Home

CodonCode Aligner User Manual

1. The views preferences allow you to set options for the various view windows Note that the changing the font size for the project view also will change the font size in dialogs In the Contig view panel at the top you choose how samples should be sorted in contig views For most projects the default of sorting samples by position in contigs makes the most sense Samples will be sorted in ascending order based on their first aligned base in a contig Sometimes sorting the samples by name is more desirable One example is a mutation detection project where your forward and reverse reads have similar names like Sample123 f for forward and Sample123 r for reverse and where you would like to have the forward and reverse reads right underneath each other If you select By direction and contig position all reads in forward direction will first be sorted by position and then all reads in reverse direction will be sorted Changing these preferences here will not affect any open contig view windows it will also not affect contigs where you previously sorted samples manually by dragging read names up or down To change the sorting in View Preferences 294 CodonCode Aligner User Manual open contig view windows or to quickly try out the different sort options open a contig view and right click command click on OS X in the aligned bases panel to display the contig view popup menu then choose Sort sam
2. Cancel Change parameters I Please note that you do not have to end clip sequences before assembly or alignment the assembly will typically work fine without end clipping However you can get cleaner and sometimes better assemblies by end clipping sequences before vector screening and assembly To each sequence that is clipped Aligner will add a processing tag which states how many bases were clipped at the beginning and the end You can see these tags in the feature view window if you have the End Clipping 43 CodonCode Aligner User Manual processing tags included in your definition of features and in the tag dialog that is accessible from the sample information dialog End Clipping Parameters You can change the stringency of the end clipping in the end clipping preferences Either press the Change parameters button in the clipping preview window as described above or select the End clipping preference panel in the Preferences window to see the Preferences window select Preferences in the application menu on OS X and Preferences in the Edit menu on Windows This will show the following window Preferences End clipping i imi i i 0 1 Base calling Maximize region with error rate below Base colors Use separate criteria for start and end Consensus method r Trim from start until Double clicking J F nd clipping V Error rate is below 0 1 ina 25 base wind
3. Contig Information Preferences Project View Columns And Sorting The project view contains a number of columns most of which are pretty self explanatory You can click on the column headers to sort the project view however the Unassembled Samples folder will always be on the top and the Trash folder at the bottom Here are descriptions of the columns from left to right the Triangles in the left most column let you expand or condense contigs and other folders the Name column shows the name of the folder or sample you can change sample and contig names through the Sample Information and Contig Information dialogs accessible through the Sample and Contig menus the Contents column tells you details about what is in a folder or contig or about the samples the Length column shows the length of a contig or sample the Quality column displays the number of bases with a quality score of 20 or above Phred20 bases for samples and contigs that have qualities the Position column shows the position of the first base of a sample within a contig only for samples in contigs not for unassembled samples or samples in the trash the Added column shows the date a sample was added to the project the Modified column shows the date a sample was last edited or otherwise modified the Comments column shows and comments you or a program may have added to the sample Selecting Samples and Contigs 180
4. to scale a trace view vertically keep the control key pressed while scrolling with the mouse wheel this has the same effect as using the vertical scroll bar making peaks larger or smaller to scroll between traces if the trace view window contains more traces than currently fit on the screen move the mouse pointer over the vertical slider on the right allows and then use the scroll wheel You can change the default height of trace view panels in the Views preferences To scale the traces horizontally use the slider in the bottom left corner of the trace view Trace Sharpening If you are working with traces where the peaks overlap and are badly resolved CodonCode Aligner s trace sharpening can help you to get a better look at your data Here is an example of a badly resolved region in a sequence eoe Traces from Unassembled Samples m P iiie S jai how sharpened traces Base 410 of 693 Quality 21 When you click on the little button in the lower right corner CodonCode Aligner will try to sharpen the peaks in the displayed traces the result looks like this Scrolling and Scaling in Trace View 184 CodonCode Aligner User Manual PS Traces from Unassembled Samples A Y a gt Lo 4 i O jaj EI v9 A454 Base 410 of 693 Quality 21 In this example it it much easier to see that there are indeed 3 Cs after the G not 2 or 4 Looking at the sharpened traces can be a useful tool when work
5. Selecting from sequence start to current cursor position To select all bases from the start of the sequence to the current cursor position choose Select from Start to Here from the Edit menu The selection will include any unaligned bases at the start of the sequence up to the cursor position You can accomplish the same thing without having to use the menus by keeping the shift key pressed while pressing the home key Selecting from current cursor position to the end of a sequence To select all bases from the the current cursor position to the end of the sequence choose Select from Here to End from the Edit menu The selection will include any unaligned bases at the end of the sequence up to the cursor position You can accomplish the same thing without having to use the menus by keeping the shift key pressed while pressing the end key Selecting all bases in a sequence To select all bases in a sequence choose Select AII from the Edit menu Alternatively you can use the keyboard shortcut Control A on Windows and Command A on OS X keep the control respectively command key pressed while pressing A The selection will include any unaligned bases at the start and at the end of the sequence If the project view is the active view then Select AII will select all contigs and samples shown in the project view The Unassembled Samples and Trash folders will also be included unless they are empty
6. 3 22 11 T Mew Bases VXS re A819 r Min mantis A xxv 0 5 29 03 3 22 11 Agi2 i COR hestriction map 136 5 29 03 3 22 11 B A333 r Assemble WHA 318 5 29 03 3 22 11 Ie Align to Reference Sequence X38R 5 29 03 3 22 11 H A326 r 651 5 29 03 3 22 11 gt Cj Trash Move to Trash 5 29 03 5 29 03 Move to Label gt None Sample Information Red Pref Orange references Yellow Green Cyan Color label the sample s 1 Unassembled contig Contig2 Blue KD Colored Labels 182 Trace View General Information In Trace View you can view and edit samples that have trace data Files with trace data that can be opened in a Trace View include standard chromatogram files scf from LI COR and other manufacturers and Applied Biosystems ABI trace files abi ab1 e 66 Traces from Contig1 GTGAAT JMAAACTATGTTAAGGGAAATAGGACAACTAAAATA cc CTTR Nbrm R 50 60 70 A Y s un eda a rs TATGTTAAGGG AAATAG G ACAAC TAAAATAT CFTR Norm F 29 4 50 A v Shelf T7 A 4 i CFTR Norm R Base 43 of 290 43 in contig Quality 68 Cons 68 _ Each contig has one trace view window in which all selected traces for this contig will be shown The same is true for the Unassembled Samples folder it has its own trace view window The number of traces in a trace view window is limited only by available memory and operating system limitations however displaying many trac
7. Add a hybridization probe You can set the parameters for the probes by clicking on the Set Probe Characteristics button Choose the number of primer pairs to show If you choose to pick primers in a certain range please note that primers are picked outside of your specified target region Therefore you need to make sure that the target region is set so that there is enough space for primers to be picked e g setting the target region to 10 90 for a 100 bp template will only work for primers with a length of 9 bp or smaller If you select the radio button Primers end exactly at region to amplify primers will be fixed at the ends inside the target region You want to use this setting to design cloning primers Sequencing Parameters For designing sequencing primers the sequencing specific parameters look like this Sequencing Primer Details Distance between primers on same strand 500 bp Distance between forward and reverse primers 250 bp Choose optimal primer location within 20 bp Distance between first primer and target 50 bp The distance between primers on the same strand Spacing is the space from the 3 end of the primer to the 3 end of the next primer on the same strand The distance between forward and reverse primer is also called Interval and means the space from the 3 end of the primer to the 3 end of the next primer on the reverse strand Named Accuracy in Primer3 the optimal location in a certain r
8. Sample names Select your main color scheme specify details below Startup r Background color details by nucleotide Toolbars Vector trimming e aS SRE Views Colored background Warnings Window placement Description The base colors preferences control the colors used for drawing traces If By nucleotide is selected bases are drawn the same color as their trace colored bases use the same background color as traces To assign a color to a specific base use the drop down box to the right of the base As always any changes will only be saved when you click OK Note that the colors chosen will also be used to draw the sequence traces regardless of the background color scheme You can pick one of the pre defined colors or click on Other to choose a different color This will bring up the following color chooser dialog Base specific colors 243 CodonCode Aligner User Manual Choose Other Color IEEE EERE E IEEE E CIE E PIRI E E B EIEEIBEEBEN E IN 5 TITI Eem ELIT TEN m INN ee JEN ee JENNI TETTE COS E mj z M N fa El TITTTISIBINI ITITISBEE Beeps ees eee M a a T mmieie s ttt mamm tt I IESU I JEISISISIUNUN T T TCIEISISISINUM T TICIEISISIBINUM messi IESU IEEE mamm S S mamm tt S mamm y m E TT a a peepee EEEEE E ox 3 f Cancel Reset Select t
