Home

QUMA User`s manual - QUMA: QUantification tool for Methylation

1. 5 4 8 Bisulfite sequences file 1 2 Or click the second button to upload a file of bisulfite sequences Reece EEE LEE E Overview how to use QUMA Quick start Execute with sample sequence data Sample sequence files Project name optional only contain A Z a z 0 9 and Enter a target genomic sequence PCR target in plain sequence FASTA or GenBank format or upload target genomic sequence PCR target file XY THAN e FASTA f XUsersfkumaYDe Browse Apply sample genomic sequence Enter bisulfite sequences multi FASTA format or upload bisulfite sequence file multi FASTA format file or zipped archive of sequence files Sequence group name optional Apply sample bisulfite sequences Optional Enter second bisulfite sequences for statistical analysis in multi FASTA format Copyright 2008 RIKEN Center for Developmental Biology All right reserved 17 April 30 2008 User s manual 5 4 9 Bisulfite sequences file 2 Select a file of bisulfite sequences Acceptable file formats are 8 4 Multi FASTA or 8 5 Zipped archive of sequence files See also 8 6 How to create zipped archive Macintosh and 8 7 How to create zipped archive Windows 7 2 Bisulfite sequences 5 4 10 Conditions to exclude bisulfite sequences If
2. TT TRRGIET T UC CECT TCR Oe Ta TC T TAAT MET FENE ATTE ToT ITE TR E ATE T TE T TE A T 587 M RELIER LER LA LTT LOTT a ee T Tara ee TC a oe E EET E SERIE TER EE misuli E GT TT ORO REO TT rar el 31121 1 218 11 amp l de TD a ERIT Aaa TTE 171 ili 11 12 ML EE RE i BN E d dt Eh d il ill tl TT zTCT rr TTTTTATAA Me Exil CUS ILI OCT el FU Ill Fl meu tite LEL ETAT TTT eT HETE TTATEATEI Et a ritm 121 Lii Vli LETS 241 FOT Bra Tis e RC AT Na _ IIIIII 1 EHE 1 RTT ee Tee OTT TT eT TT TT 101 CROC aero Tan fest sect I i
3. _ 1_ 07 111 4530993 18 01301000 Gu seq 11 110 453 995 18 1131 991 05 310 452 991 18 11310989 Ow NN int X d Wa Mo BE is _ 1_ 02 110 441 99 19 1131099 7 Gub Ji seq 13 111 AS40998 19 1151 991 seq 06 214 248 633 904 1 22112 0 4 mismatch N ident uneer cony Gm 7 seq 09 241 176 536 4 0 13 4695 50 5 idunt com Ji seq 15 3 1 453 993 18 55150 19 2 usere s cone l6anbb seq 02 140 453 998 2 1131 991 l6aabb seq 09 3 1 453 993 2 0130 1000 oeoocceocooceoocooo l6aabb 01 1 453 989 3 1130 992 000006000000 000 00 l6 anbb seq 12 0 0 453 1000 3 01310000 l6aabb seq 06 110 1453 998 4 0131 1000 l6aabb seq 05 10 7 457 978 5 2127 984 0 00090000006009000 l6anbb seq 11 2 2 453 996 7 O130 1000 16 seq 04 1 D 454 996 7 O131 1000 l6aabb seq 16 2 D 454 996 7 1131 992 00920020 000
4. ps eee ee iE eee eae Cash 11 eth ie Jb LILES Be RR was D 155 Ge rd LIE mm MEFEHEEINEFINEEFENNE Det one 07 eame 11011102 eean mad 1 1 iurc men Se DE OR Va 0 UE D aman le amr Db ome eee TE boaii h ak e LEE NL ee 5 2 amar Cue op mu Jin STEED I BLOIB eee ees tas HI ijj bs EE BEI macxesn ee wa 1 Se eee eee Um um Pee TTT 5 1 17 1 once Dumb 1 sera E HEHEHE Cade 3 Tr la a Ces HI HE MITT eee ee Cm a um 22 1 WLI BHA AHHH YT ee LXX I ct NEPON Dp Ila ol p maman ums ann Tet sp ER BOL 2 ee Cua ue 1 d IE ep an mn mr map 1 F7 4 58 BRAKE ee ae FE Copyright 2008 RIKEN Center for Developmental Biology right reserved
5. gt Lower limit of percent conversion 5 6 6 Conditions to exclude bisulfite sequences 1 sequence name Lower limit of percent identity 98 Conditions to exclude low quality bisulfite sequences be changed Then ascending order descending onder Reset Renew Show figure Download figure Download methylation status data Download alignment data click Reset with new parameter button order and exclusion of bisulfite order crine ised EUREN 6 CpG 9 converted er reason for the exclusion sequences will be reset 1 Gm9 J1 seq 10 1 1 453 99 6 2 131 98 5 oocoooooocooeceeese 2 Gm9 Ji seq 03 0 0 453 1000 6 0 131 100 0 gt Upper limit of unconversion REN JUS rere number of unconverted CpHs CpA CpC and CpT T Gm9 Ji seq 01 1 0 453 998 18 0 130 1000 1 99 Gm9 Jl seq 07 1 1 4353 998 18 0 130 100 0 v percent of number of converted CpHs number of CpHs 1 11 Gm9 1 seq 05 3 0 453 993 18 2131 985 gt Upper limit of alignment mismatch ee number of alignment mismatches and gaps between genomic and 2 gt 16 16 v Gm9 J1 seq 15 3 1 453 99 3 18 66130 59 2 unconverted con
6. iE sulfite sequence 4l 1l me FAR FREERRERERES MET HN BT TTG MIA TTT LAG TT ACHT TATA T TTT T au RE E BII AI HE LAHAT TATAI TEGGAADDUETDTTACTTTARTTTTT RTAAT RGDGTGCDTGTTTTT ERIS PELEAS PAISES AES E GTO TET TCR D C ART TIT n ATAT UT BATTTTATISTRTT TTTT AGT IE IE LAI ALE FE FARES eo ERE HOLE THAT AC TTT ATT AE PCATGSTCAT Ares C TEGOHTGCC Tis TOTITC DIET ET FERE H T TOL T TORT EE E TERT TAA Th ep cen E UES IFES FALE ARE RIE TEX TEX TAGOGSTATCRT ETCRIT A re eH PATE 1 Al LETE Je os Methylated Gob a 1 isiad Cpi 1 barie LH i Mana boy ees a OA mieu ite nemen name L rarer im n si rand cf jhe gerenic saaa of ite sequence 1 malh bezai wars 453 Aligned region bisulfite sequence dj s sg Ali merl dirst ion er mar haber ol ob ins ol of Lr
7. gt E Quentthostion tool for Methylation Freio Ble Ed amp View History paba Tooke Help Lees bra am ie repens Analysis pima mi fm to conet dei April 30 2008 User s manual SERM OF USE EXTNNLOAG REFERENCE aiken des 6 3 2 Overview of statistical analysis result page 2 A Summary of information Length of the target genome sequence number of CpG sites and number of bisulfite sequences are indicated neg eee B Statistical data E Position of CpG sites methylation status of each CpG B 3 9 1M sites and statistical significances P value of difference Summary of information Number of ceger er oped excluded total 13 3 16 group name Length of target Number of group 10 6 16 group VGE VG 115 WS HE WD PM 23 76 215679 ee HI between two bisulfite sequence groups are shown Fisher s exact test The statistical significance of the difference between two bisulfite sequence groups at each CpG site is evaluated with Fisher s exact test that is 010 peus Dn 3m P value of Fisher s axucritest 20015 Cpl position IIt IE 12713 122 0 0204 213 n a iis 5 IG
8. 65 Gm9 1 seq 10 1 1 453 998 6 2 131 98 5 ocooooooooooeoceeeee 1 Gm9 seq 08 0 0 453 1000 16 0 131 100 0 88 Gm9 1 seq 07 1 1 453 998 18 0130 1000 99 340 453 993 18 2131 98 5 eer 10 10 0 0 453 100 0 12 0 131 100 0 11 010 453 100 0 6 0 131 100 0 oeooocooooeocoooeeee 22 1 9 seq 02 1 0 453 998 19 1131 992 13 13 Gm9 J1 seq 01 1 0 453 998 18 0130 100 0 14 14 Gm9 seq 15 3 1 453 99 3 18 66130 49 2 unconverted converted 15 15 y Gm9 Jl seq 09 241 176 536 55 0 13 46 93 50 5 mismatch identity unconverted converted 16 16 Gm9 seq 06 214 248 633 504 1 22 112 80 4 mismatch identity unconverted converted Reset Renew Show figure Download figure Download methylation status data Downloac alignment data CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 33 April 30 2008 User s manual Bisulfite sequence information Hide options E Sorting conditions CpC CpT 3 Conditions to exclude low quality sequences user specified order number of methylated CpGs Upper of unconverted CpHs Gm9_J1_seq 08 0 0 453 100 0 16 0 131 100 0
9. E converted or reason far che 7 2131 98 5 aoocogoococomseeees 0 131 100 oseeodogoocos 000 dde 0 131 100 0 oeaeooccoooeeocee eoo 130 100 0 131 100 0 eooceooosceseseeces 11311992 W131 100 0 sseseeseokeaeoreeeoR IO 100 0 be REPE 0 130 100 0 RL 99 2 2131 96 5 111311592 asas baba ERA RARE PARAR 11311 59 2 esas bs eb RR ERAS RR ERR Gm Jl seq 06 Gm Jl seq 09 Gm Jl seq 15 l amp aabb seq 02 314 248 633 5043 1 22112 80 4 mismatch ideni uncon conv iAl 176 536 550 13 36 93 50 5 mismatch i hen ancy oen 3 1 453 983 18 66 130 49 2 con 1 00 453 99 B 1 11311992 i Copyright 2008 RIKEN Center for Developmental Biology right reserved 59 April 30 2008 User s manual 6 3 13 Alignments data Downloaded alignments data file can be opened by TextEdit Mac Notepad Win or other text editors Alignmend results Ha Aamar aE Fite momo crop ee PS a T A Avr PX lagrar cl lasand gA ran of the ae 4 bisulfite samm xp is region c mal ite d px n for F af na P Nake eb
10. 7 m M 1 ee LL aaa ET dmi a LONE D Tai nal d was m WW 12 id ge Gp LFU E BIS dii Sp REM 740 Um l 11 rm 1 D li wa 01 l 1 sg di 11 Hd Jl cg 02 xS 11 113 1 ghae NI Om 45265 gj pF uti gi iJ 455088 d a THAT i eA 8 In Hit 4572 FF 1 1 LIF 0 16 45257 8 E 112114 H J ec40c09 00H CHE E ETTI rra e ap LAI Dj eee AIEDND DE E II Ol SILO EJIL EI eee ee ee 6 MII IMN ma ekERBGIUG ERRETUAGOGRDE J DO 01 mia aa aiia aman a E Lg eee eee L3 189 1131 ow eee DIJLI ee ee 99 oa j wg UE SC 101774 ith eerie ceri Get J ss Of a 15 ms Fm tere tere convient dee Carel eM Me Delp 4555993 3 18 6 5 4 44 mca a m Copyright 200
11. 2 5 Gm9 Jl seq 03 0 10 7453 100 0 0 131 100 0 oeocooocoosococosess 34 Gma J seq 14 Of 453 1000 amp 0 131 100 0 4 3 12 2 023 454 99 6 9 0130 100 0 5 2 seq 04 0 0 7483 100 0 12 0131 100 0 6 1 Gm9 Jl seq 16 2 0 453 99 6 15 1 131 992 1 seq 08 Of 7453 100 0 16 0 131 100 0 8B 71 Jl seq 01 1 0 433 099 8 18 0 130 100 0 eeceseseaseseeeeten Gm9 Jl seq 07 l 1 453 99 8E 18 0 130 100 0 ttt 10 10 Gm9 seq 11 1 0 453 99 8 18 11311991 eeceesseseeet hebben n Gm9 Jl seq 05 3 0 453 993 IS 1 131 955 eessasasa ra R ARRAS E 12 Gm Jl seq 02 1 0 453 99 8 19 1 131 992 eet b ee bte ERR RR RE 15 15 J Gm9 Jl seq 09 241 176 536 55 0 13 46 93 50 5 mismatch identity unconverted amp converted Gm Jl seq 15 30 453 99 3 18 66 130 19 2 unconverted converted Ree Renee DY Shon Tawe Dormia laure Downiced methylation status dera Donnibed alignment deta CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 26 April 30 2008 User s manual E Bisulfite sequence information rm ETT SIM 5 5 11 Change the order of bisulfite sequences 2 The
12. 13 18 Gm Jl seq 13 1 1 454 99 8 18 1 13 99 2 141 J seq 06 21 248 633 504 121112 080 4 mismatch identity unconverted converted 15 15 31 Gm Jl seq 09 241 176 5360550 13 46 99 50 5 mismatch identity unconverted converted 16 5 7 seq 15 3 1 453 993 18 55 30 19 2 unconverted converted Reset Rene Show ikure toad methylation data Download allgnement data Lom TITT TATAA AOO ee ee XTIETETE 5 5 17 Methylation pattern figure This figure reflects order and include exclude sequences in analysis result page Black and white circle indicate methylated and unmethylated CpG respectively Cross indicate mismatch or gap in the alignment Other types of figures can be created at 5 8 Figure page Detailed parameters such as line width diameter of circle and etc can also be changed at 5 8 Figure page Oeeeooooooeeoceeece ecooecooceceeeececcece 9000000000000000000 000000070000 0000 0 6 o0 0000000000000000 Copyright 2008 RIKEN Center for Developmental Biology All right reserved 30 April 30 2008 User s manual 5 5 18 Go to figure page Click Show
13. 0 131 100 0 ooo0coeoocoteoceeea 2 127 98 4 DEDOTTE DOTO DOR eoo 07130 100 0 T 013 100 0 11311922 Lo o 07131 100 0 1 128 99 2 mismatch 55 April 30 2008 User s manual gt mismatch v The number of alignment mismatches includes gaps between genomic and bisulfite sequences exceeded the upper limit default 10 v This means low quality sequence read gt ident v Percent of alignment identity between genomic and bisulfite sequences exceeded the lower limit default 90 v This means low quality sequence read gt Unconv v number of unconverted CpHs CpA CpC and CpT exceeded the upper limit default 5 v This means incomplete bisulfite conversion or low quality sequence read gt conv v Percent of number of converted CpHs number of CpHs exceeded the lower limit default 95 v This means incomplete bisulfite conversion or low quality sequence read gt user desired Sequence was excluded by checking on the exclude checkbox CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 56 April 30 2008 User s manual 6 3 7 Show alignment Click links to show bisulfite alignment between bisulfite sequence to genomic sequence See 6 5 Alignment page for next step
14. 24 n Mumba e 11 radi of Bi Hoher cd E 12 Humber cof 44 a4 Z retin of 42 20 2 of DOUOS 000844 Peale of 0 000249 of m1 040 272 H 4 7 aud st 5 ou LIII NL TIT ELS E D Te LE 20 2 ie 27 2 cue 1 aat 2B 2 1 1 1 CECE IEAn T 222 cA LO oca Ca 1 z 1 1 zu TE 1 1 1 91 E zx 44 IS 25 FRE OCA E Es E du E um p QD PITE Gm9 1 seq 0 Jl seq 14 Gmi 71 seq 12 Gm Jl seq 04 J seq 16 Gm3 1 seq 08 J1 seq 01 Gm 11 seq 07 Gm seq 11 Gm Jl seq 05 mS 1 seq 02 Gm Ji_seq 13 Gm9 1 seq 06 7l seq 09 Gm9 Jl seq 15 l asbb seq 02 za qo 1 5 11 1 t1 i 455 24 24 H ara 333 PIRN QOS 314 248 633 50 4 241 176 536 55 0 yor fave any quatur THT stt oL wie PARIET Led CpG erreason for the exchusian A 1 1 453 99 8 0 0 453 100 0 0 0 453 100 0 2 440994 040 453 100 0 2 0 453 99 6 0 0 483 100 0 1 443 99 8 1 1 453 99 8 1 00 453 99 8 3 0 453 98 3 i 0 453 99 8 1 1 444 99 8 3 1 453 99 3 1 0 453 998 2 i 12 13 13 13
15. 69 8 1 Plain sequence format 69 0 2 FASTA format 220 30022 eens 69 9 3 GenBank LOM Axi rito PERF eens 70 8 4 Multi FASTA 71 8 5 Zipped archive of sequence files 72 8 6 How to create zipped archive Macintosh 72 8 6 1 Mac OS X 10 3 and 72 062 Olher Mac 74 8 7 How to create zipped archive Windows 75 8 7 1 Windows Me XP Vista 75 8 7 2 Other 5 76 Statistical TOS 77 94 Fishers exact DEED eee 77 9 2 Mann Whitney 79 107 OME E o 84 10 1 How to open a CSV 84 101 1 84 10 1 2 WIB OO WS 84 Copyright 2008 RIKEN Center for Developmental Biology All right reserved 4 April 30 2008 User s manual 1 About Bisulfite sequencing a standard method for DNA methylation profile analysis is widely used in basic and clinical studies This method is limited however by the time consuming data analysis processes required to ob
16. LIn YI 1089 H H3 WE 1013 15 591 11294 HES LOS 23432 6 33 iP PI 5205 1 3 314 41131 Fil 1215 1111 1093 12111 TT Ju FH 02394 HIP non parametric statistical significance test to determine D 438 50 60 pM DEN 0 BS SPA GP MOMS ARS 15 if there are nonrandom associations between two 1829 1301 1828 DB 1829 P4 24 140 SS 310 P value of Fixer exact best FA 20026 05383 i000 81260 dilst 08186 05880 P valee of Mann Whiteer U test categorical data See 9 1 Fisher s exact test for more detail Mann Whitney U test statistical significance between two groups of the entire set of CpG sites is evaluated with the Mann Whitney U test also called the Wilcoxon rank sum test that is non parametric statistical significance test for two distributed samples See 9 2 Mann Whitney U test for more detail As a limitation of both tests CpG methylation pattern is not considered and allele specific CoG methylation pattern especially for imprinting locus is not detectable Figure of comparative methylation status is also shown BL Le E Change graph CopyrightO 2008 RIKEN Center for Developmental Biology All ri
17. haber of Gol aj Labar ol aidmibh Lael gua l haber ol rar 0 483 r ite W E I pal ET ERE LR huwe al dele DAT I CATT ARIES Hi Bill i te El DET TASTCT CC TCTTCTGCOOCT aa Bisulfite FI uds ns iet dm hf iii ih Danas GAA T T CC Bisulli tn El ATA AGES TT THEE HAATTTTTATAATA la i4 TTE T C AT eee sls el BGA TTC Ago isses LH E WI TTP ATA 28 April 30 2008 User s manual Bisulfite sequence information Show options Racet Giara statue dats Turion arent 5 5 14 Download analysis data gem IE ies m name FERE CpG 96 converted or reason for the exclusion A Click Download methylation status data button to download if ITED 6121316084 2 2 seq 03 0 0 453 100 0 0131 100 0 analysis data 33 Gm J seq 14 0 01 453 100 0 8 W131 100 0 ceeseccoccoesoceesco 44 seq 12 2 23 454 99 6 9 0 130 100
18. Copyright 2008 RIKEN Center for Developmental Biology All right reserved 9 April 30 2008 User s manual 5 2 Top page Top page can be switched between two modes that is 5 3 Top page simple e and 5 4 Top page option e QUMA QUantification tool for Methylation Analysis Mozilla Firefox Hie Edit History Bookmarks Tools Help T T eia a WOW If you have F E om a ma m T as ree aa Analysis emt feel free to contact gum Lo m d ki e LE um d 3 E Los You can easily align visualize and quantify bisulfite sequence data for CpG methylation analysis olain seonence FASTA or GenBank format The genomic sequence must be an unconverted sequence between PCR primer not necessary to convert C to T Upload bisulfite sequence file multi F ASTA format file or zipped archive of sequence files Raw sequence data be used Removal of plasmid vector sequence is not necessary Reset Submit E Show options Copyright 2008 RIKEN Center for Developmental Biology All right reserved 10 April 30 2008 User s manual 5 3 Top page simple QUMA Quantification too Analysis Mozilla Firefox History Bookmarks Tools Help 5 3 1 Genom
