Home

Attachment PDF Icon

1. D aquila R T Bechtel L J Videler J A Eron J J Gorczyca P amp Kaplan J C 1991 Maximizing sensitivity and speci ficity by preamplification heating Nucleic Acids Res 19 3749 Don R H Cox P T Wainwright B J Baker K amp Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Farrell Jr R E 1993 RNA Methodologies A Lab Guide for Isolation and Characterization Academic Press San Diego CA Freier S M Kierzek R Jaeger J A Sugimoto N Caruthers M H Neilson T amp Tumer D H 1986 Improved free energy parameters for predictions of RNA duplex stability Proc Natl Acad Sci USA 83 9373 9377 Frohman M A Dush M K amp Martin G R 1988 Rapid production of full length cDNA from rare transcripts Amplifica tion using a single gene specific oligonucleotide primer Proc Natl Acad Sci USA 85 8998 9002 Kellogg D E Rybalkin I Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hot start PCR facilitated by a neutralizing monoclonal antibody directed against Tag DNA polymerase BioTechniques 16 1134 1137 Matz M Lukyanov S Bogdanova E Diatchenko L amp Chenchik A 1999 Amplification of cDNA ends based on template switching effect and step out PCR Nucleic Acids Res 27 6 1558 1560 Morin R D Bainbridge M Fejes A Hirst M K
2. User Manual SMARTer PCR cDNA Synthesis Kit User Manual Ss Clontech United States Canada 800 662 2566 Asia Pacific 1 650 919 7300 Europe 33 0 1 3904 6880 Japan Se Cat Nos 634925 amp 634926 Clontech Laboratories Inc PT4097 1 ATakara Bio Company 1290 Terra Bella Ave Published January 2012 Mountain View CA 94043 Technical Support US E mail tech clontech com www clontech com SMARTer PCR cDNA Synthesis Kit User Manual Table of Contents I Listof Components oi szccvcccicasciv sis ccetecvieciacetccieiaacevcdbsdseiis vesdasdervcavedestvcessaietaveesdeidesveteeseetvcsveeteert 3 Il Additional Materials Required c ccc cceceseeeseceessseeessceeesseeeeesceeesseaeseeneeeeseesseneeneesaes 4 IIL Introduction amp Protocol Overview cceceeeeeeeneesseeeeeeeesseeseceesseeeseeeseneeenteseneseneeneneaesenees 5 IV RNA Preparation amp Handling iccccccccicccciescciceesesseciidaciscceens bas sccivessssceeesbssaseivieedavsneieesesscueeesseseeis 7 A General Precautions cccsessescsseseseescsceecsceecssesesseaeseeasecsaescsasencaesecaeeecasecaseecaseaeaeeaeaseaeneaseneaseneaeereasere 7 Be RNA Tso ati otic sees tess nus is e ER ATE E A A EA cashideckedsividdevashens 7 C RNA Purity niee a A E ETEA EEEE E EEE EET ENE EN ONN 8 D Assessing the Quality of the RNA Template s sesessesesseseesssersreetrseersestesrsersrsrssrrsnrsrsntrsntrsnterentereneet 8 V SMARTer cDNA Synthesis
3. Version No 22 P PROTOCOL 013012 10 Electrophorese each 5 ul aliquot of the PCR reaction alongside 0 1 ug of 1 kb DNA size markers on a 1 2 agarose EtBr gel in 1XTAE buffer Determine the optimal number of cycles required for each experimental and control sample see Figure 4 Section VI 11 Retrieve the 15 cycle Experimental PCR tubes from 4 C return them to the thermal cycler and sub ject them to additional cycles if necessary until you reach the optimal number 12 When the cycling is completed analyze a 5 ul sample of each PCR product alongside 0 1 ug of 1 kb DNA size markers on a 1 2 agarose EtBr gel in 1XTAE buffer Compare your results to Figure 4 to confirm that your reactions were successful 13 Add 2 ul of 0 5 M EDTA to each tube to terminate the reaction PROTOCOL Column Chromatography 1 For every experimental sample and control combine the three reaction tubes A B and Experi mental of PCR product into a 1 5 ml microcentrifuge tube Transfer 7 ul of the raw PCR product to a clean microcentrifuge tube and label this tube Sample A Store at 20 C You will use Sample A for analysis of column chromatography as described in Section G 2 To each tube of combined PCR product add an equal volume of phenol choloroform isoamyl alco hol 25 24 1 Vortex thoroughly 3 Centrifuge the tubes at 14 000 rpm for 10 min to separate the phases 4 Remove the top aqueous layer and place it in a clea
4. e 95 C 1 min e Xcycles 95 C 15sec 65 C 30sec 68 C 3 min Consult Table for guidelines Subject all tubes to 15 cycles Then divide the PCR reaction mix in tube C between the Experimental and Optimization tubes using the Optimization tube for each reaction to determine the optimal number of PCR cycles as described in Step 9 below Store Tubes A and B and the Experimental tube at 4 C gt For applications requiring full length cDNA increase to 6 min Subject each reaction tube to 15 cycles then pause the program Transfer 30 ul fromTube C to a second reaction tube labeled Optimization Store Tubes A and B and the Experimental tube containing the remaining 70 ul of Tube C at 4 C Using the Optimization PCR tube determine the optimal number of PCR cycles see Figure 5 Appendix A a Transfer 5 ul from the 15 cycle PCR reaction tube to a clean microcentrifuge tube for agarose EtBr gel analysis b Return the Optimization tubes to the thermal cycler Run three additional cycles for a total of 18 with the remaining 25 ul of PCR mixture c Transfer 5 ul from the 18 cycle PCR reaction tube to a clean microcentrifuge tube for agarose EtBr gel analysis d Run three additional cycles for a total of 21 with the remaining 20 ul of PCR mixture e Transfer 5 ul from the 21 cycle PCR to a clean microcentrifuge tube for agarose EtBr gel analysis f Run three additional cycles for a total of 2
5. 1 8 ul of purified diluted cDNA after ethanol precipitation Sample G from Section E on a 1 5 agarose EtBr gel Compare the intensities of the samples and estimate what percentage of Rsal digested PCR product remains after purification and ethanol precipitation The yield of cDNA after purification using the NucleoTrapCR Kit and ethanol precipitation is typically 70 percent If your yield is lt 30 percent troubleshoot your purification protocol or consult the trouble shooting guide of the User Manual for that particular purification kit www clontech com Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual Appendix A Protocols for PCR Select continued H Troubleshooting For troubleshooting the actual PCR Select subtraction procedure please refer to the PCR Select User Manual PT1117 1 Here we provide a troubleshooting guide for preparing SMARTer cDNA for substraction described in Appendix A Sections B E in Table IV Table IV Troubleshooting Guide for Preparing SMARTer cDNA for Subtraction PROBLEM You may have applied the wrong volume of buffer to the CHROMA Spin column or collected the wrong Low yield of cDNA volume of buffer from the column after column chromatography SOLUTION Carefully check the protocol and repeat column chromatography Appendix A Section C Your column may have leaked during shipping If your column contains less than 750
6. N A C G orT N A G or C 5 PCR Primer IIA 12 uM 5X First Strand Buffer RNase Free 250 mM Tris HCI pH 8 3 375mM KCI 30mM MgCl dNTP Mix dATP dCTP dGTP and dTTP each at 10 mM Dithiothreitol DTT 100 mM RNase Inhibitor 40 U ul SMARTScribe Reverse Transcriptase 100 U ul Deionized H O CHROMA SPIN TE 1000 Columns e Store Control Mouse Liver Total RNA and SMARTer Il A Oligonucleotide at 70 C e Store the CHROMA SPIN TE 1000 Columns at room temperature e Store all other reagents at 20 C Licensing Information For important information about the use of SMART technology please see the Notice to Purchaser at the end of this user manual www clontech com Protocol No PT4097 1 Version No 013012 3 SMARTer PCR cDNA Synthesis Kit User Manual ll Additional Materials Required The following reagents are required but not supplied Protocol No PT4097 1 Version No 4 Recipe 013012 Advantage 2 PCR Kit Cat Nos 639206 amp 639207 We strongly recommend use of the Advantage 2 PCR Kit Cat Nos 639206 amp 639207 for PCR ampli fication This kit includes the Advantage 2 Polymerase Mix which has been specially formulated for efficient accurate and convenient amplification of cDNA templates by long distance PCR LD PCR Barnes 1994 The Advantage 2 Polymerase Mix is formulated to provide automatic hot start PCR Kel logg et al 1994 and efficiently ampli
7. Total RNA and the SMARTer protocol outlined in Section V In general cDNA synthesized from mammalian total RNA should appear on a 1 2 agarose EtBr gel as a moderately strong smear from 0 5 5 kb with some distinct bands The number and position of the bands you obtain will be different for each particular total RNA used Furthermore cDNA prepared from some mammalian tissue sources e g human brain spleen and thymus may not display bright bands due to the very high complexity of the RNA For nonmamma lian species the size distribution may be smaller see Section H for more details 1 Determining the Optimal Number of PCR Cycles Section B For best results you must optimize the PCR cycling parameters for your experiment as described in Section B Figure 5 Choosing the optimal number of PCR cycles ensures that the ds cDNA will remain in the exponential phase of amplification When the yield of PCR products stops increasing with more cycles the reaction has reached its plateau Overcycled cDNA is a very poor template for cDNA subtraction Undercycling on the other hand results in a lower yield of your PCR product The optimal number of cycles for your experiment is one cycle fewer than is needed to reach the plateau Be conservative when in doubt it is better to use fewer cycles than too many We have optimized the PCR cycling parameters presented in this User Manual using an authorized hot lid thermal cycler and the Advantage 2 PCR Ki