9. Cancel During the assembly process the sequences or contigs are aligned successively against each other Each alignment is evaluated against the match criteria defined in the alignment preferences Only if the alignment meets all the criteria the samples or contigs will be merged If the alignment does not match any one of the criteria the merger will be rejected The parameters are similar to the parameters for sequence alignment but you can assign different values for assembly and alignment parameters The meaning of each parameter is discussed in the next sections Please note that the assembly parameters will not be used when comparing contigs with ClustalW or muscle or when assembling with Phrap When comparing contigs the assembly preferences will only be used when the built in algorithm is selected in the Algorithm panel of the Assemble with Options dialog Assembly Preferences 230 CodonCode Aligner User Manual Algorithm The algorithm pulldown lets you choose how CodonCode Aligner compares sequences during assembly with the following options Local alignments When this algorithm is used Aligner uses local alignments this method is also used when assembling using Phrap This means the start and the end of sequences is not necessarily included in the alignment the alignments stop when the alignment score would not improve anymore This can be due to for example too many discrepancies or unremoved vector seq
10. Change Bases menu which will display the Change Bases Options dialog All auto edits will be done on the currently selected base or bases Please note When you select consensus bases in a contig view the edits will affect all samples at this position When you select samples in the project view the changes will be done to all bases in the selected sample s Match Consensus The Match consensus option will automatically change bases to match the consensus of the contig they are in it will have no effect on unassembled samples One example where this option is useful is changing bases in dye blobs in DNA sequences where many bases are wrong because of artificial strong peaks This option is intended for low quality sequence and will not change high quality bases You can change the thresholds in the Change Bases Option dialog by clicking on the Options button next to Match consensus This will show the following dialog r O O Match Consensus Options Minimum quality difference 10 S Maximum base quality to edit 29 a Cancel The number at the top is the minimum difference in sequence quality between the consensus and the base in question The default setting of 10 means that bases will only be edited if the consensus sequence quality is at least 10 higher corresponding to a 90 or higher probability that the edit is correct assuming that this is a random error The number at t
11. Double clicking Current memory use Papiria 23 MB used 233 of 256 MB available Physical memory 4096 MB atures Highlighting V Show memory use in project view License Serve E r About these settings Mutations Changes to the maximum available memory will restart Aligner Open amp save Phrap assembly Preference options Printing Protein translation Restriction maps Sample names Startup Toolbars Vector trimming Views Warnings Window placement Description Controls the maximum memory available to Aligner Changing maximum memory is disabled if your project has been edited Changing maximum memory will restart the application Cancel OD The Memory options panel at the top shows you the maximum memory available to CodonCode Aligner The panel in the middle shows you how much memory CodonCode Aligner is currently using and how much memory is available It also shows the amount of physical memory built in RAM for your computer If the check box Show memory use in project view is checked CodonCode Aligner will show the current memory use in the bottom right corner of the project view window Memory on Windows On Windows CodonCode Aligner will automatically try to get as much memory as is needed with the Memory Preferences 261 CodonCode Aligner User Manual following limitations On 32 bit versions of Windows the maximum memory available to CodonCode Aligner is limited to 1 4 G
12. If you click Cancel or press the escape key no changes to the settings will be made If you make any invalid entries in one of the fields Aligner will show a warning that indicates the problem and reset the field to the previous value Preferences and Settings 223 CodonCode Aligner User Manual By default the Preferences are specific for each user However Aligner offers the option to share preferences between different users detailed instructions are available on the Preference options help page Preferences and Settings 224 Alignment Preferences You can specify parameters for alignments to reference sequences in the Alignment Preferences r Alignment Algorithm End to end alignments e Min percent identity 80 0 Min overlap length 30 Min score 20 Max unaligned end overlap Bandwidth max gap size 30 Word length 8 1 Match score 1 Preference options Printing Mismatch penalty 2 Protein translation Restriction maps Gap penalty 2 Additional first gap penalty 3 Uncovered reference sequence Clip to 100 bases He Window placement Description The alignment preferences control settings for alignments to reference sequences During the alignment process the sequences are aligned successively against the reference sequence Each alignment is evaluated against the match crit
13. O Find all features f9 Find just the first feature Description The features preferences let you define features Regions of Interest that are shown in the feature view windows Features are also used for quick navigation using Next Feature and Previous Feature in the Go menu Cancel OED You can change the definition of features here by using the various buttons and text fields For a more detailed explanation check the feature preference help page Moving to Features You can quickly move from feature to feature in contig views by using the Next Feature and Previous Feature menu items in the Go menu To try this out open a contig view for example for the contig in the Examplel project in the Example folder in the CodonCode Aligner folder Then select the Go menu The item we want to use is Next Feature Notice the keyboard shortcut shown in the menu it is Command Right arrow on OS X and Control Right arrow on Windows Similar the shortcut for Previous Feature is Command Left arrow respecively Control Left arrow Try out the Next Feature keyboard shortcut out from the contig view You will notice that the cursor and selection in the contig view move to the right sometimes by a few bases sometimes by many bases To see what kind of feature you just navigated to look at the project view window The status panel at the bottom Defining Features 87 CodonCode Aligner User Manual shows a brief
14. Selecting Bases 126 Changing Bases CodonCode Aligner supports manual editing in all views that show bases the base view trace view and contig view In addition CodonCode Aligner provides several functions for automatic editing and to change bases to lower or upper case Manual Editing To change a single base select the base and type a new base letter Letters for ambiguity codes can also be entered Be careful if more than one base is selected before you start typing all the selected bases will be replaced with a single base which may not be what you want After changing a base Aligner will automatically move the selection one base to the right This allows you to quickly edit a number of bases in a row The consensus sequence is automatically updated with any changes if such changes introduce a change in the consensus sequence Edits made in one View are automatically updated in other Views of the same sample If you edit a consensus base then the change will be applied to all samples that have aligned bases at this position so once again be careful You can also delete bases by using the delete and backspace keys and insert new bases by pressing the space or shift space keys as described in detail on other pages Making Bases Lower or Upper Case Usually bases in CodonCode Aligner are shown in upper case Sometimes you may want to change the case for example to indicate a region that you are interest
15. Use noise filter Phrap assembly r Marking mutations Preference options Printing M Remove unedited Hy existing mutation tags Protein translation V Add tags only to mutated bases Restriction maps ES ee Use ambiguity codes for heterozygous point mutations l v Change homozygous mutations to lower case r Mutations to look for _ Look only for homozygous mutations Mi Look for heterozygous indels Window placement Description Allows you to determine the sensitivity of detecting heterozygous mutations Low sensitivity settings reduce false positives high sensitivity reduces false negatives Detection sensitivity At the top you can set the sensitivity for detection of heterozygous point mutations The first set of radio buttons determines the sensitivity at places where a secondary peak is accompanied by a drop in intensity of the primary peak compared to other samples at this position The second row of radio buttons applies to places where there is no clear drop of intensities for example because all samples at this position are heterozygous There is a trade off between sensitivity and accuracy With detection sensitivity set to low most or all point mutations identified by Aligner will be real in other words the false positive rate will be low However Mutation Detection Preferences 263 CodonCode Aligner User Manual Aligner may miss some heterozygous poi
16. When building the consensus sequence for contigs that result from alignments to a reference sequence the consensus preferences determine how the reference sequence is considered By default the reference sequence is excluded from the consensus sequence In this case any regions where none of the samples overlap with the consensus sequence will result in gap characters in the consensus sequence Alternatively you can choose to use the reference sequence as the consensus sequence Assembly and Alignment 51 CodonCode Aligner User Manual The Advanced Alignments submenu in the Contig menu offers several advanced options for aligning sequences to a reference sequence These include Align with pre processing this enables you to pre process unassembled samples automatically before alignment by base calling end clipping and or vector trimming Align in groups this option lets you define how CodonCode Aligner should group samples based on their names Aligner will then build separate contigs for each sample group Align from scratch this option dissolves existing contigs before alignment Limitations Currently the implementation of alignments has several limitations These include The numbering in the aligned contig is not relative to the reference sequence numbering and includes any gaps introduced in the consensus sequence However if you use the Find mutations function the numbering used in the mutation tags will be
17. 3 Window placement DAT C _ Include degenerate sites L Description The restriction map preferences control which enzymes to use for creating the restriction map and how to display the results aml aan A The left side of these preferences contains a list of enzymes This list reflects a set of enzymes that can be chosen on the right side of this view The two radio buttons on the top right side allow you to show either all enzmes or to show only a subset of enzymes in the list on the left side If the Show Subset radio button is selected you can choose your subset using the preferences in the Subsets section You can select a subset by manufacturer In the example above only enzymes from Invitrogen Corporation are shown in the list on the left side You have the option to choose a subset of enzymes by the size of their recognition site Above only 6 base cutters are included in this subset The cut result can also be used to specifiy a specific subset For example you can include only enzymes that generate a 5 overhang in your subset The Include degenerate sites checkbox allows you to in or exclude enzymes that have one or more ambiguities in their recognition site The list of enzymes on the left side updates according to the selection for the subsets You can select or unselect enzymes in the list through the checkboxes in front of the enzymes and by using the Select AII and Select None buttons above t