19. Friar e 11 Hater c5 E E Lire iude ot cd ck bel nk ioe caltarr ILE inm lata Esasiye lated amas ch Target gencre penaa Bt SAPE ACE LABLI EMASE IA c MAI emer EFF a EFF Teter PEM TEM MET TIES CAL AGODA CANT TITA ARTA PERIFER T T ei oe das ILL Es ALL EA UC A ULL ARD e Rn F ae ATI ACATRDAATCM EAT E tole 10 TETA TOCIL ELS CA TOET CODE TEGATTTASDEDAGE AG MMA OMT UB RTA ATT ALT N E at A CRAT Seba e EE TTA TEAM CREE EAT ARTTTGOCTAGT TT TTARTATTETATATARTGSETATT TAGS TTT TEAATITI TAOCTT eT HAL IT TTA TT ee SUMMIT Tu TARH n Jiu an T ANEMA IMG 1 ik On ao d ea MATTA TATT ET T i uel HCG TAATCATOOT TEI TTA TT TALA POINTER VR ER TAI rer Aire at ANT E 1 j ABI 14 i Fi FREE REFER PERCHE TRE T ini EET AKTACUIGTTATOE ACA GEAT ACETATE EE 1 Ce 1 Ferrie oi Goreverted Each 01 sar 1
20. sequences You can easily align visualize and quantify bisulfite sequence data for CpG methylation analysis Overview how to use QUMA Quick stat E Execute with data Upload target genomic sequence PCR target Ba plain sequence FASTA or GenBank format The genomic sequence musi be an unconverted sequence between PCR primer pair not necessary to convert C ta T a aL A 5 3 4 Bisulfite sequences file 2 Select a file of bisulfite sequences Acceptable file formats E 2 2 cuments sample genome Fasta are 8 4 MME PASTS or 8 5 Zipped archive of sequence i 4 Windows Player files See also 7 2 Bisulfite sequences 8 6 How to create zipped archive Macintosh and 8 7 How to create aaa ae Desktop zipped archive Windows bisulfite seqi Hy Documents Overview how t M Upload target ge Lg okanolab on cdb si plain sequence Panik The genomic segu convert C ta I l My Network plein seq s i FASTA f Places Raw sequence dati Copyright 2008 RIKEN Center for Developmental Biology right reserved lf you have avy questions commanty requests ate Analysis a mma Rea Sample sequence files C Users kune De Browse 12 April 30 2008 User s manual QUMA Quantification tool for Methylat
21. 5 8 12 Option of figure 4 The meaning of the value of each option parameter is shown Scale to show means size reduction rate to show in the window Click Renew button to reflect parameters eH pl Sian position 50 Center Ene width puii Scale of width 2 Diameter of cigefe 27 pits Scale to show 12 Start postion 1 Heightefr me 40 pigs Line width 2 Reverse position Width depends on the value of Scale of width Relative position of 1 H i the first base of genomic sequence CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 42 April 30 2008 User s manual 6 Statistical analysis mode 6 1 Main features Differences from Methylation status analysis mode are listed below gt gt The target genomic sequence and two groups of bisulfite sequences are necessary for input data Figure of comparative methylation status is shown The statistical significance of the difference between two bisulfite sequence groups at each CpG site is evaluated with 9 1 Fisher s exact test The statistical significance between two groups of the entire set of CpG sites is evaluated with 9 2 Mann Whitney U test Op page Paste or upload genomic sequence and two groups of bisulfite sequences Raw bisulfite sequences are acceptable Removal of plasmid vector sequence from E bisulfite sequence is not
22. 1000000 00000 00 IO I 0000000 0000 0000 eec 2229 i 4 eec CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 3 April 30 2008 User s manual JOOC K H E HC 5 8 3 Change methylation pattern figure 2 Lp 29900 Oeeeooooo0 00666 00 2 CHO COO OHO OHHH Methylation pattern figures are switched one ecoocecooec 192000 eoooseoooeoceeeeeseee 000000000000 after the other 272224 2222 5524 ee _ 6666666660666 ee 6666666660666 ee 0000000000060 TC 0 000 0 00 0 0 0 0 e oe TE a EEE ES oe i e e amp C O0 OC O 0 04 um 00 00 H HHHH MNH 99 29 99 E 3000000000009 905 4 900098 099909 90090 TEL we e 5 8 4 Show options Methylation pattern Mozilla Firefox TET File Edit Histo Tools Hel Click the Show options link to show optional fields mid Methylation pattern Ei Show Download figure at T T 60000006 60066600 OE 1000000000 100000000000 00000000000 0000 0 0000000 Copyright 2008 RIKEN Center for Developmental Biology All right reserved 38 Qi Methylation pattern Mozilla Firefox 0 8L i April 30 2008 QUMA User s
23. 505 497 DO 2 Copyright 2008 RIKEN Center for Developmental Biology All right reserved 29 April 30 2008 User s manual Bisulfite sequence information Show options Reset Ehew figure CT Download figure D Download methedation date Downlesd slignment data exclude mismatch gap 1 5 5 16 Download methylation pattern figure ah pee ee teet 1 1 Gm J seq 10 1 1 453 998 6 l131 9 5 Click Download figure button to download methylation pattern figure 26 0400000004000006 3 3 Gm9 J seq 14 0 0 453 1000 8 0131 1000 oeeeccoccosecceseco 4 Gm Jl seq 12 2 21 454 996 9 0130 100 0 55 Gm Jl seq 04 D O 453 100 0 12 0 131 100 0 66 I seq 16 274531996 15 171311992 7 Gm Ji_seq 08 Of 453 100 0 16 0131 100 0 amp B Gm Jl seg 01 l1 0 453 998 18 0130 100 0 eeceesesestes ere nth 8 Gm9 J1_ seq 07 1 05 453 998 18 0130 100 0 eeoeeetebe ttt ntn 10 10 Gm Jl seq 11 1 0 453 998 18 1 131 99 7 eeceses ee RAE Gm seq 05 3 0 453 993 18 11311985 ee eee a RR RR 1212 Gm Jl seq 02 1 0 453 928 19 171311992
24. quality 5 95 DOG Ll relate dtu of gach Cal is Cal 25 Muse of B Euer of sea mm 692 i Get A 3 5 8 7 Gat B a B 10 Gat 13 14 GB j 15 GB 16 J 4 amp 13 840 Of We HE E 5 E ME nm E 5 E m E Ed nm E E 5H n1 abphew bares Esas reb 53 53 53 E54 53 53 53 53 53 53 53 53 998 a 4 15 3 unire rm Reset Renew Show figure 4 figure Download methylation statue data Download allgorrment data 13 840 Pruis of percent ylation ait aces ree tte rra heed 085 LINH RR UL LLL A AA eo LEGAL PAL E LE LIE L RUC abd 5567 Mila bli la CR C E C RE E GER GE BO
25. 5 5 6 Overview of analysis result page 3 C Information and methylation pattern of each bisulfite sequences 1 Number of mismatches and percent identity of bisulfite alignment 2 Number of methylated CpG sites E Reset Renew T Y 4 5 T T 8 9 5 10 11 13 14 15 Gm9 1 seq 10 Om J seq 03 Gm9 seq 14 Jl seq 12 Gm J seq 04 Jl seq 16 Um Jl seq 08 Gm Jl seq 01 Gm9 I1 seq 07 Gm Jl seq 11 Gm9 J1 seq 05 Gm Jl seq 02 Om Jl seq 13 rm J seq 15 Number of bisulfite unconverted CpHs CpA CpC CpT E Show options Methylation pattern or reason for the exclusion 0 0 453 100 0 2 0 453 99 6 0 0 453 100 0 1 0 453 99 8 1 1 483 99 8 1 0 453 99 8 3 0 453 99 3 1 0 453 99 8 3 1 453 993 Shew ligure Downioed figure Cownioad methylation status data Download alignment date 4 Pattern of CpG methylation Black circle methylated White circle unmethylated Cross mismatch or gap CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 23 April 30 2008 User s manual Methylation pattern 4 is not present when quality of bisulfite sequence is low or excluded from user Low quality value is shown as magenta When excluded reason s for the exclusion will be indicated at methylation pattern column 4 Conditions to exclude low quality bisulfite sequences can be changed S
26. format v un 0 09 95 B 19 armi 20 BON UN UN 10 10 OFF 10 1 sm m m m align visualize and quantify bisulfite e mias y 2 120 622 1023 90 jefa quem ent 381 SING 09 4839 522 ekis sequence TASTA v om of Fiber s exact test Z 2946 200 04052 60004 05018 00283 10006 6001 sequence data 2 412 5239 100 ON 922 4 8238 410 418 30 10 60 50 41 0 60 A000 N 9 323 15 23 1823 192 1323 195 ambi FASTA fonat or sipped archive of separace fies OM GM 86 SUIS 9 4 612 N P vabee of Fisher s exact test 0009 1990 000 01249 04257 1188 32215 soiis 1f you hare qaerticca commmants sequar il Apply sample bode pleme ed free o corra nime E Enter second birale sequences fior im FASTA format P value of Maun Whirsey U test QUMA consists of two separate E NSI W par Dil T or second brale sequence Se for sanc al analysts Mid 1 ul ll Giski E ASTA formar fle tipped archive of sequence fies e analyses ethylation status 5 Project sequence Length of target Number of bisulfite sequeaces B i hre ag aan Cons bod
27. 1 li J GAS bui MU HHH TET Halla EE QT TOP RC GSC TTT TCT Farrar abt OIETET IEA TT TCRTEGTREGTCECEGTCTTI DC TT TTC TC ee CC CC a LT AT vorm AT TET d Tu TU TTT Taal arent TTTTARTATTATATATATI IH d PE Hl erp I SITE S TRA id HOA TTA Hih Al rire eil ril n Be Ee CT CR TS x X CN TAA TTATGIETCECET Xr TII TET HE HT Al rreri ramulis Ho 1 moase te SSS icri E garain oorr inn oF toreard rand nf the promit sequence Copyright 2008 RIKEN Center for Developmental Biology right reserved em 60 April 30 2008 User s manual 6 3 14 Download statistical analysis data Click Download statistical data button to download statistical analysis data 6 3 15 Statistical analysis data Downloaded statistical analysis data file can be opened by Microsoft Excel OpenOffice StartSuite or other spreadsheet software CSV file format See also 10 1 How to open a CSV file 1 of 4 42 Humber ci 19 of gach Hir Cpo pare e ac hepar cd cd 13 nie of
28. 11151111 ETT TTT ATIATI a emer a7 RT C 11 zl 261 GAT ae a TAET aT TAT AT ATA TAT aa Yu mm 351 421 PRATT HERE IEEE TFATGTATITTTETAGT TTT TTT TTTT RTT 36 April 30 2008 User s manual 5 8 5 8 1 Download methylation pattern figure Click Download figure button to download methylation pattern figure which displayed at that time 5 8 2 Change methylation pattern figure 1 Click Change figure link to switch methylation pattern figures Methylation pattern Mozilla Firefox Ele Edit View History Bookmarks Tools Methylation pattern El Show options Download figure E efi Oe o o 6000e0000eeee Gi I 1 I I IGI 100000000000 0000 00000000000 0000 QU IP Mo 00000 00000 I Es 00000 000006 00006 00006 0000006 000060 00006 000006 00006 000006 Methylation pattern Mozilla Firefox File Edit View Higtory Bookmarks Tools Help Methylation pattern 5000000005880 1 76 I IGI
29. bisulfite sequence is not necessary fo r G Bisulfite alignment Sequence trimming TE typically only taikes few seconds Sequence quality check Dad sequence trimming confirm Methylation pattern analysis methylation pattern analysis Making of figures aay Analysis result gt Easy to iterate many alignments with _ selectlexclude ies sequence different parameters without difficulties download Project sequence Length of target a n a ys is Number of CpGs mime prompsame gesome sequeace gt Many optional parameters are available to download su uaa n data li t 26 4 ns 1 alignmen og UB enim ONG 1008 749 BIN 615 HEN I 602 HN change the output style to the user s data preference lt lt lt lt w download e nere data a aim 4542 w fee the li t 11 9 J seq 10 1 1 4453 998 6 2131 98 5 e50 alignmen 22 J103 00 4 0 6 0131 gt 33 Gm9 7 seq 14 00 0 5 0131 eo 44 Gm Jl seq 12 o 55 B Jl seq 04 1 16 Pt 522205 22242222 33333337 Hin AAA 2 333333 4 III data download methylation pattern diagram 4 3333 eee 0000606000006 TIT eee
30. Genomic sequence QUMA QUantification tool for Methylation Analysis Mozilla Firefox Ele Edit History Bookmarks Tools Help If yos have any sons commants f ete RR d i E multi FASTA format file or zipped archive of sequence files Sequence group name optional Apply sample bisulfite sequences Optional Enter second bisulfite sequences for statistical analysis in multi FASTA format or upload second bisulfite sequence file for statistical analysis mult F ASTA format file or zipped archive of sequence files Sequence group name optional bisulfite es Conditions to exclude low quality sequences CpH CpC CpT Upper limit of unconverted CpHs A Lower limit of percent converted CpHs IA Upper limit of alignment mismatches Lower limit of percent identity Submit E Conversion gt T conversion conversion of forward strand of the genomic sequence G gt A conversion conversion of reverse strand of the genomic sequence Both search both directions and select the best result Reset Project name optional only contain A Z a z 0 9 and mm z ce e tification tool for nave any qeestions commentsiveqeests ate Aa 24286276 884 ce ethylation Analysis please feel free to contact guma Bedb riten ip 4 424 a wann BI HOME ME _ OVERVIEW TERM 5 1 JSE DOWNI Q
31. 510 0 49 190 400 40 0 70 0 00 600 600 6009 00 25 ED 1523 1423 IWD 1823 X23 1873 31436 695 652 600 733 65295 695 3304 P value of Fisher s exact test 00185 00393 10000 00059 01260 040237 01269 02213 0 0185 00000 P value of Mann Whitney U test 7 0 0004 diir T m m a lt a tk Cee posit ben E Change graph Bisulfite sequence information E Show options Etpe pertum Reset Renew Download statistical data Dowenload alignment data SESS Qu rame a Gm J seq 10 11114531998 6 2151 98 5 Gm Jl seq 03 04 0 453 1000 6 0 131 100 0 oeooooococoeocooeeee Gm9 seq 14 0 0 453 100 amp 013111000 oeeeoooocoeecoeteoo Gm Jl seq 12 2 2 454 996 9 Q130 100 0 coeescooooosecoseeos 45 2 CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 54 April 30 2008 User s manual 6 3 6 Overview of statistical analysis result page 3 C Information and methylation pattern of each bisulfite sequences Two sequence groups are indicated separately 1 Number of mismatches and percent identity of bisulfite alignment 2 Number of methylated CpG sites 3 Number of bisulfite unconverted CpHs CpC CpT 4 Pattern of CpG methylation Black circle methylated White circle unmethylated
32. B Genome sequence Bisulfite sequence Sequence outside alignment is indicated as gray color PETT LTITALTTETTATEATAELLITETT i ee SECLRATTCRRTTTI TTAMTTTTRZCOTA4UTTOEMCERDEMKALLESELTTZERTTZT CUIR BET ik mE uu LU a L oes 0 Bisulfite alignment TT Methylated C of CpG site unmethylated C of CpG site Unconverted C CpA CpC CpT are indicated as different colors TOTTI IIS T lal Poi Si ET TPIT Lieb TET 1 DF LELLE ET LDA AMEDIA LET T 1 i i Le LTE EET ALS ETL ALT 3 i WI ed didi CTL TOT T TRITT CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 35 April 30 2008 User s manual 5 7 2 Download alignment data Click Download alignment data button to download alignment data which displayed hear 5 7 3 Alignment data http quma test cdb riken jp Alignment result Mozilla Firefox Alignment result Download alignment data gt a Gm9 Jl seq 05 seq C gt T conversion conversion and detection of for
33. i ala Force CB Ge parre opem saved a of iequeace Bes Sequence poup rane mm em Enter second binde sequences for analysis or upload second sequence file Sor statistical arii mest FASTA format file oc ned nde cac fe group name sam pk b iiic s Conditions to exce os M EN pA Upper lini of unceaverted Cols Lower im of percent comversed CpHs a starch both Greeters and select best seul typically only takes a few seconds alignment sequence trimming sequence quality control methylation pattern analysis statistical analysis download statistical analysis data Analysis resu Results of statistical analysis Summary of information Number of sx P value of Fisher s exact test 008 1 600 P value of Maun Whirsey U test iil es os ll Change argh Bisulfite sequence information own ica aro Faset Peran Dover ipa 1 exclude Na Hn ame 7 seq 10 Mear lance et reason fee excbasion P _ 1_ 03 Jl seq 14 seq 12 J seq 04 Gu J1 seq 16 download comparison graph of methylation status CopyrightO 2008 RIKEN Center for Developmental Biology All right reserve
34. d O d DE EH FO WI dcm Rie di 6 3 1 Overview of statistical analysis result page 1 A TNR EN HB HS HS Bm HB Th tli HJ IP HOO Boh BES Statistical analysis result page consists of three sections UM aes ae cae ee Cae DAA IAIA A Summary of information B Statistical data 1 aes J db opu Hh daB i iit i digi em didi AB FE 413 2 vH wp wm p vm FUP FR PS IA AR id D m pi sun on Fa hih HA UR py Towm ied Information and methylation pattern of each bisulfite sequences Po Mom My nt um n PE qr ae ym pb epee ia dom em sma rea dpa s prn edt jb oma gm lili FEE eee minor Dat E 08 RITE egenus LIN ML Gili linn mW EIJI m i iis Cut bom d rpm BR REESE E b j Hb F EM a ips Fi 11111 et eg VII EEF
35. 0 _1 _ 10 1 0 453 998 8 0131 1000 ocoocceccoeceosecce l6ambb seq 07 0 453 960 4 1 128 992 _1 _ _14 415 046 744 442 4 50113 45 9 uneer 16 seq 15 255 198 811 227 7 55119 02 9 emematch ident uncom N come l6aabb seq 08 11 341 724 12 3 10 70108 SS 2 v ident uncon l amp zxabb seq 03 255 398 810042 7 11 56 106 C48 1 manatch Hide ecer l6aabb seq 13 109 400 8100042 1 56 107 47 7 enematch ident uncon come p z lz 9 converted or reason the exclusion 77 gt 1 1 453 998 21314984 0 0 453 100 0 0 131 100 0 O 0 453 100 0 113111001 Gm9 J seq 12 2 2 354 996 013011000 20 Ji seq 04 0 0 353 100 0 01511100 0 Gm9 Ji seq 16 20 453 9960 11311997 wcesesevoeseseceecese Gm9 J seq 08 0 0 453 100 0 013111001 Gm9 J seq 01 1 0 453 995 013011000 1 seq 07 1 1 453 99 8 012011000 eeoesececcecccccccc Ji seq 11 1 0 453 998 11314 99 2 Gm9 J seq 05 3 0 453 99 3 21314
