pRevTRE also includes the E coli Amp gene for antibiotic selection in bacteria pRevTRE is provided with the control vector pRevTRE Luc which was constructed by cloning the luciferase gene into the Hind Ill Cla sites in the MCS of pRevTRE pRevTRE can be used to establish inducible Tet Systems via retrovirus mediated gene transfer In combination with the pRevTet On or pRevTet Off regulatory vector a gene of interest can be inducibly expressed at high levels in response to varying concentrations of tetracycline Tc or Tc derivatives such as doxycycline Dox tTA and rtTA bind to the Tet response element TRE and activate transcription from the minimal promoter in the absence or presence of Dox respectively Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 35 BD RevTet System User Manual Notes BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 Version PR33666 BD RevTet System User Manual Notes Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 37 BD RevTet System User Manual Notes BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 Version PR33666 BD RevTet System User Manual Notes Notice to Purchaser This product is intended
23. e Use a cellulose acetate or polysulfonic low protein binding filter but not nitrocellulose Nitrocellulose binds proteins present in the membrane of retrovirus and destroys the virus To obtain approximately one insert per cell use a multiplicity of infection MOI of 0 5 3 colony forming units per cell If you have not determined the viral titer use as much virus containing medium as possible Add polybrene to the culture to a final concentration of 4 ug ml Note The concentration of polybrene may be titrated from 2 12 ug ml to optimize the infection efficiency Centrifuge the plate at 1 200 x g for 60 90 min at 32 C A room temperature centrifuge is acceptable if a 32 C unit is not available Incubate cells for 6 8 hr To remove virus containing supernatant transfer cell culture to a 15 ml conical tube and centrifuge at500 x gfor 10 min Carefully collect the supernatant Resuspend cells in a 50 50 mixture of conditioned and fresh media Incubate cells overnight Optional To further increase the efficiency of infection you may infect cells a second time 12 24 hr after the initial infection Note Half maximal infection occurs after 5 6 hr of exposure of cells to virus maximal infection occurs after 24 hr of exposure Expression can first be observed at 24 hr and reaches a maximum at 48 hr Two to three days after the last infection of target cells subject cells to G418 treatment fo
24. e derived from pLNCX a BD Retro X vector capable of producing high titer virus in the appropriate packaging cell lines In the RevTet Off System tTA binds the TRE and activates transcription in the absence of Tc or the Tc derivative doxycycline Dox Thus as Tc or Dox is added to the culture medium transcription is turned off in a dose dependent manner Figure 1 Conversely the RevTet On System allows gene expression to be ac tivated by the addition of Dox These two complementary systems allow you to choose the one that best suits your needs Benefits and applications of Tc mediated induction In most inducible mammalian gene expression systems e g induction by heavy metals steroid hormones or heat shock induction is nonspecific and expres sion levels cannot be precisely regulated In addition these systems are gener ally leaky in the off state and the inducing agent itself may be cytotoxic or have pleiotropic effects on results In contrast regulation of gene expression by the heterologous bacterial control elements in the RevTet Systems is very specific Furthermore the levels of Tc or Dox required for the full range of gene expres sion are not cytotoxic and have no significant effect on cell proliferation or animal growth even with continuous treatment Bohl et al 1997 Mayford et al 1996 The use of separate regulatory and response vectors in the RevTet Systems BD Biosciences Clontech www bdbiosciences com Protoco
25. fective retrovirus Cell 33 153 159 Mayford M Bach M E Huang Y Y Wang L Hawkins R D amp Kandel E R 1996 Control of memory formation through regulated expression of a CaMK II transgene Science 274 1678 1683 Miller A D 1996 Cell surface receptors for retroviruses and implications for gene transfer Proc Natl Acad Sci USA 93 11407 11413 Miller A D amp Buttimore C 1986 Redesign of retrovirus packaging cell lines to avoid recombina tion leading to helper virus production Mol Cell Biol 6 8 2895 2902 Miller A D amp Chen F 1996 Retrovirus packaging cells based on 10A1 murine leukemia virus for production of vectors that use multiple receptors for cell entry J Virol 70 8 5564 5571 Miller A D Garcia J V von Suhr N Lynch C M Wilson C amp Eiden V 1991 Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus J Virol 65 2220 2224 Miller D G amp Miller A D 1994 A family of retroviruses that utilize related phosphate transporters for cell entry J Virol 68 8270 8276 Miller D G Edwards R H amp Miller A D 1994 Cloning of the cellular receptor for amphotropic murine retroviruses reveals homology to that for gibbon ape leukemia virus Proc Natl Acad Sci USA 91 78 82 Miller A D amp Rosman G J 1989 Improved retroviral vectors for gene transfer and expression BioTechniques 7 980 990