18. Assemble e When the assembly is done select the contig Contig1 in the project view Alternatively select the two samples in Contigl in the project view e Go to the Contig menu and select Process Heterozygous Indels You will see a progress dialog appear which shows that CodonCode Aligner does the following steps e Aligner finds all samples that have a heterozygoteIndel tag and then identifies wild type traces for each since we have only 2 traces here this is trivial Aligner replaces the base calls in the indel region as follows 1 Aligner looks for secondary peaks in the indel region and replaces the base calls with ambiguity codes for the the two bases 2 Aligner compares the ambiguity codes to the consensus sequence and removes the consensus base call This leaves the base call that often corresponds to the base in the mutated allele Aligner creates a new artificial sequence by subtracing the wild type trace from the heterozygous indel trace starting at the start of the heterozygoteIndel tag The wild type traces are scaled vertically and horizontally as needed with the goal to subtract the trace that is due to the unmutated allele and leaving the mutated allele Next Aligner base calls the newly created trace or traces with Phred which requires that you have a trial license or a full license When Phred is done with base calling Aligner moves the initial subtracted trace which still has the ori
19. CodonCode Aligner User Manual View Bases View Quality Move to Trash Sample Information Preferences Sort samples by name Sort samples by position Sort samples by direction Select any of the Sort samples by options at the bottom of the menu and the reads in this contig view will be re sorted Typically sorting samples by position will be the best way to sort samples For re sequencing and mutation detection projects sorting by name may work well if you followed a naming scheme that uses similar names for forward and reverse reads so that sorting by name will have the forward and reverse reads right underneath each other You can also manually sort the samples by selecting and dragging the sample names up or down After manually sorting samples in a contig Aligner will keep your manual sort order for this contig until you select one of the sort options in the popup menu changing the sorting in the contig view preferences will not change the sorting of contigs that have been sorted manually Note that the overview panel displaying the samples as arrows only shows the correct sort order if you display your samples in a stacked layout You can change the arrow layout by using the Arrow Layout button above the arrow panel or through the pop up menu by right clicking in the arrow panel Automatic Trace Selection When checking or editing a contig you will often want to look at a few traces at a given p
20. CodonCode Aligner User Manual Opening Existing Projects Choose Open from the File menu to open a project you have already saved Navigate to the directory your project is in and select the project file The project file has either a ccap or a proj extension which you may not see depending on your system settings This will read all the contents of the project as it was last saved and show the contents in a new project window Projects created with CodonCode Aligner 4 0 or newer are saved in a new format and have the ccap extension as opposed to older projects who have the proj extension Alternatively you can also use the Open Recent submenu in the File menu This will show the projects you worked with recently If a project is no longer available for example because you deleted or renamed it s folder then it will be grayed out in the Open Recent submenu Saving Projects Choose Save Project from the File menu to save your project if the project is a new project for which you have not set a name and location before you will be prompted to do so now To save a copy of an existing project under a different name and or at a different location choose Save Project As from the File menu The Save Project As command will always create a new project file if you try to create a project with the same name as an existing project in this location you will get a warning dialog It s a good idea to save proj
21. Mutations Open amp save Phrap assembly Preference options Printing Protein translation Sample names Startup Vector trimming Views Warnings Window placement Additional command line options Description The Phrap assembly preferences let you specify the location of the assembly program Phrap and for experts only additional command line parameters for Phrap You specify the location and name of Phrap assembly program in the upper text field If you want to use the workstation version of Phrap that was installed with Aligner the path to Phrap should be correct and not need any changes However if you use your own installation of Phrap you may need to specify the location of the file on your system Please note that using Phrap from Aligner requires that you have a trial license or a purchased license Phrap use is not enabled in demo mode Academic users who purchased a license for CodonCode Aligner can use the workstation version of Phrap free of charge for academic research users at companies will have to purchase a separate license to use Phrap In the bottom text field you can specify additional command line options for Phrap In general please leave this line blank only experts who really know what they are doing should specify command line options Phrap Assembly Preferences 268 CodonCode Aligner User Manual here For more information about assembling with Phrap please r
22. Overlap Detection is 2296 complete Cancel When the alignment is done you will see a newly formed contig in the project window The new contig will contain a copy of the original reference sequence leaving the original reference sequence unchanged Note that the new contig will be limited to the length of the reference sequence plus any gaps introduced during the alignment Any parts of sequences that extend beyond the start or end of the reference sequence will be marked as unaligned You will not be able to see the overhanging unaligned regions in the contig view but you can see them in the trace views and base views The alignment is performed using the parameters defined by the alignment preferences Samples that do not meet the minimum criteria will not be aligned and remain in the Unassembled samples folder Note that the alignment may be clipped to the region covered by aligned samples depending on your choices in the alignment preferences The default setting is so that 100 bases to the left and the right of the first and last aligned base remain if the aligned samples are inside a coding region that is annotated with a codingSequence tag in the reference sequence then the clipping will be 100 bases to the right or left of the coding sequence region You can choose the amount of bases left on each side or choose not to trim the Alignments to a Reference Sequence 68 CodonCode Aligner User Manual alignment at
23. Previous Feature Previous High Quality Mismatch Low Quality Consensus Ambiguity Mismatch Edited Base Base Number First Aligned Base Last Aligned Base Search Sequence Search Again BLAST Search MegaBLAST Nucleotide blastn Translated blastx Translated tblastx Sample Menu Call Bases Find Heterozygous Indels Split Heterozygous Indels Clip Ends Trim Vector Edit Menu 300 CodonCode Aligner User Manual Insert gap Shift Bases Left Shift Bases Right Delete Selection Fill from Left Selection Fill from Right Erom Sample Start To Sample End Move Gap Left Gap Right Sequence Left Sequence Right Mark Start Alignment Location End Alignment Location Tag Show Local Tags Confirm Tag Mark Tag False Positive Show All Tags Add Tag Add Tag to All Set Base Number Make Reference Sequence Label Sample Information Contig Menu Assemble Advanced Assembly Assemble with Preprocessing Assemble in Groups Compare Contigs Assemble from Scratch Assemble with Phrap Align to Reference Sequence Advanced Alignments Align with Preprocessing Align in Groups Align from Scratch Unassemble Rebuild Consensus Find Mutations Process Heterozygous Indels Analyze Methylation Build Tree Build Tree for Selected Bases Delete Sample Menu 301 CodonCode Aligner User Manual Erom Contig Start To Contig End Remove Consensus Gaps Split Contig Contig
24. Vector trimming Add name part Define delimiters r Description The sample names preferences allow you to define how Aligner interprets sample names You can define different meanings for parts of sample names and then use these name parts to assemble samples in groups based on their names Cnet CD In the screen shot above Aligner would interpret samples as follows e Everything from the beginning of a sample name to the first period would be interpreted as the clone name e The part after the first period up to the next underscore would be interpreted as the direction typically F would indicate forward reads and R reverse reads Anything that follows after the underscore will simply be ignored Sample Name Preferences 283 CodonCode Aligner User Manual You change the meaning of a name part and the delimiter that indicates the end of a name part using the respective combo boxes You can add more name parts using the Add name part button and delete name parts using the Delete button next to the part you want to delete Instead of defining your name scheme manually you can use the Guess name scheme button to have CodonCode Aligner guess how to interpret the sample names in your project Guessing the name scheme will work only if your name parts are separated by delimiters like underscores dashes or periods You can of course always use the guessed name scheme as a starting point and
25. You have two options for adding a subset of samples 1 Add samples that match the selected sequences This option will import only those samples from the file that match the selected samples specifically imported sequences must have at least five 16 base words in common with one of the selected sequences One example where this option can be used is to select only chloroplast sequences from a Next Gen sequencing experiment that contains whole plant DNA Adding Several Sample Files 23 CodonCode Aligner User Manual 2 Addevery X th sequence If you select this radio button only every nth sequence of the file will be imported which can be useful to get an overview about the samples in your file Clicking OK will then show the Import Samples dialog where you can select the file that contains your samples CodonCode Aligner will add the samples that match your subset criteria to the Unassembled Samples folder Adding Entire Folders of Sample Files To quickly add many sequence files to a project it is easiest if you first gather all the files into one folder and then import the entire folder To import sequences from all files in a directory select Import gt Add Folder from the File menu This will show the standard Open file dialog Navigate to the directory you want to import select any file in this directory and then click OK Aligner will count the files in the directory and then ask you if you really want