36. 04 NOV 1999 CVRC Mass Gen Charlestown MA 02129 USA Sequence update by submitter On Nov 18 1999 this sequence version replaced gi 3327977 Location Qualifiers 1422000 organism Mus musculus mol type mRNA db_xref taxon 10090 chromosome 12 map 4 0 cM 12275200 gene Dnmt3a house mouse Hospital 149 13th Street Hospital 149 13th Street REMARK COMMENT FEATURES SOUrce gene ORIGIN 1 gaatteeggc CLgotgocgg gecgcccoac acacogcaga 61 daggoLgcac ttttCecgagg goLLgacaLtc agggLoLatg Lt amp saagtort 121 agctettgct acggcaaLttce cttotoLgaa goococtogcag coocoacagog 18L cocotogoago OcOcagcotgeo CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 70 April 30 2008 User s manual 8 4 Multi FASTA format Multi FASTA format consists of multiple sequences of 8 2 FASTA format gt sequencel ACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGTCTCGCAGCCGCA GCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAGCCCGGGTGGCC gt sequence2 CAGTCCGGCAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCCGG AGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCGGCGCGATCGCGG CacCcGCGCTACAGCCAGCCTCACTGGUGCGUGGGUGAGUGCACGGGUGCTC gt sequence3 CACGACAGGCCCGCTGAGGCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCA GACGCGGGATCTCCCCTCCCC gt sequence4 CAGCAGACATCTGAATGAAGAAGAGGGTGCCAGCGGGTATGAGGAGTGCATTATCGTTAA TGGGAACT
37. 1174531993 2151 98 5 H E 1 Gm Jl seq 03 0 45311000 6 W151 100 0 o oocoococosoccceses B Gm9 seq 14 0 0 453 1000 8 0 131 100 0 PF i 1 Kk rar ne 2 Gm Jl seq 12 2 2 354 89296 9 W130 100 0 oeeaccocoacceseccoesece 2 e E a 6 3 4 Change methylation status figure 2 Comparative methylation status figures are switched one after the other by clicking Change graph link Figures 1 and 2 reflected the position of CpG sites almost ae A Eee accurately Figures 3 7 are not reflected accurately vor ZLILI IUE rr Copyright 2008 RIKEN Center for Developmental Biology All right reserved 53 April 30 2008 User s manual 6 3 5 Download comparative methylation status figure Click Download graph button to download the comparative methylation status figure which displayed at that time QUMA QUantification tool for Methylation Analysis Mozilla Firefox Tools Help tification foo for you hava myy een rea ate Methylation Analysis faai veto contact RE 28 242 246 2804 338 343 375 LB 1113 PB 1213 1313 12123 WE IVB 117246 93 Moh 672 GLI 913 100095 9235 169 92375 140 210
38. 25 41 4 0 00866 groupi group2 0 1 1 1 0 2 1 1 10 10 10 10 47 19 4 0 00866 groupi group2 0 1 0 2 20 0 2 10 10 10 10 47 19 4 0 00216 groupi group2 0 1 0 2 1 1 20 0 1 10 10 1 0 47 5 18 5 3 5 0 00433 groupi group2 0 41 02 11 11 10 10 10 10 49 17 2 0 00866 groupi group2 0 1 02 0 2 20 10 10 10 10 51 15 0 0 00216 determine two tailed p value of the significance make sum of probabilities of these 11 cases Then the two tailed p value 0 0498 Copyright 2008 RIKEN Center for Developmental Biology All right reserved 83 April 30 2008 User s manual 10 Other 10 1 How to open CSV file In many case CSV formatted analysis data file can be opened from Microsoft Excel by double clicking the file icon If not try the drug amp drop procedure indicated below 10 1 1 Mac OS Drug amp drop the data file icon to the software icon of the Microsoft Excel or OpenOffice 10 1 2 Windows Open a blank window of the Microsoft Excel or OpenOffice StartSuite Then drug amp drop the data file icon to the window Drug amp Drop to the spreadsheet window Select the file icon Data file will be opend Alternatively open the data file from the File menu gt Open sub menu change Files of type tab to All or Text files CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 84
39. tool for Methylation Analysis Typically only a few seconds are Re mri necessary to process sequence data EUN EE ee Upka halir giti Ge FASTA sipped archive eega Baw cun ts Erma etal af peed 3 Supported browsers We supported the following web browsers Firefox Mac Win Safari Opera Mac Win Internet Explorer IE 6 0 and higher Win IE 7 is not recommended because it has many bugs Many browsers such as IE 5 0 for Windows Mozilla and Netscape 6 and higher may work as well Some older browsers such as IE for Mac or Netscape 4 will not work CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved April 30 2008 User s manual 4 Overview Top page pb iy Sy ae Results of statistical analysis fl Summary of information QUMA is web based tool for CpG cp nace pop yen any qe em OCDE ti Tween ez metum gnome Seah nimz You can easily align visualize and quantify Project group samo Lesgthoftarget Namberof ged excluded total bisulfite sequence data for CpG methylation analysis same pni ud m m E tous QU s Gm Jl 455 19 13 3 16 10 6 16 methylation analysis You can easily ITUR Enter a target genomic sequence PCR target in phin sequesce FASTA or
40. 0 55 Cm Jl seq 04 0 0 453 100 0 12 0131 100 0 e coceococeceseeesese 6 5 Gm9 Jl seq 16 2 0 453 99 6 15 1191099 2 T 7 Gm Il seq 08 OD 453 100 0 16 0131 100 0 Gm J seq 01 1 0 453 99 8 18 0 130 100 0 9 8 Gm Jl seq 07 1 1 453 99 8 18 0 130 100 0 10 10 Jl seq 11 1 0 453 99 8 18 1 131 992 eeceeessesesetessts 1l 1 1 seq 05 340 453 993 18 2131 985 12 12 Gm Ii seq 02 1 0 453 9298 19 171310992 eeseeek bes etd beg n 13 13 seq 1 1 454 99 8 19 17131799 2 seaseaa aea ERR RARE 14 14 7 Ga seq 06 214 248 1 633 504 122112 504 mismatch identity unconverted converted 15 15 7 Gm IJ seq 09 241 176 536 550 13 4693 50 2 mismatch identity unconverted converted 15 18 Gm seq 15 3 1 453 99 3 18 65 230 19 2 unconverted converted 5 5 15 Analysis data Downloaded analysis data file can be opened by Microsoft Excel OpenOffice StartSuite or other spreadsheet software CSV file format See also 10 1 How to open a CSV file D Lows Lor Ran 2 Lows iak BO CC E Surrey ble ree 2 Lengi ali E53 of ig hizba of of 3 uer of botiga
41. 0 453 99 8 3 0 453 99 3 1 0 7453 99 1 1 454 99 8 Gm9 Jl seq 06 31 248 7633 50 4 Gm 71 seq 09 241 176 536 55 0 1 131 99 2 0131 100 0 0 130 100 0 0131 100 0 0131 100 0 e ocoocoocoeoocoosees 2 131 98 4 16 1 18 18 18 19 19 1 0131 100 0 00000000008 0008808 0 130 100 0 0130 100 0 eeceeeseeeretetb ben 1131 99 2 2131 985 eec eee tht ee 0008008 1 131 99 2 131199 7 0060066400606600004 22 112 804 mismatch identity unconverted converted 13 3695 50 5 mismatch identity unconverted converted 3 1 453 993 18 55 120 19 2 unconverted converted Download methylation status data Download alienment data E Bisulfite a information 6 6 9 12 15 16 18 18 18 18 19 Reset Renew figure fure Download ligure methylation statue data Download Downiced alignment data data Peg cml or reasan SES MR pagis 9 1131 98 5 0 131 100 0 oeooooocooecoooeeee D131 100 0 oeeeocoococeecoee ecc 0 130
42. 1 1 453 998 6 2131 98 5 2 2 I1 seq 03 0 0 453 1000 6 01391 100 0 oeooccacooecoocesee 38 Gm J seg 14 07 453 100 0 8 0131 100 0 ceeseccoccoesoceesco 44 O seq 12 242 454 998 9 0130 1000 55 Gm9 Jl seq 04 0 0 453 100 0 12 0 131 100 0 68 Jl seq 16 2 0 453 996 15 171310992 Gm9 Jl seq 08 0 0 453 1000 16 0 131 100 0 80 Gm9_J _seq_01 1 0 453 99 8 18 0 130 100 0 eceeseseevecteceen 99 Gm I seq 07 1 1 453 998 18 0130 100 0 e0ceeeeseeeeeeeeee8 00 Gm9_J1_seq_11 1 0 453 998 18 1 131 99 2 weceeseeecescccesce 1111 Gm9 Jl seq 05 3 0 453 99 3 18 171311985 ee 12 12 Gm J1 seq 02 1 0 453 998 19 1 131 992 eeesete testet to hh 13 13 Gm9 Jl seq 13 1 1 454 995 19 1 131 992 14 14 4 Gm9 seq 06 21 248 633 504 1 22112 80 4 mismatch identity unconverted converted 15 15 7 Gm Jl seq 09 241 176 536 550 13 46 93 50 5 mismatch identity unconverted converted 16 15 Gm seq 15 3 1 453 99 3 18 656 130 19 2 unconverted converted Reset Renew Show ture Download figure Download methylation status data Download allanment data 8 Show options M
43. 100 0 4 Gm9 J seq 12 2 2 454 99 6 9 OM 100 0 Jl seq 04 0 0 453 100 0 12 0 131 100 0 ecooecoceoesseeesee 68 Gm seq 16 2 0 153 996 15 1 131 922 7 seq 08 010 453 100 0 16 0131 100 0 8 Jl seq 01 1 0 452 99 8 18 0 130 100 0 weonessssstssesesses See 5 7 Alignment page for next step 9 Gm9_Jl_seq 07 1 1 453 99 8 18 0 130 100 0 lop Gm9 Jl seq 11 1 0 453 99 8 18 1131 992 eeoeeecetetet berto 11111 Gm I seq 05 3 07 453 993 18 21310 98 5 sae SR RRR ERR PRA 12 12 Gm9 Jl seq 02 1 0 453 99 8 19 1131 992 eeesecesesetosetot 13 13 Gm9 Jl seq 13 1 13 454 99 19 1 131 29 2 eeesesees toos bes bs 14174 Om seq 06 214 248 633 504 122112 50 1 mismatch identity unconverted converted i Lh a Gm Jl seq 09 241 176 536 550 13 46 93 50 5 mismatch identity unconverted converted Gm9 Jl seq 15 3 1 453 993 18 55 130 49 7 unconverted converted Download figure E a Reset Renew Show figure Download methylation status data Download alignment data e Show options Download figure Download methylation status alignment data Bisulfite sequence information Reset Show ligur
44. 100 0 0131 100 0 eacoenocecesasee b b 1 131 992 0131 100 0 07130 100 0 0130 100 0 17131799 7 eecesesessonasesnen 2 131 ee 11131109 2 1616 Show figure Downioad figure Copyright 2008 RIKEN Center for Developmental Biology All right reserved 19 1 131 992 122112 204 mismatch identity unconverted converted 13 46 93 50 5 mismatch identity unconverted converted 18 65 130 19 7 unconverted converted Download methylation status data Download alignment data 2 27 April 30 2008 User s manual 5 5 13 Alignments data Downloaded alignments data file can be opened by TextEdit Mac Notepad Win or other text editors Copyright 2008 RIKEN Center for Developmental Biology All right reserved Alignment results Ro Summary informat lon Enrgat See TAT nage d PE DEAE CRAT ee LEE M DETCT ITT A1 11135 8855 1918138 FEHI e h h H Tha MEER EE PAR MA h nm n Jiu Hw ett sg MEI ME AMI
45. 100 0 1 131 99 2 0131 1 00 0 adeb e cR RR OR RR DA 0 130 1000 0 130 100 0 20 1131 RATT 2131 98 5 se 1 131 99 2 eese RE RR RR E RAE 1131 9027 assess ERR RR AAA RR RA 1 22 112 80 4 mismareh a ident unicam 9 conr 13 436 93 0 7 mismatch aident urscaev 9 cony 18 658130 49 2 unceny cons 1 131 997 April 30 2008 User s manual 6 4 Statistical analysis result page options 6 4 1 Show options 1 Click the Show options link to show optional fields right top figure 6 4 2 Show options 2 Optional fields will appear left bottom figure 6 4 3 Hide options Click the Hide options link to hide optional fields right bottom figure E Sorting conditions CpH CpA CpC CpT Bisulfite sequence information Reset exclude Ne aE 1 145 de 79 Tes you have any quest please feel free to contact Z Renew Downiced statistical data Download alignment data mismatch gap Me unconverted alignment length foe dentin CPG 6 converted 1 1 453 99 8 0 0 453 100 0 0 0 453 100 0 Sequence Methylation pattern or reason for the exclusion 7 6 2 131 98 5 009900000 0 6 013111000 0131 100 0 oeeeoooooo
46. 11910902 Copyright 2008 RIKEN Center for Developmental Biology All right reserved 58 April 30 2008 User s manual 6 3 11 Change the order of bisulfite sequences 2 The change is reflected Two sequence groups are ordered separately 6 3 12 Download alignments data Click Download alignment data button to download alignments data E Bisulfite sequence information Renen Oownioed statistical Sequence seq 13 J seq 02 Jl seq 04 71 seq 11 Jl seq 07 Gm Jl seq 01 Jl seq 06 Jl seq 16 Jl seq 04 Jl seq 12 Gm J seq 14 Ged 71 pq 03 1 seq 10 Jl seq 06 Gm9 71 seq 09 seq 15 a 2 Za ns E EG no _1 seq 02 H yon fave any quatum comments nh pna te contact E Show options mismatch gap lengik 1 1 13 454 99 8 1 0 453 99 8 3 0 453 99 3 0 443 99 8 1 lj 423 99 8 1 0 453 99 8 040 453 100 0 2 0 443 99 5 040 453 100 0 2 2 454 99 6 00 453 100 0 0 453 100 0 1 1 453 99 8 314 448 633 50 4 241 176 536 55 0 3 1 453 99 3 1 0 453 99 8 guma Quantficatian tool for Methylation Analysis Ma
47. 6 7 Conditions to exclude bisulfite sequences 2 34 5 7 Alignment DAG G 35 5 7 1 Overview of alignment page 35 5 7 2 Download alignment data 36 5 7 3 Alighment d tl a CSRS 36 5 8 FIQUE 37 5 8 1 Download methylation pattern figure 37 5 8 2 Change methylation pattern figure 1 37 5 8 3 Change methylation pattern figure 2 38 5 8 4 Show 5 38 5 8 5 FIGUE Tess cen v 39 5 8 6 Option of figure 1 39 5 0 2 FIQUEG Adelle 40 5 80 OPUN OT TOUTE 2 e 40 599 FOUTE SN DD aaa 41 5 8 10 Option of figure 3 41 5 0 T1 FIGUE E 42 5 8 12 Option of figure 4 42 Statistical analysis mode 43 6 1 Main features oett tuta aul 43 6 2 TOP 44 6 2 1 SHOW ODUORS 44 6 2 2 Optional fields 44 6 2 3 Genomic sequence 45 6
48. 93 50 5 mismatch identity unconverted converted 16 Gm9 seq 15 3 1 453 99 3 18 66 130 49 2 unconverted converted E Bisulfite sequence information Sorting conditions CpH CpA CpC CpT ditions to exclude low quality sequences a 9 user specified order _ mmber of methylated CpGs Upper limit of unconverted CpHs 5 number of unconverted CpHs percent converted CpHs Lower limit of percent converted CpHs 950 number of mismatches percent identity Upper limit of alignment mismatches 10 sequence name Lower kmit of percent identity 1900 ascending order 5 descending order Reset with new parameters etin stus Dornicnd exclude mismatch gap Methvlati 11 1 Gm9 seq 10 1 1 453 99 5 6 2 131 98 5 22 Gm9 1 seq 03 0 0 453 1000 6 0 131 100 0 33 9 seq 14 0 0 453 1000 8 0 131 100 0 ceeecoococceeocceeecc 44 Gm9 Jl seq 12 2 2 454 996 9 0130 1000 oeeecoooooeeoceeece 55 Gm9 J1 seq 04 0 0 453 100 0 12 0131 1000 00 66 J Gm9 Jl seq 16 2 0 453 996 15 1 131 99 2 77 Gm9_J1_seq_08 0 0 453 100 0 16 0 131 1000 88 Gm9 Jl_seq 01 1 0 453 998 18 0 130 100 0 1 99 7j Gm9 Jl seq 07 1 1 453
49. Cross mismatch or gap Methylation pattern 4 is not present when quality of bisulfite sequence is low or excluded from user Low quality value is shown as magenta When excluded reason s for the exclusion will be indicated at methylation pattern column 4 Conditions to exclude low quality bisulfite sequences can be changed See 5 6 1 Show options 1 for more detail Copyright 2008 RIKEN Center for Developmental Biology All right reserved Bisulfite sequence information Rare Download statistical data 1 2 3 JR RJ mismatch gag alignment lengih 6 identity Gm Ji seq 10 Cm JI 03 Jl seq 14 Gm seq 12 Gm Jl seq 04 Gm Jl seq 16 Gmt Ji seq 08 Cm seq 01 J seq 07 Gm Jl seq 11 m Jl seq 05 Cm 71 seq 02 CunO seq 13 seq 06 Gm Jl seq 09 Gm Jl seq 15 16asbb 02 Gm l aabb seg 09 Gm l amahb seq 01 Gm l aahb seq 12 Cm 1 seq 06 Gmt 16asbb seq 05 l aahb seq 11 l aabb seq 04 Gm seq 16 Gm l azbb seq 10 Gmt 16ashb seq 07 LB 0 16aabb seq 14415 3468 101 202 210 0 0 1 0 1 140 3 0 1 05 1 Di 314 448 241 17 3 Di 1 0 T E i iT n 10 0 0 qr 453 9951 453 100 0 0 0 453 10
50. Download figure Download methylation status data Download alignment data W vv exclude mismatch gap Methylation ascending descending order Then click Renew button TI umo ML Ifi 1 Gm9 71 seq 10 1 1 453 998 6 2 131 98 5 gt user specified order 22 Gm9 J1 seq 03 0 0 453 100 0 6 0 131 100 0 0000 0000 0 0 W W 33 Gm9 1 seq 14 0 0 453 1000 0131 1000 oeeeoocoooeecoeeeco The value of order column a 55 Gm9 J1 seq 04 0 0 453 1000 12 0131 1000 0 000 0 n u m ber of methylated CpGs 6 5 Gm9 seq 16 2 0 453 99 6 15 1131 992 eeeeeecoeeeeeceecee 17 Gm9 11 seq 08 0 0 453 1000 16 0131 100 0 n of n CO n ve r S n S 88 Gm9_Ji_seq 01 1 0 453 998 18 0120 1000 99 Gm9 seq 07 1 4 453 995 18 0130 1000 10 10 Gm9 J1 seq 11 1 0 453 99 8 18 1131 992 unconverted CpHs CpA CpC CpT 5 rr 12 12 Gm9 71 seq 02 1 0 453 998 19 1131 992 gt percent conversion 13 13 Gm9 J1 seq 13 1 1 454 998 19 1131 992 14 4 4 Gm Jl seq 06 314 248 633 504 1 22 112 80 4 mismatch identity unconverted converted m lt Gm9 Ji seq 09 241 176 536 5
51. converted 155 seq 09 241 176 536 55 0 13 4693 50 5 mismatch identity unconverted converted 1616 Gm9 Jl seq 15 3 1 453 993 18 66130 49 2 unconverted converted Reset P Renew Jj Show figure Dewnkced figure Dewnicad methylation statue data Download alignment data 25 CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved April 30 2008 User s manual Bisulfite sequence information E Show options 5 5 9 Include exclude bisulfite sequence 2 Reset Show figure Tigure Download methylation status data Dowload alignment data s mismatch gap UNS 2 The change is reflected 7 ee Memes Gm Jl seq 10 1 1 453 998 6 Gm Jl seq 03 0 0 453 1000 6 Q I31 100 0 cecocooocoecooceese 8 9 2 131 98 5 Gm9 _ 14 0 0 453 1000 W131 100 0 Gm Jl seq 12 2 2 454 90 W130 100 0 oweecoooccseoceeece 7 Gm9 JI seq 04 Of 453 100 0 12 W131 100 0 Gm Jl seq 16 21 0 453 9086 15 1 131 992 Gm Jl seq 01077453 100 0 16 WII 1000 Jl seq 01 1 0 453 99 8 18 0 130 100 0 a Gm seq 07 1 1 45
52. data Project name optional only contain A Z a z 0 9 and Enter a target genomic sequence PCR target in plain sequence FASTA or GenBank format or upload target genomic sequence PCR target file plain sequence FASTA GenBank format enomic se e E Enter bisulfite sequences in multi FASTA format multi FASTA format file or zipped of sequence files Sequence group name optional Apply sample bisulfite sequences m bla Enter second bisulfite sequences for statistical analysis in multi FASTA format upload bisulfite sequence file Copyright 2008 RIKEN Center for Developmental Biology All right reserved m S tion tool for If you have questions comments requests etc tion Analysis plane fros to contact 311 HOME OVERVIEW TERMS OF USE DOWNLOAD REFERENCE ACQOMEDGENENTS Sample sequence files S LI April 30 2008 User s manual 6 2 5 Genomic sequence file 2 Rs ce EEFE QUant sasaw Irile Upload Select a target genomic sequence file to upload See also 7 1 n gow l OI Overview how t 5 Genomic sequence 5 Enter a target ge Desktop e Documents 5 1 1 046 me E GI FASTA 2 Bone Sequence group name optional