26. for your experiments For those requiring more detailed information or related protocols we recommend the following general references Hetroviruses ed by J M Coffin S H Hughes amp H E Varmus 1997 Cold Spring Harbor Laboratory Press NY Current Protocols in Molecular Biology ed by F M Ausubel et al 1994 Greene Publishing Associates and Wiley amp Sons A Transfection of Retroviral Vector Transfect the packaging cells using any standard transfection protocol See Current Protocols in Molecular Biology for sample procedures We recommend proceeding to Section IX B and selecting for stable virus producing packaging cell populations Virus titers of stable cells are not dependent on the efficiency of transfection and can be frozen and used for subsequent experiments However transient virus can also be used to infect target cells Virus can be collected for 3 days at 12 24 hour intervals starting 24 hr post transfection The virus titer reaches a maximum 48 hr after transfec tion and is generally at least 3096 of maximum between 24 and 72 hr after transfection Alternative Method Transduction of packaging cells As an alternative to transfecting the retroviral vector retroviral constructs can be delivered by infecting packaging cells with virus obtained from ecotropic packaging cells such as the EcoPack 293 Cell Line C3200 1 or from the Pantropic Retroviral Expression System Cat No 631512 The pr
27. h www bdbiosciences com Protocol PT3223 1 12 Version PR33666 BD RevTet System User Manual IV RevTet Procedural Overview Plasmid Manipulations Cell Line Manipulations Section V Section VII Transform all plasmids Establish cultures of into E coli PT67 packaging cells 8 10 days M Large scale plasmid preps Y Subclone gene of interest Prepare frozen cultures into pRevTRE of PT67 cells V I J Pilot Experiments Section VIII e Use CHO AA8 Luc Tet Off Titrate G418 and hygromycin 2 3 Cell Line to determine effective to determine optimal conc for weeks concs of Tc or Dox stocks selection of your target cells e Use CHO AA8 Luc cells to test Use pRevTRE Luc to test target serum for Tc contamination cells with the RevTet system Alternatively use Tet Approved by establishing an inducible cell FBS 8630 1 line expressing luciferase Virus Production Section IX RevTet Off On Virus RevTRE Gene X Virus Control Viruses as necessary 4 Produce Produce Produce weeks Select Select Select Titer Titer Titer Make frozen cultures Make frozen cultures Make frozen cultures Optional use transiently produced virus to infect target cells RevTet Off On Virus RevTRE Gene X Virus Create Tet cell line Incorporate gene of interest 3 5 Target Cell Infect Infect Weeks Infections Select Select Sections X XI e Isolate inducible clones solate inducible
28. he presence and absence of 1 ug ml Dox As with the development of Tet Off or Tet On cell lines you should generally choose the cell line that gives you the highest overall induction and lowest background i e uninduced expression level of Gene X 2 Allow the cells to grow for at least 48 hr then assay each sample for Gene X expression using a method suitable for your gene of interest Possible assays include Western blot with an antibody to Protein X RT PCR using Gene X primers Be sure you can discriminate PCR products generated from genomic DNA from true RT PCR products Northern blot with Gene X probe Functional assay for Protein X 3 Optional Confirm the presence of integrated TRE Gene X by per forming PCR on chromosomal DNA using primers that will amplify an internal portion of the construct 4 Once you have developed a suitable double stable Tet Off or Tet On cell line prepare frozen cultures Section VII D BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 28 Version PR33666 BD RevTet System User Manual XII References Ausubel F M Brent R Kingdom R E Moore D M Seidman J G Smith J A amp Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates Inc amp John Wiley amp Sons Inc Bohl D Naffakh N amp Heard J M 1997 Long term control of erythropoeitin secretion by doxycycline in mice with engineered primary myobla