8. aside another 10 ul of purified ds cDNA for agarose EtBr gel analysis to estimate the size range of the ds cDNA products Step 4 below Label this tube Sample D 1 Add the following reagents to the purified cDNA fraction collected from the CHROMA SPIN column Appendix A Section C 21 36 ul 10X Rsal restriction buffer 1 5 ul Rsal 10 units 2 Mix well by vortexing and spin briefly in a microcentrifuge 3 Incubate at 37 C for 3 hr 4 To confirm that Rsal digestion was successful electrophorese 10 ul of uncut ds cDNA Sample D and 10 ul of Rsal digested cDNA on a 1 2 agarose EtBr gel in 1X TAE buffer see Appendix A Sec tion G 3 in this User Manual and Section V B in the PCR Select User Manual 5 Add 8 ul of 0 5 M EDTA to terminate the reaction 6 Transfer 10 ul of the digested cDNA to a clean microcentrifuge tube label this tube Sample E7 and store at 20 C You will compare this sample to the PCR product after final purification as described in Appendix A Section G 4 E PROTOCOL Purification of Digested cDNA You may purify your digested cDNA using any silica matrix based PCR purification system such as those offered by Clontech Alternatively a phenol chloroform extraction may be performed however this may decrease the efficiency of the PCR Select subtraction The following purification procedure has been optimized using SMARTer ds cDNA and our NucleoTrapCR Kit Cat No 740587 not included with PCR Select K
9. by tapping the bottom of the tube Then spin the tube briefly to bring all contents to the bottom Perform all reactions on ice unless otherwise indicated Add enzymes to reaction mixtures last and thoroughly incorporate them by gently pipetting the reaction mixture up and down Do not increase or decrease the amount of enzyme added or the concentration of DNA in the reac tions The amounts and concentrations have been carefully optimized for the SMARTer amplification protocol and reagents B PROTOCOL First Strand cDNA Synthesis This protocol has been optimized for both total RNA and poly At RNA The minimum amount of starting material for cDNA synthesis is 2 ng of total RNA or 1 ng of poly A RNA However if your RNA sample is not limiting we recommend that you start from 1 ug of total RNA or 0 5 ug of poly A RNA for cDNA synthesis Please note that if you are starting from gt 100 ng of total RNA you must follow the guidelines inTables amp Il to dilute your first strand cDNA product before proceeding with cDNA amplification Section C We strongly recommend use of the Advantage 2 PCR Kit Cat Nos 639206 amp 639207 for PCR amplifica tion Section C This kit includes the Advantage 2 Polymerase Mix which has been specially formulated for efficient accurate and convenient amplification of cDNA templates by long distance PCR LD PCR Barnes 1994 IMPORTANT The success of your experiment depends on the quality of your
10. hr Remove and discard the top layer 5 Add an equal volume of chloroform isoamy alcohol 24 1 to the remaining layer Mix thoroughly Remove and discard the top layer 6 Store the bottom layer of phenol chloroform isoamy alcohol 25 24 1 at 4 C away from light for a maximum of two weeks e TE buffer 10 mM Tris HCI pH 7 6 0 1 mM EDTA e Ethanol e 4M ammonium acetate pH 7 0 e 1XTNE buffer 10 mM Tris HCl pH 8 10 mM NaCl 0 1 mM EDTA e NucleoTraPCR Kit Cat No 740587 e Microfiltration columns 0 45 um B PROTOCOL cDNA Amplification by LD PCR Guidelines for optimizing your PCR depending on the amount of total RNA used in the first strand synthesis are provided in Table see Section V These guidelines were determined using the Control Mouse Liver Total RNA and a hot lid thermal cycler optimal parameters may vary with different templates and thermal cyclers To determine the optimal number of cycles for your sample and conditions we strongly recommend that you perform a range of cycles 15 18 21 24 and 27 cycles Figure 5 To generate sufficient cDNA for PCR Select subtraction you should set up three 100 ul PCR reactions labeled A B and C for each tester and driver sample Figure 5 In our experience each PCR reaction will typically yield 1 3 ug of ds cDNA Subtraction usually requires 2 ug of driver cDNA so the three com bined tubes of SMARTer cDNA should produce sufficient cDNA taking
11. in the exponential phase of amplification When the yield of PCR products stops increasing with more cycles the reaction has reached its plateau Overcycled cDNA can result in a less representative probe Undercy cling on the other hand results in a lower yield of CDNA The optimal number of cycles for your experiment is one cycle fewer than is needed to reach the plateau Be conservative when in doubt it is better to use fewer cycles than too many Figure 4 provides an example of how your analysis should proceed In this experiment the PCR reached its plateau after 24 cycles for the 2 ng experiment and 21 cycles for the 50 ng experiment that is the yield of PCR products stopped increasing After 24 and 21 cycles a smear appeared in the high molecular weight region of the gel indicating that the reactions were overcycled Therefore the optimal number of cycles would be 23 for the 2 ng experiment and 20 for the 50 ng experiment We have optimized the PCR cycling parameters presented in this User Manual using a hot lid thermal cy cler and the Advantage 2 PCR Kit Cat Nos 639206 amp 639207 These parameters may vary with different polymerase mixes templates and thermal cyclers We strongly recommend that you optimize the number of PCR cycles with your experimental sample s and the Control Mouse Liver Total RNA Try different num bers of cycles then analyze your results by electrophoresing 5 ul of each product on a 1 2 agarose EtBr ge
12. of intensities of these bands should be 1 5 2 5 1 For more information see Sambrook amp Russell 2001 3 Formaldehyde agarose gel visualization with SYBR Green or SYBR Gold One drawback of visualizing RNA with Ethidium Bromide is the amount of sample required Alterna tive dyes such as SYBR Green II or SYBR Gold Invitrogen CA allow you to detect as little as 1 or 2 ng of RNA using SYBR Gold and SYBR Green Il respectively These dyes are especially useful if you have a limited amount of RNA 4 Detection with the Agilent 2100 BioAnalyzer Agilent Technologies CA This microfluidics based technology which provides an alternative to traditional gel based analysis requires only 10 ng of RNA per analysis In addition to assessing RNA quality this automated system provides a good estimate of RNA concentration Methods for Assessing mRNA Integrity All of the methods mentioned above can be used to assess the quality of your mRNA However be cause mRNA does not contain strong ribosomal bands the assessment of its quality will be somewhat subjective Typically mRNA appears as a smear between 0 5 kb to 6 kb with an area of higher intensity around 1 5 and 2 kb This size distribution may be tissue or species specific If the average size of your mRNA is lower than 1 5 kb it could be an indication of degradation www clontech com Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual
13. sssaannnneeeennaneennnnnernnnnerrnnnnnrntnnanentnnnnennnnnennnnnnennanneennnnneennnn aii 9 A General Considerations ccccscsssssesessescsescseeseseeaeseeaeseeaesceaeeecaesecaeeecaseecaseecaesaeaeeaeaeeaeneaeeneasereaseneaee 10 B PROTOCOL First Strand CDNA Synthesis c cscccsssseseesesescneescneeseneeseneeseeeaeeeeseecneeecneeeeneeeeneees 10 C PROTOCOL cDNA Amplification by LD PCR uw ee eesesesesseceseeesseeeeceeseseseeseseacaeeasecaeeeeesesateceees 12 VI Analysis of cDNA Amplification Results ccccecccsscsseeeeeseneessseseessneesseeeeseesseeesoneeeneneaes 16 VII Troubleshooting Guide sic ccccssceces cecsssie sec cssceid cosasstigeciescccbecescvactiteeevuscbecteevactbeceseuuubeccneeesteconeees 17 VIN RePGrenGes i iisiicses cccceesseciacescseesscetcaccasocenstcaseeeesczssenseceesscoesatedscbeaapea sae saseasesecvstd veces saneeaaozesees sees 18 Appendix A Protocols for PCR Select 0 cccccccscscceeeeesceeeeeeeeseeeeeeeescneaeseeesseaeeseensseaeeeeensaaaes 19 A Additional Materials Requited sissies icc chesi innige ls aisoinnrmaiensoienieneuiusiananaieens 19 B PROTOCOL cDNA Amplification by LD PCR ce eeeseeesseseeesenceececneseeseeaesensaeaeeenseeeesneneeesaes 19 C PROTOCOL Column Chromatography eccccssesesesssesssseseseseeceececsseeeecesaeeeeeeaeseaenseaeecseaeeesesareceees 22 De PROTOCOL Real Digestiotis ieccsccossssosresosscsaszes sovesisscedpessiseusesegsapepssescssessves sveedesses speed apesedpepsape det
14. starting sample of total or poly At RNA For best results we strongly recommend that you use the NucleoSpin RNA II Kit see Section II for ordering information to isolate highly pure RNA from cells tissues or biological fluids See Section IV B RNA Isolation Prior to cDNA synthesis please make sure that your RNA is intact and free of contaminants see Section IV D Assessing the Quality of the RNA Template Do not change the size volume of any of the reactions All components have been optimized for the volumes specified The first time you use this kit you should perform cDNA synthesis with the Control Mouse Liver Total RNA provided in the kit in parallel with your experimental sample Performing this control synthesis at least once will verify that all components are working properly and will also help you troubleshoot any problems that may arise For each sample and Control Mouse Liver Total RNA combine the following reagents in separate 0 5 ml reaction tubes 1 3 5 ul RNA 1 ng 1 ug of poly At RNA or 2 ng 1 yg total RNA 1 ul 3 SMART CDS Primer IIA 12 UM x ul Deionized H O 4 5 ul Total Volume For the control synthesis add 1 ul 1 ug l of Control Mouse Liver Total RNA PCR Select users should start with gt 10 ng of total RNA www clontech com Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual V SMARTer cDNA Synthesis continued Recipe BREAK Clont
