MINT Universal cDNA synthesis kit
Contents
1. 3 After RNA isolation we recommend RNA quality estimation using gel electrophoresis before the first strand cDNA synthesis Denaturing formaldehyde agarose gel electrophoresis should be performed as described Sambrook et al 1989 Alternatively stan dard agarose ethidium bromide EtBr gel electrophoresis can be used to quickly estimate RNA quality see Appendix A for recommendations to perform a non denaturing agarose gel electrophoresis of RNA The following characteristics indicate successful RNA preparation For mammalian total RNA two intensive bands at approximately 4 5 and 1 9 kb should be observed against a light smear These bands represent 28S and 18S rRNA The ratio of intensities of these bands should be about 1 5 2 5 1 Intact mammalian polyA RNA appears as a smear sized from 0 1 to 4 7 or more kb with faint 28S and 18S rRNA bands Technical support customer support evrogen com 8 V RNA requirements continued In the case of RNA from other sources plants insects yeast amphibians the normal mRNA smear on the non denaturing agarose gel may not exceed 2 3 kb Moreover the overwhelming majority of invertebrates have 28s rRNA with a so called hidden break Ishikawa 1977 In some organisms the interaction between the parts of 28s rRNA is rather weak so the total RNA preparation exhibits a single 18s like rRNA band even on a non denaturing gel In other species the 28s rRNA is more robust so it is stil2. 7 Analyze 4 ul aliquots of each PCR product alongside 0 1 ug of 1 kb DNA size marker and 4 ul aliquot of the Control cDNA sample 2 on a 1 2 agarose EtBr gel in 1X TAE buffer If required add 1 2 additional PCR cycles for the experimental samples Now you have obtained amplified ds cDNA This cDNA can be stored at 20 C up to six months It can be used for directional cloning of cDNA library into vectors restricted with asymmetric Sfi l sites Before cloning cDNA purifica tion using phenol chloroform extraction or commercial PCR purifica tion kits and size separation using CHROMA SPIN 400 or 1000 columns Clontech is strongly recommend Note The cDNA has a limited use for protein translation as 5 UTRs may contain stop codons in frame with the vector ATG You should use three vector variants with ATG in various frames to clone cDNA for this purpose Before cloning this cDNA can be normalized using Trimmer direct kit Evrogen cat NKOO2 MINT Universal User Manual www evrogen com 29 Vill Troubleshooting guide A Low molecular weight size distribution lt 1 5 kb poor yield or no PCR product observed for the control brain total RNA 1 RNA may have degraded during storage and or first strand cDNA synthesis Your working area equipment and solutions must be free of contamination by RNases Check the quality of starting RNA on denaturing formaldehyde agarose gel electrophoresis 2 You may have made an error d
3. tase for first strand cDNA synthesis and a free trial size Encyclo PCR kit Cat PKOO1 For important information about the use of MINT Universal kit please see the ENDNOTES at the end of this User Manual BOX 1 Component Amount 5X First Strand Buffer 80 ul DTT 20mM 30 ul 10X dNTP mix LOmM each 25 ul PlugOligo 1 adapter 15 pM 25 ul 5 AAGCAGTGGTATCAACGCAGAGTACGGGGG P 3 CDS 1 adapter 10 uM 25 ul 5 AAGCAGTGGTATCAACGCAGAGTAC T 3QVN 3 PlugOligo 3M adapter 15 pM 25 ul 5 AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGGG P 3 CDS 3M adapter 10 uM 25 ul 5 AAGCAGTGGTATCAACGCAGAGTGGCCGAGGCGGCC T oyN 3 Mint Reverse Transcriptase 20 ul IP solution 130 ul Control total RNA template 0 5 ug ul 15 ul Sterile RNase free water 1 8 ml MINT Universal User Manual www evrogen com Ill Kit components and storage conditions continued 5 BOX 2 Component Amount 50X Encyclo polymerase mix 50 ul 10X Encyclo buffer 300 ul PCR Primer M1 10 uM 100 ul 5 AAGCAGTGGTATCAACGCAGAGT 3 50X dNTP mix LOmM each 80 ul Sterile RNase free water 1 8 ml Control amplified cDNA sample 1 for electrophoresis 25 ul Control amplified cDNA sample 2 for electrophoresis 25 ul Rsal and Sfil restriction sites are underlined N A C GorT V A GorC Shipping amp Storage Encyclo Polymerase mix Mint Reverse Transcriptase PlugOligo adapters and control RNA are shipped at 20 C or below All other components of the kit can be ship
4. all reagents shown except the first strand cDNA Then aliquot 49 ul of the PCR Master Mix into an appropriate number of fresh sterile 0 5 ml tubes and add 1 ul of the first strand cDNA solu tions from Step VII A 12 If your first strand cDNA samples were stored at 20 C pre heat the first strand cDNA reactions at 65 C for 1 min and mix contents by gently flicking the tube before taking aliquots Store the remaining first strand cDNA in blue ice if you plan to perform full size cDNA preparation section B 2 directly after evaluative PCR If you plan to perform full size cDNA preparation sometime later store the remain ing first strand cDNA at 20 C 2 Mix PCR components by gently flicking the tube Spin the tube briefly in a microcentrifuge MINT Universal User Manual www evrogen com VII cDNA preparation protocol Il continued 23 3 Aliquot 16 ul of PCR reaction into PCR tubes three tubes for each first strand cDNA Label the tubes as lt S gt 1 lt S gt 2 and lt S gt 3 where in lt S gt is a sample identifier Note Thin wall PCR tubes are recommended These PCR tubes are optimized to ensure more efficient heat transfer and to maximize thermal cycling performance We recommend that you use 0 2 ml PCR tubes rather than 0 5 ml ones 4 Overlay each reaction with a drop of mineral oil 15 20 ul Close the tubes and place them into a thermal cycler Note Because of a small reaction volume we recommend that you
5. begin the first cDNA synthesis procedure shake all enzymes solutions and spin the tubes briefly in a microcen trifuge A First strand cDNA synthesis and PlugOligo incorporation Note During the first strand cDNA synthesis the use of a thermal cycler for incubation steps is recommended Using the air thermo stat may require additional optimization 1 For each RNA sample combine the following reagents in a sterile thin 0 2 ml or 0 5 ml tube X ul Sterile water 1 3 ul RNA sample containing 0 25 2 ug of total or 0 1 1 0 ug of polyA RNA For the control reaction use 2 ul of the control RNA 1 ul CDS 1 adapter 10 uM 1 ul PlugOligo 1 adapter 15 uM 5 ul Total volume Note Before taking aliquots heat the RNA samples at 65 C for 1 2 min and mix the content by gently flicking the tubes to prevent RNA aggregation Spin the tubes briefly in a microcentrifuge Technical support customer support evrogen com 10 VI cDNA preparation protocol l continued 2 Gently pipette the reaction mixtures and spin the tubes briefly in a microcentrifuge 3 If you use a thermal cycler that is not equipped with a heated lid overlay each reaction with a drop of molecular biology grade miner al oil This will prevent the loss of volume due to evaporation 4 Close the tubes and place them into a thermal cycler 5 Incubate the tubes in a thermal cycler at 70 C for 2 min use heat ed lid 6 Decrease the incubation temperature