29. her general information and precautions For more complete information refer to Biosafety in Microbiological and Biomedical Laboratories available on the world wide web at http ombl od nih gov BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 Version PR33666 BD RevTet System User Manual Table of Contents continued List of Figures Figure 1 Mechanism of RevTet On and RevTet Off gene expression 5 Figure 2 Packaging of infectious replication incompetent retroviral particles 6 Figure 3 Establishing an inducible cell line with the RevTet System 8 Figure 4 Infection of 3T3 cells with pRevTet Off IN produces a higher percentage of highly inducible clones 9 Figure 5 Overview of the RevTet procedure 13 Figure 6 Dose response curve for the CHO AA8 Luc Control Cell Line 19 Figure 7 Fold induction of luciferase activity in different lots of FBS 19 Figure 8 pRevTet On Vector map 32 Figure 9 pRevTet Off Vector map 33 Figure 10 pRevTet Off IN Vector map 34 Figure 11 pRevTRE Vector map and MCS 35 Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 3 BD RevTet System User Manual Introduction The BD RevTet On amp BD RevTet Off Systems combine the advantages of retrovirus mediated gene transfer with the proven tetracycline regulated control of BD Tet On and BD Tet Off Gene Expression Systems BD RevTet allows the fast and efficient establishment of regul
30. l PT3223 1 4 Version PR33666 BD RevTet System User Manual Introduction continued RevTet Off System Transcription turned off by addition of Tc or Dox copy of pRevTet Off regulatory plasmid Tc or Dox aN A Tc or Dox tTA GS copy of pRevTRE response plasmid Transcription Gene of interest RevTet On System Transcription turned on by addition of Dox copy of pRevTet On VP16 regulatory plasmid t Dox Dox rtTA Transcription Painem RU EL copy of pRevTRE response plasmid Figure 1 Mechanism of BD RevTet On and BD RevTet Off gene expression RevTet Off The TRE is located upstream of the minimal immediate early promoter of cytomegalovirus P mincmv which is silent in the absence of activation tTA binds the TRE and thereby activates transcription of the gene of interest in the absence of Tc or Dox BD RevTet On The reverse Tet repressor rTetR was created by four amino acid changes that reverse the protein s response to Dox As a result of these changes the rtTA binds the TRE and activates transcription in the presence of Dox also produces several specific advantages First the ratios of the two vectors can be varied to obtain optimal induction Second it allows for the construction of a reference r tTA line to be used in combination with any pRevTRE construct Furthermore it allows for insertion of a tissue specific promoter in f
31. l G418 and 200 400 ug ml hygromycin to be optimal C Pilot Experiment with the pRevTRE Luc Vector Using the protocols in Sections IX X amp Xl sequentially or simultaneously infect your target cells with virus obtained from PT67 cells transfected with pRevTet On Off and pRevTRE Luc After selecting for stable populations plate cells in medium Dox for 48 hr to determine luciferase induction Note You should save any unused RevTRE Luc virus produced in this pilot experiment This virus can be used for screening the inducibility of experi mental RevTet Off On cell lines Section X C The viral supernatant without polybrene can be stored at 80 C for up to one month however the viral titer may fall 2 4 fold after freezing If you desire a permanent source of RevTRE Luc control virus you can create a stable virus producing RevTRE Luc packaging cell line using the procedure described in Section IX B BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 20 Version PR33666 BD RevTet System User Manual IX Virus Production The protocols in this section are intended specifically for use with the PT67 packaging cell line and RevTet Vectors This protocol provides detailed proce dures for virus production infection of target cells and selection of stable clones Follow the steps below to produce RevTet Off On virus and RevTRE Gene X virus as well as any control viruses lacking inserts that you will need
32. ll users acknowledge that the Tet Technol ogy is experimental in nature Abbott makes no warranties express or implied or of any kind and hereby disclaims any warranties representations or guarantees of any kinds as to the Tet Tech nology patents or products All others are invited to request a license from Abbott prior to pur chasing these reagents or using them for any purpose BD Biosciences Clontech is required by its licensing agreement to submit a report of all purchasers of the Tet controllable expression sys tems to Abbott For license information please contact Abbott Bioresearch Center 100 Research Drive Worcester MA 01605 4314 U S A Fax 508 755 8506 BD AmphoPack BD Clonfectin BD RevTet Off BD RevTet On BD RetroPack BD Retro XTM BD RevTet BD RevTet Off BD RevTet On BD Tet Off BD Tet On are trademarks of Becton Dickinson and Company NucleoBond is a registered trademark of Macherey Nagel GmbH amp Co Polybrene is a registered trademark of Abbott Laboratories Inc BD BD Logo and all other trademarks are property of Becton Dickinson and Company 2003 BD Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 39