26. for example you have a feature view for Contigl and Contig2 open and then open a feature view for Contig2 and Contig3 Aligner will first close the older feature view and then show you the new feature view for Contig2 and Contig3 In the Font size panel you can set the font size used in the different views The project view settings affect only the project view the feature views settings affect feature views and mutation report windows the contig view settings affect only the contig view and the other views setting affects the trace views base views and other views View Preferences 295 Warning Preferences You can control how many warnings CodonCode Aligner shows in the Warning Preference dialog Preferences r Warnings Base calling r General Warnings Base colors Which warning dialogs should the program show Consensus method All warning dialogs Double clicking O oni E d End clipping J Only severe warnings and errors F7 Features No warning dialogs only severe errors Highlighting most warnings will still be shown in the status box License Server Memory r When Opening Windows Mutations m Open amp save vi Warn before opening more than 5 c Windows Phrap assembly V Warn before opening more than 20 trace view panels Preference options Printing Protein translation Sample names Startup Vector trimming Views Window pl
27. make sure the checkbox labeled Replace in consensus with n is checked You have two choices when to replace with n 1 If any sample has bases This option will use n in the consensus if any of the aligned samples at this position has a non gap base But if all samples have a gap at this position the character will be used in the consensus 2 Always This option will replace all characters in the consensus with n The first option can be usefull when working with aligned contigs contigs of contigs when some but not all of the aligned contigs have insertions The contigs with insertions will have n in the consensus while the other contigs will have a The second option always use n makes sure that consensus sequences do not have any gap characters at all One example where this option can be useful is if you are working with contigs that contain samples with heterozygous insertions or deletions where the longer allele leads to the introduction of gaps in the consensus When you change any consensus method preferences and then click the OK button the consensus sequences for all contigs in the currrently open project will be re calculated Quality Scores At Discrepancies And Edits You can choose whether or not you want Aligner to subtract the quality scores of discrepant bases when calculating the consensus quality score In general this is not necessary since discrepancies are typically err
28. or contig region CodonCode Aligner will perform the necessary edits and show a dialog summarizing the results Remove Gaps Results Removed consensus gaps in 1 contig changed 108 bases Change requirements were not met for 12 bases Note that removing consensus gaps is not undoable We suggest that you save a copy of your project first How to remove consensus gaps 150 Alignment Locations Start and End During contig building by assembly or alignment Aligner automatically determines the useful parts of reads For each sample regions at the start and end with high levels of discrepancies to other reads will remain unaligned These regions are typically shown dimmed in the contig view Bases in the unaligned regions are not considered when determining the consensus sequence Unaligned regions are not aligned meaning that Aligner will not introduce gaps in unaligned regions You can change the start and end of sample alignments through two menu items in the Sample menu Mark Start Alignment Location and Mark End Alignment Location If you use one of these options to extend the aligned region of a sample you will have to introduce any gaps required for proper alignment by hand If you import Phrap assemblies please note that unaligned regions of samples may extend beyond the ends of a contig on both sides the start and the end Alignment Locations Start and End 151 Reverse Complementing To reve
29. parameters and lookup table for sequence quality values Each chromatogram contains a primer ID string that Phred looks up in this file to get the relevant chemistry dye and machine information If your sequencing machine is not listed select the machine class that is closest to your sequencer e g for samples processed on an ABI 3730 set the machine class to ABI 3700 Cancel At the bottom you see a newly added line in your case this may be more than one line you may have to scroll down to see the newly added entries Here is a brief description Editing the PHRED parameter file 36 CodonCode Aligner User Manual e The first column contains the primer ID string that you need to add Aligner already filled this out for you so you should not need to change anything here e The second column contains the chemistry which is primer for dye labeled primers and terminator for dye labeled terminator chemistry Most sequencing nowadays is done with dye labeled terminators but check with the supplier of your sequences or sequencing kits if in doubt The third column contains details about which class of fluorescent dyes was used Most current chemistries from ABI are big dye while chemistries from Amersham Pharmacia are typically energy transfer The fourth column lists the kind of DNA sequencer used If you cannot find an exact match use the machine that is most similar to your machine For example if you a
30. parsing of the currently selected samples in a separate window Assemble in groups by name part 57 CodonCode Aligner User Manual eoo Name parts preview WERE Name Gene Exon Patient Direction File type i EGHkexoIS M Fabi tGFR exo JM Fr labi EGFR_exon19_JJM_R abi EGFR exon19 JJM R labi EGFR exon19 NWS F abi EGFR exonl9 NWS F abi EGFR exon19 NWS R abi EGFR exonl9 NWS R jabi ECF exon13 XHS Fab JEGFR exonl9 XHS F abi EGFR exon19 XHS R abi EGFR exon19 XHS R abi EGIT 0029 MLE ab EGFR exon20 JM F abi EGFR exon20 JJM R abi EGFR exon20 JM R abi EGFR exon20 NWS F abi EGFR exon20 NWS F abi EGFR exon20 NWS R abi EGFR exon20 NWS R abi EGFR exon20 XHS F abi EGFR exon20 XHS F abi EGFR exon20 XHS R abi EGFR exon20 XHS R abi I H 4 After defining the name scheme you can choose which name part Aligner should use to group samples by selecting this name part in the Assemble in Groups dialog In this example Choosing Gene would try to assemble all reads into one contig Choosing Exon would try to assemble the genes into 2 contigs one for exon 19 and one for exon 20 Choosing Patient would assemble the samples for each patient separately Assuming that there is enough overlap between the exon 19 and exon 20 sequences this would generate one contig for each of the three patients Without sufficient overlap be
31. scrolling preferences let you control what happens when you double click on samples or contigs in the project view and how scroll bars are linked to scroll wheel movements Cancel 0 amp 3 The section Double clicking in Project View allows you to choose which views windows Aligner should open in response to double clicks in the Project View If the samples you selected are in contigs you can also choose if Aligner should open the corresponding contig view in addition to the other views selected above such as the trace view or just open the corresponding contig view or not open the contig view at all In the section Scroll wheel handling you can set how the scroll bars are linked to your scroll wheel movements Horizontal scrolling uses the scroll wheel to scroll horizontally If this option is selected you can scroll left and right in the contig view by using your scroll wheel If your mouse supports bi directional scrolling e g the Magic Mouse or Mighty Mouse from Apple or you would like to scroll vertically in the contig view then select the option Bi directional or vertical scrolling Clicking amp Scrolling Preferences 251 End Clipping Preferences The end clipping preferences allow you to specify how Aligner will remove low quality sequence from the ends of samples and to set up minimum quality criteria after end clipping Preferences Base calling Base colors Consensus method End clippin
32. typically do Aligner identifies the highest quality base at each position taking into account confirmations by reads in the opposite direction Slightly simplified here is the algorithm in detail 1 For each possible nucleotide A G C T find the sample with this base at the given position that has the highest quality Take this score as the initial consensus score for the nucleotide use 0 if no sample has this nucleotide 2 Find the highest quality confirming base from a read in opposite direction and add the score of the confirming base 3 Optionally find the highest quality discrepant base and subtract the score This subtraction can be turned on or off in the Consensus preferences The default setting is to not subtract the discrepant score 4 Calculate the score for a gap in the consensus the same way using gaps at this position in the individual samples The quality scores of gaps in samples are taken as the average of the two neighboring bases 5 Pick the nucleotide or the gap character that has the highest quality Assign the calculated confirmed quality score to the consensus sequence The maximum quality score assigned to a consensus base is 90 Several points to remember when trying to understand this algorithm Assembly 81 CodonCode Aligner User Manual e The base quality scores are error probabilities on a logarithmic scale therefore the error probabilities can simply be added as long as the probabilitie
33. 0 0 4 27 4 27 Z8 Primer3R Text 21 0 0 4 27 4 27 gt Trash 0 samples 0 0 5 29 5 29 D Primera primer detection complete 6 primers imported 77M of 1303M Primer characteristics for each primer are displayed in the sample information dialog select the primer and choose Sample Information from the Sample menu Primer Results 117 CodonCode Aligner User Manual 6 Sample Information PrimerlF 20 bp 60 0 GC 2 A 10 C 2 G 6 T Comments Primer Information Primer template Contig1 Penalty 0 316029 Interval 4 23 Length 20 Direction forward TM 59 816 GC 60 0 1 ANY 0 0 Y No tags M Allow manual edits The sequence that the primers were created for will have a primer annotation tag added to its sequence for each imported primer TTCT ACTGCAGCCA 51 TTAGGGGAGC C CTGTTCTG TG TTC dd Tana 101 AAAGTCCATT TCCTCTGCCC TG Display tag information iGcc 151 AGCTCCTACC TGTGCTTCAG AT View Contig X36C iccA 201 AGCACACCCT CACCTCCCTG C T View Bases Mis CTC View Traces CET a9 251 ACAGAATCAT ATGTCTGTTG GTi View Qualities XHQ CAG 301 GTACTTATCT GATTATTTTT GT View Features XRF TTT Contigl Base 23 o View Restriction Map XP ly 37 Z Details about each primer can be viewed by showing the primer annotation tag right click on the tag and select Show Tag primerAnnotation Exporting Primers For ordering primers you can expo