53. figure button to go to figure page where other types of figures can be created with detailed parameters See 5 8 Figure page for next step 5 6 Result page options 5 6 1 Show options 1 Click the Show options link to show optional fields Bisulfite sequence information Reset Renew Show figure Download tiure Download alignment data order Na mee ha lA lj dh P D p j p 1 exclude rl L1 Sequence name Gm9 1 10 Gm Jl seg 03 Gm Jl seq 9_ seq 12 Gm9 Jl seq 04 Gm9 seq 16 Gm Jl seg 08 J seq 01 Jl seq 07 m9 seq 11 Gum Jl seq 05 Gm Jl seq 02 Gm seq mismatch gag identity 1 1 453 99 8 0 0 453 100 0 0 0 453 100 0 212 454 99 6 0 0 453 100 0 2 0 453 99 6 0 0 453 100 0 1 0 453 99 8 1 1 453 99 8 1 0 453 99 3 0 453 99 3 1 0 453 99 8 1 1 454 99 8 Gm9 J seq 06 114 248 633 50 4 Gm seg 09 231 176 536 55 0 CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 3 1 453 993 CpG 0 converted Bisulfite sequence information Show options KEren eure Doreen figure Downlend methyistion statue data Download alianmant mismatch gap Enn O en aaa 1 Gm Jl seq 10
54. methylation analysis Overview how to use QUMA Quick start Execute with E plam sequence FASTA or GenBank format The genomic sequence musi be an unconverted sequence between primer pam not necessary to convert C to Upload bisulfite sequence file E muiti FASTA format file or zipped archive of sequence files Raw sequence data can be used Removal of plasmid vector sequence i5 not necessary ES Copyright 2008 RIKEN Center for Developmental Biology All right reserved 13 April 30 2008 User s manual 5 4 2 Optional fields Optional fields will appear The third text input field is used only for the Statistical analysis mode Ei Price or oum acr 0t Sand el Ermer a target gencesic sequezee PCR target ie sequence FASTA ex GenBank format ea oo ou qet E Copyright 2008 RIKEN Center for Developmental Biology All right reserved 14 April 30 2008 User s manual 5 4 3 Hide options If you want to go back to the simple top page click the Hide options link 5 4 4 Genomic sequence Input a project name optional When the project name is presented it will be included in the output file name The target genomic sequence can be input by two ways of 1 direct input and 2 upload 1 In case of direct input paste a target genomic sequence 8 1 Plain sequence 8 2 FASTA or 8 3 GenBank format See also 7 1
55. to create zipped j sample genome fasta archive Macintosh and 8 7 How to create zipped archive Documents Windows Desktop If yos have any questions comments requests pum dud Sun in content anna eh ip i gt 9 plain sequence Apply sample Enter bisulfite se Ns Computer a Network 9_ J1 plan sea Places Files Optional Enter second bisulfite sequences for statistical analysis multi FASTA format Copyright 2008 RIKEN Center for Developmental Biology All right reserved 47 you quat ics co THTHITI EE piam feel free bo contact gura Eod Hx fl April 30 2008 QUMA User s manual Project name optional only contain A Z a z 0 9 and Gro Gab Enter a target genomic sequence PCR target in plain sequence FASTA or GenBank format ChRAGAZCAZCTIGZCAZCITCSZAGAARACICZATCTICCAGIICIACGIAGCICGAGZGCGGCGAAGGCAICRCACC AIAAATGCGCAIGCACACGCGCACCIIGAAGGCIGGGCIITICICAGCBAGCICAGAGGCTCICGIGAGA TTIICATCCITAGTCICGCTCTICTGCCCCTTCCCCCACAAGACACAGGITTTCCCTCCGARAAACCACAC 2 If mr La LOC ACTI AGO aa 6 2 9 Second bisulfite sequence group Input a group name of second bisulfite sequence group optional BE Apply sample genomic sequence Then input the bisulfite sequences of second group E E
56. was designed for reverse strand of the genomic sequence gt Both Search both direction of conversion and adopt more appropriate strand 6 2 14 Submit Click the Submit button to analyze Typically only a few seconds are necessary Sime QUMA Quantification tool for Methylation Analysis Mozilla Firefox Co mes Ele Edit History Bookmarks Tools Help re tool for If yos have any questions comments requests at a please free to contact guma riken ip browse multi FASTA format file or zipped archive of sequence files Sequence group name optional Apply sample bisulfite sequences Optional Enter second bisulfite sequences for statistical analysis in multi FASTA format or upload second bisulfite sequence file for statistical analysis mult F ASTA format file or zipped archive of sequence files Sequence group name optional Apply sample bisulfite sequences Conditions to exclude low quality sequences p Conversion CpH CpA CpC CpT C gt T conversion S Upper limit of unconverted CpHs 5 conversion of forward strand of the genomic sequence E Lower limit of percent converted CpHs 950 9 Upper limit of alignment mismatches 10 2 Lower limit of percent identity 900 gt conversion conversion of reverse strand of the genomic sequence earch both directions and select t
57. you want change conditions to exclude low quality bisulfite sequences gt Upper limit of unconverted CpHs number of unconverted CpHs CpC and CpT gt Lower limit of percent converted percent of number of converted CpHs number of CpHs gt Upper limit of alignment mismatch number of alignment mismatches and gaps between genomic and bisulfite sequences gt Lower limit of percent identity v percent of alignment identity between genomic and bisulfite sequences on een ns ee Cm Elle Edit History Bookmarks Tools Help e CO OO 6224 ee My tool for If yos have any questions comments requests etc ylation Analysis please feel free to contact riken ip Overview how t Look in a Desktop gt gt 7 le se files Project name 2 sample genome fasta A i Shortcut to Useri Enter target ger My Network Places windows Media Player z seq _16 mul fasta Ji plan seq up load target and Support De Browse plain sequence home My Documents 2 Apply sample Enter bisulfite se m okanolab on cdbfs1 Paint LN Beis File name m3_J1_plan_seq bisulfit Places muki FASTA fc ype zi Sequence group 5 isulfite Optional Enter second bisulfite s
58. 0 0 454 99 6 453 99 6 453 100 0 453 99 8 18 453 99 8 153 99 8 463 9937 453 55 8 Show options ried Mesirrlatian partera reaten for the exclusion 211311989 5 131 100 0 8 0 131 100 0 0130 100 0 2 01311100 D eocosooceceese 1131199 1 easet e oct eh nRRO RA D 131 100 D 013011200 eecesaeese ae 07130 100 0 1131199 2 21151 CSR 5 oe 454 99 8 633 10 4 536 55 0 453 99 3 453 99 8 453 99 3 3057 43 0 0 45 1 05 45 2 2 455 2 1 43 2 1 45 1 00 453 90 Gm l aabb seq 15 265 398 Gm l aabb seq 08 414 341 m lbaahb seq 03 465 398 469 400 m l6aabb seq 13 3 693 50 5 mamatch 6 ident uncon cae 11311927 aat RR ERE ARR 1131 99 2 22112 RO 4 9 ident une av s cae 66 130 39 2 fuson con 1 131 99 2 2 07130 1090 0 oo00Do w00DooceoDoono l 130 589 2 3 0131 100 0
59. 1 95 5 453 99 3 8 66 130 419 2 oncon conr 63 QUMA Quantification teol for Methylation Analysis Mozilla Firefox April 30 2008 User s manual vew History Bookmarks Tools Heb E E Boinyiation Analys d OVbAVIEW TEAMS OF USE DOWNLOAD REFERENCE lt tr rc 6 4 6 Conditions to exclude bisulfite sequences 1 p Lm Conditions to exclude low quality bisulfite sequences can be changed Then click Reset with new parameter button order and exclusion of bisulfite sequences will E En be reset rT gt Upper limit of unconversion a Ee number of unconverted CpHs CpA CPC and CPT EOIS gt Lower limit of percent conversion eee percent of number of converted CpHs number of CpHs LU eats 204908 IDIOMS gt Upper limit of alignment mismatch Y number of alignment mismatches and gaps between genomic and bisulfite sequences e QUMA Quantification tool for Methylation Analysis Mozilla Firefox a i bp Lower limit of percent identity eese trium iiim Botnylation ge wary percent of alignment identity between genomic and bisulfite sequences ete he P5 cer ab M Bisulfite sequence information Ivi Hide options E Sorting conditions Cp Cp CpT E Conditions to exchade low quality sequences 3 user spec
60. 1 1 IN LETT ATE T l l 1 ET Lee 1 11 I amp i E LET CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 65 April 30 2008 QUMA User s manual ee URN DNO NA Dinary irm inn aqare mans fete 3 penas 1 d Bre DITT m sf y rar of fhe ogenonii bszulT iti els Ah A Ge cal nunc waro PE 6 5 2 Download alignment data nai on of biete 8 Cl ic k P Down load al n ment data http quma test cdb riken jp Alignment result Mozilla Firefox ren ated Coli 5 button to download alignment data Alignment result Summary information which displayed hear S AS REN Download alignment dete gt w Cede Tp of cls ell i nerrent idea ty 37 8 3 Mette at bons eal ten PHP AMBIENT M ILE uma hola ui Mak yell Xlmixmalchl JH nber e CIR PTT ELI Bisulfite sequence name 16aabb seq 05 ee C gt T conversion conversion and detection of forward strand of the genomic sequence anam ame Length ofbisulfite sequence 983 Length of target genome sequence Aligned region of bisulfi
61. 2 4 Genomic sequence file 1 45 6 2 5 Genomic sequence file 2 46 6 2 6 First bisulfite sequence group 46 6 2 7 File of first bisulfite sequence group 1 47 6 2 8 File of first bisulfite sequence group 2 47 6 2 9 Second bisulfite sequence group 48 6 2 10 File of second bisulfite sequence group 1 48 6 2 11 File of second bisulfite sequence group 2 49 6 2 12 Conditions to exclude bisulfite sequences 49 6 2 13 Strand of bisulfite conversion 50 6 2 14 50 6 3 Statistical analysis result page 51 6 3 1 Overview of statistical analysis result page 1 51 6 3 2 Overview of statistical analysis result page 2 52 6 3 3 Change methylation status figure 1 53 Copyright 2008 RIKEN Center for Developmental Biology All right reserved 3 April 30 2008 User s manual 6 3 4 Change methylation status figure 2 6 3 5 Download comparative methylation status figure 6 3 6 Overview of statistical analysis result page 3 6 3 7 SNOW Align MENT 6 3 8 Include exclude bisulfite sequence 1 6 3 9 In
62. 3 898 18 W150 100 0 10 1 seq 11 1 0 453 998 18 1 7131 99 2 11 Ji seq 02 1077453099 8 19 1 131 99 2 12 Jl seq 1 11 454 99 19 1151199 ud d 173 oo 13 y 3 0 453 99 3 2 131 98 5 user desired 14 14 gt Gm9 Jl seq 06 314 248 633 504 1227112 0 1 mismatch identity unconverted converted 15 15 7 QGm9 Jl seq 09241 176 536 550 13 4693 50 5 mismatch identity unconverted converted 16 16 J Gm9 seq 15 3 4 453 993 18 66 130 49 2 unconverted converted S a p Reset Renew Show figure Download figure Download methylation status data Download alignment data J seq 1 1 134 99 8 19 131 997 14 God Jl seq 06 515 248 633 50 7 1 22 112 80 4 mismatch identity unconverted converted la E Bisulfite sequence information 8 Show options 5 5 10 Change the order of bisulfite sequences 1 ESED sentare Somosi erren mismatch gap Change the value of order column to desired order Then click Renew 255 SIN NM orm a button 1 5 seq 10 1 1 453 998 6 DII PES
63. 5 l6aabb seq 15 l wbb scq 06 Gm l5aabh seq 03 Gm9 l6asbh seq 13 lation Analysis 314 248 633 50 4 241 176 36 55 0 3 11453 99 3 1 02453 99 8 3 1 453 993 5 1 453 98 9 0 00 453 100 0 1 0 443 99 8 212 453 99 6 2 1 454 99 6 2 1 434 99 6 1 0 453 99 8 1 amp 0 4453 96 0 415 346 144 44 1 10 7 457 97 8 465 398 811 42 7 414 341 724 42 8 4 amp 8 398 810 42 2 459 400 810 432 1 1 you have any questions comments requests etc aan guma cdb ritenjp pleas feel free to contact Methylation patte 9 converted or reason for the exclusion A 2 131 98 4 0 131 1000 0 131 100 0 oeeeccooooeecoeeeoco 0 130 100 0 0 131 100 0 0 0 1 131 99 2 0 131 100 0 07130 100 0 0 130 100 0 1 131 99 2 2 131 98 4 1 131 99 1 1 131 99 2 1 131 99 2 Q0 130 100 0 2055 yore bare a
64. 50 13 4693 50 5 mismatch identity unconverted converted percent of converted CpHs total CpHs Gm9 Jl seq 15 3 1 453 99 3 18 65 130 49 2 unconverted converted number of mismatches Reset C Show figure Download ligure Download methylation status data Downiced alignment data percent identity 5 ON 1 5 lt Bisulfite sequence information Hide options E Sorting conditions CpC CpT FA 1 Conditions to exclude low quality sequences sequence name user specified order number of methylated CpGs Upper limit of unconverted CpHs 1 number of unconverted CpHs percent converted CpHs Lower limit of percent converted CpHs 950 ascending order unici am sequence name asccadiag order descending order Reset with new parameters VV VV WV des ce n d i n O rde r Reset Renew Show Download figure Downiced methyletion status data Dommicad alignment data mismatch uc BS 1 2 0 453 99 6 15 1 131 992 22 0 0 453 1000 8 0 131 100 0 oeeeooooooeeooeeeoco 5 6 5 order of bisulfite sequences 2 3 3 Gm9 seq 13 1 1 454 998 19 1 131 99 2 The ch ange is reflected 44 Gm9 seq 12 2 2 454 996 9 0130 1000 oeeeocccooeecoeeece 5 5 Gm9 J1 seq 11 1 0 453 995 18 1 131 99 2
65. 6 m format into a folder Acceptable file extension of sequence file is ho E 2 Right click on the folder Slide the mouse up to Send and then click on Compressed zipped Folder Explore Search Sharing and Security Scan For Viruses Send Compressed zipped Folder Cut 9 Desks create shortcut Copy Mail Recipient Create Shortcut My Documents EEE 225 DYDICD RW Drive D Rename Removable Disk E Properties SEQUENCE Copyright 2008 RIKEN Center for Developmental Biology All right reserved 75 April 30 2008 User s manual 3 The zipped archive automatically appears as a folder icon with a zipper at the same location as the folder you selected Type Compressed zipped Folder Date Modified 11 16 2007 6 39 PM Size 15 3 KB 8 7 2 Other Windows Please use 7 Zip WinZip or other program to create zipped archive Copyright 2008 RIKEN Center for Developmental Biology All right reserved 76 April 30 2008 User s manual 9 Statistical test 9 1 Fisher s exact test The statistical significance of the difference between two bisulfite sequence groups at each CpG site is evaluated with Fisher s exact test that is non parametric statistical significance test to determine if there are nonrandom associations between two categorical data Fisher s exact test can use the same way as the Chi square test for independence and mor
66. 6 3 8 Include exclude bisulfite sequence 1 To include exclude a bisulfite sequence check off on exclude checkbox Then click Renew button To include all bisulfite sequence information click unselect all link QUMA Quantification tool for E Bisulfite sequence information Reset Renew Download statistical date Download alignment data 2 Las SBREREREKREREEE EK bk Pi Li exclude Sequence B name Gm9 J1 seq 10 Gm9 11 seq 03 Gm9 Jl seq 14 Gm9 71 seq 12 Gm9 11 seq 04 Gm9 J seq 16 Gm9 J1 seq 08 Gm9 71 seq 01 Gm9 Jl seq 07 Gm9 71 seq 11 Gm9 7 1 seq 05 Gm9 J1 seq 02 Gm9 71 seq 13 Gm9 J seq 06 Gm9 11 seq 09 Gm9 seq 15 Gm9 16aabb seq 02 314 248 633 50 4 241 176 536 55 0 mismatch gap Me 99 identity 96 1 12 453 998 6 0 0 453 100 0 6 0 0 453 100 0 8 22 454 99 6 9 0 0 453 100 0 2 0 453 99 6 0 0 453 100 0 1 0 453 99 8 1 1 453 998 1 0 453 99 8 3 0 453 993 1 0 453 99 8 1 1 454 998 3 1 453 993 1 0 453 99 8 2 gt VIT 21 Wwe 15 Gm Jl seq 06 Om5 1 seq 09 Jl seq 15 l aabb seq 02 l aabb seq 09 Gm seq 01 l mabb seq 12 Cm9 1 seq 06 Gm9 1 seq 11 l aabb seq 04 Gm l aabb seq 16 Cmn 16 seq 10 Cm l6aabb seq 07 9 l asbb seq 14 Gm9 l6asbb seq 0
67. 724 42 8 10 70 108 35 2 mismatch ideni uncon con 458 398 810 2 11 56105 35 1 mismatch eident unconv E 459 400 10 422 1 11 55 107 47 7 mismatch ident uncon can 111 4531998 bare amy qeenhorcommants resah ate irea ter TEE Di converted reason the exclusion 1131 FE 5 ecococoaoocokc sd bd 0 0 453 100 0 0 453 100 0 2 2 454 99 6 0 0 453 100 0 2 0 453 99 6 0 0 453 100 0 110 443 99 8 1 1 443 99 8 433 799 8 3 0 433 99 3 1 0 483 99 8 111 444 99 8 0 131 100 0 0131 100 0 cama concocaeoceae oc 0 130 100 0 o esoocoooasocesece 100 f 1131 99 7 0 131 100 0 120 100 0 0 130 100 f 1 1 992 eos ba ERR R RRTER 2131 98 5 aec 1 131 99 2 edet bb ttbi th 1131190 7 ees bh RA RR RR IJ seg 06 314 248 633 50 3 1 22 112 80 4 mismateh ient e con Jl seq 09 241 176 5336 553 7 13 46 93 50 3 mismatch 4 ident umece conv Gm9 seq 15 3 1 453 99 3 18 55130 49 7 ucam conr l aabb seq 02 1107453199 2