6. perform evaluative PCR under the mineral oil even if you use a ther mal cycler equipped with a heated lid 5 Commence thermal cycling using the following program Step Number of cycles Temperature Initial denaturation 1 95 C for 1min Cycling X 95 C for 15 s 66 C for 20 s 72 C for 3 min Final Extension 1 66 C for 15 s 72 C for 3 min Technical support customer support evrogen com 24 VII cDNA preparation protocol Il continued Table 1 PCR cycling parameters Total RNA PolyA RNA Number of PCR cycles for tubes ug ug lt S gt 1 lt S gt 2 lt S gt 3 1 0 2 0 0 5 0 1 14 15 17 18 20 21 0 5 1 0 0 1 0 5 15 16 18 19 21 22 0 25 0 5 0 1 or rather less 17 18 20 21 23 24 X is a number of cycles shown in Table 1 for a given amount of total or polyA RNA used in the first strand synthesis Note Cycling parameters in this protocol have been optimized for MJ Research PTC 200 DNA thermal cycler and Encyclo polymerase mix Optimal parameters may vary with different thermal cyclers polymerases and templates If you use another thermal cycler addi tional optimization of PCR parameters may be required See Troubleshooting Guide for details 6 Analyze 4 ul aliquots of each PCR product alongside 0 1 ug of 1 kb DNA size markers and 4ul of the Control cDNA sample 2 on a 1 2 agarose EtBr gel in 1X TAE buffer Compare the PCR product you have obtained with that in Fig 4 relative to the 1 kb DNA ladder size markers Use gu
7. to 42 C Keep the tubes in the thermal cycler at 42 C for a time required to prepare RT Master mix from 1 to 3 min 7 Simultaneously with steps 5 6 prepare a RT Master mix for all reaction tubes by combining the following reagents in the order shown per rxn the recipe must be adjusted for multiple samples 2 ul 5X First Strand Buffer 1 ul DTT 20 mM 1 ul 10X dNTP 10 mM each 1 ul Mint reverse transcriptase 5 ul Total volume If required 0 5 ul of RNase Inhibitor 20 u ul Ambion can be added to the reaction 8 Gently pipette the RT Master mix and spin the tube briefly in a microcentrifuge 9 Add 5 ul of the RT Master mix into each reaction tube from Step 6 Gently pipette the reaction mix and if required spin the tubes briefly in a microcentrifuge to deposit contents at the bottom Note Do not remove the reaction tubes from the thermal cycler except for the time necessary to add RT Master mix MINT Universal User Manual www evrogen com VI cDNA preparation protocol l continued 11 10 Incubate the tubes at 42 C for 30 min after that proceed imme diately to step 11 11 Add 5 ul of the IP solution to each reaction tube mix by gently pipetting if required spin the tubes briefly in a microcentrifuge and continue incubation of the tubes at 42 C for 1h 30 min Note Do not remove the reaction tubes from the thermal cycler except for the time necessary to add IP solution 12 Place the tubes on ice to stop
8. ul of the control RNA 1 ul CDS 3M adapter 10 uM 1 ul PlugOligo 3M adapter 15 uM each 5 ul Total volume Note Before taking aliquots heat the RNA samples at 65 C for 1 2 min and mix the content by gently flicking the tubes to prevent RNA aggregation Spin the tubes briefly in a microcentrifuge 2 Gently pipette the reaction mixtures and spin the tubes briefly in a microcentrifuge Technical support customer support evrogen com 20 VII cDNA preparation protocol Il continued 3 If you use a thermal cycler that is not equipped with a heated lid overlay each reaction with a drop of molecular biology grade mineral oil This will prevent the loss of volume due to evaporation 4 Close the tubes and place them into a thermal cycler 5 Incubate the tubes in a thermal cycler at 70 C for 2 min use heat ed lid 6 Decrease the incubation temperature to 42 C Keep the tubes in the thermal cycler at 42 C for a time required to prepare RT Master mix from 1 to 3 min 7 Simultaneously with steps 5 6 prepare a RT Master mix for all reac tion tubes by combining the following reagents in the order shown per rxn the recipe must be adjusted for multiple samples 2 ul 5X First Strand Buffer 1 pl DTT 20 mM 1 pl 10X dNTP 10 mM each 1 ul Mint Reverse transcriptase 5 ul Total volume If required 0 5 ul of RNase Inhibitor 20 u ul Ambion can be added to the reaction 8 Gently pipette the RT Master mix and spin
9. 0 1 0 5 14 15 17 18 20 21 0 1 0 5 0 1 or rather less 16 17 20 21 23 24 Note Cycling parameters in this protocol have been optimized for MJ Research PTC 200 DNA thermal cycler and Encyclo polymerase mix Optimal parameters may vary with different thermal cyclers polymerases and templates If you use another thermal cycler addi tional optimization of PCR parameters may be required See Troubleshooting Guide for details 6 Analyze 4 ul aliquots of each PCR product alongside 0 1 ug of 1 kb DNA size marker and 4 ug of control cDNA sample 1 on a 1 2 agarose EtBr gel in 1X TAE buffer Compare the PCR product you have obtained with that in Fig 3 relative to the 1 kb DNA ladder size markers Use guidelines in the step 7 to determine samples with an optimal number of PCR cycles Note PCR product can be stored at 20 C up to three months If amplified samples were frozen before electrophoresis heat them at 72 C for 2 min and mix before loading onto the agarose gel 7 Analysis of PCR result When the yield of PCR products stops increasing with every addition al cycle the reaction has reached its plateau The optimal number of cycles for your experiment should be one or two cycles less than that needed to reach the plateau Be conservative when in doubt it is better to use fewer cycles than too many Figure 3 shows a characteristic gel profile of ds cDNA synthesized using the control human brain total RNA following the Mint protocol
10. 2 156 159 Diatchenko L Lau Y F Campbell A P Chenchik A Moqadam F Huang B Lukyanov S Lukyanov K Gurskaya N Sverdlov E D Siebert PD 1996 Suppression subtractive hybridization a method for generating differentially regulated or tissue specific cDNA probes and libraries Proc Natl Acad Sci U S A 93 12 6025 6030 Diatchenko L Lukyanov S Lau Y F Siebert PD 1999 Suppression subtractive hybridization a versatile method for identifying differen tially expressed genes Methods Enzymol 303 349 380 Franz O Bruchhaus l l Roeder T 1999 Verification of differential gene transcription using virtual northern blotting Nucleic Acids Res 27 e3 Ishikawa H 1977 Evolution of ribosomal RNA Comp Biochem Physiol B 58 1 7 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual 2nd edition Cold Spring Harbor Laboratory Press Cold Spring Harbor New York Schmidt W M Mueller M W 1999 CapSelect a highly sensitive method for 5 CAP dependent enrichment of full length cDNA in PCR mediated analysis of mRNAs Nucleic Acids Res 27 21 e31 Zhulidov P A Bogdanova E A Shcheglov A S Vagner L L Khaspekov G L Kozhemyako V B Matz M V Meleshkevitch E Moroz L L Lukyanov S A Shagin D A 2004 Simple cDNA normal ization using kamchatka crab duplex specific nuclease Nucleic Acid Res 32 e37 Zhulidov P A Bogdanova E A Shcheglov A S Shagina l A Wagne