15. ul of matrix discard it and use another column If the size distribution of your sample and or control cDNA is not reduced after Rsal digestion yourTNE buffer mix may be suboptimal Failure of Rsal Digestion Appendix A Section D Check the recipe forTNE buffer If you used the correct recipe for TNE buffer perform phenol chloroform extraction and ethanol precipitation then repeat the Rsal digestion Loss of cDNA during purification Troubleshoot your purification procedure Loss of cDNA during ethanol Low yield of cDNA after TANAN precipitation purification of digested cDNA Appendix A Section E Check the volumes of the ammonium acetate and ethanol Repeat purification and ethanol precipitation Your PCR did not reach the plateau i e the reaction was undercycled Perform more PCR cycles Optimize the number of cycles as described in Appendix A Section B Protocol No PT4097 1 Version No 013012 27 Clontech Laboratories Inc www clontech com ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual Appendix B Virtual Northern Blots Protocol No PT4097 1 Version No 28 013012 After cloning your subtracted cDNA fragments you should confirm that they represent differentially ex pressed genes Typically this is accomplished by hybridization to Northern blots of the same RNA samples used as driver and tester for subtraction If however y
16. 4 with the remaining 15 ul of PCR mixture g Transfer 5 ul from the 24 cycle PCR to a clean microcentrifuge tube for agarose EtBr gel analysis h Run three additional cycles for a total of 27 with the remaining 10 ul of PCR mixture www clontech com Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual Appendix A Protocols for PCR Select continued 300 uI PCR reaction mix J 100 pl 100 pl 100 ul Tube A Tube B Tube C 15 PCR cycles 15 PCR cycles 15 PCR cycles O 9 Experimental tube Optimization tube v v v v store at4 C storeat4 C store at 4 C remove 5 ul aliquot 3 PCR cycles 18 total Yo remove 5 ul aliquot 3 PCR cycles 21 total remove Syl aliquot 3 PCR cycles 24 total remove Syl aliquot 3 PCR cycles 27 total v remove 5 ul aliquot Vv Run aliquots ona Y M Y 1 2 agarose EtBr gel Run additional PCR cycles lt _ Determine optimal to achieve optimal number number of PCR cycles Section VI Figure 4 Combine amp Use for PCR Select Digestion and Purification Steps Figure 5 Optimizing PCR parameters for SMARTer cDNA synthesis for use with Clontech PCR Select Clontech Laboratories Inc www clontech com Protocol No PT4097 1 ATakara Bio Company Version No 013012 21 SMARTer PCR cDNA Synthesis Kit User Manual Appendix A Protocols for PCR Select continued Protocol No PT4097 1
17. 61 1167 Zhu Y Y Machleder E M Chenchik A Li R amp Siebert P M 2001 Reverse transcriptase template switching A SMART approach for full length cDNA library construction Bio Techniques 30 892 897 www clontech com Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual Appendix A Protocols for PCR Select e Attention P PROTOCOL Clontech Laboratories Inc ATakara Bio Company PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING The following modified SMARTer cDNA synthesis protocol allows you to use your cDNA di rectly for PCR Select cDNA Subtraction Clontech s PCR Select cDNA Subtraction Kit Cat No 637401 offers an efficient method for selectively amplifying differentially expressed genes those genes expressed in one mRNA population but reduced or absent in another IMPORTANT The minimum amount of starting material for PCR Select cDNA synthesis is 10 ng of total RNA However if your RNA sample is not limiting we recommend that you start with 20 1 000 ng of total RNA for cDNA synthesis A Additional Materials Required The following materials are required for PCR Select but are not supplied e Phenol chloroform isoamyl alcohol 25 24 1 Prepare as follows 1 Melt phenol 2 Equilibrate with an equal volume of sterile buffer 50 mM Tris pH 7 5 150 mM NaCl 1 mM EDTA 3 Incubate the mixture at room temperature for 2 3
18. DNA by LD PCR with PCR primer mmm Double stranded cDNA ss 7 eEE S Figure 1 Flowchart of SMARTer cDNA synthesis The SMARTer II A Oligonucleotide 3 SMART CDS Primer II A and 5 PCR Primer II A all contain a stretch of identical sequence see Section for sequence information SMARTer cDNA Synthesis Allcommonly used cDNA synthesis methods rely on the ability of reverse transcriptase RT to transcribe mRNA into single stranded ss DNAin the first strand reaction However because RT cannotalwaystranscribethe entire mRNA sequence the 5 ends of genes tend to be underrepresented in cDNA populations Inthe absence of RNA degradation truncated cDNA molecules presentin libraries are often due to the tendency of RT to pause before transcription is complete In contrast the SMARTer method is able to preferentially enrich for full length cDNAs SMARTer cDNA synthesis starts with nanogram amounts of total RNA A modified oligo dT primer the 3 SMART CDS Primer IIA primes the first strand synthesis reaction Figure 1 When SMARTScribe RT reaches the 5 end of the mRNA the enzyme s terminal transferase activity adds a few additional nucleotides to the 3 end of the cDNA The SMARTer Oligonucleotide patent pending base pairs with the non template www clontech com Protocol No PT4097 1 Version No 013012 5 SMARTer PCR cDNA Synthesis Kit User Manual ill Introduction amp Protocol Overview continued nucleo
19. Library Construction Kit These include the mammalian expression vector pEXP Lib Cat No 635003 and the retroviral expression vector pRetro Lib Cat No 635002 IV RNA Preparation amp Handling Clontech Laboratories Inc ATakara Bio Company A General Precautions The integrity and purity of your total or poly At RNA starting material is an important element in high quality cDNA synthesis The following precautions will help you avoid contamination and degradation of your RNA e Wear gloves throughout the procedure to protect your RNA samples from degradation by nucleases e Use freshly deionized e g MilliQ grade H O directly without treatment with DEPC diethyl pyro carbonate e Rinse all glassware with 0 5 N NaOH followed by deionized H O Then bake the glassware at 160 180 C for 4 9 hr e Use only single use plastic pipettes and pipette tips e Ethidium bromide is a carcinogen Use appropriate precautions when handling and disposing of this reagent For more information see Molecular Cloning A Laboratory Manual by Sambrook amp Russell 2001 B RNA Isolation Clontech offers several kits for isolating total or poly At RNA from a variety of sources The NucleoBond RNA DNA Kit contains AX R tips to isolate total RNA from tissue or cells without using phenol or chloroform With the NucleoSpin RNA II Kit you can isolate highly pure total RNA from cells tissues or cell free biological fluids without phenol chloro
20. R is a registered trademark of Molecular Probes Inc Clontech the Clontech logo Advantage CHROMA SPIN In Fusion PCR Select SMART SMARTer and SMARTScribe are trademarks of Clontech Laboratories Inc All other marks are the property of their respective owners Certain trademarks may not be registered in all jurisdictions Clontech is aTakara Bio Company 2012 Clontech Laboratories Inc This document has been reviewed and approved by the Clontech Quality Assurance Department www clontech com Clontech Laboratories Inc ATakara Bio Company
21. V SMARTer cDNA Synthesis PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Use the following protocol for generating cDNA with Clontech s simple and highly efficient SMARTer technology This protocol is designed for synthesizing SMARTer cDNA for a variety of applications OTHER THAN LIBRARY CONSTRUCTION IMPORTANT This protocol is designed for synthesizing SMARTer cDNA for applications other than library construction such as PCR Select cDNA Subtraction See Appendix A or Virtual Northern Blots See Appendix B To synthesize SMART cDNA for library construction use our Attention SMART cDNA Library Construction Kit Cat No 634901 or In Fusion SMARTer Directional cDNA Library Construction Kit Cat No 634933 If you plan to use cDNA generated by the SMARTer method with our PCR Select cDNA Sub traction protocol please refer to the procedure provided in Appendix A before performing first strand cDNA synthesis In addition we recommend reading the User Manual for cDNA Subtraction PT1117 1 A different RNA control is supplied with Clontech s PCR Select cDNA Subtraction Kit that should be used to synthesize cDNA according to the PCR Select User Manual a non SMARTer method In addition use the control provided in this kit to trouble shoot any problems using the SMARTer protocol For more information about using these controls see Appendix A of this User Manual If you decide that you want to use your SMARTer cDNA for cons
22. ate cDNAs that were preferentially expressed in cells producing y globin 1 ug of total RNA from cells producing y globin was used as tester 1 ug of total RNA from cells producing B globin was used as driver Tester and driver cDNAs were synthesized using the SMART PCR cDNA Synthesis Kit and were subjected to PCR Select subtraction 84 subtracted cDNA clones were arrayed on a nylon membrane for differential screening 13 of these subtracted cDNAs showed differential signals and were therefore candidates for further analysis by Virtual Northern blots Differential expression of all 13 clones was confirmed four examples are shown in this figure Virtual Northern blots were prepared using the same SMART PCR amplified cDNA that was used for subtraction Each lane contains 0 5 ug of SMART cDNA Subtracted cDNA fragments y 1 y 2 y 3 and y 4 were labeled with 32P dCTP and hybridized to the Virtual North ern blots Hybridization with G3PDH serves as a control for loading Lane y Cells producing y globin Lane p Cells producing B globin www clontech com Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual Appendix C Protocol for Non Directional Cloning of SMARTer cDNA P PROTOCOL G ZA Clontech Laboratories Inc ATakara Bio Company We recommend the following procedure for polishing the ends of SMARTer cDNAs for constructing libraries A Additional Materials Required The following mate