68. 8 RIKEN Center for Developmental Biology All right reserved April 30 2008 User s manual A Summary of information 5 5 2 Overview of analysis result page 2 Project sequence Length of target Member of Cpls Number of bisulfite sequences A Summary of information name group genome sequence used excluded total Cm 11 453 19 13 3 16 Length of the target genome sequence number of CpG sites and E Methylation status of each CpG site number of bisulfite sequences are indicated CpGposition 26 42 49 54 78 88 90 118 134 Meca 913 IVB 612 1013 913 613 913 B Methylation Status of each CpG SItes 4656 500 769 602 615 53 89 462 692 CpG position 198 212 28 242 246 264 338 343 375 1213 113 WG 15 WG LED 10 13 12 13 182 246 92 3 34 6 692 615 923 00095 925 76995 923 140 Position and methylation status of each CpG sites and figure of methylation status are shown Me CpG Lois S Hekhyleted Cx Download graph 5 5 3 Change methylation status figure 1 Click Change graph link to switch methylation status figures Project Length of target __ Number of bisulfite s nude dd mre minns E Gm9 Ji Jl 453 19 13 3 16 Methylation status of each CpG site CpG position 26 42 49 54 78 90 118 134 n 9 13 1113 6 12 1013 913 13 713 613 913 e CPG 7 34 6 500 769 692 615 53 8 462 69 2 CpGposit
69. 82 823 B 6 11 10 80 17 8 18 700 i3 n3 M 1 DOAS DIZGROIB OOS MEA fhe uenenum af aa prar ores Heated Xon manch 453 BO B 453 E B 483 109 483 483 T0 E 453 100 102 453 59 8 453 EO B 453 Ej 3 483 sa HM 453 453 53 453 453 A53 483 18 08 38 Copyright 2008 RIKEN Center for Developmental Biology All right reserved oo de BS lt ga lt E 130 ILA LE 13 EIR EEE ETETETT UGUALI ee 131 LES RLRLR RR RU RR 131 RU 13 PAULL PD DVD numm 131 1 30 aoc lace 131 LERULRLELERLR RNA RMS 130 RULFULIUE RU 130 RULRUL RU FUR FULL N11 131 LLRULRULRUE FUR 131 LLRULRULTUR RUE 130 ee 13 1 131 131 127 113 24 ng wai e 2 131 882 ovoococoococsosssss 0 131 100 0 0 131 0 130 100 0 oae eo D 07131
70. 9 6 19 9 19 12 19 15 19 18 19 0 5 89 6 group2 3 19 5 19 5 19 7 19 7 19 0 2842 5 Copyright 2008 RIKEN Center for Developmental Biology All right reserved 81 April 30 2008 User s manual Table 2 Position 1 1 2 3 4 5 6 7 8 Me CpGs CpGs 3 19 5 19 6 19 7 19 9 19 12 19 15 19 18 19 number of Rank sum rank 1 23 45 6 7 8 9 10 11 Sequences rank average 1 2 5 45 6 5 8 9 10 11 group1 0 0 2 0 1 1 1 1 6 47 R number of group2 1 2 0 2 0 0 0 0 5 19 sequences total 1 2 2 2 1 1 1 1 11 U1 n no n ny 1 2 4 U2 n N2 1 2 R gt 26 U min 91 U2 4 When the marginal totals are fixed there are 179 cases and 11 cases indicated below have U value not more than the U value of the sample Copyright 2008 RIKEN Center for Developmental Biology All right reserved 82 April 30 2008 User s manual Position 1 2 3 4 5 6 7 8 Me CpGs CpGs 3 19 5 19 6 19 7 19 9 19 12 19 15 19 18 19 Rank U value Probability rank 1 2 3 4 5 6 7 8 9 10 11 sum rank average 1 25 4 5 6 5 8 9 10 11 groupi group2 1 0 20 20 1 1 04 01 01 21 5 44 5 0 5 0 00433 groupi group2 10 20 20 0 2 10 01 01 23 43 2 0 00216 groupi group2 1 0 20 20 0 2 0 1 1 0 01 04 24 42 3 0 00216 groupi group2 1 0 20 20 0 2 01 01 10 01 25 41 4 0 00216 groupi group2 1 0 2 0 1 1 20 0 1 0 1 0 1 0 1 23 5 42 5 25 0 00433 groupi group2 1 0 20 1 1 1 1 1 0 OM 01 014
71. 91 probability 0 0069995962 0 0699959618 0 2362363710 0 3499798089 0 2449858662 0 0801771926 0 0111357212 0 0004894823 To determine two tailed p value of the significance make sum of probabilities of the case when the absolute value of bc is not less than the absolute value of bc of the sample In this data the cases of a 6 12 and 13 are used Then the two tailed p value 0 0069995962 0 0111357212 0 0004894823 0 0186257997 Copyright 2008 RIKEN Center for Developmental Biology All right reserved 78 April 30 2008 User s manual 9 2 Mann Whitney U test The statistical significance between two groups of the entire set of CpG sites is evaluated with the Mann Whitney U test also called the Wilcoxon rank sum test that is non parametric statistical significance test for two distributed samples Although Student s t test is useful in the same situations as Mann Whitney U test we adopt not the parametric Student s t test but the non parametric Mann Whitney U test because methylation status does not distribute as a normal distribution especially in case of hyper or hypo methylation Two tailed p value of the Mann Whitney U test is determined from ranks of ratio of CoG methylation to all CpG at each bisulfite sequence exampled below This p value indicates the independence of distribution of the ratio of CoG methylation to all CpG Importantly this test dose not detect differences in the
72. 98 5 ss eet s estote Gm9 J seq 02 1 0 353 998 L131 99 2 Gm9 J seq 13 1 1 454 99 8 11314991 7 seq 06 14 248 633 50 1221124804 mismatch unconverted s converted 7 seq 09 241 176 5360 55 0 13 4691 50 5 mismatch identity unconverted converted 16 7 seq 15 3 1 453 993 18 55 1 0 59 2 unconverted converted Reset Renew Show figure Downoad ligure methylation status deta Downioed akerenent dota qn a Cw WS 2h he Bis alz ore x a E E w u a boli S E is e iii ek f Domnom c cel Dom load sheresent data Methylation status analysis Statistical analysis Copyright 2008 RIKEN Center for Developmental Biology All right reserved 8 April 30 2008 User s manual 5 Methylation status analysis mode be edd konst 5 1 features a gt Raw bisulfite sequences are acceptable omamne No need to exclude plasmid vector eee Paste or upload genomic sequence and ao bisulfite sequences seq uence Sara runt Raw bisulfite sequences acceptable OO Removal of plasmid vector sequence from Typically only a few seconds are necessary m NEN
73. 998 18 0 130 1000 10 10 L Gm9 Ji seq 11 1 0 453 998 18 1 131 99 2 11 11 Gm9 Jl seq 05 3 0 453 993 18 2151 985 ex eeeecececcececec 12 12 Gm9 Jl seq 02 1 0 453 99 8 19 1 131 992 13 13 Gm9 J1 seq 13 101 454 99 8 19 1 131 99 2 14 14 4 Gm9 seq 06 314 248 633 504 1 22 112 0 1 mismatch identity unconverted converted 15 15 7 Gm9 Jl seq 09 241 176 536 lt 5 0 13 4693 50 lt mismatch identity unconverted converted 16 16 Gm9 Jl seq 15 3 1 453 993 18 66 130 49 2 unconverted converted Reset Renew Show figure Download figure Download methylation status data Download aligrenent data Copyright 2008 RIKEN Center for Developmental Biology All right reserved 32 April 30 2008 User s manual i options Sorting conditions CpH CpA CpC CpT Ez Conditions to exclude low quality sequences user specified order number of methylated CpGs Upper Emit of unconverted CpHs 5 5 6 4 Change the order of bisulfite sequences 1 e E m number of mismatches percent identity Lower limit of percent identity 900 9 sequence name Order of bisulfite sequences can be changed by several parameters and ascending ode descending nith rew parameter Reset Renew Show
74. AD i ACKNOWLEDGEMENTS Overview how to use QUMA Quick stat Execute with sample sequence data Mer ta et geno 4 target m piam lt 4 or Genbank gt ref NT_111909 2 MmX_ 110779 37 c2447217 2446765 Mus musculus chromosome X genomic contig strain C57BL 64 ATAAATGCGCATGCACACGCGCACCTTGAAGGCTGGGCTTTTCICAGCGAGCTCAGAGGCTCTCGTGAGA TITCATCCTTAGTCTCGCTCTTCTGCCCCTTCCCCCACAAGACACAGGTTTTCCCTCCGAAAAACCACAC or upload target genomic sequence PCR target file plain sequence FASTA or GenBank format E Apply sample genomic sequence Enter bisulfite sequences in multi FASTA format IC OTI pi or upload bisulfite sequence file multi FASTA format file or zipped archive of sequence files Sequence group name optional 9 Apply sample bisulfite sequences Optional Enter second bisulfite sequences for statistical analysis in multi F ASTA format Copyright 2008 RIKEN Center for Developmental Biology All right reserved 15 April 30 2008 User s manual Eile Edit View History Bookmarks Tools Help 5 4 5 Genomic sequence file 1 ror imis en ey ded lll 2 Or click the first button in this case Browse button to upload a target genomic sequence file Overview how to use QUMA Quick start Execute with sample sequence data Project name optional only contain A Z a z 0 9 and Enter a target genomic seque
75. Apply sample bisulfite sequences Optional Enter second bisulfite sequences for statistical analysis in multi FASTA format 6 2 6 First bisulfite sequence group Input a group name of first bisulfite sequence group optional The bisulfite sequences can be input by two ways of 1 direct input If have any questions comments requests S stems feel frao to contact tama De nimp ARR and 2 upload 4 Overview how to use QUMA 14 Quick start E Execute with sample sequence data 19 Sample sequence files Project name optional only contain A Z a z 0 9 _ and A 1 In case of direct input paste the bisulfite sequences 8 4 Enteratarget genomic sequence PCR target in plain sequence FASTA or GenBank format ref NT 111909 2 iMX 110779_37 2447217 2446765 Mus musculus chromosome X AIAAAT GCGCAIGCACACGCGCACCIIGAAGGCT GGGCIIIICI CGT GAGA TITCATCCTTAGTCTCGCTCTTCTGCCCCTTCCCCCACAAGACACAGGTTTTCCCTCCGAAAAACCACAC Multi FASTA format See also d 2 Bisulfite sequences CAAGAGAGCIGAGCITGGAGARACICGATCTICCAGITCIACGTAGCICGAGGCGGGAAGGCATCACACC or upload target genomic sequence PCR target file plain sequence or GenBank format Gm9 21 seq 01 AGAICGCAIGCI CCGGCCGCCATGGCGGCCGCGCGATTCGATTTAAGAGAGTITGAGTTIGGAGAAATTCGATTITTITAGT multi mil FASTA format or zi ive of se files ieee e Tee Enter xd bini sequences for statistic
76. April 30 2008 User s manual eons se soo XC X CX QUantification tool for Methylation Analysis http quma cdb riken jp I QUMA User s manual April 30 2008 Version 1 02 Contact information Yuichi Kumaki amp Masaki Okano Laboratory for Mammalian Epigenetic Studies Center for Developmental Biology RIKEN 2 2 3 Minatojima Minamimachi Chuo ku Kobe 650 0047 Japan If you questions comments requests etc please feel free to contact quma cdb riken jp Copyright 2008 RIKEN Center for Developmental Biology All right reserved 1 April 30 2008 User s manual Contents 1 ctiam 5 2 QUICK SIE 6 2 1 Select a genomic sequence file 6 2 2 Select a bisulfite sequence file 6 ene ee VIS EIE 7 3 Supborted DIOWSBLES oorr 7 4 Overview 8 5 Methylation status analysis mode 9 5 1 Main 9 222 10 5 3 page 11 5 3 1 Genomic sequence file 1 11 5 3 2 Genomic sequence file 2 11 5 3 3 B
77. ETE dm SEE IIO UT NEC Lam r Ea xt XII XE April 30 2008 User s manual Finder File Eda View Go Window Help 2 Click to select the folder v SEQUENCE 3 Select Create Archive of FOLDER NAME from File E s menu in the Finder toolbar Close Window Get Info Make Alias Show Original SEGUE m Creare Archive of SEQUENCE Burn Disc Copyright 2008 RIKEN Center for Developmental Biology right reserved 13 April 30 2008 User s manual 4 The zipped archive automatically appears with 2 Finder file Edt View Go Window Help extension zip at the same location as the folder you selected 8 6 2 Other Mac OS Please use ZipIT CleanArchiver MacZip STUFFIT or other program to create zipped archive Copyright 2008 RIKEN Center for Developmental Biology All right reserved 74 April 30 2008 QUMA User s manual P sequence pU Ba See eee S EXC X 3 78 Qe O 1 tie E Address 8 7 How to create zipped archive Windows ies Rae ms 8 7 1 Windows Me XP Vista 49 Other ao n ES 1 Put bisulfite sequence files of 8 2 FASTA or 8 1 Plain sequence mz a hs T Ti a genal 3 1q Im qene Ld Pith Hace a a fas fasta or txt Rl ang n Date 6 2007 620
78. Gm9 J1 seq 02 1 0 453 998 19 1131 992 99 Gm9 J1 seq 13 1 1 454 99 19 1121 992 10 Gm9 Jl seq 06 214 248 633 50 4 22 112 80 4 mismatch identity unconverted converted ll Gm9 J1 seq 10 1 1 453 99 8 2 131 98 5 unconverted converted 12 12 Gm9 1 seq 12 2 2 454 99 6 0 130 100 0 mismatch 13 Gm9 Jl seq 09 241 176 536 55 0 46 93 50 5 mismatch identity unconverted converted 14 Gm9 J1 seq 16 2 0 453 99 6 1 131 99 2 mismatch 15 Gm9 seq 15 3 1 453 99 3 66 130 49 2 mismatch unconverted converted 16 Gm9_J1_seq_05 3 0 453 99 3 2 171 98 5 mismatch unconverted converted Show fiore Download figure Download methylation status data Download alisnment cata 34 CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved April 30 2008 User s manual a 5 7 Alignment page i S DEC eed ope 5 7 1 Overview of alignment page al Te Alignment page consists of four sections Summary of information carat TE N CRTC FETIL FFCCELETCEDLIEC i thie de Information about bisulfite alignment TOP eal ENT nd TET Le ET TEK E Te ee ST A al BETH et kk
79. IKEN Center for Developmental Biology All right reserved 39 April 30 2008 User s manual B Methylation pattern Mozilla Firefox Elle Edit History Bookmarks Tools Help Methylation pattern F 2 Centerline width Scale to show 1 2 Show CpG postion tap 5 8 7 19 u re j Download figure MM Width of column 95 pisis Diameter of circle 27 Start postion 1 D banem F Change figure ine wi 2 verse position This figure is displayed circles at even intervals with the center line for each bisulfite sequences In case of the 5 8 8 Option of figure 2 700 start position 50 The meaning of the value of each option parameter is shown Scale to show means size reduction rate to show in the window Click Renew Center Ene width 3 pix Scale to show button to reflect parameters Width ofcolumf 36 Diameter of circle 27 71 Heightofg w 40 2 E Reverse position line wigih amp t Relative position of first N i Width of base of genomic sequence column Diameter of circle Copyright 2008 RIKEN Center for Developmental Biology All right reserved 40 Methylation pattern Mozilla Firefox April 30 2008 QUMA User s manual Methylation pattern Center width pixels Scale of wid
80. TCAGTGACCAGTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGA GoCARTCTOCACAGAGUCAGTCTOUACACC CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved April 30 2008 User s manual 8 5 Zipped archive of sequence files Zipped archive which consists single folder and includes bisulfite sequence files of 8 2 FASTA or 8 1 Plain sequence format is uploadable Acceptable file extension of sequence file is fas fasta or txt 8 6 How to create zipped archive Macintosh 8 6 1 Mac OS X 10 3 and later 1 Put bisulfite sequence files of 8 2 FASTA or 8 1 Plain sequence format into folder Acceptable file extension of sequence file is seq fa fas fasta or txt e Finder File Edit View Go Window Help m GENE 1 1260 1 12 5 0 1 15 5 0 1 18 5 0 GENEL 20 5EQ m Copyright 2008 RIKEN Center for Developmental Biology All right reserved 1 10 SEQ us 1 13 SEQ L GENEI 16 560 ta GENE1 19 5EQ 21 504 gt 1 11 4 0 1 14 489 1 17 5 0 1 2 5 0 GENE Z2 5EQ Anm 72 1 1 IM 8 S SS SS Farm mro 760 IS EE zem Taio F
81. TTTTAT TTA TOATT TTT AAG AT Bae A TTT T ERAT RATT RESITI AGT STAT TATAST 8 a z i TTTEATET CAAT T TEGCGGDPOE CAL TA TD RC EEE BF AST TG MIT TT TETTE RT ETE TEE TARCS ThE TS TOT 1 HE 71294 11 LATTE 6 5 3 Alignment data 2 P FREI EE ER E ETT RT EM T ATA TATRA CA TEACH AREA Downloaded alignment data file can be opened by TextEdit Mac Notepad Win LA green other text editors TM lated ri i Loh GAT CAC TAE AT pu Tit m Bea Erit Hii e B Men et TTODE TTA fis sie dise eda SCAT OCT TIVE CACAD d BT AR TOITA AACA Wit simu us E im ls 8 STE METTE a eee UE NAP IGSGTRAATETODCTUCCL TAT IT iii IJI TII Ab Uds miti PARERE T alt T ADI HM ETHER HT E CEN arali Copyright 2008 RIKEN Center for Developmental Biology All right reserved 66 April 30 2008 User s manual 7 Input data 7 1 Genomic sequence Select the genomic sequence file of target region to upload Or paste the targe
82. al B Quma Quantification tool for Methylation Analysis Mozilla Firefox File Edit History Bookmarks Tools Help fi 6 2 3 Genomic sequence 2 92 e 2 tification tool for If you have any questions comments reqsasts ate Aa 4 see sesse se ethylation Analysis please feel free to contact guma Pedb riten ip Input a project name optional When the project name is 222 2774 HOME OVERVIEW TERMS OF USE DOWNLOAD REFERENCE Overview how to use QUMA Quick start Execute with sample sequence data presented it will be included in the output file name T target genomic sequence can be input by two ways of 1 direct E T EOE x genomic contig strain C57BL 64 input and 2 upload ATAAATGCSCATGCACACGCSCACCTTGAAGGCTGGGCTTTTCTCAGCGAGCTCAGAGGCTCTCSTGAGA 1 In case of direct input paste a target genomic sequence 8 1 or upload target genomic sequence PCR target fle plain sequence FASTA or GenBank format Plain sequence 8 2 FASTA or 8 3 GenBank format See also 7 1 uu eoe s FASTA format Genomic sequence Quma Quantification tool for Methylation Analysis Mozilla Firefox 6 2 4 Genomic sequence file 1 2 Or click the first button in this case Browse button to upload a target genomic sequence file Overview how to use QUMA Quick Execute with sample sequence
83. al analysis in multi FASTA format Copyright 2008 RIKEN Center for Developmental Biology All right reserved 46 April 30 2008 User s manual 6 2 7 File of first bisulfite sequence group 1 uuu EET at ns ion ylation Analysis please feel free to contact guma Bed rien ip 2 Or click the second button to upload a file of bisulfite Sequences eh TOTNES AE ommum Overview how to use QUMA Quick start Execute with sample sequence data Sample sequence files Project name optional only contain A Z a z 0 9 and Enter a target genomic sequence PCR target in plain sequence FASTA or GenBank format of first group ors target g nes demam qm C Users kuma De plain sequence FASTA or GenBank format re kume De Browse Apply sample genomic sequence Enter bisulfite sequences in multi FASTA format or upload bisulfite sequence file multi FASTA format file or zipped archive of sequence files Sequence group name optional Apply sample bisulfite sequences Optional Enter second bisulfite sequences for statistical analysis in multi FASTA format 6 2 8 File of first bisulfite sequence group 2 Select a file of bisulfite sequences of first group Acceptable file formats are 8 4 Multi FASTA or 8 5 Zipped archive of sequence files See also 7 2 Bisulfite sequences 8 6 How