11. 5 6 kb while normal cDNA size for many non mammalian species is less than 3 kb 2 Several bright bands corresponding to abundant transcripts A number of distinct bright bands are usually present in cDNA pre pared from many tissue sources Band visibility depends on gel elec trophoresis parameters RNA source etc However if bright bands diffuse during PCR cycling this could indicate PCR overcycling If PCR undercycling is observed in all lt S gt 1 lt S gt 3 samples subject the samples to two or three additional PCR cycles plus 1 final exten sion extra cycle and recheck the products Note Representation of the resulting amplified cDNA strongly depends on the initial number of target DNA molecules used for PCR amplification and accordingly on the number of PCR cycles required to amplify cDNA to the amount of 5 10 ng ul when it becomes visi ble on agarose EtBr gel Please remember that if cDNA requires more than 25 26 PCR cycles to be amplified it probably doesn t con tain rare transcripts If no or low yield PCR product is observed after 26 cycles see Troubleshooting Guide MINT Universal User Manual www evrogen com VII cDNA preparation protocol Il continued 27 B2 Full size preparation of ds cDNA 1 For each first strand cDNA sample prepare a PCR Master Mix by combining the following reagents in the order shown per reaction the recipe must be adjusted for multiple samples or other reaction volumes 40 ul S
12. R product and also can decrease cloning efficiency The optimal number of PCR cycles must be determined individually for each experimental sample The protocol provided includes the pro cedure of evaluative PCR in a small reaction volume to determine the optimal number of PCR cycles section VII B1 and subsequent full size preparation of ds cDNA section VII B2 2 In parallel with your experimental samples we recommend that you perform a positive control PCR with the first strand cDNA obtained from the control human RNA provided in the kit This con trol is used to verify that all components are working properly 3 Cycling parameters in this protocol have been optimized for a MJ Research PTC 200 DNA Optimal parameters may vary with different thermal cyclers polymerase and templates Technical support customer support evrogen com 22 VII cDNA preparation protocol Il continued B1 Evaluative PCR 1 For each first strand cDNA sample prepare PCR Master Mix by combining the following reagents in the order shown 40 ul Sterile water 5 ul 10X Encyclo PCR Buffer 1 ul 50X dNTP mix 10 mM each 2 ul PCR Primer M1 10 uM 1 ul 50X Encyclo Polymerase Mix 1 ul First strand cDNA from Step VII A 12 50 ul Total volume Notes The recipe is for three reactions of 16 ul and must be adjust ed for multiple samples or other reaction volumes In the case of multiple samples first prepare a PCR Master Mix for all samples combining
13. Virtual Northern blot see Appendix C SSH see Clontech SMART PCR cDNA Synthesis Kit User Manual Cat PT3041 1 Section VIII Protocol for PCR Select cDNA Subtraction and cDNA normalization using Trimmer kit Evrogen cat NKOO1 MINT Universal User Manual www evrogen com 19 Vil cDNA preparation protocol li PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Important Notes This protocol allows synthesis of cDNA ready to use for directional cloning of cDNA library To prepare cDNA for non directional cloning as well as for other applications Virtual Northern blot suppression subtractive hybridization SSH RACE please use protocol l in the Section VI above To verify that all kit components are working properly perform a positive control cDNA synthesis with human RNA provided in the kit in parallel with your experimental samples Before you begin the first cDNA synthesis procedure shake all enzymes solutions and spin the tubes briefly in a microcentrifuge A First strand cDNA synthesis and PlugOligo 3M incorporation Note During the first strand cDNA synthesis the use of a thermal cycler for incubation steps is recommended Using the air thermo stat may require additional optimization 1 For each RNA sample combine the following reagents in a sterile thin 0 2 ml or 0 5 ml tube x ul Sterile water 1 3 ul RNA sample containing 0 25 2 ug of total or 0 1 1 0 ug of polyA RNA For the control reaction use 2
14. es ethanol or LiCl precipitation of RNA can remove impurities If this does not help re isolate RNA using a different technique C The concentration of the PCR product generated from the experimental RNA samples is low but the quality is good 1 PCR undercycling resulting in a low yield of PCR product may be a problem Subject the samples to two or three additional PCR cycles plus 1 final extension extra cycle and recheck the products MINT Universal User Manual www evrogen com VIII Troubleshooting guide continued 31 If the increase in the cycle number of does not improve the yield of PCR product repeat PCR using a fresh aliquot of the first strand cDNA If you still obtain a low yield of PCR product it could indicate a low yield of first strand cDNA Repeat the experiment using more RNA Note We do not recommend that you use cDNA samples obtained after more than 25 PCR cycles because these samples may be not representative 2 Your experimental RNA can be too diluted When total RNA con centration is determined on a spectrophotometer high content of tRNA may include a mistake in estimation of MRNA concentration If you have not already done so analyze your RNA samples using formaldehyde agarose EtBr gel electrophoresis to estimate its con centration and quality If high content of tRNA is a problem remove low molecular weight RNA fraction using RNA purification columns D No expected bright bands are distinguishab
15. es not work anyway contact Evrogen tech nical support customer supportGevrogen com B Poor yield or no PCR product is generated from your experi mental RNA The PCR product has size distribution less than expected At the same time a high quality PCR product is gen erated from the control RNA 1 Your experimental RNA can be too diluted or degraded If you have not already done so analyze your RNA samples using formaldehyde agarose EtBr gel electrophoresis to estimate its concentration and quality 2 Experimental RNA can be partially degraded e g due to RNase contamination before or during the first strand synthesis Check the Stability of your experimental RNA by incubating a small aliquot in water for 1 hr at 42 C Then analyze it on a formaldehyde agarose EtBr gel alongside an unincubated aliquot If the RNA is degraded during the incubation it will not yield good results in the first strand cDNA synthesis In this case re isolate RNA Perform several additional rounds of phenol chloroform extraction because they can considerably increase RNA stability Repeat the experiment using a fresh lot or preparation of RNA 3 If RNA degradation during cDNA synthesis is suspected add 0 5 ul RNase Inhibitor 20 u ul Ambion into the first strand synthesis reaction as described in the sections VI A 7 protocol l or VII A 7 protocol II 4 Your experimental RNA sample can contain impurities that inhibit cDNA synthesis In some cas