23. brary construction protocol NOTE This preparation of blunt ended cDNA may now be ligated to any adaptor you choose Consult your protocol for cDNA library construction www clontech com Protocol No PT4097 1 Version No 013012 29 SMARTer PCR cDNA Synthesis Kit User Manual Notes Protocol No PT4097 1 Version No 30 013012 Contact Us For Assistance Customer Service Ordering Technical Support Telephone 800 662 2566 toll free Telephone 800 662 2566 toll free Fax 800 424 1350 toll free Fax 650 424 1064 Web www clontech com Web www clontech com E mail orders clontech com E mail tech clontech com Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without prior written approval of Clontech Laboratories Inc Your use of this product is subject to compliance with any applicable licensing requirements described on the product s web page at http www clontech com It is your responsibility to review understand and adhere to any restrictions imposed by such statements HiScanSQ HiSeq and Illumina are trademarks or registered trademarks of Illumina Inc SYB
24. c ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual ill Introduction amp Protocol Overview continued run allows you to annotate coding SNPs discover transcript isoforms characterize splice junctions and determine the relative abundance of transcripts from even the smallest samples e SMARTer cDNA Synthesis for Rapid Amplification of cDNA Ends RACE The SMARTer cDNA synthesis method is also optimized for rapid amplification of cDNA ends RACE Matz et al 1999 The SMARTer RACE cDNA Amplification Kits Cat Nos 634923 amp 634924 allow researchers to synthesize first strand cDNA and facilitate both 5 and 3 RACE using either poly At RNA or total RNA Clontech Also Offers SMART cDNA Library Construction Kits Clontech offers a number of kits that feature SMART technology The SMART cDNA Library Construction Kit Cat No 634901 includes the components for directional cloning of full length cDNA Please note that cDNA generated using the SMART cDNA Library Construction Kit cannot be used for PCR Select cDNA sub traction Clontech also offers another SMART library construction kit the In Fusion SMARTer Directional cDNA Library Construction Kit Cat No 634929 that allows creation of cDNA libraries in any vector starting from as little as 2 ng of total RNA There are also several vectors sold separately that can be used with the SMART cDNA Library Construction Kit or the In Fusion SMARTer Directional cDNA
25. e 23 E PROTOCOL Purification of Digested cDNA wo eeccecscssseseseeseenseseseseneeesecsenesetenaeaeeeeeasseneeeeeseenes 23 E Controls for PCR Select CDNA Subtraction cccessssessescseesceescseeecseeaeseeaeaeeaeeeaeeeeaeeecaesecaeeeeateeeneees 25 G Analysis of Results of SMARTer PCR cDNA Synthesis for PCR Select cDNA Subtraction 25 H Troubleshooting ricis ana E EEA EE EEEE EE 27 Appendix B Virtual Northern BlotS onnnensenennennnnennnnunnnensrnnnrenerennnrnnnrrnnrernnrnnnnrnnnnrnnnnrennnnnne 28 Appendix C Protocol for Non Directional Cloning of SMARTer cDNA cccsseceeeeeseeees 29 A Additional Materials Requited 2c csiisci scisiiperccstestanves ee E a E EAER 29 B PROTOCOL dsDNA Polishing sisissisissiskoinsins eienn naea ire tiaara ia E eai 29 List of Figures Figure 1 Flowchart of SMARTer cDNA synthesis ceseescseesssesesesesseseecssceececaesececersesenseavseseneeeseeateesesenas 5 Figure 2 Guide to using the SMARTer cDNA synthesis protocol for PCR Select cDNA Subtraction Virtual Northerns Non Directional Cloning amp Library Construction and other applications 9 Figure 3 Optimizing PCR parameters for SMARTer cDNA synthesis 0 0 csscsseeseseseseseeseseecseeeeeeeeareeeees 15 Figure 4 Analysis for optimizing PCR parameters sccscsssessssesssessecesceesseceeceeaeecsesaeseaceeasecseaceesesanaceees 16 Figure 5 Optimizing PCR parameters for SMARTer cDNA synthesis for use with Clont
26. ech Laboratories Inc ATakara Bio Company Mix contents and spin the tubes briefly in a microcentrifuge Incubate the tubes at 72 C in a hot lid thermal cycler for 3 min then reduce the temperature to 42 C for 2 min NOTE The initial reaction steps Step 4 6 are critical for first strand synthesis and should not be delayed after Step 3 You can prepare your master mix for Step 4 while your tubes are incubating Step 3 in order to jump start the cDNA synthesis Prepare a Master Mix for all reaction tubes at room temperature by combining the following re agents in the order shown 2 ul 5X First Strand Buffer 0 25 ul DTT 100 mM 1 ul dNTP Mix 10 mM 1 ul SMARTer IIA Oligonucleotide 12 uM 0 25 ul RNase Inhibitor 1 ul SMARTScribe Reverse Transcriptase 100 U 5 5 ul Total Volume added per reaction Add the reverse transcriptase to the master mix just prior to use Mix well by pipetting and spin the tube briefly in a microcentrifuge Aliquot 5 5 ul of the Master Mix into each reaction tube Mix the contents of the tubes by gently pipetting and spin the tubes briefly to collect the contents at the bottom Incubate the tubes at 42 C for 1 hour NOTE If you plan to use a downstream application that requires full length cDNAs extend the incubation time to 90 min Terminate the reaction by heating the tubes at 70 C for 10 min Dilute the first strand reaction product by adding the appropriate v
27. ech PCR Select sssaihvsidinuiadiciadisisauiaiindsaniiideisndinsciaiiauaneraianne 21 Figure 6 Virtual Northern blot analysis of cDNA fragments expressed in cells producing y globin 28 List of Tables Table I Guidelines for Setting Up PCR Reactions iccesscssseeeseesesenseceseecnseesecsesesesesaeseeeeeaseeaeeeeeseeaes 12 Table II Cycling Guidelines Based on Starting Material ccc csesessesssesesseseecsesseecesasseeesesasseseeeatecneaes 13 Table HI Troubleshooting Guide for First Strand cDNA Synthesis amp SMARTer PCR Amplification 17 Table IV Troubleshooting Guide for Preparing SMARTer cDNA for Subtraction eieeeeseeseeeeeeeees 27 Protocol No PT4097 1 www clontech com Clontech Laboratories Inc Version No 013012 ATakara Bio Company 2 I List of Components Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual SMARTer PCR cDNA Synthesis Kit Cat No Cat No 634925 634926 10 rxns 20 rxns Box 1 e 10 ul 20 ul e 5 ul 5 ul Box 2 e 10 ul 20 ul e 200 ul 400 ul e 404ul 80 ul e 100 ul 200 ul e 50ul 50 ul e 10 ul 10 ul e 12 ul 25 ul e 1ml 1ml Box 3 e 10 20 Storage Conditions SMARTer II A Oligonucleotide 12 uM 5 AAGCAGTGGTATCAACGCAGAGTACXXXXX 3 Rsa I X undisclosed base in the proprietary SMARTer oligo sequence Control Mouse Liver Total RNA 1 yg ul 3 SMART CDS Primer IIA 12 uM 5 AAGCAGTG GTATCAACGCAGAGTACT N_ N 3 Rsa I
28. emove 5 ul aliquot 3 PCR cycles 18 total remove 5 ul aliquot 3 PCR cycles 21 total M remove 5 ul aliquot 3 PCR cycles 24 total y remove 5 ul aliquot 3 PCR cycles 27 total y remove 5 ul aliquot v Run aliquots on a 1 2 agarose EtBr gel Run additional PCR cycles 4 Determine optimal to achieve optimal number number of PCR cycles Section VI Figure 4 Figure 3 Optimizing PCR parameters for SMARTer cDNA synthesis Clontech Laboratories Inc www clontech com Protocol No PT4097 1 ATakara Bio Company Version No 013012 15 SMARTer PCR cDNA Synthesis Kit User Manual VI Analysis of cDNA Amplification Results Figure 4 shows a typical gel profile of ds cDNA synthesized using the Control Mouse Liver Total RNA for SMARTer cDNA synthesis and amplification In general cDNA synthesized from mammalian total RNA should appear on a 1 2 agarose EtBr gel as a moderately strong smear from 0 5 to as high as 5 kb with some distinct bands The number and position of the bands you obtain will be different for each particular total RNA used Furthermore cDNA prepared from some mammalian tissue sources e g human brain spleen and thymus may not display bright bands due to the very high complexity of the RNA For the best results you must optimize the PCR cycling parameters for your experiment as described in Section V C Figure 3 Choosing the optimal number of PCR cycles ensures that the ds cDNA will remain
29. form extractions The NucleoTrap mRNA Mini Kit combines a spin column filter with oligo dT latex bead technology to isolate high quality mRNA from total RNA in less than 30 minutes For more RNA isolation kits visit the Clontech website at www clontech com Many procedures are available for the isolation of poly A RNA Farrell 1993 Sambrook et al 1989 www clontech com Protocol No PT4097 1 Version No 013012 7 SMARTer PCR cDNA Synthesis Kit User Manual IV RNA Preparation amp Handling continued Protocol No PT4097 1 Version No 8 013012 C RNA Purity The purity of RNA is the key factor for successful cDNA synthesis and SMARTer cDNA Amplification The presence of residual organics metal ions salt or nucleases in your RNA sample could have a large impact on downstream applications by inhibiting enzymatic activity or degrading the RNA We strongly recommend checking the stability of your RNA to ensure that it is free of contaminants To test the stability of your RNA incubate a small portion of it at 37 C for 2 hours then compare the sample to a duplicate control stored at 70 C If the sample incubated at 37 C shows a lower 28S 18S ratio than the control or the RNA shows a significant downward shift on a formaldehyde agarose gel the RNA may have nuclease contaminants see Section IV D for methods for assessing RNA quality Impurities such as salt or organic contaminants can be removed by repeated ethanol preci