84. ard urbe af i bec c7 msrbhswresd cp Leer CpH Ecc ape Com pul 151 ber piumi linzluds gan 1 amber f TIFT gm dts gr ETT Icke try Rethy lation pattern AF ENDE leg meta labed 4 LL B 1 RAAT n z 2a BORAT RETO M RITE T TT 5 re ee Li d dd LE PET a Adda d ET TT paa dL 1 He ch IAE ELT IDE ETA ET ST LT HES ELT BT TT TET Toe uh TL es EF eee ee LL APPR ae eT PPP AZTTT TITO A TTTT mcCTCTTTTTTTITTTTTTTTTTTATAZLTLATATGZCETOTTCTTTTOGRALLANRTTALTAGTTT GGZACCOGTZTTATTTARTTTTT ETAT OTTER TTTTT ETAT TTGOTTAGTTTT AXEATTARFATAT ATGTATAT Tara a MILII TATT ST ae ETAT T TANT TT TTE NT BTEXCUSTTTECT TRACER TEE AT CRAT AT RET
85. atus figure 23 5 5 6 Overview of analysis result page 3 23 5 5 7 Show 25 5 5 8 Include exclude bisulfite sequence 1 25 5 5 9 Include exclude bisulfite sequence 2 26 5 5 10 Change the order of bisulfite sequences 1 26 5 5 11 Change the order of bisulfite sequences 2 27 5 5 12 Download alignments data 27 5 5 13 Alignments 28 5 5 14 Download analysis data 29 5 5 15 ADalVSIS 29 5 5 16 Download methylation pattern figure 30 CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 2 April 30 2008 User s manual 5 5 17 Methylation pattern figure 30 5 5 18 Go lo figure page 31 5 6 Result page options 31 56 1 31 5 6 2 Show options 2 32 5 6 3 IGS ODUONS ere poco deu Dose usw but Det 32 5 6 4 Change the order of bisulfite sequences 1 33 5 6 5 Change the order of bisulfite sequences 2 33 5 6 6 Conditions to exclude bisulfite sequences 1 34 5
86. change is reflected Dosnioad methylation status data Download alignment data h gap Me unconverted pattern CpG 99 converted Methylation or reason for the exclusion E 5 5 12 Download alignments data Click Download alignment data button to download alignments data sme SEE x 96 identity 1 7 J seq 10 1 1 453 99 8 2 o seq 03 0 0 453 100 0 33 Gm Jl seq 14 0 0 453 100 0 4i O Gm Jl seq 12 2 2 454 99 6 55 3 Gm Jl seq 04 0 0 453 100 0 68 O Jl seq 16 2 0 453 99 6 1 Gm9 Ji seq 08 0 0 453 100 0 BB Jl seq 01 1 0 453 99 8 99 Gm9_J1_seq 07 1 1 1 453 99 8 Gm Jl seq 11 1 0 453 99 8 I Gm9 seq 05 3 0 453 99 3 12 12 seq 02 1 0 453 99 8 13 13 37 Gm Jl seq 13 1 1 454 99 8 14 14 9 Gm9 1 seq 06 31 248 633 50 4 15 15 seq 09 241 176 536 55 0 1 Jl seq 15 3 1 453 99 3 udo ls ges 1 1 qu hs j Gm9 Jl seq 08 Gm Jl seq 01 Gm9 Jl seq 07 10 1 Gm9 Jl seq 11 n Gm9 Jl seq 05 12 12 1 J seq 02 13 18 Gm9 Jl seq 13 14 14 15 15 7i 16 16 J Gm9 Jl seq 15 Reset Downlzad 2 T 453 99 6 0 0 453 100 0 2 2 454 99 6 0 0 453 100 0 0 0 453 100 0 1 1 453 99 8 0 0 453 100 0 1 0 453 99 8 1 1 453 99 8 1
87. clude exclude bisulfite sequence 2 6 3 10 Change the order of bisulfite sequences 1 6 3 11 Change the order of bisulfite sequences 2 6 3 12 Download alignments data 6 3 13 Alignments data 6 3 14 Download statistical analysis data 6 3 15 Statistical analysis data 6 4 Statistical analysis result page options 6 4 1 SHOW OpllOls 6 4 2 Show options 2 5 4 5 Hide ODUOTIS es cun Lodo tu n eco 6 4 4 Change the order of bisulfite sequences 1 6 4 5 Change the order of bisulfite sequences 2 6 4 6 Conditions to exclude bisulfite sequences 1 6 4 7 Conditions to exclude bisulfite sequences 2 6 5 Alignment 6 5 1 Overview of alignment page 6 5 2 Download alignment data 6 53 All fiment dala oet teta aai T Input dala o4 55 7 1 Genomic 2 2 2 2 67 7 2 Bisulfite SEQUENCES 68 8 Sequence format ooi
88. contact 5 4 12 Submit Click the Submit button to analyze Typically only a few seconds es eee mm are necessary irme Optional Enter second bisulfite sequences for statistical analysis in multi FASTA format a or upload second bisulfite sequence file for statistical analysis format fle or zipped archive of sequence files Sequence group name optional e bisulfite es Conditions to exclude low quality sequences Conversion CpH CpA CpC CpT gt T conversion Upper limit of unconverted CpHs 5 conversion of forward strand of the genomic sequence E Lower limit of percent converted CpHs 95 0 gt A conversion conversion of reverse strand of the genomic sequence 9 Upper limit of alignment mismatches 10 Both Lower limit of percent identity 90 0 search both directions and select the best result Reset Submit 7 Hide options CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 19 April 30 2008 User s manual 5 5 Analysis result page 5 5 1 Overview of analysis result page 1 Analysis result page consists of three sections A Summary of information B Methylation status of each CpG sites C Information and methylation pattern of each bisulfite sequences He Bee T bere lation stam of sach Cpl vire ea do d 0 su
89. d confirm alignment sequence download alignment data Alignmen select exclude download alignment data 43 April 30 2008 User s manual 6 2 Top page 6 2 1 Show options Click the Show pions link to show optional fields quuin oin EE C Ree i m oot guma MIB Project name optional only comaa A F a1 0 9 and 2 Enter a target penoenic iogarace PCR target plam teqata You can easily align visualize and quantify bisulfite sequence data for CpG methylation analysis rusa imd m E Overiew how to use QUMA Quick start E Execute with Upload target genomic sequence PCR target file s plam sequence FASTA GenBank format The genomic sequence must be an unconverted sequence between PCR primer not necessary to convert C to T Upload bisulfite sequence file J nuiti FASTA format file or zipped archive of sequence files Raw sequence data be used Removal of plasmid vector sequence is nol necessary Reset Submit 6 2 2 Optional fields Optional fields will appear E E of the prnomac Hance Both search beth dachani and dhe bear ep ual Copyright 2008 RIKEN Center for Developmental Biology All right reserved 44 April 30 2008 User s manu
90. e unconverted Methylation partern reason for the exclusion 2 131 92 5 131 100 0 O13 100 0 cesaeooncooseoceseoco um c CM Ch 0 130 100 0 oeaecoccooeeoosteeos 12 0 131 100 0 cocecoceceeeeeea qn 15 1 131 991 16 0131 100 0 18 07130 100 0 18 0 130 100 0 18 11311991 aeos b bed RR RR ee 18 21311985 oe eta RR ERROR 19 151 99 2 19 1 131 992 ease ee 1 22 112 80 4 mismatch identity unconverted converted 13 4693 50 5 mismatch identity unconverted 6 converted 18 56 130 19 2 unconverted converted 31 April 30 2008 User s manual 5 6 2 Show options 2 Optional fields will appear 5 6 3 Hide options Click the Hide options link to hide optional fields Bisulfite sequence information m Hide options Sorting conditions CpA CpC CpT E Conditions to exclude low quality sequences 9 user specified order mmber of methylated CpGs Upper limit of unconverted CpHs number of unconverted CpHs Lower limit of percent converted CpHs number of mismatches Upper limit of alignment mismatches Lower lmit of percent identity Reset with new parameters Re
91. e exact for small number of methylated CpGs or unmethylated CpGs that is usually detected in CpG methylation analysis Two tailed p value of Fisher s exact test is calculated from the 2 x 2 tables exampled below at each CpG site This p value is used to show the independence of CpG methylation between two groups at the CpG site Example 2 x 2 table for CoG methylation status a number of methylated CpGs of group1 at the CpG site b number of unmethylated CpGs of group1 at the CpG site group a b c number of methylated CpGs of group2 at the CpG site methylated CpG unmethylated CpG group2 d number of unmethylated CpGs of group2 the CpG site In case of sample data show in tablet this data can be transformed as table2 CpG position 375 methylated CoG unmethylated CpG total group1 12 13 92 3 group 12 1 13 Me CpG group2 4 10 40 0 group2 4 6 10 total 16 23 69 6 total 16 7 23 Copyright 2008 RIKEN Center for Developmental Biology All right reserved 77 April 30 2008 User s manual The probability of this table be determined by following formula P asbCa 13C12 10C4 23C16 13 10 16 7 12 1 4 6 23 0 0111357212 where the symbol indicates the factorial operator When the marginal totals are fixed there are 9 cases indicated below a b c d lad be 6 7 100 7161 911 85 82 70 47 24 1 22 45 68
92. ee 5 6 1 Show options 1 for more detail gt mismatch v The number of alignment mismatches includes gaps between genomic and bisulfite sequences exceeded the upper limit default 10 v This means low quality sequence read gt ident v Percent of alignment identity between genomic and bisulfite sequences exceeded the lower limit default 90 v This means low quality sequence read gt Unconv v number of unconverted CpHs CpA CpC and CpT exceeded the upper limit default 5 v This means incomplete bisulfite conversion or low quality sequence read gt conv v Percent of number of converted CpHs number of CpHs exceeded the lower limit default 95 v This means incomplete bisulfite conversion or low quality sequence read gt user desired Sequence was excluded by checking on the exclude checkbox Copyright 2008 RIKEN Center for Developmental Biology All right reserved 24 April 30 2008 User s manual 5 5 7 Show alignment Reset Renew Show figure Download flare Download methylation status data Download alignment data Click links to show bisulfite alignment between bisulfite sequence to Mi Spa 16 STERN rants etn 1 Umm J seq 10 1 1 453 998 6 2131 98 genomic seq uence 2 Gm9 Jl seq 03 010 453 100 0 0131 100 0 3 Gm IJ seq 14 0 4539 1000 8 0131
93. eeooeeeoo 2 2 454 99 6 0 0 453 1000 12 013111000 ecocecoceceeecececcc 2 0 453 99 6 15 1131 992 9 0 130 100 0 ceeeooooooeeocoeeece Edit View History Bookmarks Tools Help X eme sme S rt aene CA X x 22000002222 Li 1 1 If you have any questions comments requests etc please feel free to contact ibe FA Conditions to exclude low quality sequences number of methylated CpGs Upper limit of unconverted CpHs Lower limit of percent converted CpHs Upper limit of alignment mismatches Lower limit of percent identity Reset with new parameters 9 user specified order percent identity MANT Me unconverted Methylation pattern name i me length 0 converted or reason for the exclusion 1 1 1453 99 8 6 2 131 98 5 If vos have any questions comments requests please feel free to contact rto Copyright 2008 RIKEN Center for Developmental Biology All right reserved F Bisulfite sequence information Hide option d Sorting conditions CpC CpT A 1 Conditions to exclude low quality sequences 9 user specified order number of methylated CpGs Upper limit of unconverted CpHs 25 mmber of unconverted CpHs percent converted CpHs Lower limit of percent con
94. equences for statistical analysis in multi FASTA format B QUMA QUantification tool for Methylation Analysis Mozilla Firefox cc Co s Ele Edit History Bookmarks Tools Help ses ee tification tool for If yos have any 2229 8 y y quest ons comments requests ylation Analysis please feel free to contact riken ip multi FASTA format or zipped archive of sequence files rone Sequence group name optional Apply sample bisulfite sequences Optional Enter second bisulfite sequences for statistical analysis multi FASTA format or upload second bisulfite sequence file for statistical analysis multi F ASTA format file or zipped archive of sequence files Sequence group name optional e bisulfite es CpH CpC CpT Upper limit of unconverted CpHs conversion of forward strand of the genomic sequence A Lower limit of percent converted CpHs 9 s 1 Ipp er ali 2 t t tran limit of conversion of reverse 5 eg sequence Both 7 Lower limit of percent identity search both dsrections and select the best result Reset Submit Hide options Copyright 2008 RIKEN Center for Developmental Biology All right reserved 18 April 30 2008 User s manual QUMA Quantification tool for Methylation Analysis Mozilla Firefox gt gt 5 4 11 Strand of bisulfite conversio
95. format C WsercikumalDe Browse Apply sample genomic sequence Enter bisulfite sequences in multi F ASTA format m lerz kurma Die Browse a 4 d Enter aed sequences for statistical analysis an multi F ASTA format or upload second bisulfite multi FASTA d i Copyright 2008 RIKEN Center for Developmental Biology All right reserved 48 QUMA Quandfication tool for Methylation Analysis Mozilla Firefox April 30 2008 QUMA User s manual Yew History Bookmarks Tools Help 6 2 11 File of second bisulfite sequence group 2 pm Select a file of bisulfite sequences of second group The sequence n file format of the second group is same as the first group xr upload arg Desktop 26 2 L i re p home iH Sup oi i3 homes My 4 ip ckanolas on cde st J home Paint zr Id honez 2 Computer omulh FASTA format or zipped archree of sequence files 6 2 12 Conditions to exclude bisulfite sequences Bee If you want change conditions to exclude low quality bisulfite seq uences QUMA Quantification tool for Methylation Analysis Mozilla Firefox crx Ele Edit History Bookmarks Tools Help gt Upper limit of unconverted CpHs Ee QUantfication tool for ivis erts number of unconverted CpHs CpC CpT aee T
96. ght reserved 52 April 30 2008 User s manual 6 3 3 Change methylation status figure 1 Click Change graph link to switch comparative methylation status figures QUontification tool for Methylation Analysis Mozilla Firefox File Edit View History Bookmarks Tools Help T SoS B Teese 70 d d HOME OVERVIEW TERMS OF USE DOWNLOAD REFERENCE AGKMNLEDGENERTR 198 212 2198 2746 264 338 343 375 Teal 12113 1233 19 13 1213 1827246 017 892 615 9235 0213 769 LIR 74 a Ar 20 719 IO 610 Gl 49 190 T 40 0 20095 00 00 600 500 500 5009 400 25 53 TT a i4 ii a i P a 163 153 10423 823 1803 198773 1823 IXB 168 73 2331436 6525 606 MER 783 321609 7835 652 6360 35305 P value of Fisher s exact test F 00186 00593 10000 0 0059 01280 0 0237 01260 0 2213 00185 00000 P value of Mann Whitney U test 0 0004 LIT ne z Fw p m apa 5 3 H 3 t 3 3 5 Download graph Bisulfite sequence information Show eptions ert sad 5 i Reset Riera Download statistical data Download alignment data order Sequence mismatch Me unconverted Methylation pattern ent l growp m m ge CpG comverted reason for the exclusion E Jl seq 10 1
97. he best result Reset Submit Hide options B QUMA QUantification tool for Methylation Analysis Mozilla Firefox Ele Edit History Bookmarks Jools Help ae tification tool for If yos have any questrons comments requests is ae ylation Analysis please feel free to contact guma RE x 7 multi FASTA format flle or zipped archive of sequence files E Sequence group name optional Apply sample bisulfite sequences Optional Enter second bisulfite sequences for statistical analysis in multi FASTA format A or upload second bisulfite sequence file for statistical analysis multi F ASTA format file or zipped archive of sequence files Sequence group name optional bisulfite 5 Conditions to exclude low quality sequences p 5 Conversion E CpA CpT C gt T conversion s Upper limit of unconverted CpHs 5 conversion of forward strand of the genomic sequence S Lower limit of percent converted CpHs 950 E Upper of TEE 10 sequence E Lower limit of percent identity 900 7 search both directions and select the best result Hide options Copyright 2008 RIKEN Center for Developmental Biology All right reserved 50 April 30 2008 User s manual 6 3 Statistical analysis result page lemph i a i peg al El ia ia ide
98. ic sequence file 1 io inns pation Analysis deme BUS Click the first button this case Browse button to upload a target genomic sequence file QUantification tool for Methylation Analysis z You can easily alien visualize and quantify bisulfite sequence data for CpG methylation analysis Overview how to use QUMA Quick start E Execute with sample se Upload target genomic sequence PCR target file plain sequence FASTA or GenBank format The genomic sequence must be an unconverted sequence between PCR primer pair not necessary to convert C to Upload multi FASTA format file or zipped archive of sequence files Raw sequence data can be used Removal of plasmid vector sequence is not necessary Submit 5 3 2 Genomic sequence file 2 Select a target genomic sequence file to upload See also T 7 1 a po Dezktop bisulfite s Docume Overview E wir My Comouter B p Ej Shortcut bo E GGE Filename genome lasta Places Files ol type All Files Show options Copyright 2008 RIKEN Center for Developmental Biology All right reserved 11 April 30 2008 User s manual 5 3 3 Bisulfite sequences file 1 eee Edit History Bookmarks Tools Help Click the second button to upload a file of bisulfite p