16. everse transcriptase RT The workflow to prepare cDNA using the MINT Universal cDNA synthesis kit is shown in Fig 1 First strand cDNA synthesis starts from the 3 end adapter compris ing oligo dT sequence to anneal to polyA stretch of RNA When RT reaches the 5 end of the mRNA it adds several non template nucleotides primarily deoxycytidines to the 3 end of the newly syn thesized first strand cDNA Schmidt amp Mueller 1999 This oligo dC stretch base pairs to complementary oligo dG sequence located at the 3 end of a special 30 mer deoxyribooligonucleotide called PlugOligo RT identifies PlugOligo as an extra part of the RNA tem plate and continues first strand cDNA synthesis to the end of the oligonucleotide thus incorporating PlugOligo sequence into the 5 end of cDNA The last 3 dG residue of the PlugOligo is a terminator nucleotide comprising 3 phosphate group This blocking group prevents unwanted annealing and extension of the PlugOligo Under standard conditions RT can hardly use PlugOligo as a template however our special IP solution solution for Incorporation of PlugOligo sequence dramatically increases the efficiency of this process Technical support customer support evrogen com 2 Il Method overview continued At the final step ds cDNA is amplified by PCR Use of Encyclo poly merase and specially designed primers allows synthesis of full length enriched cDNA that is flanked by PlugOligo and 3 e
17. fa evrogen MINT Universal cDNA synthesis kit Cat SKOO2 User Manual This product is intended for research use only TABLE OF CONTENTS l Intended use 1 Il Method overview 1 Ill Kit components and storage conditions 4 IV General considerations 6 V RNA requirements 7 VI cDNA preparation protocol l cDNA for non directional 9 cloning VII cDNA preparation protocol lI cDNA for directional 19 cloning VIII Troubleshooting guide 29 IX Appendixes Appendix A Recommendations to perform 32 non denaturing agarose gel electrophoresis of RNA Appendix B ds cDNA Polishing 33 Appendix C Virtual Northern blot 33 X References 34 XI Related products 35 A Encyclo PCR kit B Trimmer CDNA normalization kit C Trimmer direct cDNA normalization kit Endnotes 36 MINT Universal User Manual www evrogen com l Intended use MINT Universal cDNA synthesis kit is designed to synthesize full length enriched double stranded ds cDNA from total or polyA RNA Synthesized cDNA can be used in various applications including preparation of directionally or non directionally cloned cDNA libraries Virtual Northern blot Franz et al 1999 subtractive hybridization SSH Diatchenko et al 1996 Diatchenko et al 1999 and cDNA normalization using duplex specific nuclease Zhulidov et al 2004 Zhulidov et al 2005 ll Method overview MINT cDNA synthesis is based on a novel technology utilizing the specific features of MMLV based r
18. g protocol 1 Combine the following reagents in a sterile 0 5 ml tube 50 ul of non purified amplified dsDNA after step B2 6 1 0 ul dNTP mix 10 mM each 3 0 ul 15 units of T4 DNA polymerase Mix components by gently flicking the tube Spin the tube briefly in a microcentrifuge 2 Incubate the tube at room temperature for 5 10 min 3 Purify blunt ended cDNA using either phenol chloroform extrac tion followed by ethanol precipitation or commercial PCR purifica tion kits 4 Dissolve cDNA in 30 50 ul of 5mM Tris HCI buffer pH7 5 8 5 to the final DNA concentration of about 30 50 ng ul This cDNA can be ligated to any adapter you choose Consult your protocol for cDNA library construction Appendix C Virtual Northern blot To perform Virtual Northern blot perform gel electrophoresis of your unpurified PCR products on a 1 2 agarose EtBr gel and transfer them onto a nylon membrane Sambrook et al 1989 Load 150 200 ng of ds cDNA onto a gel slot about 8 12 ul of the PCR reaction Use P labeled probes specific to the genes of interest for hybridization with the membrane For example TurboBlotter equip ment and protocol from Schleicher amp Schuell should be used to per form Virtual Northern blot Technical support customer support evrogen com 34 X References Chomczynski P Sacchi N 1987 Single step method of RNA isola tion by acid guanidinium thiocyanate phenol chloroform extraction Anal Biochem 16
19. idelines below step 7 to determine samples with optimal number of PCR cycles Note PCR product can be stored at 20 C up to three months If amplified samples were frozen before electrophoresis heat them at 72 C for 2 min and mix before loading onto the agarose gel 7 Analysis of PCR result When the yield of PCR products stops increasing with every addition al cycle the reaction has reached its plateau The optimal number of cycles for your experiment should be one or two cycles less than that needed to reach the plateau Be conservative when in doubt it is better to use fewer cycles than too many MINT Universal User Manual www evrogen com Vil cDNA preparation protocol ll continued 25 Figure 4 shows a characteristic gel profile of ds cDNA synthesized using the control human brain total RNA following the protocol out lined in Section VII Figure 4 Agarose gel 1 2 electrophoresis of amplified control cDNA after different number of PCR cycles The number of PCR cycles per formed is indicated at the top M 1 kb DNA size mark er SibEnzyme Russia C control cDNA sample 2 In the experiment showed 1 ug of control RNA was used for cDNA synthesis PCR products 4 ul per lane after 15 18 21 and 24 cycles were analyzed on a 1 2 agarose EtBr gel in 1X TAE buffer alongside 0 1 ug of 1 kb DNA size markers After 21 cycles a smear appeared in the high molecular weight region of the gel indicating that
20. ification cycles If the smear is much fainter lane 1 this could indicate PCR under cycling too few cycles Technical support customer support evrogen com 16 VI cDNA preparation protocol l continued If the size distribution of cDNA is generally less than expected for example less than 3 kb for cDNA from mammalian sources this could indicate that initial RNA is of poor quality or degraded during storage synthesis Note In general ds cDNA size distribution should be similar to cor respondent mRNA which typically appears within the range of 0 5 10 kb on an agarose EtBr gel For most mammalian tissues visible smear of full length enriched cDNA should be within the range of 0 5 6 kb while normal cDNA size for many non mammalian species is less than 3 kb Fig 4 2 Several bright bands corresponding to abundant transcripts A number of distinct bright bands are usually present in cDNA pre pared from many tissue sources Band visibility depends on gel elec trophoresis parameters RNA source etc However if bright bands diffuse during PCR cycling this could indicate PCR overcycling If PCR undercycling is observed in all lt S gt 1 lt S gt 3 samples subject the samples to two or three additional PCR cycles plus 1 final exten sion extra cycle and recheck the products Note Representation of the resulting amplified cDNA strongly depends on the initial number of target DNA molecules used for PCR amplification a