30. fy full length cDNAs with a significantly lower error rate than that of conventional PCR Barnes 1994 NucleoSpin RNA II Kit Cat Nos 740955 10 740955 20 740955 50 amp 740955 250 We strongly recommend the use of the NucleoSpin RNA II Kit for RNA purification We have found that cells or tissues frozen in RA1 buffer are better preserved resulting in the isolation of higher quality RNA The RA1 buffer which contains guanidinium isothiocyanate protects cellular RNA by inactivating RNases The higher quality of RNA reduces the number of cycles required to reach the optimal SMARTer cDNA amplification level resulting in a more representative cDNA pool Additional Buffer RA1 Cat No 740961 can be purchased separately NucleoSpin Extract Il Cat Nos 740609 10 740609 50 amp 740609 250 We strongly recommend use of NucleoSpin Extract II for PCR product purification Easy Dilution Solution Cat No TAK 9160 We recommendTakara s Easy Dilution Solution for RNA template dilution Clontech Cat No TAK 9160 TE buffer 10 mM Tris HCl pH 8 0 0 1 mM EDTA 8 mercaptoethanol Sigma Cat No M6250 DNA size markers 1 kb DNA ladder 50X TAE electrophoresis buffer 242 0 g Tris base 57 1 ml glacial acetic acid 37 2 g Na EDTA 2H O x ml Add H O to 1L NOTE If you plan to use the SMARTer method to generate cDNA for use with PCR Select please see Appendix A for specific materials required for that application www clontech com Clon
31. he following reagents in the order shown 74 ul Deionized H O 10 ul 10X Advantage 2 PCR Buffer 2 ul 50X dNTP Mix 10 mM 2 ul 5 PCR Primer IIA 12 uM Recipe 2 ul 50X Advantage 2 Polymerase Mix 90 ul Total Volume per reaction 4 Mix well by vortexing and spin the tube briefly in a microcentrifuge 5 Aliquot 90 ul of the PCR Master Mix into each tube from Step 2 6 Cap the tube and place it in the preheated thermal cycler If you are NOT using a hot lid thermal cycler overlay the reaction mixture with two drops of mineral oil IMPORTANT Typical cycle numbers are provided as a rough guide for those working with extremely small amounts of RNA We strongly recommend that you perform a range of cycles to determine the optimal number of cycles for your sample and cycling conditions o Attention Table Il Cycling Guidelines Based on Starting Material No of Cells Typical Yield of Typical No of e g HeLa Total RNA ng PCR Cycles 10 0 15 27 100 1 5 24 1 000 15 20 10 000 150 18 We recommend that you do not use the cDNA equivalent of more than 100 ng of reverse transcribed RNA in a single PCR reaction See Table for dilution guidelines 7 Commence thermal cycling using the following program e 95 C 1 min e X cycles 95 C 15 sec 65 C 30 sec 68 C 3 min Consult Table for guidelines Subject all tubes to 15 cycles Then divide the PCR react
32. he pellets for 5 10 min 21 Dissolve the pellet in 6 7 ul of IX TNE buffer 22 Transfer 1 2 yl to a clean 1 5 ml microcentrifuge tube containing 11 ul of deionized H O label this tube Sample G and store the remaining sample at 20 C Use 10 ul of the diluted DNA to assess the yield of DNA by UV spectrophotometry For each reaction we usually obtain 1 3 ug of SMART er cDNA after purification For two tubes you should obtain a total of 2 6 ug of cDNA If your yield is lower than this perform the agarose EtBr gel analysis described in Appendix A Section G 4 23 If your DNA concentration is gt 300 ng ul dilute your cDNA to a final concentration of 300 ng ul in 1XTNE buffer and follow the adaptor ligation step in accordance with the PCR Select cDNA sub traction protocol 24 Your digested ds cDNA is now ready for adaptor ligation as described in Section IV F of the User Manual for our PCR Select cDNA Subtraction Kit Cat No 637401 Be sure to read Section F for important cDNA subtraction control procedures www clontech com Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual Appendix A Protocols for PCR Select continued Clontech Laboratories Inc ATakara Bio Company F Controls for PCR Select cDNA Subtraction We strongly recommend that you perform the following control subtractions Please refer to Section IV of the PCR Select User Manual 1 Control subtraction using
33. icroarray experiments Ohtsu et al 2008 Nygaard et al 2006 Wilhelm et a 2006 SMART technology enables researchers to synthesize highly sensi tive array probes from minimal starting material Gonzalez et al 1999 Livesey et al 2000 Using the SMARTer method probes made from small amounts of total RNA produce results that are comparable to those from pure poly At RNA a clear advantage when only limited amounts of tissues or cells are available SMARTer cDNA Synthesis for Next Generation Sequencing SMARTer cDNA synthesis has proven very useful for generating samples for various next generation sequencing platforms Cheung et al 2006 Morin et al 2008 Andreas et al 2007 The SMARTer Ultra Low RNA Kit for IIlumina Sequencing provides a simple and efficient solution for generating librar ies from total RNA that are compatible with Illumina s Genome Analyzer HiScanSQ and HiSeq instruments facilitating transcriptome analysis from as little as 100 pg of input RNA The integration of Clontech s SMART technology with Illumina sequencing has resulted in the most sensitive sample preparation workflow offered by any next generation sequencing NGS platform The combination of SMART technology s ability to handle very small quantities of RNA and the Illumina sequencing plat form s capacity for single and paired end sequencing of millions to billions of long and short reads per www clontech com Clontech Laboratories In
34. into account any loss from column chromatography three tubes will also be ample for the tester To ensure that you have sufficient cDNA you should estimate the yield of SMARTer cDNA by UV spectrophotometry www clontech com Protocol No PT4097 1 Version No 013012 19 SMARTer PCR cDNA Synthesis Kit User Manual Appendix A Protocols for PCR Select continued Protocol No PT4097 1 Version No 20 Recipe 013012 1 2 Ny 9 o SF Preheat the PCR thermal cycler to 95 C For each experimental sample aliquot 30 ul cDNA from Step V B 9 into a labeled 1 5 ml reaction tube Prepare enough Master Mix for all PCR reactions and 1 extra reaction to ensure sufficient volume Combine the following reagents in the order shown 222 ul Deionized H O 30 ul 10X Advantage 2 PCR Buffer 6 ul 50X dNTP Mix 10 mM in Advantage 2 PCR Kit 6 ul 5 PCR Primer IIA 12 uM 6 ul 50X Advantage 2 Polymerase Mix 270 ul Total Volume per reaction Mix well by vortexing and spin the tube briefly in a microcentrifuge Aliquot 270 ul of the PCR Master Mix into each tube from Step 2 Mix well Aliquot 100 ul of the resulting PCR reaction mix into three reaction tubes labeled Ay BY and C Cap each tube and place them in the preheated thermal cycler If you are NOT using a hot lid ther mal cycler overlay the reaction mixture with two drops of mineral oil Commence thermal cycling using the following program
35. ion mix between the Experimental and Optimization tubes using the Optimization tube for each reaction to determine the optimal number of PCR cycles as described in Step 8 Store the Experimental tubes at 4 C gt For applications requiring longer cDNA transcripts increase to 6 min Clontech Laboratories Inc www clontech com Protocol No PT4097 1 ATakara Bio Company Version No 013012 13 SMARTer PCR cDNA Synthesis Kit User Manual V SMARTer cDNA Synthesis continued Protocol No PT4097 1 Version No 14 013012 8 Subject each reaction tube to 15 cycles then pause the program Transfer 30 ul from each tube to a second reaction tube labeled Optimization Store the Experimental tubes at 4 C Using the Tester PCR tube determine the optimal number of PCR cycles see Figure 3 a Transfer 5 ul from the 15 cycle PCR reaction tube to a clean microcentrifuge tube for agarose EtBr gel analysis b Return the Optimization tubes to the thermal cycler Run three additional cycles for a total of 18 with the remaining 25 ul of PCR mixture c Transfer 5 ul from the 18 cycle PCR reaction tube to a clean microcentrifuge tube for agarose EtBr gel analysis d Run three additional cycles for a total of 21 with the remaining 20 ul of PCR mixture e Transfer 5 ul from the 21 cycle PCR to a clean microcentrifuge tube for agarose EtBr gel analysis f Run three additional cycles for a total of 24
36. it Before you start Add 95 ethanol to the Wash Buffer NT3 concentrate for a final concentration of ap proximately 85 The appropriate volume is listed on the Buffer NT3 bottle 1 Aliquot the Rsal digested cDNA Appendix A Section D 6 above into two clean 1 5 ml microcentri fuge tubes approximately 170 ul in each tube Vortex the NucleoTrap Suspension thoroughly until the beads are completely resuspended Add 680 ul of Buffer NT2 and 17 ul of NucleoTrap Suspension to each tube of digestion mixture Incubatethe sample at room temperature for 10 min Mix gently every 2 3 min during the incubation period Oo BR wo N Centrifuge the sample at 10 000 x g for 1 min at room temperature Discard the supernatant www clontech com Protocol No PT4097 1 Version No 013012 23 SMARTer PCR cDNA Synthesis Kit User Manual Appendix A Protocols for PCR Select continued Protocol No PT4097 1 Version No 24 013012 6 Add 680 ul of Buffer NT2 to the pellet Mix gently to resuspend Centrifuge at 10 000 x g for 1 min at room temperature Remove the supernatant completely and discard 7 Add 680 ul of Buffer NT3 to the pellet Mix gently to resuspend Centrifuge the sample at 10 000 x g for 1 min at room temperature Remove the supernatant completely and discard 8 Repeat Step 7 9 Air dry the pellet for 15 min at room temperature or at 37 C to speed up evaporation NOTE Do not use a speed vac to dry