33. ly be used for pilot experiments Additionally adapt the following steps to infect with control viruses as required for your experiments Proceed with Section A below for adherent cells proceed with Section B for non adherent cells Note Growth of some target cells can be affected by media conditioned by the packaging cells due to nutrient depletion If this appears to be the case in your system the following precautions can be taken to avoid an adverse effect induced by the packaging cell derived supernatants Dilute virus containing media at least 2 fold with fresh medium 4 6 hr after exposure of target cells to virus replace with fresh medium A Infection of Adherent Cells and Selection of Stable Clones 1 Plate target cells 12 18 hr before infection in a 100 mm plate Plate a sufficient number of cells to attain a confluency of 40 60 at the time of infection 2 For infection collect medium from the packaging cells filter through a 0 45 um filter Note Use a cellulose acetate or polysulfonic low protein binding filter but not nitrocellulose Nitrocellulose binds proteins present in the membrane of retrovirus and destroys the virus To obtain approximately one insert per cell use a multiplicity of infection MOI of 0 5 3 colony forming units per cell If you have not determined the viral titer use as much virus containing medium as possible 3 Add polybrene to the culture to a final concentration of 4 ug ml No
34. n is induced by the addition RevTet On or withdrawal RevTet Off of doxycycline or tetracycline Prior to target cell infection high titer virus producing lines can be established with antibiotic selection clones We recommend storing frozen stocks of this cell line or population to express future genes of interest from pRevTRE Gene X or pT RE2 constructs Next the Tet Off On cell line is infected with pRevTRE virus Hygromycin selection of this culture yields a population of cells containing all the components needed for Tet regulated expression Single clones with the desired induction characteristics can be isolated at this point As an alternative to producing Tet regulated cell lines via serial infection with pRevTet Off On and pRevTRE virus you may infect with both viruses simulta neously However this method is only recommended for pilot experiments and for cell lines such as primary cells that cannot be propagated in culture for an extended period of time BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 8 Version PR33666 BD RevTet System User Manual Introduction continued 70 pRevTet Off IN NIH 3T3 E pRevTet Off IN Swiss 3T3 7 7 pTet Off NIH 3T3 i E pRevTet Off NIH 3T3 50 x 50 4 q 2 40 2 e e 5 404 5 s 2 S 30 20 205 10 104 j E i 0 20 fold 21 50 fold gt 50 fold 0 20 fold 21 50 fold gt 50 fold Luciferase induction Dox RLU Dox RLU Luciferase induction Do
35. ndividual clones are then isolated from this population to establish a Tet Off On cell line If desired the heteroge neous population can be used instead however expression systems with the lowest background and highest inducibility are obtained after isolating individual Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 7 BD RevTet System User Manual Introduction continued Packaging Cells Target Cells Transfect packaging cell Infecttarget line with regulatory and cells with expression vectors collected virus Collect virus containing Hyg supernatant p Gene of pRevtre amp Select Neo JJ interest and screen Tet On or Tet Off cell line Premade cell lines are also available from CLONTECH Select Hyg and screen Double stable cell line expressing the target gene under doxycycline control Figure 3 Establishing a inducible cell line with the BD RevTet System The pRevTet On or pRevTet Off Vector and the pRevTRE response vector expressing your gene of interest or a library are separately transfected into the RetroPack PT67 packaging cell line The resulting virus containing supernatants are used to serially infect target cells first with pRevTet Off On virus to produce a stable Tet Off On cell line then with pRevTRE virus to integrate your gene of interest Alternatively the supernatants can be used simultaneously to infect target cells not shown Expressio
36. ose filters because they bind proteins presentin the retroviral membrane destroying the virus For transient and stable transfections The transient and stable transfections in this protocol can be performed by various methods Reagents will depend on which transfection method you use We generally use electroporation or the calcium phosphate method for both transient and stable transfections Protocols for other methods can be found in Freshney 1993 and Ausubel et al 1994 For infection of target cells Polybrene Hexadimethrine Bromide Sigma H9268 Inducing Agent Doxycycline Dox Cat No 631311 We recommend using Dox for inducing gene expression in the RevTet Systems In the RevTet On system Dox has a 100 fold higher affinity for rtTA than Tc Gossen amp Bujard 1995 As a result Dox produces much greater activation ofthe rtTA protein and a higher level of induction of the target gene In contrast both drugs completely inactivate the tTA regulatory protein in the BD RevTet Off System At BD Biosciences Clontech we use Dox for all RevTet System experiments A significantly lower concentration of Dox is required for complete activation or inactivation 10 ng 1 ug ml Dox vs 1 2 ug ml Tc Subtoxic levels of Tc and Dox The working concentrations of Tc and Dox used inthe RevTet systems are far below the levels known to have cytotoxic effects on mammalian cells in culture or in transgenic animals BD Biosciences Clontec