21. ionally cloned cDNA library TRIMMER direct kit is designed to normalize full length enriched cDNA prepared using Evrogen MINT Universal cDNA synthesis kit Cat 4 SKOO2 see protocol ll in the section VII or Clontech SMART technology based kits SMART cDNA Library Construction Kit Cat 634901 Creator SMART cDNA Library Construction Kit Cat 634903 Technical support customer support evrogen com 36 XI Related products continued Note a specially designed Evrogen CDS 3M adapter provided in TRIMMER direct kit must be used for cDNA preparation instead of the Clontech adapter cDNA generated using these kits contains asymmetric Sfil restriction sites and can be used after normalization with TRIMMER direct kit to generate directionally cloned normalized cDNA library Product Cat Amount TRIMMER direct NKOO2 for 10 rxn Endnotes This product is intended to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use Evrogen products may not be resold modified for resale or used to manufacture commercial products without written approval of Evrogen PCR is the subject of patents issued in certain countries The pur chase of this product does not include a license to perform PCR However many researchers may not be required to obtain a license Other investigators may already have a license to perform PCR through use of a thermal cycler with the approp
22. l visible as a second band Note If your experimental RNA is shorter than expected and or degraded according to electrophoresis data prepare fresh RNA after checking the quality of RNA purification reagents If problems per sist you may need to find another source of tissue cells In some cases partially degraded RNA is only available e g tumor samples or hard treated tissues This RNA can be used for cDNA preparation however the cDNA sample will contain reduced number of full length molecules 4 Commonly genomic DNA contamination does not exceed the amount seen on the agarose EtBr gel as a weak band of high molec ular weight Such contamination does not affect cDNA synthesis DNase treatment to degrade genomic DNA is not recommended In some cases excess of genomic DNA can be removed by LiCl precip itation or by phenol chloroform extraction MINT Universal User Manual www evrogen com VI cDNA preparation protocol l PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Important Notes This protocol allows synthesis of cDNA ready to use for non directional cloning of cDNA library Virtual Northern blot RACE and suppression subtractive hybridiza tion To prepare cDNA for directional cloning please use proto col ll in the Section VII below To verify that all kit components are working properly perform a positive control cDNA synthesis with human RNA provided in the kit in parallel with your experimental samples Before you
23. le in the PCR product visualized by agarose gel electrophoresis 1 For most cDNA samples there should be several intensive bands distinguishable against the background smear when the PCR prod uct is visualized on agarose gel If these bands are expected but not visible and the background smear is very intense it could indicate PCR overcycling Repeat PCR amplification with a fresh first strand cDNA sample using 2 3 fewer cycles Note cDNA prepared from some mammalian tissues e g human brain spleen and thymus may not display bright bands due to a very high complexity of the starting RNA 2 Gel running parameters can alter band visibility Be sure to use the following conditions for optimal quality of your electrophoresis pic ture a 1X TAE buffer instead of 1X TBE a gel concentration of 1 1 1 5 agarose and running voltage up to 10 V cm Technical support customer support evrogen com 32 IX Appendixes Appendix A Recommendations to perform non denaturing agarose gel electrophoresis of RNA 1 The following gel electrophoresis conditions are recommended use 1X TAE buffer instead of 1X TBE use agarose gel in the concentration of 1 1 1 2 add ethidium bromide EtBr to the gel and electrophoresis buffer to avoid the additional potentially RNAse prone step of gel staining always use fresh gel and buffer as well as clean electrophoresis equipment for RNA analysis Wear gloves to protect RNA samples from degradati
24. ly flicking the tube and spin the tube briefly in a microcen trifuge to deposit contents at the bottom before use 6 Add enzyme to reaction mixture last and thoroughly mix it by gen tly pipetting the reaction mixture up and down 7 Do not increase the amount of enzymes added or concentration of RNA and cDNA in the reactions The amounts and concentrations have been carefully optimized MINT Universal User Manual www evrogen com V RNA requirements PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Note The sequence complexity and the average length of the MINT cDNA noticeably depend on the quality of starting RNA material 1 The protocol has been optimized for both total and polyA RNA The minimum amount of starting material for cDNA synthesis is 250 ng of total RNA or 100 ng of polyA RNA However for better results we recommend that you use at least 1 1 5 ug of total RNA or 0 5 ug of polyA RNA to start first strand cDNA synthesis Note Representation of the resulting amplified cDNA depends on the initial amount of RNA used for the first strand cDNA synthesis Thus if possible use the higher starting amounts of RNA indicated in the following protocol 2 There are a number of methods suitable for RNA isolation providing stable RNA preparation from a majority of biological objects for exam ple Trizol method GIBCO Life Technologies Chomczynski amp Sacchi method Chomczynski amp Sacchi 1987 and RNeasy kits QIAGEN
25. microcentrifuge MINT Universal User Manual www evrogen com VI cDNA preparation protocol l continued 13 3 Aliquot 16 ul of PCR reaction into PCR tubes three tubes for each first strand cDNA Label the tubes as lt S gt 1 lt S gt 2 and lt S gt 3 wherein lt S gt is a sample identifier Note Thin wall PCR tubes are recommended These PCR tubes are optimized to ensure more efficient heat transfer and to maximize thermal cycling performance We recommend that you use 0 2 ml PCR tubes rather than 0 5 ml ones 4 Overlay each reaction with a drop of mineral oil 15 20 ul Close the tubes and place them into a thermal cycler Note Because of a small reaction volume we recommend that you perform evaluative PCR under the mineral oil even if you use a ther mal cycler equipped with a heated lid 5 Commence thermal cycling using the following program Step Number of cycles Temperature Initial denaturation 1 95 C for 1min Cycling X 95 C for 15 s 66 C for 20 s 72 C for 3 min Final Extension 1 66 C for 15 s 72 C for 3 min X is a number of cycles shown in Table 1 for a given amount of total or polyA RNA used in the first strand synthesis Technical support customer support evrogen com 14 VI cDNA preparation protocol l continued Table 1 PCR cycling parameters Total RNA PolyA RNA Number of PCR cycles for tubes ug 18 lt S gt 1 lt S gt 2 lt S gt 3 1 0 2 0 0 5 1 0 13 14 16 17 19 20 0 5 1 0