37. l in 1X TAE buffer 50 ng 2ng cycles 18 21 24 27 18 21 2427 M Figure 4 Analysis for optimizing PCR parameters 2 ng or 50 ng of the Control Mouse Liver Total RNA was subjected to first strand cDNA synthesis and purification as described in the protocol 10 ul was used for PCR amplification A range of PCR cycles were per formed 18 21 24 and 27 5 ul of each PCR product was electrophoresed on a 1 2 agarose EtBr gel in 1X TAE buffer following the indicated number of PCR cycles The optimal number of cycles determined in this experiment was 23 for the 2 ng reaction and 20 for the 50 ng reaction Lane M 1 kb DNA ladder size markers Protocol No PT4097 1 Version No 16 013012 www clontech com Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual VII Troubleshooting Guide Clontech Laboratories Inc ATakara Bio Company PROBLEM Low molecular weight size distribution lt 3 kb with a majority between 500 200 bp poor yield or no PCR product observed for the Control Mouse Liver Total RNA Poor yield or truncated PCR product from your experimental RNA Table Ill Troubleshooting Guide for First Strand cDNA Synthesis amp SMARTer PCR Amplification RNAs may have degraded during storage and or first strand synthesis Poor quality RNA starting material will reduce the ability to obtain full length cDNAs SOLUTION RNA must be stored at 70 C You
38. ld from bacteriophage tem plates Proc Natl Acad Sci USA 91 2216 2220 Borson N D Sato W L amp Drewes L R 1992 A lock docking oligo dT primer for 5 and 3 RACE PCR PCR Methods Applic 2 144 148 Chenchik A Moqadam F amp Siebert P January 1995 Marathon cDNA amplification A new method for cloning full length cDNAs Clontechniques X 1 5 8 Chenchik A Moqadam F amp Siebert P 1996 A new method for full length cDNA cloning by PCR In A Laboratory Guide to RNA Isolation Analysis and Synthesis Ed Krieg P A Wiley Liss Inc pp 273 321 Chenchik A Zhu Y Diatchenko L Li R Hill J amp Siebert P 1998 Generation and use of high quality cDNA from small amounts of total RNA by SMART PCR In RT PCR Methods for Gene Cloning and Analysis Eds Siebert P amp Larrick J BioTechniques Books MA pp 305 319 Cheng S Fockler C Barnes W M amp Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 5695 5699 Cheung F Haas B J Goldberg S May G D Xiao Y amp Town C D 2006 Sequencing Medicago truncatula expressed sequenced tags using 454 Life Sciences technology BMC Genomics 7 272 Chou Q Russell M Birch D Raymond J amp Bloch W 1992 Prevention of pre PCR mispriming and primer dimeriza tion improves low copy number amplifications Nucleic Acids Res 20 1717 1723
39. n 1 5 ml tube 5 Add 700 ul of n butanol and vortex the mix thoroughly Butanol extraction allows you to concen trate your PCR product to a volume of 40 70 ul NOTE Addition of too much n butanol may remove all the water and precipitate the nucleic acid If this happens add water to the tube and vortex until an aqueous phase reappears 6 Centrifuge the solution at room temperature at 14 000 rpm for 1 min 7 Remove and discard the upper n butanol organic phase 8 If you do not end up with a volume of 40 70 ul repeat steps 6 7 with the same volume of n butanol NOTE If your volume is lt 40 ul add H20 to the aqueous phase to adjust volume to 40 70 ul 9 Invert a CHROMA SPIN TE 1000 column several times to completely resuspend the gel matrix NOTE Check for air bubbles in the column matrix If bubbles are visible resuspend the matrix in the column buffer by inverting the column again 10 Remove the top cap from the column and then remove the bottom cap 11 Place the column into a 1 5 ml centrifuge tube or a 17 x 100 mm tube 12 Discard any column buffer that immediately collects in the tube and add 1 5 ml of 1X TNE buffer 13 Let the buffer drain through the column by gravity flow until you can see the surface of the gel beads in the column matrix 14 Discard the collected buffer and proceed with purification 15 Carefully and slowly apply the sample to the center of the gel bed s flat surface Do not allow any sample
40. n typically yields 1 3 ug of ds cDNA after the PCR and purification steps Sections C and D To ensure that you have sufficient cDNA for your application you should estimate the yield of SMARTer cDNA by UV spectrophotometry IMPORTANT Table I Guidelines for Setting Up PCR Reactions Volume of Diluted ss cDNA for PCR pl 1 Typical Optimal TotaliRNA ng No of PCR Cycles 1000 18 20 250 4 18 20 50 10 19 21 10 10 21 23 2 10 23 25 Volume of Diluted ss cDNA Typical Optimal PAA RINA aa No of PCR Cycles for PCR pl 500 2 15 17 100 4 15 17 20 10 16 18 5 10 18 20 10 20 22 From Step V B 9 Optimal parameters may vary with different templates and thermal cyclers To determine the optimal number of cycles for your sample and conditions we strongly recommend that you perform a range of cycles 15 18 21 24 and 27 cycles 1 Preheat the PCR thermal cycler to 95 C 2 For each reaction aliquot the appropriate volume seeTable above of each diluted first strand cDNA into a labeled 0 5 ml reaction tube If necessary add deionized H O to adjust the volume to 10 ul www clontech com Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual V SMARTer cDNA Synthesis continued 3 Prepare a PCR Master Mix for all reactions plus one additional reaction Combine t
41. olume of TE buffer 10 mMTris pH 8 0 0 1 mM EDTA e Add 40 ul of TE buffer if you used total RNA as the starting material e Add 190 ul of TE buffer if you used more than 0 2 ug of poly A RNA as the starting material e Add 90 ul of TE buffer if you used less than 0 2 ug of poly A RNA as the starting material For PCR Select cDNA subtraction proceed with the protocols provided in Appendix A of this User Manual For all other applications proceed with Section C If necessary cDNA samples can be stored at 20 C for up to three months until you are ready to proceed with cDNA amplification Section C www clontech com Protocol No PT4097 1 Version No 013012 11 SMARTer PCR cDNA Synthesis Kit User Manual V SMARTer cDNA Synthesis continued C PROTOCOL cDNA Amplification by LD PCR Table provides guidelines for optimizing your PCR depending on the amount of total or poly At RNA used in the first strand synthesis These guidelines were determined using the Control Mouse Liver Total RNA and a hot lid thermal cycler optimal parameters may vary with different templates and thermal cyclers Additional guidelines based on the amount of starting material are also provided in Table Il P PROTOCOL Protocol No PT4097 1 Version No 013012 12 M Attention For each sample and control set up an extra reaction tube to determine the optimal number of PCR cycles In our experience each 100 ul reactio
42. ou have limited sample material you may wish to use Virtual Northern blots for analysis By using the same SMARTer PCR amplified tester and driver cDNA used for subtraction you can obtain information that is similar to that provided by standard Northern analysis Even if a cDNA does not give a single band when hybridized to a Virtual Northern blot you can still detect whether or not it is differentially expressed Multiple bands on aVirtual Northern blot may result from differ ent causes The cDNA may belong to a multi gene family or may contain a nucleotide repeat Alternatively a truncated copy of the gene may be present To distinguish between these possibilities analysis should also include other methods such as genomic DNA sequencing or RACE To prepare a Virtual Northern blot electrophorese your SMARTer PCR amplified cDNA before purification on an agarose EtBr gel and use a Southern transfer onto a nylon membrane see Sambrook amp Russell 2001 At Clontech we use theTurboblotter equipment and protocol from Schleicher amp Schuel Figure 6 shows how Virtual Northern blots can be used to confirm differential expression of subtracted cDNAs y 1 y 2 y 3 y 4 G3PDH kb y B kb y B kb y B kb y B 4 0 4 0 4 0 4 0 3 0 3 0 3 0 3 0 M 2 0 2 0 2 0 1 6 1 6 1 6 1 6 1 0 10 io 0 5 0 5 0 5 0 5 Figure 6 Virtual Northern blot analysis of cDNA fragments expressed in cells producing y globin PCR Select cDNA subtraction was per formed to isol
43. ows researchers to obtain clones of genes that are expressed in one population but not in the other When total RNA is used for cDNA synthesis by conventional methods ribosomal RNA is transcribed along with the poly A fraction even if synthesis is oligo dT primed If this cDNA is used with the PCR Select Kit the excess of ribosomal RNA and low concentration of cDNA corresponding to the poly A fraction results in inefficient subtractive hybridization However cDNA generated using the SMARTer PCR cDNA Synthesis Kit can be directly used for PCR Select subtraction even when total RNA is used as the starting material See Appendix A for more information on PCR Select cDNA Subtraction SMARTer cDNA Synthesis for Virtual Northern Blots and Probes SMARTer cDNA may also be useful for researchers who wish to analyze transcript size and expression patterns by hybridization but lack sufficient poly At or total RNA for Northern blots This is especially im portant for researchers who have isolated clones using the PCR Select Kit and who also need to confirm the differential expression of corresponding mRNAs Virtual Northern blots can be generated using SMARTer cDNA instead of total or poly At RNA Endege et al 1999 and can give information similar to that provided by standard Northern blots See Appendix B for more information on Virtual Northern blots SMARTer cDNA Synthesis for Array Probes SMART cDNA amplification has been widely used in m