37. otocol PT3223 1 6 Version PR33666 BD RevTet System User Manual Introduction continued Broad host range of PT67 packaged virus The viral env gene expressed by the packaging cell line encodes the envelope protein which determines the cellular host range of the packaged virus The envelope protein allows infection of different cell types through recognition of specific cellular receptors The RevTet System includes the RetroPack PT67 Packaging Cell Line an NIH 3T3 based line expressing the 10A1 viral envelope Virus packaged from PT67 cells can enter cells via two different surface mol ecules the RAM1 and GALV receptors and thus exhibits a broader host range than virus packaged by other lines Miller amp Miller 1994 Miller 1996 The RevTet Systems produce retrovirus capable of infecting nearly all dividing mammalian cells including primary cell lines Cell lines that are typically more difficult to transfect such as Jurkat and PC12 have been successfully infected with RevTet viruses Please note that retroviral transduction specifically nuclear entry of the viral pre initiation complex can only occur in actively dividing cells In addition to PT67 cells you may also use other packaging cell lines offered by BD Biosciences Clontech to provide different host ranges BD EcoPack 293 Cell Line C3200 1 Generate ecotropic virus to infect a broad range of mouse and rat cells BD AmphoPack 293 Cell Line
38. otocols that follow in Section X can be used for this technique This approach ensures that a high percentage of the cells acquire the construct with a consistent copy number 1 2 copies per cell Additionally virus producing clones derived from transduced rather than transfected cells are more stable However this method relies on the availability of virus with the appropriate tropism Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 21 BD RevTet System User Manual IX Virus Production continued B Selection of Stable Virus Producing Cell Lines To obtain stable virus producing cell lines the packaging cells transfected with retroviral plasmids are plated in selection medium 2 3 days after transfection The regulatory RevTet Off On Vectors carry the neomycin Neo gene as a selectable marker For G418 selection culture cells in the presence of G418 0 4 0 5 mg ml for one week The pRevTRE response vector carries the hygromycin Hyg gene driven by the 5 LTR promoter as a selectable marker For hygromycin selection culture cells in the presence of hygromycin 0 2 0 4 mg ml for 5 6 days The selected cell populations usually produce titers of 10 recombinant virus particles per ml This amount is suitable for most purposes If desired higher titer clones may be isolated In this case after selection pick individual clones use cloning cylinders cloning discs or limiting dilution
39. r 631007 pRevTet Off Vector 631003 pRevTRE Vector 631002 RetroPack PT67 Cell Line 631510 BD Biosciences Clontech 10 Tet System Approved Fetal Bovine Serum 631101 www bdbiosciences com Protocol PT3223 1 Version PR33666 BD RevTet System User Manual lll Additional Materials Required Cell culture The PT67 Packaging Cell Line should be grown in DMEM 90 fetal bovine serum 10 4 mM L glutamine 100 U ml penicillin G sodium 100 ug ml streptomycin sulfate To prepare complete DMEM combine 500 ml DMEM 50 ml tetracycline free FBS 10 ml 200 mM L Glutamine 4 mM final concentration 5 ml Penicillin Streptomycin solution final concentrations penicillin 100 units ml streptomycin 100 ug ml The CHO AA8 Luc Control Cell Line should be grown in Minimum Essential Medium Eagle Alpha Modification 9096 fetal bovine serum tetracycline free 10 2 mM L glutamine 100 ng ml G418 100 units ml penicillin G sodium 100 ug ml streptomycin sulfate 100 ug ml hygromycin B Dulbecco s Modified Eagle s Medium DMEM Sigma D5671 Tet System Approved Fetal Bovine Serum FBS Cat No 631101 200 mM L Glutamine Sigma G7513 Solution of 10 000 units ml Penicillin G sodium and 10 000 ug ml Streptomycin sulfate Sigma P0781 G418 G418is available in powdered form from BD Biosciences Clontech 631307 Note that the effective weight is about 0 7 g per g of powder Make a 10 mg