99. ified order mimber of methylated CpGs Upper limit of unconverted CpHs 1 mmber of uncoaverted CpHs percent converted CpHs Lower imit of percent ouverted CpHs 6 4 7 Conditions to exclude bisulfite sequences 2 L L ber a H ascending order descending order Reset with now parameters T h ec h an g e IS ref lected E Ree Donnas statistical data Downlos date exclude mismatch Methri m oan cae ar 11 J seq 03 0 0 453 1000 6 0131 1000 cecoocoocoeoocoeeee 22 Gm9 1 seq 14 0 O 443 1000 8 0131 1000 ceeeocoocooeecceeeocc 33 Gm9 1 seq 12 2 2 1454 99 6 9 0 7130 100 0 4 4 Gm9 7 seq 04 000 453 100 0 12 0131 100 0 5 5 Gm9 J seq 16 240 4530996 15 11311992 eeeeecoceescececesces 6 6 Gm9 J1 seq 08 O 0 453 100 0 16 013111000 1 Gm9 1 seq 01 1 00 453 998 1 013011000 8 B J1 seq 07 1 01 453 998 18 0130 1000 i 9 8 Gm9 Jl_seq 11 1 0 4530998 18 11311992 10 1 Gm9 02 1 0 453 99 19 1131 992 11 11 Gm9 J seq 13 10 4540998 19 1131 1 997 J1 seq 06 314 48 633 50 4 22 112 80 4
100. ion 198 212 218 242 246 264 338 343 375 Total 1213 1113 913 813 073 1373 1213 10 13 1213 182 46 0525 925 846 692 615 923 100 0 923 769 923 710 Hethulated i Download graph Copyright 2008 RIKEN Center for Developmental Biology All right reserved 21 April 30 2008 User s manual 5 5 4 Change methylation status figure 2 Methylation status figures are switched one after the other by clicking Change graph link Figures 1 and 2 are reflected the position of CpG sites almost accurately Figures 3 6 are not reflected accurately 1 Pit im sta dn Copyright 2008 RIKEN Center for Developmental Biology All right reserved 22 April 30 2008 User s manual 5 5 5 Download methylation status figure Click Download graph button to download the methylation status figure which displayed at that time Summary of information Project sequence Length of target 1 rop Number of bisulfite sequences name group name genome sequence i isa used excluded total Gm9 Ji 453 19 13 3 16 Methylation status of each CpG site CpGposition 26 42 49 54 78 88 90 18 134 9 13 IG 6 12 1013 9 13 13 3 613 9 13 692 846 500 76995 692 615 53 8 46 2 692 CpG position 198 212 218 242 246 264 338 343 375 Total 1213 1113 913 813 134313 1213 1013 1243 182 246 ct 925 846 692 615 923 100096 923 76995 925 140 f Methylated OO
101. ion Analysis Mozilla Firefox 5 3 5 Submit Elle Edit View History Bookmarks Tools Help Click the submit button to analyze Typically only a few ego PRSE aac seconds are necessary HOME OVERVIEW TERMS OF USE DOWNLOAD REFERENCE AXNOWADGENENS Ap ma QUantification tool for Methylation Analysis You can easily alien visualize and quantify bisulfite sequence data for CpG methylation analysis E Overview howtouseQUMA 9 Quickstart E Execute with s data Upload target genomic sequence PCR target gj lain sequence FASTA or GenBank format C Users kure De Browse The genomic sequence must be en uncenverted sequence between PCR primer pair not necessary to convert C to T Upload bisulfite sequence file or ac 3 See 5 5 Analysis result page for next step mi FASTA format fe sipped archive of sequence Raw sequence data can be used Removal of plasmid vector sequence is not necessary Sample sequence files B quma Quantification tool for Methylation Analysis Mozilla Firefox 5 4 Top page option File Edit View History Bookmarks Tools Help iP 1 erem edel shan fod Amer rini 5 4 1 Show options Diese TEMS OF USE DOWNLOAD ERNE Click the Show options link to show optional fields Yos can pe align visualize and quantify bisulfite sequence data for CpG
102. isd a ander elude Sequence CpO b converted fer reason for the excusis pep m mpm hare seq 10 2151 954 Jl seq 03 tan Jl seq 14 Jl seq 12 1 1 453 99 8 0 0 443 100 0 0 0 453 100 0 2 2 454 99 6 Gma Jl seq 0 0 443 100 0 Gm3 1 seq 16 201453995 Jl seq 0 0 453 100 0 seq 01 140 453 99 8 Gm seq 07 1 1 453 99 8 Gm3 Jl seq 11 140 453 99 m3 J seq 06 3 0 453 993 0 131 100 0 aeocoocooostoooote de 5 1000 130 100 0 osaecooccoaeoceaece 0131 100 0 e oacecoccosoaeseeaess 1 11 99 2 W131 100 0 esesaebcse ae CAR RAD i 0130 100 0 eecesssesessasesabes Ie GA 4 de 130 100 0 esceessasesessenrnn 17131 99 2 A 21311555 sen ed ER ERR 1131 99 2 I El 111311902 221124 804 i idim ansenv 9 Tools Help yore hava my questo corer reqs wir please dies ba contact Bisulfite sequence information E Soeting conditions CpH Cpa Cpt CpT FA E Conditions to exchade low quality sequences wer specified order number of methylated CpG
103. isulfite sequences file 1 12 5 3 4 Bisulfite sequences file 2 12 9 RE OT 13 5 4 Top page option 13 5 4 1 SHOW OD COINS 13 5 4 2 Optional fields 14 se lg Ce e 9 6 9 e 15 5 4 4 Genomic sequence 15 5 4 5 Genomic sequence file 1 16 5 4 6 Genomic sequence file 2 16 5 4 7 Bisulfite sequences 17 5 4 8 Bisulfite sequences file 1 17 5 4 9 Bisulfite sequences file 2 18 5 4 10 Conditions to exclude bisulfite sequences 18 5 4 11 Strand of bisulfite conversion 19 5 5 Analysis result page 20 5 5 1 Overview of analysis result page 1 20 5 5 2 Overview of analysis result page 2 21 5 5 3 Change methylation status figure 1 21 5 5 4 Change methylation status figure 2 22 5 5 5 Download methylation st
104. k Renew button Gm 1 seq 15 l aabh seq 02 Gm9 l aabb seq 09 Ge l 6asxbb seq 01 Om l aabb seq 12 Gm9 l amp asbh seq 06 l asbb seq 11 Gm9 l asbb seq 04 ER 314 248 633 50 4 241 176 536 550 3 1 453 99 3 1 0 453 99 8 3 19 483 99 3 1 433 98 9 040 453 100 0 1 097443 99 9 2129 453 99 6 2 41 484 99 4 ee ee 2D 112 80 4 ident uncon t conv 4693 50 5 mismatch idem unconw 66 130 49 2 uncanv 1131 99 3 0130 100 0 0131 1100 0 oocoococoomseococooowo 0 131 1100 0 0 130 100 0 7 seq 03 Ged Jl seq 14 Gm Jl seq 12 Gm 71 seq 04 Gmb Jl seq 16 Gm5 Jl seq 08 Gm Jl seq 01 Gn Jl seq 07 Jl seq 11 J seq 05 1 seq 02 Jl sq 13 2 1 454 99 6 1 0 453 98 8 15 0 443 960 10 Ti 457 97 8 415 346 244 44 2 455 398 11 42 7 2 2 3 3 5 7 7 0131 100 0 aoococoooocewoer eos 7 8 4 5 4 7 11131 99 2 0131 100 0 60 113 36 2 manaich unconv conv 65 119 32 7 mismatch ident uncony a conv 414 AAI
105. mame promp same sequeace of CyGs used excluded total Me Bisulfite sequence information B Show optogs d 5 f 19 13 3 16 Upper imit of unconverted CpHs Reset Drei statistical dete Download slgresert date Lower limit of percent converted 0 S aimed ana VSIS mo e using one grou p O Methylation status of each CpG site Upper kirl of abermere au crea 9 CpGpedtim 26 42 4 16 E Lower of percent identity beth decane and elect the best renti 7 sea 10 1 D 453 998 6 2131 989 002002000 0 J1 seq 03 0 0 453 1000 6 O131 1000 Gub Ji seq 14 04045301000 8 01311100 0 cesecooccoeecoeeeco 1 seq 12 2 2 454 996 9 0130 1000 oeee000000000000000 Gm seq 04 010 45501700 12 013141000 ecooecoceoseccecoce Ga J1 seq 16 1210 45360996 14 1131 991 Gub seq 08 0 0 453 1000 16 013111020 9 113 60 sn 68 9n Fever Hide options 92 769 2 615 532 2628 GIN 95 bisulfite sequences and a Statistical analysis mode mode using two groups of bisulfite sequences i 7 seq 01 110 453 995 18 0130 1000
106. manual File Edit View History Bookmarks Tools Help Methylation pattern PSE In case of mismatch show X show bases do not show Show CpG position top 9 bottom 5 8 5 Figure 1 Do nload figure E Widthofcohmmn ad Hate uf cade 323 Start postion 1 Seale to shew 2 Hesght of row 40 Line width 2 Reverse position Renew This figures is displayed circle at even intervals not 009099 OK OK O e Oe OC 54 depend on CpG positions OO OO J Oo e ec e OI 00000000070 000000000 000000000 00990909 9 00000000000 000000000000 0000007000706 000000000000 O00000 O 5 8 6 Option of figure 1 SOO The meaning of the value of each option parameter O MO e e e is shown Scale to show means size reduction o 30 rate to show in the window Click Renew button to reflect parameters _ Show CpG position 9 7 bottom Width ofcolumn pixels Diameter of 33 Start postion 1 Scale to show 1 2 Height of row ieis Line width Relative position of the first Position from base of genomic sequence downstream In case of the Start position 50 Copyright 2008 R
107. mismatch ident unconv conv Gm9 71 seq 10 1 1 453 99 8 2 131 98 5 umcenv cons Gm9 1 seq 09 241 176 36 550 13 4693 50 5 mismatch ident unconv conv Gm9 J seq 15 3 1 453 993 66 1 30 49 2 unceav con Gm9_J1_seq_05 3 0 453 99 3 18 2131 98 5 conv ls E CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 64 ou lii April 30 2008 User s manual resmi Druide ni nci nin Hos bam 11 6 5 Alignment page 6 5 1 Overview of alignment page Alignment page consists of four sections E A Summary of information Information about bisulfite alignment tute B Genome sequence SSPE C Bisulfite sequence Sequence outside alignment is indicated as gray color D Bisulfite alignment T TEM M TUER Methylated C of CpG site unmethylated C of CpG site Unconverted C CpA CpC CpT are indicated as different colors ETILIBTLITERZITOIZIETT CC IIIIII HI 1 1 re re ee TX ESL ESOT Co TL TT ee P IP IH 11 il jeeps TAA Tu rt MEELEL bo TLEETET Leek 1
108. n gdt History Bookmarks Tools Help a s 9 Sen 8 foul te you have any quantions commants sequents Select a strand of bisulfite conversion of the target genomic eee phase fad fe to contact sequence multi FASTA format file or zipped archive of sequence files Sequence group name optional gt gt conversion Ele ERs Optional Enter second bisulfite sequences for statistical analysis in multi FASTA format v When bisulfite PCR primer pair was designed for forward strand of the genomic sequence default gt G gt A conversion e er cored adire Brome Sequence group name optional i i i i E bisulfite 5 v When bisulfite PCR primer pair was designed for reverse ae 5 strand of the genomic sequence as eee 1 a rene S Lower limit of percent converted CpHs 950 G gt A conversion gt Both Te 10 conversion of reverse strand of the genomic sequence z Lower limit of percent identity 90 0 Search both direction of conversion and adopt more kes Sime m Hid options appropriate strand mu Quma Quantification tool for Methylation Analysis Mozilla Firefox I Sox Eile Edit View History Bookmarks Tools Help tification tool for If yos have any questions comments requests 2 a please fed fno to
109. nce PCR target in plam sequence FASTA or GenBank format or upload target genomic sequence PCR target file plain sequence FASTA or GenBank format 9 Apply sample genomic sequence Enter bisulfite sequences in multi FASTA format 5 4 6 Genomic sequence file 2 Select a target genomic sequence file to upload See also 7 1 Genomic sequence Documents Documerts My Computer cm LA My Network Optional Enter second bisulfite sequences for statistical analysis multi FASTA format Copyright 2008 RIKEN Center for Developmental Biology All right reserved 16 April 30 2008 User s manual Edit History Bookmarks Tools Help 5 4 7 Bisulfite sequences i Huic Methylation Analysis sa aesan Input a group name of bisulfite sequences optional E Overview how to use QUMA 8 Quick stat E Execute with sample sequence data The bisulfite sequences be input by two ways of 1 direct input 25 oeii obon dD and 2 upload 2 22 1 In case of direct input paste the bisulfite sequences 8 4 Multi FASTA format See also 7 2 Bisulfite sequences sequence PCR target fle plain sequence FASTA or GenBank format Gm9 Ji seq 01 AGAICGCAIGCICCGGCCGCCATGGCGGCCGCGCGAITICGATIIAAGAGAGITGAGITIGGAGAAATICGATTIITIIAGI TITACGTAGTTTGAGGCGGGAAGGTATTATATTATAAATGCGTATGTATACGCGTATTTTGAAGGTTGGGITTTTTTTAG
110. nter bisulfite sequences in pii FASTA format Tumd JL seq 01 AGATCUCATGCTCCGGCCUCCATUGCUUCCUCUCGATICGATTTAAGAGAGITGAGTTTO PGADAAATTCGATTTTTIIAGT E 1 In case of direct input paste the bisulfite sequences of second c MH MM AIAITCGOARGCGICITATITTAATTITITATAATAGCCTGCCTIGITITTIGIAATTIGCGTA group The sequence format of the second group is same as the first I group omi l6aabb seq 01 ACTOGCATGCTOCOSSCGCCATGGOSGCOSCGGGAATTOGATTTAAGAGASTIGAGTITGSAGAAATITGATITITIAGT TIT ATGI AGTIT GAGGTI G GGTATTATATTATAAAT GT GI GT GIAITIT GAAGGIT T AG TGAGTITAGAGSTTITIGIGAGATITIGIITITAGIITIGIITITITGTITITITITIATAAGATATAGSITITITTITI GAAAAAITATATTGGAAGTSTGTIATITAATITITATAATAGTSTGCGISTTTITIGIAATTIGIGIAGITCTIARTAT of upload second bisulfite sequence for statistical analysis ovulti F AS TA format or zapped archive of sequence files 6 2 10 File of second bisulfite sequence group 1 greene een E 2 Or click the third button to upload a file of bisulfite sequences of pee ae my tion come redi second group Project name optional only contain A Z a 2 0 9 _ and G3 41 16ssbb Enter a target genomic sequence target in plain sequence FASTA or GenBank format or upload target genomic sequence PCR target TEM plain sequeace FASTA or GenBank
111. ntosh NotePad Windows many word processors or text editors Copyright 2008 RIKEN Center for Developmental Biology All right reserved 68 April 30 2008 User s manual 8 Sequence format 8 1 Plain sequence format Plain sequence contains only sequence characters and line feed Only one sequence can contain in one file 8 2 FASTA format Sequence of FASTA format is started from single comment line and followed by lines of sequence A greater than gt symbol is used at the first character of comment line to distinguish from sequence lines See more detail about FASTA format Wikipedia ex CAGTCCGGCAGCGCCGGGG TTAAGCGGCCCAAGTAAACGTAGCGCAGCGA TCGGCGCCGGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAG GACCCGCGGCGCGATCGCGGCGCCG CGC TACAGCCAGCCTCACTGGCGCG CGGGCGAGCGCACGGGCGCTC gt Dnmt3a partial sequence ACICCCCGTIOCGUGULCCGGUCCCGTAGCGTCCTUCGTCGCCGUCCCTCGTCT CoCAGCUGUAGCCUGUGOIGGACGCTCTOGCUCTGAGOGCUGUGGACL TAGCCU CGGGTGGCCCACTGGCGCGCGGGCGAGCGCACGGGCGCTCCAGTCCGGCA GCGCCGGGG TTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCCGG AGATTCGCGAACCCGACACTUCCGCGCULGUCULGUCGGUCAGGAUCCGULGOGC GCGATCGCGGCGCCGCGCTACAGCCAGCC TCACGACAGGCCCUGCTGAGGC TTGIGCCAGAUCCTTGGAAACCTCAGGTATATACCTTTOCCAGACGCGGGAT CICOCOTCOCOCCATOCATAGTGCUTTGGOGUACUARATICOAGGGCUTTCTTT CAGGAAACAATGAAGGGAGACAGCAGACATCTGAATGAAGAAGAGGGTGC CAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTCAGTGACCAGT COTCAGACACGAAGGATGCTCOCCTCACCCCCAGTOCTTGGAGGCAATCTGC ACAGAGCCAGTCTGCACACC Copy
112. r connected to a local network by using a bootable CD This feature is especially helpful to the researcher who must analyze sensitive data The QUMA web server is available at http quma cdb riken jp Overall we feel confident that QUMA will prove to be of value to the biological community CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 5 April 30 2008 User s manual 2 Quick start 2 1 Select a genomic sequence file The genomic sequence must be an unconverted sequence between PCR primer pair not necessary to convert C to T See 7 1 Genomic sequence for more details 2 2 Select a bisulfite sequence file Raw sequence data can used Removal of plasmid vector sequence is not necessary Use 8 4 Multi FASTA file or 8 5 Zipped archive of sequence files See 7 2 Bisulfite sequences for more details Copyright 2008 RIKEN Center for Developmental Biology All right reserved You can sasilv vnuadurs xr bisulfite gaat data for pie bear vc mer E i maii Bern din cu sipped ar dicun Tha ei Vou can easily alien gata t data for i Teremin brm April 30 2008 User s manual 2 3 Submit CE RATES cmm ome EFIE EDGE
113. right 2008 RIKEN Center for Developmental Biology All right reserved 69 April 30 2008 User s manual 8 3 GenBank format GenBank format GenBank Flat File Format consists of annotation section and sequence section The start of annotation section 1 marked by a line beginning the word LOCUS The start of sequence section is marked by a line beginning the word ORIGIN and the end of the section is marked by line only contains I See more detail about GenBank format NCBI LOCUS AF068625 200 bp mRNA linear ROD 06 DEC 1999 DEFINITION Mus musculus DNA cytosine 5 methyltransferase 3A Dnmt3a mRNA complete cds AF068625 REGION 1 200 AF068625 2 6449467 ACCESSION VERSION KEYWORDS SOURCE Mus musculus ORGANISM Mus musculus Eukaryota Metazoa Chordata Craniata Vertebrata Euteleostomi Mammalia Eutheria Euarchontoglires Glires Rodentia Sciurognathi Muroidea Muridae Murinae Mus REFERENCE 1 bases 1 to 200 AUTHORS Okano M Xie S and Li E TITLE Cloning and characterization of a family of novel mammalian DNA cytosine 5 methyltransferases JOURNAL Nat Genet 19 3 219 220 1998 PUBMED 9662389 REFERENCE 2 bases 1 to 200 AUTHORS 5 Okano M and 11 8 TITLE Direct Submission JOURNAL Submitted 28 MAY 1998 CVRC Mass Gen Charlestown MA 02129 USA REFERENCE 3 bases 1 to 200 AUTHORS Okano M Chijiwa T and 11 8 TITLE Direct Submission JOURNAL Submitted