44. pitation subse quent washing with 80 ethanol and the complete removal of all remaining ethanol If your RNA template is from a plant or some other species with high pigment levels please pay special attention to polysaccharide pigment contamination Polysaccharides pigments are hard to remove and can t be detected on the agarose gel These glycoproteins might interfere with primer binding sites of RNA during the first strand cDNA synthesis leading to reduced cDNA yield D Assessing the Quality of the RNA Template Methods for Assessing Total RNA Integrity 1 RNA cDNA Quality Assay The Clontech RNA cDNA Quality Assay Kit Cat No 636841 directly determines the quality of your human and mouse RNA and cDNA samples using reverse transcription RT and PCR Because this assay uses RT PCR it provides a direct functional test of your sample for its ability to produce full length cDNA for your application You achieve quick results using standard lab equipment and avoid inconvenient and toxic formaldehyde gels 2 Formaldehyde agarose gel visualization with Ethidium Bromide EtBr The integrity of total RNA can be visually assessed by the ratio of 28S 18S RNA on a denaturing formaldehyde agarose gel by staining with EtBr The theoretical 28S 18S ratio for eukaryotic RNA is approximately 2 1 For mammalian total RNA you should observe two bright bands at approximately 4 5 and 1 9 kb these bands represent 28S and 18S ribosomal RNA The ratio
45. r working area equipment and solutions must be free of con tamination by RNase For best results freeze cells tissue immediately following harvest in Buffer RA1 with an RNase inhibitor then use the NucleoSpin RNA II Kit to isolate RNA see Section II Additional Materials Required for ordering information You may have made an error during the procedure such as using a sub optimal incubation temperature or omitting an essential component The conditions and parameters for PCR may have been suboptimal The optimal number of PCR cycles may vary with different PCR machines polymerase mixes or RNA samples Carefully check the protocol and repeat the first strand synthesis and PCR with your sample and the control RNA Check the protocol and repeat the first strand synthesis and PCR If your RNA sample was prepared from a nonmammalian species the apparently truncated PCR product may actually have the normal size distribution for that species For example for insects the normal RNA size distribution may be lt 2 3 kb If you have not already done so electrophorese a sample of your RNA on a formaldehyde agarose EtBr gel to determine its concentration and analyze its quality see Section IV D Assessing the Quality of the RNATemplate for more details The concentration of your experi mental RNA is low but the quality is good Repeat the experiment using more RNA and or more PCR c
46. rials are required for ds cDNA polishing but are not supplied Proteinase K 20 ug ul Roche Applied Science Cat No 03 115 887 T4 DNA Polymerase New England BioLabs Cat No M0203S B PROTOCOL ds cDNA Polishing 1 2 3 4 5 6 7 8 9 Combine 50 ul 2 5 ug of the amplified ds cDNA with 2 ul of Proteinase K 20 ug pl in a sterile 0 5 ml microcentrifuge tube Store the remainder of the PCR mixture at 20 C NOTE Proteinase K treatment is necessary to inactivate the DNA polymerase activity before proceeding with the ligation steps Mix contents and spin the tube briefly Incubate at 45 C for 20 min Spin the tube briefly Heat the tube at 90 C for 8 10 min to inactivate the Proteinase K Chill the tube in ice water for 2 min Add 3 ul 15 units of T4 DNA Polymerase Incubate the tube at 16 C for 30 min Heat the tube at 72 C for 10 min Add 27 5 ul of 4 M ammonium acetate 10 Add 210 ul of room temperature 95 ethanol 11 Mix thoroughly by inverting the tube 12 Spin the tube immediately at 14 000 rpm for 20 min at room temperature NOTE Do not chill the tube at 20 C or on ice before centrifuging Chilling the sample will result in coprecipitation of impurities 13 Carefully remove the supernatant 14 Wash pellet with 80 ethanol 15 Air dry the pellet 10 min to evaporate residual ethanol 16 Add deionized H O to resuspend the pellet The amount added will depend on your cDNA li
47. rzywinski M Pugh T J McDonald H Varhol R Jones S J M amp Marra M A 2008 Profiling the HeLa S3 transcriptome using randomly primed cDNA and massively parallel short read sequencing BioTechniques 45 81 94 Nygaard V amp Hovig E Options available for profiling small samples a review of sample amplification technology when combined with microarray profiling Nucleic Acids Res 34 3 996 1014 Ohtsu M Kawate M Fukuoka M Gunji W Hanaoka F Utsugi T Onoda F amp Murakami Y 2008 Novel DNA Microar ray System for Analysis of Nascent mRNAs DNA Res 15 241 251 Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods Applic 4 5185 5194 Sambrook J amp Russell D W 2001 Molecular Cloning A Laboratory Manual Third Edition Cold Spring Harbor Labora tory Cold Spring Harbor NY Siebert P D Chenchik A Kellogg D E Lukyanov K A amp Lukyanov S A 1995 An improved method for walking in uncloned genomic DNA Nucleic Acids Res 23 6 1087 1088 Weber A P M Weber K L Carr K Wilkerson C amp Ohlrogge J B 2007 Sampling the Arabidopsis Transcriptome with Massively Parallel Pyrosequencing Plant Physiol 144 32 42 Wilhelm J Muyal J P Best J Kwapiszewska G Stein M M Seeger W Bohle R M amp Fink L Systematic Com parison of the T7 IVT and SMART Based RNA Preamplification Techniques for DNA Microarray Experiments Clin Chem 52 11
48. t Cat No 639207 These parameters may vary with different polymerase mixes templates and thermal cyclers We strongly recommend that you optimize the number of PCR cycles with your experimental sample s and the control mouse liver total RNA Try different numbers of cycles then analyze your results by electrophoresing 5 ul of each product on a 1 2 agarose EtBr gel in 1X TAE buffer Figure 4 provides an example of how your analysis should proceed In this experiment the PCR reached its plateau after 21 and 24 cycles that is the yield of PCR products stopped increasing After 21 and 24 cycles a smear appeared in the high molecular weight region of the gel indicating that the reaction was overcycled Because the plateau was reached after 24 cycles for the 2 ng reaction and after 21 cycles for the 50 ng reaction the optimal number of cycles determined in this experiment would be 23 for the 2 ng reaction and 20 for the 50 ng reaction www clontech com Protocol No PT4097 1 Version No 013012 25 SMARTer PCR cDNA Synthesis Kit User Manual Appendix A Protocols for PCR Select continued Protocol No PT4097 1 Version No 26 013012 2 Column Chromatography Section C To analyze the ds cDNA after column chromatography electrophorese 3 ul of the unpurified PCR product Sample A from Step C 1 alongside 10 ul of the PCR product purified by column chroma tography Sample B from Section C and 10 ul of the second frac
49. tech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual lll Introduction amp Protocol Overview Clontech Laboratories Inc ATakara Bio Company The SMARTer PCR cDNA Synthesis Kit provides a PCR based method for producing high quality cDNA from nanogram quantities of total RNA The SMARTer PCR cDNA Synthesis Kit is an improved version of our original SMART PCR cDNA Synthesis Kit with a new SMARTer oligo and SMARTScribe Reverse Transcriptase included it provides higher specificity lower background and increased yield This kit allows you to synthesize high quality cDNA for array probe generation cDNA subtraction Virtual Northern blots cDNA sequencing or other applications from as little as 2 ng of total RNA The cornerstone of SMARTer cDNA synthesis is SMART Switching Mechanism At 5 End of RNATranscript technology SMART technology is especially useful for researchers who have limited starting material such as RNA derived from laser capture microscopy samples cells sorted by flow cytometry or other extremely small samples Poly A RNA BS ADNDDADDDNDNDNDLYS polyA 3 Yorn 5 x SMARTer II A CDS primer Oligonucleotide First strand synthesis by SMARTScribe RT 5i olyA orn NINININI NI NINININI NIN poly Pigg a tailing by aoe SMARTScribe RT yr SD ADNDDDDADDYY polyA g a gn Template switching and extension by SMARTScribe RT Yh VYY YY polyA 5 o a Amplify c
50. the human skeletal muscle poly A RNA included in the PCR Select Kit Use the conventional method as described in the PCR Select User Manual to synthesize ds cDNA from the control human skeletal muscle poly A RNA provided in the PCR Select Kit Then set up a mock subtraction use a portion of the human skeletal muscle cDNA as driver and mix another portion with a small amount of the control Haelll digested 6X174 DNA from the PCR Select Kit for tester This control subtraction which is described in detail in the PCR Select User Manual is the best way to confirm that the multistep subtraction procedure works in your hands 2 Control subtraction using the mouse liver total RNA included in the SMARTer kits Use the SMARTer kit to amplify the control mouse liver total RNA then perform a mock subtraction as described for control 1 use a portion of the mouse liver cDNA as driver and mix another portion with a small amount of the control Haelll digested X174 DNA from the PCR Select Kit for tester If control 1 works but control 2 does not you may assume that the SMARTer cDNA amplification and or purification failed In this case try reducing the number of PCR cycles for the cDNA amplification and troubleshoot your purification protocol Appendix A Section E G Analysis of Results of SMARTer PCR cDNA Synthesis for PCR Select cDNA Subtraction Figure 4 shows a typical gel profile of ds cDNA synthesized using the Control Mouse Liver