40. r 7 days changing medium as necessary Isolate individual clones using the limiting dilution technique Continue with Section C BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 24 Version PR33666 BD RevTet System User Manual X Establishing a Stable BD Tet Off or BD Tet On Cell Line cont C Screening for Inducible Clones With RevTRE Luc Virus The next step is to infect with RevTRE Luc virus to identify G418 resistant clones that have high inducibility and low background You should have sufficient RevTRE Luc virus from Section VIII C to do this experiment Alternatively you may generate RevTRE Luc virus or simply use the original plasmid in transient transfections using a standard transfection protocol 1 Expand clones as needed to perform infections or transfections 2 For each clone maintain a stock plate and set up two additional cultures in wells of a six well plate to use as a test plate for screening Plate test cells 12 18 hr before infection Plate a sufficient number of cells to attain a confluency of 40 60 adherent cells or a density of 0 5 1 x 108 cells per well non adherent cells 3 Infect test cells with RevTRE Luc virus using an MOI of 0 5 3 colony forming units per cell 4 After 24 hr of incubation change medium and add Dox 1 2 ug ml to one of the two test plates 5 Incubate the cells for 48 hr 6 Assay for luciferase and calculate fold induction For Tet Off Fol
41. re available in the above publication If possible observe and learn the practices described below from someone who has experience working with retroviruses Summary of Biosafety Level 2 Practices perform work in a limited access area post biohazard warning signs minimize production of aerosols decontaminate potentially infectious wastes before disposal take precautions with sharps e g syringes blades Safety equipment biological safety cabinet preferably Class II i e a laminar flow hood with a microfilter HEPA filter that prevents release of aerosols not a standard tissue culture hood protective laboratory coats face protection double gloves Facilities autoclave for decontamination of wastes unrecirculated exhaust air chemical disinfectants available for spills Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 15 BD RevTet System User Manual VII Cell Culture Guidelines A General Information The protocols in this section are intended specifically for use with the PT67 packaging cell line For additional information pertaining to the laboratory use of retroviruses see Section VI For more information on mammalian cell culture we recommend the following general references Culture of Animal Cells Third Edition ed by R I Freshney 1993 Wiley Liss available from BD Biosciences Clontech V2128 1 Current
42. ront of r tTA Lastly toxic or deleterious genes can be packaged in the absence of expression Transcription will only begin upon integration into a stable r tTA expressing line Additional information on the Tet Systems can be found in The Tet Systems User Manual PT3001 1 available on our web site www bdbiosciences com clontech Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 5 BD RevTet System User Manual Introduction continued Retroviral gene transfer technology Current retroviral gene transfer technology is based on the coordinated design of retroviral vectors and packaging cell lines The development of packaging lines cell lines that package retroviral RNAs into infectious particles without the concomitant production of replication competent virus created a new level of safety and control Figure 2 Mann etal 1983 Miller amp Buttimore 1986 To make a packaging cell line the structural genes necessary for particle formation and replication gag pol and env are integrated into the genome without any other viral sequences Subsequent introduction of a retroviral vector containing V transcription and processing elements and the gene of interest produces high titer replication incompetent infectious virus That is these retroviral particles can infecttarget cells and transmit the gene of interest but cannot replicate within these cells since they lack the viral genes
43. s Y the extended viral packaging signal and the neomycin resistance Neo gene for antibiotic selection in mammalian cells pRevTet On also includes the E coli Amp gene for antibiotic selection in bacteria pRevTet On can be used to establish stable Tet On cell lines via retrovirus mediated gene transfer A gene of interest cloned into pRevTRE can be inducibly expressed when delivered to these Tet On cells rtTA binds to the Tet response element TRE thus activating transcription in the presence of Dox As Dox is removed from the culture medium transcription from the TRE is turned off in a highly dose dependent manner BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 Version PR33666 BD RevTet System User Manual Appendix Vector Information continued Pvul 7057 coe PRevTet Off neo ori 7 8 kb BamH 2654 4649 Hind Ill 3466 Figure 9 pRevTet Off Vector map pRevTet Off is a retroviral vector expressing the tetracycline controlled transactivator tTA from the CMV promoter This vector is derived form pLNCX a Moloney murine leukemia virus MoMuLV based retroviral vector The 5 viral LTR controls expression of the transcript that contains V the extended viral packaging signal andthe neomycin resistance Neo gene for antibiotic selection in mammalian cells pRevTet Off also includes the E coli Amp gene for antibiotic selection in bacteria pRevTet Off can be used to establish s