26. mix by gently flicking the tubes before taking aliquots Store the remaining first strand cDNA at 20 C 5 If you use a thermal cycler that is not equipped with a heated cover overlay each reaction with a drop of mineral oil Close the tubes and place them into a thermal cycler Technical support customer support evrogen com 18 VI cDNA preparation protocol l continued 6 Commence thermal cycling using the following program Step Number of cycles Temperature Initial denaturation po 95 C for 1min Cycling N 95 C for 15 s 66 C for 20 s 72 C for 3 min Final Extension 1 66 C for 15 s 72 C for 3 min N is the optimal number of cycles determined previously section VI B 1 7 Analyze 4 ul aliquots of each PCR product alongside 0 1 ug of 1 kb DNA size marker and 4 ul aliquot of the Control cDNA sample 1 ona 1 2 agarose EtBr gel in 1X TAE buffer If required add 1 2 additional PCR cycles Now you have obtained amplified ds cDNA This cDNA can be stored at 20 C up to six months It can be used for non directional cloning of cDNA library into TA cloning vectors Before cloning purification of a PCR product is rec ommend using phenol chloroform extraction or commercial PCR purification kits After polishing procedure see Appendix B the cDNA can be non directionally cloned using blunt ends into any other vector of choice Note Use unpurified PCR product for polishing This cDNA can be also used for
27. mprise asymmetric sites for Sfil restriction enzyme SfiA amp SfiB Fig 2 Being incorporated at the 5 and 3 ends of the cDNA the sites allow directional cloning of the cDNA library After digestion with Sfil and size fractionation synthe sized cDNA can be ligated into an appropriate Sfil digested vector Prior to cloning cDNA can be normalized using Evrogen Trimmer direct kit Evrogen Cat NKOO2 See protocol Il for synthesis of cDNA for directional cloning at the Section VII Important note In the case of cDNA prepared for directional cloning a size separation procedure is recommended before cloning to remove low molecular weight cDNA fragments that are often gener ated during cDNA amplification SfilA site SfilB site y v 5 GGCCATTACGGCC 3 5 GGCCGCCTCGGCC 3 3 CCGGTAATGCCGG 5 a CCGGCGGAGCCGG 5 f Figure 2 Sfil A amp B recognition sites Technical support customer support evrogen com 4 Ill Kit components and storage conditions A List of kit components MINT Universal cDNA synthesis kit provides components for 20 reactions of ds cDNA synthesis The kit comprises two adapter pairs wherein the first pair CDS 1 and PlugOligo 1 allows synthesis of cDNA suitable for non directional cloning see protocol l Section VI while the second CDS 3M and PlugOligo 3M is for synthesis of cDNA for directional cloning see protocol ll Section VII Package of the kit includes a free sample of Mint reverse transcrip
28. nd adapter sequences MINT Universal cDNA synthesis kit comprises two pairs of adapters allowing synthesis of cDNA with different flanking sequences RNA NA RANT SARA NT NA FF MAAK First strand cDNA synthesis 3 end adapter TTTT 1 RAAN AAAA NT RA AAAA AA KAKA G mm Mint RT Y RANS RA PSHOOSS SSA FT eo TU on PlugOligo p PlugOligo Incorporation lm ccc 0o AP i m 6666 y o IP solution SE ENDIS ee ow ee ae ow ae AAA E ion AP Ma GGG EDENN AN ANDAN ANANA ANA KABA 0 A AAA OO n ds cDNA preparation by PCR PCR primer M1 GGGG A aaa w ro re Amplified cDNA cDNA cloning Figure 1 Schematic outline of Mint cDNA synthesis workflow MINT Universal User Manual www evrogen com Il Method overview continued 3 The first pair is 3 end adapter CDS 1 and 5 end adapter PlugOligo 1 both are identical to that included into the Mint cDNA synthesis kit Cat SKOO1 These adapters comprise extensive common sequence and allow synthesis of cDNA ready to non directional cloning see cDNA synthesis protocol l at the Section VI The cDNA is also well suited for other common applications like Virtual Northern blot Franz et al 1999 subtractive hybridization SSH Diatchenko et al 1996 Diatchenko et al 1999 etc This cDNA can be normalized using Evrogen Trimmer kit Evrogen Cat NKOO1 The second adapter pair is 3 end adapter CDS 3M and 5 end adapter PlugOligo 3M The adapters co
29. nd accordingly on the number of PCR cycles required to amplify cDNA to the amount of 5 10 ng ul when it becomes visi ble on agarose EtBr gel Please remember that if cDNA requires more than 26 PCR cycles to be amplified it probably doesn t contain rare transcripts If no or low yield PCR product is observed after 25 cycles see Troubleshooting Guide MINT Universal User Manual www evrogen com VI cDNA preparation protocol l continued 17 B2 Full size preparation of ds cDNA 1 For each first strand cDNA sample prepare a PCR Master Mix by combining the following reagents in the order shown per rxn the recipe must be adjusted for multiple samples or other reaction volumes 40 ul Sterile water 5 ul 10X Encyclo PCR Buffer 1 ul 50X dNTP mix 10 mM each 2 ul PCR Primer M14 10 uM 1 pl 50X Encyclo Polymerase Mix 49 ul Total volume 2 Mix PCR components by gently flicking the tube Spin the tube briefly in a microcentrifuge 3 Aliquot 49 ul of PCR Master Mix into the appropriate number of PCR tubes Note Thin wall PCR tubes are recommended These PCR tubes are optimized to ensure more efficient heat transfer and to maximize thermal cycling performance We recommend that you use 0 2 ml PCR tubes rather than 0 5 ml ones 4 Add 1 ul aliquot of the first strand cDNAs from step A 12 into the tubes Note If your first strand cDNA samples were stored at 20 C pre heat the first strand cDNA reactions at 65 C for 1 min and
30. on by nucleases and avoid a hand contact with EtBr use running voltage up to 10 V cm 10V per each cm of space between the electrodes in electrophoretic chamber Do not use high voltage to avoid RNA degradation during electrophoresis 2 Heat an aliquot of the RNA solution at 700C for 1 min and place it on ice before loading on a gel 3 Load a known amount of DNA or RNA ladder alongside your RNA sample as a standard for determining the RNA concentration RNA concentration can be roughly estimated assuming that the efficien cy of EtBr incorporation in rRNA is the same as for DNA the riboso mal RNA may be considered a double stranded molecule due to its extensive secondary structure 4 The first sign of RNA degradation on the non denaturing gel is a slight smear starting from the rRNA bands and extending to the area of shorter fragments RNA showing this extent of degradation is still good for further procedures However if the downward smearing is so pronounced that the rRNA bands do not have a discernible lower edge this RNA should be discarded MINT Universal User Manual www evrogen com IX Appendixes continued 33 Appendix B ds cDNA Polishing A Materials required for cDNA polishing T4 DNA Polymerase New England Biolabs Cat No MO203S 96 ethanol 3 M potassium acetate pH5 2 80 ethanol TE saturated phenol chlorophorm isopropyl alcohol mix 24 1 10mM Tris HCl pH 7 5 8 5 B ds cDNA polishin