51. the pellet speed vacs tend to overdry the beads which leads to lower recovery rates 10 Add 50 ul of TE buffer pH 8 0 to the pellet Resuspend the pellet by mixing gently Combine the resuspended pellets into one tube Mix gently 11 Elute the DNA by incubating the sample at 50 C for 5 min Gently mix the suspension 2 3 times during the incubation step 12 Centrifuge the sample at 10 000 x g for 30 sec at room temperature Transfer the supernatant con taining the pure DNA to a clean 1 5 ml microcentrifuge tube NOTE Repeating Steps 10 12 can increase yields approximately 10 15 13 Apply the supernatant to a microfiltration column that has been inserted into a 1 5 ml tube Centri fuge for 5 min and discard the column 14 Transfer 6 ul of the filtered DNA solution to a clean 1 5 ml microcentrifuge tube containing 14 ul of deionized H O Label this tube Sample F and store at 20 C You will use this sample to analyze the SMARTer cDNA after purification as described in Appendix A Section G 4 15 To precipitate the DNA add 50 ul of 4 M ammonium acetate and 375 ul of 95 ethanol to the re maining sample from Step 14 16 Vortex the mix thoroughly and centrifuge the tubes at 14 000 rpm for 20 min at room temperature 17 Carefully remove and discard the supernatant 18 Overlay the pellet with 500 ul of 80 ethanol 19 Centrifuge the tube at 14 000 rpm for 10 min Carefully remove the supernatant and discard 20 Air dry t
52. tide stretch creating an extended template SMARTScribe RT then switches templates and continues replicating to the end of the oligonucleotide Chenchik et al 1998 The resulting full length single stranded ss CDNA contains the complete 5 end of the mRNA as well as sequences that are complementary to the SMARTer Oligonucleotide In cases where the RT pauses before the end of the template the addition of nucleotides is much less efficient than with full length cCDNA RNA hybrids thus the overhang needed for base pairing with the SMARTer Oligonucleotide is absent The SMARTer anchor sequence and the poly A sequence serve as universal priming sites for end to end cDNA amplification In contrast cDNA without these sequences such as prematurely terminated cDNAs contaminating genomic DNA or cDNA transcribed from poly A RNA will not be exponentially amplified However truncated RNAs that are present in poor quality RNA starting material will be amplified and will contaminate the final cDNA library Protocol No PT4097 1 Version No 6 013012 Downstream Applications of Synthesized SMARTer cDNA SMARTer cDNA Synthesis for Subtractive Hybridization The PCR Select cDNA Subtraction Kit Cat No 637401 provides a powerful method for identifying differentially expressed genes by subtractive hybridization Diatchenko et al 1996 Gurskaya et al 1996 Subtractive hybridization enables the comparison of two populations of mRNA and all
53. tion Sample C from Section C on a 1 2 agarose EtBr gel Compare the intensities of Sample A and Sample B and estimate the per centage of PCR product that remains after column chromatography The yield of cDNA after column chromatography is typically 50 If your yield is lt 30 check to see if it is present in the second frac tion Sample C If this second fraction has a higher yield of cDNA than the first combine the fractions and proceed with Section D Otherwise if the cDNA is not present in Sample C repeat the PCR and column chromatography steps Rsal Digestion Section D To confirm that Rsal digestion was successful electrophorese 10 ul of uncut ds cDNA Sample D from Appendix A Section D alongside 10 ul of Rsal digested cDNA from Step D 4 on a 1 2 agarose EtBr gel Compare the profiles of both samples Before Rsal digestion ds cDNA should appear as a smear from 0 5 10 kb with bright bands corresponding to abundant mRNAs For some RNA samples from nonmammalian species the size distribution may be only 0 5 3 kb After Rsal digestion the smear should range from 0 1 2 kb This result will be similar to that shown in the PCR Select Kit User Manual Purification of Digested cDNA Section E To analyze the yield of purified SMARTer cDNA electrophorese 10 ul of Rsal digested cDNA before purification Sample E from Section D alongside 10 ul of purified diluted cDNA before ethanol pre cipitation Sample F Section E and
54. to flow along the inner wall of the column 16 Apply 25 ul of 1X TNE buffer and allow the buffer to completely drain out of the column www clontech com Clontech Laboratories Inc ATakara Bio Company Appendix A P PROTOCOL P PROTOCOL Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual Protocols for PCR Select continued 17 Apply 150 ul of 1XTNE buffer and allow the buffer to completely drain out of the column 18 Transfer column to a clean 1 5 ml microcentrifuge tube 19 Apply 320 ul of 1X TNE buffer and collect the eluate as your purified ds cDNA fraction Transfer 10 ul of this fraction to a clean microcentrifuge tube and label this tube Sample B Store at 20 C Use this aliquot for agarose EtBr gel analysis Step 21 below 20 Transfer column to a clean 1 5 ml microcentrifuge tube Apply 75 ul of 1X TNE buffer and collect the eluate in a clean microcentrifuge tube Label this tube Sample C and store at 20 C Save this fraction until after you perform agarose EtBr gel analysis Step 21 below 21 To confirm that your PCR product is present in the purified ds cDNA fraction perform the agarose EtBr gel analysis as described in Appendix A Section G 2 D PROTOCOL Rsal Digestion This step generates shorter blunt ended ds cDNA fragments which are necessary for both adaptor ligation and subtraction Before proceeding with Rsal digestion set
55. tructing libraries please refer to the procedure provided in Appendix C for polishing the ends of SMARTer cDNAs Total RNA or Poly A RNA Section IV First strand ss cDNA Section V B Optimization of PCR cycles Section V C SMARTer ds cDNA PCR Select cDNA Non Directional Cloning amp Next 6 i Subtraction Virtual Northerns Library Construction Array Probes Sa Dee ripe Appendix A Appendix B Appendix C equencing Reagents for these procedures are included in the Clontech PCR Select cDNA Subtraction Kit i Reagents for these procedures are notincluded in the SMARTer PCR cDNA Synthesis Kit Figure 2 Guide to using the SMARTer cDNA synthesis protocol for PCR Select cDNA Subtraction Virtual Northerns Non Directional Cloning amp Library Construction and other applications Clontech Laboratories Inc www clontech com Protocol No PT4097 1 ATakara Bio Company Version No 013012 9 SMARTer PCR cDNA Synthesis Kit User Manual V SMARTer cDNA Synthesis continued A General Considerations P PROTOCOL e Attention Recipe Protocol No PT4097 1 Version No 013012 10 We recommend Takara s Easy Dilution Solution Clontech Cat No TAK 9160 for RNA template dilution Easy Dilution Solution can prevent template from sticking to the tube and allows correct dilution at low concentration Resuspend pellets and mix reactions by gently pipetting the solution up and down or
56. with the remaining 15 ul of PCR mixture g Transfer 5 ul from the 24 cycle PCR to a clean microcentrifuge tube for agarose EtBr gel analysis h Run three additional cycles for a total of 27 with the remaining 10 ul of PCR mixture 9 Electrophorese each 5 ul aliquot of the PCR reaction alongside 0 1 ug of 1 kb DNA size markers on a 1 2 agarose EtBr gel in 1X TAE buffer Determine the optimal number of cycles required for each experimental and control sample see Figure 4 Section VI 10 Retrieve the 15 cycle Experimental PCR tubes from 4 C return them to the thermal cycler and subject them to additional cycles if necessary until you reach the optimal number 11 When the cycling is completed analyze a 5 ul sample of each PCR product alongside 0 1 ug of 1 kb DNA size markers on a 1 2 agarose EtBr gel in 1X TAE buffer Compare your results to Figure 4 to confirm that your reactions were successful 12 Add 2 ul of 0 5 M EDTA to each tube to terminate the reaction After PCR product purification you now have SMARTer ds cDNA ready to use for applications such as the generation of cDNA array probes or Virtual Northern blots www clontech com Clontech Laboratories Inc ATakara Bio Company SMARTer PCR cDNA Synthesis Kit User Manual V SMARTer cDNA Synthesis continued First strand ss cDNA from Section V B 100 ul PCR reaction 15 PCR cycles Experimental tube Optimization tube store at 4 C r
57. ycles Your experimental RNA has been partially degraded by contaminating RNases before or during first strand synthesis Repeat the experiment using a fresh lot or prepara tion of RNA Check the stability of your RNA by incubating a small sample in water for 2 hr at 42 C Then electrophorese it on a formaldehyde aga rose EtBr gel alongside an unincubated sample If the RNA is degraded during incubation it will not yield good results in the first strand synthesis In this case reisolate the RNA using a different technique such as our NucleoSpin RNA II Kit see Section II Additional Materials Required for order ing information Your experimental RNA sample contains impurities that inhibit cDNA synthesis In some cases ethanol precipitation of your exist ing total RNA followed by washing twice in 80 EtOH may remove impurities If this fails reisolate the RNA using a different technique such as our NucleoSpin RNA II Kit see Section II Additional Materials Required for ordering information www clontech com Protocol No PT4097 1 Version No 013012 17 SMARTer PCR cDNA Synthesis Kit User Manual Vill References Protocol No PT4097 1 Version No 18 013012 For the most recent publications featuring SMART technology please visit the SMART microsite on the web at www clontech com smart Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yie

Attachment PDF Icon

Contents

Download Pdf Manuals

Related Search

Related Contents