34. 1660 bp of 1660 bp AAA A gt op 1 000 bp 0 31 AGACCTAGGAAGTCCTGTgCC TTCTGCACCCTGTGTCCAGTTCATCT pao kso agg 209 M 3ACCTAGGAAGTCCTG THC CT TCTGCACCCTGTGTCCAGT TCA A454 s 170 180 190 200 TO Anto DAY A TCTGCACIEMEGTG TC CAGT TC AT 120 KA A454 s Base 181 of 455 181 in contig Quality 62 Cons 62 P At the cursor position Aligner chose the T from sequence A454 s as the consensus since it is of much higher quality than the C in sequence A455 s the higher quality is indicated by the lighter background You can also see one other discrepancy in this region in each case the sequence from A454 s is high quality and correct and therefore chosen as the consensus sequence If you would look at the same region in an older assembly program that only supports a majority based consensus the consensus base at all different locations would be an ambiguity or the single called base at places where one sequence has a gap character To get a clean consensus you would have to look at all different regions and edit every time to come to the same end result Also note that Aligner uses the quality scores to estimate how likely it is that the consensus quality is correct this can be done with rather good accuracy since the quality scores are linked to error probabilities In the region shown above the estimated consensus quality is very high since one of the two sequences is of very
35. Aligner not from the command line or scripts they require a valid license for the Workstation Phred and Workstation Phrap modules as shown in the license dialog Single user Licenses 4 CodonCode Aligner User Manual r eoo CodonCode Aligner License CodonCode Aligner CodonCode Aligner License Licensed To CodonCode Corporation Demo Use License Type Single User License Serial Number DD0502 Computer ID NP4104 Module Licensed Expires View amp Edit Trace Functions Yes 2004 10 03 Data Processing Functions Yes 2004 10 03 Workstation Phred Yes 2004 10 03 Workstation Phrap Yes 2004 10 03 Enter New License Note that the Licensed column in the example above says Yes for all modules indicating that you can use the workstation versions of Phred and Phrap that were installed with Aligner Time limited trial license will generally allow the time limited use of workstation Phred and Phrap Licenses purchased by academic users will also generally include licenses for workstation Phred and Phrap since Phred and Phrap can be obtained by academic users free of charge Licenses purchased by users at for profit institutions however will not include permissions to use workstation Phred and Phrap unless a separate license fee was paid If you have your own licensed copies of Phred and Phrap you can use these from Aligner instead of the workstation versions except when running in demo mode by
36. CodonCode Aligner User Manual Status messages The area at the bottom of the project view window is used by Aligner to display messages status messages warning and error messages If you click on this area the Message history dialog will be displayed which shows all previous messages e Status Message History Status Log Date Time Status Message 3 11 03 17 33 40 Assembly completed in 2 50 seconds 6 successful joins 1 island remaining 3 11 03 17 33 38 Started Assembly of 7 reads f Clear Messages 3 Close gt You will have to close this window before you can do anything else in Aligner You can press the Clear Messages button to erase all old messages Colored Labels You can highlight sequences in the project view by using colored labels Select the sample or contig you want to highlight and go to Label in the Sample menu Then choose the color you want to label the sample with from the Label submenu You can also label the sequences in the project view by using the popup menu Status messages 181 CodonCode Aligner User Manual is Neen a T uH Save Project Save Project As Add Samples Add Folder i Assemble Align to Reference Unassemble Name Contents Length Quali Position Added Modified Help v 5 Unassembled Samples 2 samples 0 0 5 29 03 3 22 11 muss M 05 29 03 3 22 11 E a4ss s View Traces NET 0 5 29 03
37. CodonCode Aligner User Manual What to export f9 Selected sample All samples Format SCF Note that there are no export options for SCF files A separate file will be created for each sample that has traces Exporting SCF files 166 Exporting Consensus Sequences To export the consensus sequences of contigs select the contigs of interest in the project view and then choose Export Consensus Sequences from the File menu This will bring up the following dialog ANOO Export Consensus What to export fe Current selection All consensus sequences Format FASTA Single file HJ Options gt N A Cancel 9 e Using the radio buttons at the top select to export the consensus sequences for just the selected contigs or all contigs in the project The Format pull down menu gives you the following format choices Single FASTA file This will generate a single text file in FASTA format which contains all the exported consensus sequences You can specify the name and location of the file in a Save As dialog box that will be shown when you click the Export button ndividual FASTA files This option allows you to create a separate file for each consensus sequence Again this is a text file in FASTA format each file contains exactly one sequence You can choose the folder where the files are created in a Save As dialog that will be shown once you click on the Export button All files will
38. Information Tools Menu Design Primers Error Correct NGS Data Assemble NGS Data Align with Bowtie2 Script About the Script Menu View Menu Features Restriction Map Select Enzymes Restriction Map Options Mask Bases Matching Consensus Auto Select Traces Sequence Colors Quality 3 Colors Quality Continuous By Base Translation Based Sequence Translation Show Bases Show Amino Acids Amino acids frame 1 Amino acids frame 2 Amino acids frame 3 Consensus Translation None Frame 1 Frame 2 Frame 3 Frame Forward 3 Frames All 6 Frames Annotated Coding Regions Preferences Toolbars Show Toolbars Hide Toolbars Contig Menu 302 CodonCode Aligner User Manual Window Menu Close Help Menu Aligner Help Quick Tour Tip of the Day License Aligner Web Site Check for updates Window Menu 303 Memory Requirements CodonCode Aligner is currently intended for projects with up to several thousand chromatograms or several hundred thousand short reads On computers with sufficient RAM 4 GB or more CodonCode Aligner can handle projects with up to several thousand ABI reads each about 500 1000 bases long or several hundred thousand short next gen reads less than 100 bases long The size of projects that CodonCode Aligner can handle is determined by the amount of memory available to Aligner Details depend on the operation system used On Windows Codon
39. Manual Contig _ amp hv c D 3 Print Reverse Build Tree View Traces Colors Bases lt gt Transl Show overview Change size Exclude v 5345 5349 5352 5382 5387 5422 5462 5474 5475 5516 5530 5564 5565 5818 5819 5 ROTANA a A A A POERA al e ft EST PS ERN IET ERI RINT CN DRE CR UN m pm 7 Next Frame Mask Matches Help A j Aj AL A cG A 4 4 A 4 A A A ee en es cit ata tatata aaea G T A C C E C A A A C A A G Te A pees al Se SESE SESE SE SESE SE ARSE N ESEN G TJIC A MEM nsum LA Se SE Se Ss ee SS SS I Eig Fe es ee ERES EE eee A I i zi 273 N35 x2 273 N35 s1 AATTGA lt lt 273 L95 s1 lt lt 273 N86 s1 lt lt 273 E77 81 273 M77 s1 JAATTGAAAACCAAAAAG JAATTGAAAACCAAAAAGA AATTGAAAACCAAAAAG AATTGAAAACCAAAAAG 273 M17 s1 Pos 5467 9989 Q You can switch between the difference table and the graphical overview by pressing the button Show differences if you are looking at the overview or the button Show overview if you are looking at the differences Moving Around You can move around in the aligned bases panel by using the scoll bar at the bottom or by using the keyboard When moving around in a contig view the gray rectangle in the contig overview p
40. Manual If you do not want to use muscle to generate contigs of contigs you have two alternative options to use either the program ClustalW or CodonCode Aligner s built in assembly algorithm to form contigs of contigs To do this select the ClustalW or Built in algorithm button in the Compare contigs dialog When you click on Assemble and the Compare button is selected in the Contigs panel CodonCode Aligner will use the algorithm you have chosen to create contigs of contigs The following table gives an overview of some of the differences between the algorithms ClustalW CodonCode Aligner s built in algorithm Developed and optimized for sequence alignments newer than ClustalW Always generates end to end alignments Alignments formed generally include all input sequences Tends to be faster than ClustalW alignments are often better than ClustalW alignments Comparisons alignments can be generated for samples only Removes gaps from contigs before alignments and may therefore remove bases in samples Developed and optimized for sequence alignments Always generates end to end alignments Alignments formed generally include all input sequences Tends to be slow especially for alignments with many contigs and or samples Comparisons alignments can be generated for samples only Keeps existing gaps Developed for shotgun sequence assemblies Uses local alignments that can include
41. NINE DM a UM M M M 35 Editini the PHRED parameter T8 occorre Eee ode iato namie pale delebo eH an 35 Base calling problems iion poeti ro ia EMEN SEES EINER ML sonia PEDE KR aN AER ERA EXE E iaaii iE 37 Cannot tind base calling pregratu eese oe or eter AEN NINEN E NN E RANE RE ATRASE 37 Missing entries 1 the Phred parameter Tile ioo eco renis nests Krna AoE ENRE RA 38 Problems teading th Phred parameter Tile iios corno rrr mas rm trn ra cor ee et re Ur ea i a Uv 39 Wrong command Ine paramelets i e ceste etit tear een eene o VERRE E ERE REESE NEM EE 30 Problem running the workstation version of Phired ier eter ee ori Tre NER 40 More about the Phred parameter Tile auo oce teo Pus tO ba onde E DU bx EU DU D Ge eae 40 About Pii an n D pita Des ee DM S LE ME D eaten M M CUL ie Ud 41 nM TT snes si nen Ene ene eee 43 Bid C pino PSAP mie CES esses sse marii E EO sea RERORISRMIRE ERU DE A tux EP Maa 44 Bind X pp sx eas AAMAS cod ca rie fnnt ngu rnb bw ege rie pado bi b d d pid gt lg 45 Method 1 Maximizing regions with error rates below a given threshold 45 Method 2 Using separate criteria at the start and the end of the sequence 45 Trimming Vector SeefkCBs iere eon E UG ER RR DUEMU MEHR e RIS n RE tuc a Ei ee nS 47 Vactor Bed m E Imm 49 Usine Uni Vee Library EHesu inse paesi y dat eR EROR E EYE VA ERE VIS RD TER DUI EDU DEM nr EGO FXRDIR ER UR CR tdg 49 Usi
42. Normal Poster Font size 8 point vi Include colors and highlighting vi Print bases in groups of f 10 H4 bases vi Print unaligned ends Cancel The top section of the dialog lets you choose how much of the contig to print either the entire contig or just a section of the contig Aligner automatically fills in the first and last bases visible in the contig view as the range for printing but you can edit both numbers to print any section of your contig The options in the lower half are described in detail in the Printing Preferences Printing Contigs 209 Feature Window Select a contig in the project view and then choose Feature View from the View menu to display a window showing features for a contig eoe Features in Contig2 Feature Source Foundin Parent Contig Start End Content dataNeeded polyPhred ca 23 s Contig2 22 25 e heterozygoteCT polyPhred ca 22 r Contig2 119 119 Confirmed heterozygoteCT polyPhred ca 22 s Contig2 119 119 Confirmed heterozygoteCT polyPhred ca 21 s Contig2 119 119 Confirmed homozygoteCC polyPhred ca 9 r Contig2 119 119 Confirmed homozygoteCC polyPhred Cca 23 s Contig2 119 119 Confirmed homozygoteCC polyPhred ca 9 s Contig2 119 119 Confirmed polyPhredRank1 polyPhred Contig2 Contig2 119 119 COMMENT co heterozygoteGT polyPhred ca 22 r Contig2 172 172 heterozygoteGT polyPhred ca 22 s Contig2 172 172 heterozygoteGT polyPhred ca 21 s Contig2 172 172 heteroz