31. outlined in Section VI In the experiment showed 1 ug of control RNA MINT Universal User Manual www evrogen com VI cDNA preparation protocol l continued 15 was used for cDNA synthesis PCR products 4 ul per lane after 15 18 21 and 24 cycles were analyzed on a 1 2 agarose EtBr gel in 1X TAE buffer alongside 0 1 ug of 1 kb DNA size markers M 15 18 21 24 C Figure 3 Agarose gel 1 2 electrophoresis of amplified or control cDNA after different 4 number of PCR cycles The number of PCR cycles per formed is indicated at the top M 1 kb DNA size marker SibEnzyme Russia C control cDNA sample 1 After 21 cycles a smear appeared in the high molecular weight region of the gel indicating that the reaction is overcycled Because the plateau was reached after 20 cycles the optimal cycle number for this experiment is 18 19 Typical results indicative of a successful PCR should have the fol lowing characteristics 1 A moderately strong cDNA smear of expected size distribution For cDNA prepared from most mammalian RNA the overall signal intensity relative to the 1 kb DNA ladder size markers 0 1 ug run on the same gel should be roughly similar to that shown for the control experiment in Fig 3 lane 2 If the cDNA smear appears in the high molecular weight region of the gel e g as in lane 4 especially if no bright bands are distinguishable this could indicate overcycled PCR too many ampl
32. ped at ambient temperature Once arrived the kit must be kept at 20 C B Materials required but not included Biology grade mineral oil RNase Inhibitor 20 u ul Ambion optional Blue ice Sterile 0 5 or 0 2 ml PCR tubes and sterile microcentrifuge 1 5 ml tubes Pipettes P10 P20 P200 and pipette tips pipette tips with hydrophobic filters are recommended for all procedures Vortex Microcentrifuge Agarose gel electrophoresis reagents and equipment DNA size markers 1 kb DNA ladder PCR thermal cycler Columns for size selection of cDNA equilibrated in TE buffer e g Clontech CHROMA SPIN 400 or 1000 for size separation of cDNA for directional cloning Technical support customer support evrogen com 6 IV General considerations PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING 1 Wear gloves to protect RNA and cDNA samples from degradation by nucleases 2 If possible perform cDNA synthesis PCR reaction preparation and post PCR analysis in separate laboratory areas to avoid cross contamination of samples 3 Use PCR pipette tips containing hydrophobic filters to minimize contamination 4 We recommend that you perform a positive control cDNA synthe sis from the total RNA provided in the kit in parallel with your exper iment This control is performed to verify that all components are working properly 5 After solution is just thawed we strongly recommend that you mix it by gent
33. r L L Khaspekov G L Kozhemyako V B Lukyanov S A Shagin D A 2005 A method for the preparation of normalized cDNA libraries enriched with full length sequences Russian Journal of Bioorganic Chemistry 31 2 170 177 MINT Universal User Manual www evrogen com 35 XI Related products A Encyclo PCR kit Encyclo PCR kit is suitable for most PCR applications It is especially recommended for cDNA amplification due to optimal combination of high fidelity and processivity provided by Encyclo polymerase mix Evrogen Encyclo polymerase mix produces high yields of PCR prod ucts from a wide variety of templates and is suitable for difficult tem plates long PCR up to 15 kb and cloning Product Cat Amount Encyclo PCR kit PKOO1 100 PCR rxn 50 ml each B TRIMMER kit for nondirectionally cloned cDNA library preparation TRIMMER kit is designed to normalize full length enriched cDNA pre pared using Evrogen MINT cDNA synthesis kit Cat SKOO1 or Clontech SMART technology based kits SMART PCR cDNA Synthesis Kit Cat 634902 Super SMART PCR cDNA Synthesis Kit Cat 635000 cDNA generated using these kits contains symmetric adapter sequences 5 aagcagtggtatcaacgcagagt 3 at both ends and can be used after normalization with TRIMMER kit to generate nondirection ally randomly cloned normalized cDNA library Product Cat Amount TRIMMER NKOO1 for 10 rxn C TRIMMER direct kit for preparation of direct
34. reaction Note A brown sediment may be generated in the reaction s It does not affect following pro cedures First strand cDNA prepared can be used immediately for ds cDNA synthesis Section VI B or stored at 20 C up to three months B ds cDNA synthesis by PCR amplification Important Notes 1 Use of the optimal number of PCR cycles ensures that the ds cDNA remains in the exponential phase of amplification This is cru cial for many applications like Virtual Northern blot Franz et al 1999 or selective subtraction hybridization Diatchenko et al 1996 Diatchenko et al 1999 PCR overcycling yields nonspecific PCR products and is extremely undesirable for these applications PCR undercycling results in a lower yield of PCR product The optimal number of PCR cycles must be determined individually for each experimental sample The protocol provided includes the procedure of evaluative PCR in a small reaction volume to determine the opti mal number of PCR cycles section B1 and subsequent full size preparation of ds cDNA section B2 2 In parallel with your experimental samples we recommend that you perform a positive control PCR with the first strand cDNA obtained from the control human RNA provided in the kit This con trol is used to verify that all components are working properly Technical support customer support evrogen com 12 VI cDNA preparation protocol l continued 3 Cycling parameters in this protocol ha
35. riate label license Material safety data sheet information EVROGEN JSC Moscow Russia hereby confirms that to the best of our knowledge this product does not require a Material Safety Data Sheet However all of the properties of this product and if applica ble each of its components have not been thoroughly investigated Therefore we recommend that you use gloves and eye protection and wear a laboratory coat when working with this product MINT Universal User Manual www evrogen com ver 03110 Evrogen JSC Miklukho Maklaya str 16 10 117997 Moscow Russia Tel 7 495 988 4084 Fax 7 495 988 4085 www evrogen com