44. sts Nature Med 3 299 305 Clonfectin Transfection Reagent July1996 Clontechniques XI 3 18 19 Coffin J M amp Varmus H E editors 1996 Retroviruses Cold Spring Harbor Laboratory Press NY Cunningham S M Cunningham M D Zhu L amp Kain S 1997 Determination and correlation of expression levels of luciferase and EGFP using the tetracycline controlled gene expression system and fluorescence imaging Neuroscience Abs 23 647 Cunningham S M Mazo l A Kerr H Cunningham M D Kain S K amp Zhu L 1998 Use of retroviral mediated transfer of the tetracycline controlled gene expression systems for efficient induction of heterogeneous cell populations Soc Neuroscience Abstracts 24 1 71 Freshney R I 1993 Culture of Animal Cells Third Edition Wiley Liss NY Gossen M Bonin A amp Bujard H 1993 Control of gene activity in higher eukaryotic cells by prokaryotic regulatory elements Trends Biochem Sci 18 471 475 Gossen M amp Bujard H 1992 Tight control of gene expression in mammalian cells by tetracycline responsive promoters Proc Natl Acad Sci USA 89 5547 5551 Gossen M Freundlieb S Bender G Muller G Hillen W amp Bujard H 1995 Transcriptional activation by tetracycline in mammalian cells Science 268 1766 1769 Mann R Mulligan R C amp Baltimore D 1989 Construction of a retrovirus packaging mutant and its use to produce helper free de
45. table Tet Off cell lines via retrovirus mediated gene transfer A gene of interest cloned into pRevTRE can be inducibly expressed when delivered to these Tet Off cells tTA binds to the Tet response element TRE thus activating transcription in the absence of Tc or Dox As Tc or Dox is added to the culture medium transcription from the TRE is turned off in a highly dose dependent manner Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 33 BD RevTet System User Manual Appendix Vector Information continued EcoR I 1471 pRevTet Off IN Col E1 1 1 kb tTA ori BamH 2496 Hind HI 2767 Figure 10 pRevTet Off IN Vector map pRevTet Off IN is a bicistronic retroviral vector intended for use with the BD RevTet Off Gene Expression System The internal ribosomal entry site IRES located between the tetracycline controlled transactivator tTA and the gene encoding neomycin resistance Neo provides simultaneous expression of these two elements The bicistronic mRNA can bind ribosomes either at the 5 end to translate the tTA or at the IRES to translate the antibiotic resistance marker Bicistronic expression via the IRES sequence provides a high degree of correlation between neomycin G418 resistance and stable expression of the tTA protein in target cells thus allowing more efficient selection of highly inducible clones The 5 viral LTR controls expression of the extended
46. te The concentration of polybrene may be titrated from 2 12 ug ml to optimize the infection efficiency 4 Replace medium after 24 hr of incubation Optional To further increase the efficiency of infection you may infect cells a second time 12 24 hr after the initial infection Note Half maximal infection occurs after 5 6 hr of exposure of cells to virus maximal infection occurs after 24 hr of exposure Expression can first be observed at 24 hr and reaches a maximum at 48 hr 5 Two to three days after the last infection of target cells subject cells to G418 treatment for 7 days changing medium as necessary Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 23 BD RevTet System User Manual X Establishing a Stable BD Tet Off or BD Tet On Cell Line cont 6 Once clones are visible isolate large healthy colonies gt 100 cells and transfer them to individual plates or wells When working with adherent cells we generally isolate clones using cloning cylinders or cloning discs Continue with Section C B Infection of Non Adherent Cells and Selection of Stable Clones 1 10 Plate target cells 12 18 hr before infection in a six well plate in 1 ml medium Plate a sufficient number of cells to attain a density of 0 5 1 x 10 cells per well at the time of infection For infection collect medium from the packaging cells and filter through a 0 45 um filter Not
47. the last infection of target cells subject cells to hygromycin treatment for 7 days changing medium as needed 6 Onceclones are visible isolate large healthy colonies 100 cells and transfer them to individual plates or wells When working with adherent cells we generally isolate clones using cloning cylinders or cloning discs Continue with Section C BD Biosciences Clontech www bdbiosciences com Protocol PT3223 1 26 Version PR33666 BD RevTet System User Manual XI Establishing a Double Stable Inducible Cell Line cont B Infection of Non Adherent Cells and Selection of Stable Clones Note Except for the selection marker used this section is identical to Section X B 1 Plate target cells 12 18 hr before infection in a six well plate in 1 ml medium Plate a sufficient number of cells to attain a density of 0 5 1 x 108 cells per well at the time of infection 2 For infection collect medium from the packaging cells and filter through a 0 45 um filter Note Use a cellulose acetate or polysulfonic low protein binding filter but not nitrocellulose Nitrocellulose binds proteins present in the membrane of retrovirus and destroys the virus To obtain approximately one insert per cell use a multiplicity of infection MOI of 0 5 3 colony forming units per cell If you have not determined the viral titer use as much virus containing medium as possible 3 Add polybrene to the culture to a final concentration