43. Sbha peni ioo x EE ashes eae te ee EES tou Eee 184 Colors and Higie ATE sE EEA alerted E EAE caine eo AEA E OEE 185 Autorusuc Trice Se ECO a DE eap acp Tete vba LN Pa DP pe opbo d ERI dd 185 Hiding Some Traces oe ieri rte Per HERO a EXER PEE wilde iawn 185 Preis PESOS oso condotta Pa ti uide NU DI AE cg M MS E D PU E 187 vii CodonCode Aligner User Manual Table of Contents PETI ASI I Te S 188 Quality View WV AN Oi ore n ECHO BUE OE E pU came rine EDI ME he E EO RE nana 189 Contig View Window uina pae ev REPERI RE RA FE IO EH ATHEN DEAPR EO ERR ROG VERE EE E CHEER PR FUE 190 Moving FOU or E E HERE a UR REPE TERI ee ee 191 Conus Overview Pae ooo ac Tea M ta dO MORI t OE UE EN RES 192 Coverage graph in the overview panel ceo ete oO ne eee ob Ue ECC RR Aqu dd 192 Navigating Using ihe Overview panel seio orient e aix E ERE ames 192 Changing the display of the sample BITOWS rote esset toro Ur e PER EYE VER HEEL ERE EAEE 193 Coup D erence T dble Lise teni e ipe Eo tact Ron Era bv ko uU Aruba eS 194 Display options for the ditference tIB G sescenti oer bec e Fe x eres 195 Navigaung ising the difference table iret ioter aneian Cx reae vL da ped die top eaa 198 Aligned Bases and Consensus Protein Translation oct ee ree tee ade Ys eden 198 Pi dos enel WSS o e oo PO ROME ae ns DS M Gn NUI SUN P E AD 199 SPEC UEP OMISIT Io LE ENS 202 Building Trees tor Selected Bases OMY esarion manea QURE ISEHUEIREE
44. Selects the sample with the given name Save the project at the given location select sample or contig name Selects everything in the current view Selects all unassembled samples Selects all contigs unselect sample or contig name Scripting CodonCode Aligner 219 CodonCode Aligner User Manual Unselects the sample or contig with the given name Calls the bases End clips the currently selected samples Vector trims the currently selected samples Makes the named sample a reference sequence Finds heterozygous indels in the findHeteroIndels selected samples Contig menu At least one of these algorithm local or large or end minPercentIdentity 50 100 a number between 50 and 100 minOverlapLenth 10 500 minScore 10 500 maxUnalignedEndOverlap 0 0 100 0 Sets assembly parameters for bandWidth 10 100 subsequent assemblies wordLength 6 24 maxSuccessiveFailures 10 5000 matchScore 1 19 mismatchPenalty 1 19 gapPenalty 0 19 additionalFirstGapPenalty 0 19 Assembles the selected samples and assemble none contigs assembleFromScratch none Assembles from scratch assembleByName none Assembles in groups by name Compares contigs to each other using Clustal or muscle if setAssemblyParameters compareContigs Clustal or muscle optional specified othebwise the curent default assembleUsingPhrap none Assembles contigs with PHRAP setAlignmentParameters A
45. Then choose either Move to Unassembled Samples or Move to Trash from the Edit menu Before removing the sample from the contig Aligner first checks if removing the sample would introduce any gaps in the contig This happens if there are reads to both sides of the sample and the sample is the only sample that covers one or more bases of the consensus sequence In this case removing the sample would in effect split the contig into two pieces and at least currently Aligner will refuse to do so If splitting the contig is what you wanted to do you will first have to split the contig yourself and then remove the sample from the new contigs formed after splitting An example where removing a read would split a contig into two is shown below eoo Contigl Show differences 2710 bp of 2710 bp gt ap 1 000 bp 2 000 bp djs74 237 s1 djs74 3174 8s1 djs74 932 s1 Translation ASSOC TEGGTTGCTTTCAATGACAACAGTECTARAT GGT 4 1260 1270 1240 1290 Y L Q Pos 1283 2710 Qual 39 Here removing the selected sample djs74 1432 s1 would split the contig into two parts However the other samples could be removed without problems since they only cover regions that are also covered by other reads Removing Samples from Contigs 147 Deleting Parts of Contigs To delete all bases from the current cursor positon to the start of
46. Use the mutation preferences to adjust the mutation detection sensitivity whether Aligner should add tags to samples that are not mutated and so on You can use tags for example a codingSequence tag assigned to the reference sequence or dontGenotype tags to fine tune which regions Aligner analyzes and how the effect of mutations is described in the Content field this is described in detail below To take a close look at the results you can double click on any entry in the table This will bring up the views you have chosen in the double click preferences typically the contig view and the trace view A screen shot of the contig view for the example above is shown below How To Find SNPs 90 CodonCode Aligner User Manual 9 E eee 458 bp of 458 bp 2p 100 bp 200 bp 300 bp The tags added by Aligner are shown as blue and pink boxes blue boxes indicating homozygous bases and pink boxes indicating heterozygous bases unless you changed the display of tags in the highlighting preferences to something other than box The corresponding trace view for the four samples is shown below f eo00 Traces from sonigi A gull uv v Scroll together va 1 x Base 168 of 437 183 in contig Quality 21 Consensus 35 7 How To Find SNPs 91 CodonCode Aligner User Manual Note that all three traces that were characterized as heterozygous C T show two peaks a blue C peak and a red T peak your colors may b
47. When you are done editing the name press enter or click on any other item in the project view If you change your mind about renaming the folder you can press escape while you are still editing or select Undo from the Edit menu right after you changed the name Deleting Folders To delete a folder that you created first remove all of its contents then Organizing Samples And Contigs In Folders 31 CodonCode Aligner User Manual e Select the folder in the project view then e Choose Delete Folder from the File menu Only empty folders can be deleted If a folder still contains samples or contigs the Delete Folder menu item will be disabled To delete a folder that contains samples first move the samples to the trash and then delete the folder You cannot delete the Unassembled Samples folder or the Trash folder Deleting Folders 32 Removing Samples from an Aligner Project To remove samples from an open project Go to the project window e Select the sample s you want to remove use shift click to make continuous selections use control click Windows or command click OS X to make discontinous selections e Select Move To Trash from the Edit menu or display the popup menu by right clicking OS X control clicking and choose Move To Trash from the pop up menu You can also select samples in contigs and move them to the trash This will remove the samples from the contig If removing a sa
48. a regular assembled rather than aligned contig however you can add unassembled samples to existing alignments without changing the contig to a regular assembled contig Tips for dealing with alignments To find out if a contig is an alignment look at its icon Alignments icons have two vertical lines in the folder Alternatively you can check the contig information dialog To see it go to the project view select Contig Information from the Contig menu To convert a contig that contains a reference sequence to an aligment you can select the contig in the project view and then select Align with options from the Contig menu in the dialog that follows choose Align to reference from scratch However the resulting contig may be different from the initial contig for example not all reads may have been added some reads may have been moved to the Unassembled Samples folder Rebuilding the Consensus Sequence You can rebuild the consensus sequence for any contig by selecting the contig and then choosing Rebuild Consensus from the Contig menu In general you will not need to use this option since CodonCode Aligner automatically calculates the consensus sequence and updates it when you edit any sequence in a contig However if you change the consensus method and then open a previously saved project using Rebuild Consensus may be advisable since existing consensus sequences are not re calculated when opening pr
49. added to the reference sequence in particular codingSequence and dontGenotype tags You can also ignore the reference sequence completely when building the consensus To do this select the Exclude reference sequence when building consensus radio button If you exclude the reference sequence when building the consensus also choose one of the characters X N or from the pull down box that will be used as the consensus at uncovered regions Tip If you want to compare a lot of samples against a reference sequence in separate projects it s a good idea to first create a project with the reference sequence only and to add the codingSequence and if needed codonStart and dontGenotype tags to the reference sequence Then save the project and save a copy under a different name For more information check the Find mutations section External Consensus Sequences The section External Consensus only concerns the consensus of imported assemblies You can choose whether to keep the consensus sequence when you import entire assemblies or to re calculate the consensus based on the current settings Even when you decide to keep the imported consensus sequence however Aligner will re calculate the consensus sequence when you later change a contig for example by editing bases or removing samples Masking Low Coverage Regions The section at the bottom called Low coverage regions allows you to automatically set the consensus base
50. all in the alignment preferences If you work with very large reference sequences for example genomic sequences for multi exon genes the automatic clipping after alignment can make working with the resulting contigs a lot easier and also reduce the amount of memory and disk space needed for your projects If you wish to return the sample files to their unaligned state select the alignment contig in the project view and then choose Unassemble from the Contig menu When unassembling alignments the copy of the reference sequence that was included in the alignment will be moved to the trash unless the original reference sequence was deleted or renamed You can also select more than one reference sequence for an alignment CodonCode Aligner will align each sample to the reference sequence that it appears to be most similar to This will typically work well as long as the reference sequences are sufficiently different e g representing different genes but may fail for reference sequences that are almost identical Adding Samples to Alignments To add new samples to existing alignments Go to the project view e Select the aligned contig and the samples you want to add to it Go to the Contig menu and choose Align to Reference Sequence This will start an alignment of the existing contig and the new samples Instead of using the menu you can also use drag and drop in the project view to add unassembled samples to an existing alignm