114. ry qaom comma reas wir pana teal free omg Ty 1 22 112 80 4 mismatch ident unconv conv 13 46 91 50 5 mismatch ident unconv conv 18 66 130 49 7 unconv conv IF 1221351 L T 32 112 BO mismatch ident uncony cam 4653 50 5 mismatch amp ident unceny 8 cam B 66120 49 2 unconv come 1 131 99 2 coccocecoocosooponn 0 130 100 1 130 9 2 0 131 100 0 ooococooooseoooooso 0131 OO cocoocacoocosooseeao T 0130 100 0 eoceococcooc sos dde 0 131 OO 113113912 213111000 1 128 99 2 missutch 60113315 9 misnateh ident unconw a conv 2 127 98 4 mismatch 65 119 12 msmmch amp ident uncon 8 conv 70 108 35 2 mismatch ident uncenr 8 cont 56 105 39 1 mismatch ident unzonv 4 cont Copyright 2008 RIKEN Center for Developmental Biology All right reserved 56 107 37 7 ident unceny 14 can 57 April 30 2008 User s manual seq 06 6 3 9 Include exclude bisulfite sequence 2 The change is reflected 6 3 10 Change the order of bisulfite sequences 1 Change the value of order column to desired order Then clic
115. s 5 5 8 Include exclude bisulfite sequence 1 include exclude bisulfite sequence check off on exclude ue Methylation pattern CpG 90 converted reason for the exclusion checkbox Then click Renew button To include all bisulfite sequence Gm seq10 1 453 998 6 2 131 985 9960 17 7 seq 03 0 0 453 1000 6 0 131 1000 information click unselect all link 3 3 Jl seq 14 000 453 1000 W191 100 0 44 Gm9 seq 12 2 2 454 996 9 0 130 100 0 ceeseoccococoseeooteece 55 Gm9 Jl seq 04 Of 453 100 0 12 0 131 100 0 e ocoecooeoeeeseeeno 86 Gm9 Jl seq 16 2 0 453 996 15 1 151 99 2 17 Gm9 71 seq 08 0 0 453 100 0 16 0 131 100 0 85 seq 01 1 0 7453 998 18 130 1000 99 Gm9 Jl seq 07 1 1 453 99 8 18 0 130 100 0 eeceeeceseeccececooco 1010 Gm9 seq 11 1 0 7453 998 18 1 131 992 eeceesessotctos tono 11 11 Jl seq 05 3 01453 993 18 2 13 08 5 12 12 Gm9 Jl seq 02 0 453 895 19 1131199 7 13 13 Gm9 J seq 13 Di1 354 998 19 1 131 992 esses see beheben 14 14 J Gm9 Jl seg 06 314 248 633 50 5 122112 20 3 mismatch identity unconverted
116. s Upper limit of unconverted CpHs mumber of unconverted CpHs percent converted CpHs Lower Erit of percent converted CpHs number of mismatches a percent idenbry Upper limit of abgnnsent mismatches sequence rane Lower of percent identity ascending onder a descending order 6 4 5 Change the order of bisulfite sequences 2 e Re owns seta cn Gernas alumen at VV VV WV Reest with new parameters Methylation pattern r CpG reason for the excbusian iride Sequence nime pag ancanvaried The change is reflected Two sequence groups are ordered separately 1 1 2 4 6 3 RE 9 10 11 n 13 m CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved Cm9 Jl seq 14 Gand 71 seq 0 seq 04 seq 03 Cm Jl seq 13 Gm Jl seq 11 Gm9 Il seq 10 J seq 07 Cm Jl seq 02 Jl seq 01 Jl seq 15 Gm Jl seq 12 Gm J seq 09 Gm Jl seq 15 07131 100 07 debido 0 131 100 0 assaseecesaecasaec 015 100 0 8 100 0 SRDS 17131 99 2 aedi ER 17131199 2 D131 98 4 1 0130 00 0 17131199 2 0130 100 0 scs b bb 1 13 90 7 130 100 0 eeseccoocoaeocesece 2 121
117. set Renew Show figure Downlosd figure Download methylation status data Download alignment data order Sequence Me unconverted Methylation pattern nali name gore CpG 90 converted or reason for the exclusion A 1 Gm9 Jl seq 10 1 1 453 998 6 2 131 984 ooc0o0cooococeceeeee Gm9 seq 03 0 0 453 1000 6 0 131 100 0 7 Gm9 seq 14 0 0 453 1000 8 9 2 3 4 QGm9Jlseq12 250291454996 5 6 0 131 1000 oeeeccoooceecoeeeco 0 130 100 0 oeeeoooooceecoeeeoe Gm9 1 seq 04 0 0 453 100 0 12 0 131 100 0 00 Jl seq 16 2 0 453 996 15 1 131 99 2 eeeeeecoeeececeecee Gm9_J1_seq_08 0 0 453 1000 16 0 131 100 0 n 8 Gm9 seq 01 1 0 453 998 18 0 130 100 0 9 Gm9_Jl_seq_07 1 1 4530998 18 01300000 10 9 1 seq 11 1 0 453 998 18 1131 992 11 Gm9 Jl seq 05 3 0 453 993 18 2 131 98 5 12 Gm9 Ji seq 02 1 0 453 998 19 1 131 99 2 eeeececcecececececeo 13 Gm9 1 seq 13 1 1 454 998 19 1 131 99 2 14 7 Jl seq 06 314 248 633 504 1 22112 80 1 mismatch identity unconverted converted J1 seq 09 241 176 536 55 0 13 46
118. some situations especially CoG methylation of imprinting regions because this test only check the difference of the average of two groups Additionally the patterns of CpG methylation are not considered Example The sample data sets are Me CpGs CpGs of each sequence average ratio of number of number of methylated CpGs number of CpGs methylation sequences group1 6 19 6 19 8 19 9 19 12 19 15 19 16 19 18 19 18 19 18 19 18 18 19 19 19 19 0 7409 13 ni 2 2 19 2 19 3 19 3 19 5 19 5 19 7 19 7 19 7 19 8 19 0 2579 10 This is the analyzed data of the QUMA sample sequence files Is this difference between the average ratio of methylation 0 7409 vs 0 2579 significant Copyright 2008 RIKEN Center for Developmental Biology All right reserved 19 April 30 2008 User s manual First make ranking of the values methylation ratio and determine a rank When two or more values are share the same rank take an average of the rank values In the sample data two sequences are Me CpGs CpGs 3 19 and the rank values are 3 and 4 Then use 3 5 average of 3 and 4 as the rank Second calculate sum of the rank Rank sum and Ro Position 1 2 3 4 5 6 8 9 10 11 12 Me CpGs CpGs 2 19 3 19 5 19 6 19 7 19 8 19 9 19 12 19 15 19 16 19 18 19 1 Rank sum rank 1 2 3 4 5 6 7 8 9 11 12 13 14 15 16 17 18 20 21 23 1 5 3 5 5 5 7 5 10 12 5 14 15 16 17 19 22 gro
119. t genomic sequence into the text box only for 5 4 page option The genomic sequence must be unconverted not necessary to convert to T and use sequence between PCR primer pair Sequence of 8 1 Plain sequence 8 2 FASTA or 8 3 GenBank format is acceptable Only rich text format with rtf file extension or plain text format text file is acceptable for upload file Binalry file such as Microsoft Word file is unacceptable Rich text format file can be created with TextEdit Macintosh WordPad Windows or many word processors Plain text file can be created with TextEdit Macintosh NotePad Windows many word processors or text editors CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 67 April 30 2008 User s manual 7 2 Bisulfite sequences Select the file of bisulfite sequences to upload 8 4 Multi FASTA format file or 8 5 Zipped archive of sequence files Or paste the 8 4 Multi FASTA format bisulfite sequences into the text box only for 5 4 Top page option The bisulfite sequences outputted from DNA sequencer can be used as input sequences No need to remove plasmid vector sequence Only rich text format with rtf file extension or plain text format text file is acceptable for multi FASTA upload file Rich text format file can be created with TextEdit Macintosh WordPad Windows or many word processors Plain text file can be created with TextEdit Maci
120. tain accurate DNA methylation profiles from the raw sequence output of the DNA sequencer and by the fact that quality checking of the results can be influenced by researcher s bias We have developed an interactive and easy to use web based tool QUMA QUantification tool for Methylation Analysis for the bisulfite sequencing analysis of CoG methylation QUMA includes most of the data processing functions necessary for the analysis of bisulfite sequences It also provides a platform for consistent quality control of the analysis QUMA has four major features First it is easy to use and needs only two types of input a PCR target genomic sequence and raw bisulfite sequences With its user friendly interface only a few clicks are needed to quickly align visualize and quantify the bisulfite sequence data in a comprehensive manner Almost all the displayed data are downloadable Second QUMA is an all in one tool that includes most of the data processing functions necessary for the analysis of bisulfite sequences In addition many optional parameters are available to change the output style according to the user s preferences Third QUMA provides a helpful feature that allows the user to control the quality of aligned sequences easily by changing the cutoff parameters if the input data and cutoff parameters are indicated anyone can reproduce the analysis by using the QUMA web server Fourth QUMA server can be launch locally on a personal compute
121. te sequence 45 498 Alignment direction Me CpG 5 19 Unconverted CpH mismatch gap alignment length identity 10 7 457 97 8 96 Mehtylation pattern PEN MT TERT GOMA ACTOCATCTTI Cd T TEST T CT Ga TODA GALS AT Ecc FEE MI wir nr CT CAG CTO Toa TACT TARGTETODET TTT aA CSDRGGT TT AT TURAN PAU AA STER TITGCAATCT MICATI CAM TCT SEDE AAT RRP REEL SALE LAS AATA LAARA LAAEN A TIR TTA Target genome sequence CAAGAGAGCTGAGCTTGGAGAAACTCGATCTTCCAGTTCTACGTAGCTCGAGGCGGGAAG GCATCACACCATAAATGCGCATGCACACGCGCACCTTGAAGGCTGGGCTTTTCTCAGCGA GCTCAGAGGCTCTCGTGAGATTTCATCCTTAGTCTCGCTCTTCTGCCCCTTCCCCCACAA GACACAGGTTTTCCCTCCGAAAAACCACACCCGGAAGCGTGTCACTCAATCCCCACAACA GCGTGCGTGCCCTTTGCAATCTGCGCAGTCCCCAACATCACACATATGCACATTCTAGCC CTCCAATCTCTAGGGTTGTGTGAATGTGCCTCCCCACCGATCCGATCCCTAAGAACAGAA GACCTCTAGACAATCGAAACTGCAGCATCAAAAGCATCACAGCACATACAATCACAAACT TTATGTGTCTCCTAGCCTGTCCAATCCCCCACT 111931 FER ITER STEER E ICD T T TTTACET MITT TmT aN TATT ATTTTTAGTTTTGTTTTET TEA RTT AIK TTA TET TATTTSATTTTTATARTAZEGTGOGTGTT
122. th 2 V Show CpG position Download figure z Diameter of circle 27 pixels Scale to show 1 2 top 9 bottom m Change figure 5 8 9 igure 3 Height ofrow 40 pines Line width 2 pixeis Renew A The positions of circles are reflected the position of CpG sites almost accurately But closely positioned CpG sites are overlapped 5 8 10 Option of figure 3 The meaning of the value of each option parameter is shown Scale to show means size reduction rate to show in the window Click Renew button to reflect parameters depends on ihe value of Scale of width Center Ene width 3 Scaleofwidth 2 7 Shaw position de 27 Seale to show 12 tep bottom e Diameter of CopyrightO 2008 RIKEN Center for Developmental Biology All right reserved 41 April 30 2008 User s manual Methylation pattern Mozilla Firefax Ble Edit yew History Bookmarks Tools Help Methylation pattern 5 8 11 Figure 4 Center width 3 Scaleofwidth 2 Show Cp position C top The positions of circles depend on the position of CpG sites but Chefs Diameter of circle 27 Beale to show 2 E af cow 40 Line width z Reverie poison accurately The circles are placed as not to overlap
123. ue E Ef HOME TERMS OF USE DOWMLOAD REFERENCE 1 or zipped archive of sequence files gt Lower limit of percent converted CpHs ir EE Apply sample bisulfite sequences v percent of number of converted CpHs number of CpHs E Optional Enter second bisulfite sequences for statistical analysis muli FASTA format gt Upper limit of alignment mismatch Y number of alignment mismatches and gaps between III EET 5 multi F ASTA format file or zipped archive of sequence files genomic and bisulfite sequences mum gt Lower limit of percent identity ed unconv 5 5 conversion of forward strand of the genomic s e gt percent of alignment identity between genomic and bisulfite eic 55 REND ES E Upper limit of i cmm conversion of reverse strand of the genomic sequence sequences Lower limit of percent identity search both dsrections and select the best result Reset Submit W Hide options Copyright 2008 RIKEN Center for Developmental Biology All right reserved 49 April 30 2008 User s manual 6 2 13 Strand of bisulfite conversion Select a strand of bisulfite conversion of the target genomic sequence gt Cz gt T conversion When bisulfite PCR primer pair was designed for forward strand of the genomic sequence default gt G gt A conversion When bisulfite PCR primer pair
124. up1 0 0 0 2 0 1 1 1 1 1 3 212 5 R1 number of group2 2 2 2 0 3 1 0 0 0 0 0 63 5 ZR sequences total 2 2 2 2 3 2 1 1 1 1 3 3 Third determine temporary U value U1 and U2 as below U1 n n2 ny Ny 1 2 8 5 U2 n n2 n2 1 2 R2 121 5 Take the smaller value of U1 and U2 as the U value this case U 8 5 Then determine a two tailed p value from the U value To determine the p value we take the approximation using the normal distribution for the number of sequences above 20 In the case of small sequences 20 and below we determine the p value from exact probabilities Mann Whitney U exact test Copyright 2008 RIKEN Center for Developmental Biology All right reserved 80 April 30 2008 User s manual normal approximation is performed as z U where 2 is a standard normal deviate E U is the mean of V U is the variance of U E U n n 2 aap _ 1302 z 3 3 V U 12 2 n a 2 6 2 where t is the number of tied ranks of the position i At the sample E U 65 V U 257 812 and 2 3 51879 Then the two tailed p value 0 0004 is determined from the standard normal distribution double value for two tail Another sample data sets for Mann Whitne U exact test are Table 1 Me CpGs CpGs of each sequence average ratio of number of number of methylated CpGs number of CpGs methylation sequences group1 6 1
125. verted Show figure Download methylstion status date Download alignment dats Dowload figure bisulfite sequences gt Lower limit of percent identity Bisulfite sequence information 9 Hide options I Sorting conditions CpC CpT 7 Conditions to exclude low quality sequences percent of alignment identity between genomic and bisulfite sequences abe filled C0 gt Upper f dips 5 js i 9 ascending order descending order Reset with mew parameters 5 6 7 Conditions to exclude bisulfite sequences 2 Reset Renew Show figure Download figure Downlos methylation status data Download alignment data ordery iclude Sequence I REEF cha 4 unconverted Methylation pattern The change is reflected Tep lh 11 Gm9 seq 03 0 0 453 1000 6 0 131 100 0 EP Gm9 1 seq 14 0 0 453 1000 8 0131 1000 oeeeoocoooeecoeeeco 33 J1 seq 04 0 0 453 1000 12 013111000 44 Gm9 seq 08 0 0 453 1000 16 0131 100 0 5 5 Gm9 seq 01 1 00 453 99 8 18 0 130 1000 65 Gm9 1 seq 07 1 1 453 998 18 0 1320 100 0 7 Gm9 J1 seq 11 1 0 453 99 8 18 1131 992 88
126. verted CpHs 50 number of mismatches percent identity Upper limit of alignment mismatches 8 sequence name Lower limit of percent identity 900 9 ascending order 2 descending order Reset with new parameters Reset Renew Download statistical data Download alignment data exclude mismatch gap order Sequence Me unconverted Methylation pattern a name CpG 9 converted or reason for the exclusion Z 11 Gm9 J seq 10 1 1 453 998 6 2 131 98 5 oooocooccoooeceeeee 62 April 30 2008 User s manual QUMA QUantification tool for Methylation Analysis Firele Edit View History Bookmarks Tools Help Pet 1 tool for yoa hava my IOTA COTENT sic p ylation Analysis fete imaged rime Bisulfite sequence information Iri Hide options 6 4 4 Change the order of bisulfite sequences 1 eem Order of bisulfite sequences be changed by several parameters and ascending descending order Then click Renew button M M user specified order value of order column gt number of methylated CpGs number of unconversions unconverted CpHs CpC CpT percent conversion v percent of converted CpHs total CpHs STET 10 4099 number of mismatches HODI COD percent identity sequence name ascending order descending order wnranser
127. ward strand of the genomic sequence Summary information Bisulfite sequence name Length of bisulfite sequence 977 Length of target zenome sequence 453 Aligned region of bisulfite sequence 29 43 Alignment direction forward Me CpG 18 18 Unconverted CpH 231 mismaich gap alignment length identity 3 0 453 99 3 96 Mehtylation pattern Target genome sequence GCATCACACCATAAATGCGCATGCACACGCGCACCTTGAAGGCTGGGCTTTTCTCAGCGA GCTCAGAGGCTCTCGTGAGATTTCATCCTTAGTCTCGCTCTTCTGCCCCTTCCCCCACAA GACACAGGTTTTCCCTCCGAAAAACCACACCCGGAAGCGTGTCACTCAATCCCCACAACA GCGTGCGTGCCCTTTGCAATCTGCGCAGTCCCCAACATCACACATATGCACATTCTAGCC CTCCAATCTCTAGGGTTGTGTGAATGTGCCTCCCCACCGATCCGATCCCTAAGAACAGAA GACCTCTAGACAATCGAAACTGCAGCATCAAAAGCATCACAGCACATACAATCACAAACT TTATGTGTCTCCTAGCCTGTCCAATCCCCCACT Bisulfite sequence 2 Downloaded alignment data file can be opened by TextEdit Mac Notepad Win or other text editors Copyright 2008 RIKEN Center for Developmental Biology All right reserved Twi B 14 ny Tra beri Sd Dae mg pie midi We ton Lzenwwr pn zB Poari sered of the enh scarce png n E genome cese H PU Fi bla 110488 3i ARI lr z ber Forw
128. zils Frefax Eje View Hitoy Bookmarks Took Help Gm Jl seq 10 Km Jl seq 03 Om9 1 seq 14 Jl seq 12 Jl seq 04 Gm Jl seq 16 Jl seq Jl seq 01 Gm Jl seq 07 Jl seq 11 Gm Jl seq 05 J seq 02 Gm Jl 13 nn Ls E E E E Nw m 3 2 mim mmus eu identity 1 1 453 99 8 0 0 453 100 0 0 0 453 100 0 2 2 454 99 6 000 453 100 0 20 453 99 6 0 0 443 100 0 1 0 453 99 8 1 1 453 99 8 1 0 453 99 8 3 0 453 983 1 0 453 998 1 1 454 99 8 Download simant data Meihylariem pattern 9 concerted er reason for che A 17131199 7 essssensssessosenes 1131 991 17131 99 eecesesessesss senos 07130 100 0 07130 100 0 RR 0 131 100 0 11314992 0 131 100 0 3 0120 100 0 oeeecocooceeoos eor 0 131 100 0 aeaecocoocamonmemon 0 131 1000 2131 98 ER see 1 22 112 804 mismatch ident uncer Sk coy 13 4693 20 7 mismatch ident umcaere 98 conv 18 65 130 49 2 uncon conv 2 1131199 2 tane any questions commentisequesrs ete

QUMA User`s manual - QUMA: QUantification tool for Methylation

Contents

Download Pdf Manuals

Related Search

Related Contents