48. to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use BD Biosciences Clontech products may not be resold modified for resale or used to manufacture commercial products without written approval of BD Biosciences Clontech PT67 Cells This product is sold under license from the Fred Hutchinson Cancer Research Center Rights to use this product are limited to research only No other rights are conveyed Inquiry into the availability of a license to broader rights or the use of this product for commercial purposes should be directed to Fred Hutchinson Cancer Research Center Technology Transfer Office 1124 Columbia St C2M 027 Seattle WA 98104 Purchase of this product does not grant rights to 1 offer the materials or any derivatives thereof for resale or 2 to distribute or transfer the materials or any derivatives thereof to third parties Use of the Tetracycline controllable expression systems the Tet Technology is covered by a series of patents including U S patents 5 464 758 and 5 814 618 which are proprietary to Abbott Laboratories Academic research institutions are granted an automatic license with the purchase of this product to use the Tet Technology only for internal academic research purposes which license specifically excludes the right to sell or otherwise transfer the Tet Technology or its com ponent parts to third parties In accepting this license a
49. trol Cell Line Experiments with another control cell line CHO K1 EGFP Luc Tet Off have demonstrated that suppression can be maintained with Dox concentrations as low as 10 pg ml Cunningham et al 1997 15x 10 10 x 10 Fold induction 5x 10 Tet System Other commercially Approved FBS available FBS Figure 7 Fold induction of luciferase activity in different lots of FBS The CHO AA8 Luc control cell line was grown in media prepared with different lots of FBS Average uninduced expression level 0 21 Relative Light Units RLU n 21 S D 0 07 maximum expression levels varied from 123 to 3 176 RLU Protocol PT3223 1 www bdbiosciences com BD Biosciences Clontech Version PR33666 19 BD RevTet System User Manual VIII Pilot Experiments continued important because of lot to lot variation in the potency of these drugs Titrate stocks using cells plated at fixed density 1 Plate 2 x 10 cells in each of six 10 cm tissue culture dishes containing 10mlofthe appropriate complete medium plus varying amounts 0 50 100 200 400 800 ug ml of hygromycin or G418 2 Incubate the cells for 7 10 days replacing the selective medium every four days 3 Examine the dishes for viable cells every two days For selecting stable transformants use the lowest concentration that begins to give massive cell death in 5 days and kills all the cells within one week For HeLa and NIH 3T3 cells we have found 400 500 ug m
50. x RLU Dox RLU Figure 4 Infection of 3T3 cells with pRevTet Off IN produces a higher percentage of highly inducible clones Panel A Infection of NIH 3T3 or Swiss 3T3 cells with pRevTet Off IN Clones were selected with 1 mg ml G418 Panel B Transfection of NIH 3T3 cells with pTet Off from our non retroviral based Tet Off System or infection with pRevTet Off In both panels clones gener ated by plasmid transfection or retroviral infection were analyzed for their ability to exhibit inducible expression of luciferase from the pTRE Luc vector and grouped according to fold induction RLU relative light units The BD RevTet Vectors see maps in the Appendix The RevTet Vectors are based on pLNCX Miller amp Rosman 1989 a vector derived from Moloney Murine Leukemia Virus MoMuLV These vectors contain the extended retroviral packaging signal which promotes high titer virus production See the Appendix for detailed maps In addition to the regulatory vectors supplied with the RevTet Systems we offer pRevTet Off IN 6136 1 which contains an internal ribosomal entry site IRES located between the regulatory sequence and the neomycin resistance gene The inclusion of the IRES which allows the simultaneous expression of the tet regulatory protein with Neo from a single transcript ensures that all of your G418 resistant clones also express the regulatory protein Figure 4 shows that pRevTet Off IN yields a higher percentage of

Download Pdf Manuals

Related Search

Related Contents

エコライフのはじめかた（PDF2.1MB）  Manuale di installazione  exhibitor service manual - Facilities Management Expo, Buffalo NY  Woods Equipment BB8400X Brush Cutter User Manual  Télécharger - Revue Squeeze  Precautions on Using the Tiny/SLP E7 Emulator  Borland® StarTeam® 2009 - Borland Technical Publications    

Copyright © All rights reserved. Failed to retrieve file