36. terile water 5 ul 10X Encyclo PCR Buffer 1 pl 50X dNTP mix 10 mM each 2 ul PCR Primer M1 10 uM 1 pl 50X Encyclo Polymerase Mix 49 ul Total volume 2 Mix PCR components by gently flicking the tube Spin the tube briefly in a microcentrifuge 3 Aliquot 49 ul of PCR Master Mix into the appropriate number of PCR tubes Note Thin wall PCR tubes are recommended These PCR tubes are optimized to ensure more efficient heat transfer and to maximize thermal cycling performance We recommend that you use 0 2 ml PCR tubes rather than 0 5 ml ones 4 Add 1 ul aliquot of the first strand cDNAs from step A 12 into the tubes Note If your first strand cDNA samples were stored at 20 C pre heat the first strand cDNA reactions at 65 C for 1 min and mix by gently flicking the tubes before taking aliquots Store the remaining first strand cDNA at 20 C 5 If you use a thermal cycler that is not equipped with a heated cover overlay each reaction with a drop of mineral oil Close the tubes and place them into a thermal cycler Technical support customer support evrogen com 28 VII cDNA preparation protocol Il continued 4 Commence thermal cycling using the following program Step Number of cycles Temperature Initial denaturation 4 95 C for 1min Cycling N 95 C for 15 s 66 C for 20 s 72 C for 3 min Final Extension ui 66 C for 15 s 72 C for 3 min N is the optimal number of cycles determined in the section B 1
37. the reaction is overcycled Because the plateau was reached after 19 20 cycles the optimal cycle num ber for this experiment is 18 Typical results indicative of a successful PCR should have the fol lowing characteristics 1 A moderately strong cDNA smear of expected size distribution For cDNA prepared from most mammalian RNA the overall signal intensity relative to the 1 kb DNA ladder size markers 0 1 ug run on the same gel should be roughly similar to that shown for the control experiment in Fig 5 lane C If the cDNA smear appears in the high molecular weight region of the gel e g as in lane 4 e g cDNA after Technical support customer support evrogen com 26 VII cDNA preparation protocol Il continued 22 cycles of PCR especially if no bright bands are distinguishable this could indicate overcycled PCR too many amplification cycles If the smear is much fainter lane 1 this could indicate PCR under cycling too few cycles If the size distribution of cDNA is generally less than expected for example less than 2 kb for cDNA from mammalian sources this could indicate that initial RNA is of poor quality or degraded during storage synthesis Note In general ds cDNA size distribution should be similar to cor respondent mRNA which typically appears within the range of 0 5 10 kb on an agarose EtBr gel For most mammalian tissues visible smear of full length enriched cDNA should be within the range of 0
38. the tube briefly in a microcentrifuge 9 Add 5 ul of the RT Master mix into each reaction tube from Step 6 Gently pipette the reaction mix and if required spin the tubes briefly in a microcentrifuge to deposit contents at the bottom Note Do not remove the reaction tubes from the thermal cycler except for the time necessary to add RT Master mix MINT Universal User Manual www evrogen com VII cDNA preparation protocol Il continued 21 10 Incubate the tubes at 42 C for 30 min after that proceed imme diately to step 11 11 Add 5 ul of the IP solution to each reaction tube mix by gently pipetting if required spin the tubes briefly in a microcentrifuge and continue incubation of the tubes at 42 C for 1h 30 min Note Do not remove the reaction tubes from the thermal cycler except for the time necessary to add IP solution 12 Place the tubes on ice to stop reaction Note A brown sediment may be generated in the reaction s It does not affect following pro cedures First strand cDNA prepared can be used immediately for ds cDNA synthesis Section VII B or stored at 20 C up to three months B ds cDNA synthesis by PCR amplification Important Notes 1 Use of the optimal number of PCR cycles ensures that the ds cDNA remains in the exponential phase of amplification PCR over cycling yields nonspecific PCR products and is extremely undesir able for cDNA library cloning PCR undercycling results in a lower yield of PC
39. uring the procedure such as using a suboptimal incubation temperature or omitting an essential com ponent Carefully check the protocol and repeat the first strand syn thesis and PCR using 1 ul of the control RNA on a start One of the typical mistakes is that RNA samples were not well mixed after defrosting In some cases heating of RNA samples before aliquoting 65 C for 2 3 min may help 3 PCR conditions and parameters might have been suboptimal The optimal number of PCR cycles may vary with different PCR machines RNA samples etc If your PCR reaches its plateau after 25 cycles or more the conditions of your PCR may have not been optimal Perform optimization of PCR parameters and repeat the PCR using a fresh aliquot of the first strand cDNA product Optimization of PCR parameters a Annealing temperature is too high decrease the anneal ing temperature in increments of 2 4 C b Denaturation temperature is too high or low optimize denaturation temperature by decreasing or increasing it in 1 C increments c Extension time too short increase the extension time in 1 min increments 4 If RNA degradation during cDNA synthesis is suspected add 0 5 ul RNase Inhibitor 20 u ul Ambion into the first strand synthe sis reaction as described in the sections VI A 7 protocol l or VII A 7 protocol Il Technical support customer support evrogen com 30 VIII Troubleshooting guide continued 5 If the positive control do
40. ve been optimized for a MJ Research PTC 200 DNA Optimal parameters may vary with different thermal cyclers polymerase and templates B1 Evaluative PCR 1 For each first strand cDNA sample prepare PCR Master Mix by combining the following reagents in the order shown 40 ul Sterile water 5 ul 10X Encyclo PCR Buffer 1 ul 50X dNTP mix 10 mM each 2 ul PCR Primer M1 10 uM 1 ul 50X Encyclo Polymerase Mix 1 ul First strand cDNA from Step VI A 12 50 ul Total volume Notes The recipe is for three reactions of 16 ul and must be adjusted for multiple samples or other reaction volumes In the case of multiple samples first prepare a PCR Master Mix in a sterile 0 5 ml tube for all samples combining all reagents shown except the first strand cDNA Then aliquot 49 ul of the PCR Master Mix into the appropriate number of fresh sterile 0 5 ml tubes and add 1 ul of the first strand cDNA solutions from Step VI A 12 If your first strand cDNA samples were stored at 20 C pre heat the first strand cDNA reactions at 650C for 1 min and mix contents by gently flicking the tube before taking aliquots Store the remaining first strand cDNA in blue ice if you plan to perform full size cDNA preparation section B 2 directly after evaluative PCR If you plan to perform full size cDNA preparation sometime later store the remain ing first strand cDNA at 20 C 2 Mix PCR components by gently flicking the tube Spin the tube briefly in a
Download Pdf Manuals
Related Search