51. an example 7 070 JA TipoftheDay 2 2 0 D Did you know Press 3 XG File Import From Genbank to import DNA sequences directly from GenBank using accession numbers ImpotfromGenbank Enter Genbank ID Import single sequences or a range of sequences at once You can also use GI numbers instead of GenBank accession numbers to specify the sequences to import M Show tips at startup Tip 10 of 19 Previous Tip Geam Close LZ If you do not want to see the tips every time at when CodonCode Aligner starts simply uncheck the Show tips at startup checkbox in the Tip of the Day dialog You can also look at the tips by selecting the menu item Tip of the Day from the Help menu Usage Tips for CodonCode Aligner 14 Quality Values In CodonCode Aligner CodonCode Aligner was designed to make optimal use of base specific quality values both for pre processing and for sequence assembly Accurate base specific quality values that are linked to base calling accuracy were first introduced by the program PHRED that s why they are often called Phred qualities or Phred scores While you can do many things in Aligner even if your sequences do not have quality scores we strongly suggest that you use sequences with quality scores For sequence traces that do not have qualities Aligner allows you to call bases with PHRED to get PHRED base calls and quality sc
52. and 10 aligned bases in the middle The bottom sequence has 5 unaligned based at the start and 20 unaligned based at the end Between the two sequences there are 15 additional bases that could possibly have been aligned the 5 unaligned bases at the start of the bottom sequence and the 10 bases at the start of the top sequence Aligner calculated the relative amount of unaligned sequence that could have been aligned by dividing the overlapping bases in the unaligned ends by the length of the shorter sequence In our example this is 15 30 the length of the top sequence or 50 With the default setting of 70 for the Maximum Unaligned End Overlap our example would have passed at least for this parameter You may need to adjust this value depending on the kind of project you are doing If you aligned cDNA sequences to genomic DNA use values of or near 10046 since large stretches of exons may be unaligned But if you expect your samples to match end to end and pre process your sequences with end clipping and vector trimming you can use lower values to reduce the chance that different copies of repeats will be incorrectly assembled together Bandwidth Maximum Gap Size The bandwidth parameter allows you to set the half width of the diagonal used during the banded alignment This has an effect on the maximum size of gaps insertions or deletions in one sample that can still be aligned A bit simplified if one sample has an insertion or
53. as explained below How to remove consensus gaps To remove consensus gaps 1 Select a contig in the project view or a consensus region in the contig view 2 Choose Remove Consensus Gaps from the Contig menu This will show the following dialog BOK Remove gap options In low coverage areas lt 10x Remove consensus gaps if the quality of gaps exceeds the quality of any bases by atleast 30 B In high coverage areas Remove consensus gaps if at least 90 96 of samples have a gap Note that removing consensus gaps is not undoable Sa ee The dialog lets you set the safeguard thresholds In low coverage areas less than 10 x coverage CodonCode Aligner will remove consensus gaps only if the quality of any basis in samples at a given consensus position is lower than the quality of the highest quality gaps at this position the required difference can be set to values between 10 and 99 default 30 Note that choosing a value of 99 means that no gaps will be removed in low coverage areas In high coverage areas 10x or higher coverage the decision whether a consensus gap should be removed will be based on how many of the aligned samples have a gap at this position The value can be set to between 50 and 100 default 90 Removing Consensus Gaps 149 CodonCode Aligner User Manual After setting the tresholds click on the Remove gaps button to remove consensus gaps in the selected contig s
54. au uJ x ec ome Te a o o O m U ui a ul lt ca uJ a x lt m Ww Ww eo 454 bp 268 721 A Ww eo 150 100 50 Text Map 214 CodonCode Aligner User Manual The virtual gel shows the fragments in bp on a gel The first lane displays the choosen marker In this example the second lane shows a digest for all enzymes of this sample The other lanes represent the sample being cut by one enzyme each Mouse overs show the size start and end base of the fragment The restriction maps can be printed and the text map and the summary of each map can be copied using keyboard shortcuts To copy a restriction map select the part you want to copy and use the keyboard shortcut Apple C on OSX and Ctrl C on Windows to copy and the keyboard shortcut Apple V on OSX and Ctrl V on Windows to paste Selecting Fragments The graphical restriction map views single multi line map and gel allow you to select part of the sample shown in the map by clicking on a fragment The selected part of the sample is highlighted in blue in the single and multi line map and in red in the virtual gel Restriction map for Contig1 1660 bases linear DNA Displaying cut positions EcoRI 629 Xbal 656 Pstl 268 Pstl 722 BstXI 1067 Pstl 1619 Non cutters Acc65l Apal BamHI Bsp68l Hincll Hindlll Kpnl Notl Pael Sacl Sall Smal Xhol Xmil LA In the screen shot above the fragment between the two en
55. base calling program If CodonCode Aligner cannot find the base calling program Aligner will show the following error message Base calling problems 37 CodonCode Aligner User Manual x eoo Cannot Call Bases Cannot find base calling program I Applications CodonCode Aligner phred Please use the Base Calling Preferences to specify the correct location of PHRED on your computer Help The name and location of the base calling program PHRED is defined in the base calling preferences if the name specified there is not correct for example because you moved renamed or deleted the program or the CodonCode Aligner folder then Aligner cannot find Phred To solve this problem do what the dialog says use the base calling preferences to specify where exactly on your system Phred is installed Detailed instructions are given above for the workstation version of Phred that is installed with CodonCode Aligner For more information please read the Prerequisites section Missing entries in the Phred parameter file Another possible error message you may encounter looks like this eoo Base calling error The following error occurred during base calling Phred produced no result files Probable cause missing entries in Phred parameter file For more information check the error messages in I Applications CodonCode Aligner Phred Phrap Basecalling errors txt Help sonis This happens if Phred ca
56. bases Word Length The word length parameter determines the size of words that CodonCode Aligner uses when looking for potential overlaps between sequences Only sequence pairs that have perfect matches of at least this length will be considered for merging If you are trying to align sequences with high error or mutation rates reducing the word length may help to get samples aligned For very large projects or projects with many repeat sequences larger numbers may give better results The impact of the word length setting on the alignment speed depends on the size of the project for large projects larger word length values can lead to faster alignments Match scoring The next four alignment parameters determine how matches are scored The Match score is used when two aligned nucleotides are identical the Mismatch penalty when two base calls are different The Gap penalty and the Additional first gap penalty is used when one of the two sequences has a deletion relative to the other sequence For single base deletions the penalty score will be the sum of the gap penalty and the additional first gap penalty for additional deleted bases multiple gaps in a row the penalty will be just the gap penalty You can change the scoring within limits scores from 1 to 19 for matches and penalties of 1 to 19 In general we suggest that only experts change the match scores and penalties Clipping Uncovered Regions When work
57. be created in the same folder the names of the files will be the sample name with fasta appended Note that this option is only available if you export all consensus sequences Haplotypes as FASTA files This will export the consensus sequences as unphased pseudo haplotypes to a single file The file will contain two entries for each consensus sequence These two entries will be identical except at positions where a consensus sequence contains a 2 base ambiguity code For example if the the consensus sequence contains a Y one of the two entries will have a C at this position and the other entry will have a T FASTO files This will generate a single text file in FASTQ format which contains all the exported consensus sequences and their qualities You can specify the name and location of the file in a Save As dialog box that will be shown when you click the Export button Export options for FASTA files If you choose to export as FASTA files you can set several options To see these options press the Options expand button the triangle next to Options The dialog will then look like this Exporting Consensus Sequences 167 CodonCode Aligner User Manual Export Consensus What to export Current selection All consensus sequences Format FASTA Single file ei Options v _ Replace problem characters in names _ Append of samples in contigs Append comments _ Include gaps in FASTA fil
58. bo tta na ke een eph eto n o nrk sue as ead uva checeacpendoeusantuasssesine 14 ality Values In CodonCode ATlpn r iio eee e ooo rore o to ere e o eroe enero e nao coesessscesesvcesssueceesaniecessuieceessuustesseaeeenns 15 Cuality values explained oio o HH E ari ETATE ERI EFE EDU METH eS ID 13 A oBeregualitv values COD ATOTILS cs ove tote t on cs EHE Eni n OB ren nece er froid ie 15 FPN ICR ANE UIC c custo ego ace ob CE PUR DUO CE Lid Dr ua PE o b A For p eb EU QU FR CC Eu E 16 Gap cualilies aceite n asd dennsanz COR ERN RUNE RR REESE RU INGEESEPUUME Ht EQUI d OXON E 16 Viewing MANTIS I E D Et 16 ESI rin ERR 17 Aligner Projetis eonna E AA e Fk debe 18 Working with Aligner Projects ouest rd entre itd ia ena in e eae esie ui n vai cond ine EN a ee DET saias iei sasies 20 Creating New PPOIGODS 2c aod ms eno t o nS Cc ecu ob enue Nome DER LENT UE ONE HIVE E UON DL DU eS 20 Opening Existing Projects nainii eaa aa ia E TEE E EXER DILE OR PASSE FREE ASK Ye AER IR dL OEE 21 Saving Proj ets sscisosecr rex EUER E A E E 21 Cone BIOS Uca eo he Ree Roe bue abe ROC bona Lori tcm PUR Re bett c rena bt Pe 21 Adding Sample Files io Aligner Projects iier e er EYE innit nineties 24 Opening Single Sample Piles eiii or ne er RE RU ii EVER aot een 22 Addie Several Sampie PES s oo ao sio EUREN EDAD EDAD MG A EO do E RU CS ROS A EE 22 Addins a subset DP Samples s cce y erhalt c Diet nadie nat elg We AAG Lee 23 CodonCode Aligner User Manual Table
59. button in the sample name preferences or the Sample Name Options dialog from Assemble With Options This will show the following dialog Defining delimiters 286 CodonCode Aligner User Manual e00 Define Delimiters r Currently defined delimiters _ underscore period dash plus Delete star dollar space rAdd new delimiters For name parts separated by characters Define new character to separate name parts J For name parts separated by characters Name part is exactly characters long a Add To add a new character delimiter type the character in the text field after Define new character to separate name parts and then press the Add button next to it To use fixed length name parts select the length of your name part in the pulldown menu near the botton and then click the Add button to the right of it Repeat this for different lengths as needed The screen shot below shows an example of several custom defined delimiters e00 Define Delimiters r Currently defined delimiters space the character the character Use exactly 2 characters Use exactly 3 characters characters r Add new delimiters For name parts separated by characters Define new character to separate name parts c For fixed length name parts Name part is exactly 6 HJ characters long After clicking OK you will be able to use the
60. calling Phred produced no result files probable cause wrong command line option Check error messages in file Basecalling errors txt Missing entries in the Phred parameter file 39 CodonCode Aligner User Manual then you did not read the for experts only part in the Base Calling Preferences did you Or perhaps you just mistyped an option go back to the base calling preferences and change the Additional command line options If you leave this line blank as we suggest you should not see this error message Problem running the workstation version of Phred When Aligner uses the workstation version of Phred you may see the following error message r M eoo Base calling error The following error occurred during base calling Phred produced no result files Probable cause problem running PHRED workstation version For more information check the error messages in I Applications CodonCode Aligner Phred Phrap Basecalling errors txt Usually you should not see this dialog but if you see it the first thing to try is to do the base calling again it might work without problems the second time One thing that may cause this problem is renaming the Phred executable Aligner looks at the program name to determine whether you are using the workstation version of Phred or the regular version If you have a regular non workstation version of Phred and you rename it to workstation phred you will see the dialo
61. can switch between showing the tree branch length proportional to the calculated evolutionary time between organisms as shown above or the topology only The distance labels shown on the branches can also be turned on and off A tree showing only the topology between the organisms could look like this Phylogenetic Trees 200 CodonCode Aligner User Manual CtgComparis coi Wo mx S o 7 Print Reverse Build Tree ViewTraces Colors Bases Transl Mask Matches Help Position 22 23 24 25 26 42 45 53 56 69 103 121 122 123 124 147 148 149 155 156 183 To Consensus AJA JA GICICITI CI CI C A GITE TAG GD IM 2 Ea FYC EE IRR EE UM EN DGO 7 ZT Ea MEM 8 6A 6A 6A 6G 6C 6C 6T 9C 7C 6C 7A 6 6 6 6 9G 7T 9T 8C 6G 6G 70 Summary 4 4 4 4 4 4A 4C 1T 3T 4T 3G 4A 4T 4T 4A 1 2C 1 2T 4T 4 l ATTTGGGGAATTATTTGAGAAAGC ATTTGGGGAATTATTTGAGAAAGC ATTTGGGGAATTATTTGAGAAAGC ATTTGGGGAATTATTTGAGAAAGC ATTTGGGGAATTATTTGAGAAAGC ATTTGGGGAATTATTTGAGAAAGC ATTTGGGGAATTATTTGAG ATTTGGGGAATTATTTGAG ATTTGGGGAATTATTTGAG ATTTGGGGAATTATTTGAG ATTTGGGGAATTATTTGAGAAAGC MV Topology only _ Label branches Pos 1 183 Qual 90 Please note that Neighbor Joining trees can only be built if you have three or more samples
62. changing the base calling preferences or the Phrap assembly preferences Replacement License Keys Under certain circumstances you may need a replacement license key This can happen if you replace your computer if you install a new operating system replace the hard drive and similar circumstances If you receive a replacement license you must make sure that the original license is not used anymore If Aligner detects that a replacement license and the original license are both used Aligner will invalidate one or both of the licenses and you may have to request another replacement license In general you should not move the folder where CodonCode Aligner is installed after the installation If you move the folder to a different location on the same computer you may have to re enter the license information License Server Licenses License Server licenses for CodonCode Aligner allow you to install CodonCode Aligner on an unlimited number of computers but limit concurrent use to the number of licenses you purchased Using License Server licenses requires installation of a separate program Aligner License Server on a computer that acts as the license server Using Phred and Phrap from CodonCode Aligner 5 CodonCode Aligner User Manual If Aligner License Server is available for your laboratory or department you can choose to use the Aligner License Server in the dialog that CodonCode Aligner displays when starting up eoe FRE
63. choose the different advanced options Adding Samples to Alignments 69 CodonCode Aligner User Manual Align with Preprocessing Align with preprocessing lets you do common pre processing steps like end clipping and vector trimming before aligning to a reference sequence 1 Select the unassembled samples and contigs you want to work with in the project view 2 Go to the Contig menu move to the Advanced Alignments submenu and select Align with Preprocessing 3 In the dialog that pops up click on the Preprocess tab and select the checkboxes you want to use Here is what the dialog looks like e 00 Align with Preprocessing v Pre process unassembled samples Base call samples without qualities Find heterozygous indels v Clip ends Y Trim vector This panel lets you choose how Aligner should pre process any unassembled samples before alignment Note that your pre processing choices are not applied to samples that are already in contigs Help Cancel Align The checkbox at the top determines whether or not your samples will be pre processed before assembly the four lower check boxes let you pick the pre processing steps that will be done The choices are Base call samples without qualities Any samples that have chromatograms but no base specific quality scores will be base called with PHRED To use this option you will need either a trial licen se or a purchased license base c
64. containing up to several hundred reads possibly more if you have enough memory available and a fast computer However it has a few weaknesses most of which are typical for such greedy algorithms If a project contains multiple copies of a repeat with high identity there is a good chance that they are mis assembled but Alu sequences are generally not a problem e Samples have to share at least one perfect word match to be considered for joining This means very short overlaps or short overlaps with errors or ambiguities may not be found The default word length is 12 bases but this can be changed in the assembly preferences Information from double ended sequencing or other ordering information is not used to generate the assembly which can lead to incorrect assemblies especially in larger projects containing high identity repeats Aligner Algorithms for Assembly and Alignments 80 CodonCode Aligner User Manual You can adjust the stringency requirements for successful mergers in the Assembly preference panel Note that the assembly preferences apply only to assemblies generated with the built in algorithm not for assemblies with PHRAP or contig comparisons generated with ClustalW or muscle Consensus Calculation CodonCode Aligner offers five methods for determining the contig consensus sequence 1 Quality based consensus sequences This is the preferred method for most assembly projects since it gives the most accurate
65. copy will not be available Paste The Paste menu item in the Edit menu is disabled since Aligner is not intended to be used as a text editor You can however paste any sequence that you copied see above into programs outside of Aligner for example BLAST web pages Please note that any gaps in sequences will be removed in the copied sequence since most programs or web pages you might paste the sequence into will expect ungapped sequences If you need to copy and paste gapped sequences please let us know There are also some dialogs that support paste through the keyboard shortcuts control V on Windows command V on OS X The most notable is the Search Sequence dialog accessible from the Go menu Copy and Paste 143 Editing Contigs CodonCode Aligner lets you manipulate contigs in a number of different ways You can edit the samples in a contig as described in the previous section Several other common tasks with contigs are Adding new samples to existing contigs Merging contigs e Removing samples from contigs Reverse complementing contigs e Splitting contigs Unassembling contigs Editing contig information Editing Contigs 144 Adding Samples to Contigs To add new samples to an existing contig you need to first add the samples to the project and do any pre processing steps like base calling or end clipping that you want to do Then to add the sample to an existing contig 1 Go to the p
66. coverage regions or tags that have been added by programs like PolyPhred After defining features you can view all features in a separate window the feature view quickly move to the next or previous feature in a contig export features to text files for later analysis Defining Features To define feature criteria select Define Features from the Go menu in CodonCode Aligner This will open the preferences dialog with the Features panel selected Regions of Interest Features 86 CodonCode Aligner User Manual Preferences r Features Feature Criteria Regions of Interest Base calling Base colors vi Low quality consensus quality lower than 30 wr Consensus method vi High quality discrepancy quality at least 40 e ppl Low coverage regions nd clipping OT E Cm m 77 C Total coverage less than 3 Rame 7777 Bs 3 Cm Highlighting LL Covered in just one direction License Server O Ignore tags All tags Some tags Memory ax E Mutations Gaps in sample C Any ambiguity Edited bases Open amp save M Gaps in consensus _ Any discrepancy Phrap assembly EET Preference options When navigating Printing rLook for features in Protein translation Consensus and all samples Sample names pos Startup J Consensus only Vector trimming All samples only C Current selection only Window placement rAt each consensus location
67. cursor position to the end of a seg entes iie e err retenir 126 Selecting all bases dil d SEQUOlice 2o oos i co ver en pats qi Ae p WE a rn etg ane RE LEE FRE d 126 Chanegmg B3ses ice rrr RI EE EE E Eu PEE QEAU PIN NUUE AN Mu PEN tE LEER E E 127 Mamma PUO ssar EGO EEEREN PURIS ent KG TEASE bee XEM Re pu pe ARES NA 127 Making Bases Lower or Upper ase eco gre eo n reo ei bini rico E o e p da ei gef Rn 127 Zug BOE eo oett Ot ero aod Meer Ate LM IL MIDI M M CM LL LI 127 Maen COn SIDES ETT 128 Call Second Peaks Higher THSBE o ioo Fo sie OPERE RED UNDER ORO TENEO VEU HUN Hes 128 Change Ambiguities to Single Bases accu ker tete rex pl ha ru eed aaia 129 Change Low Quality Bases to Nissen ceri asinna iasan PIDE E AGER ER PASE ianiai 129 Undo cR EXE Gioco co taco reped oli es E HU ERR E SERES Es IEEE RU eM ed ipo bas esso o ECL UR V oU PH Sd SP Pa PEE SL oo e eb nEdud 129 lange Bases DDIOfiS oie mia ee REOR EUREN APER RA RARE RAS UNI EE oem Ameo 129 Deleting Bases odes eue rd REED EEUU ELO RR FORE PEU EP GER VEDRR REED EUER E RWERR UR 131 Using the Keyboard to Delete lebe sid E E AAT AEE A isa E a eet ee 131 Memis for Deleting Bases nio Do dare i UND cis VO RON EEEN 131 Deleting Samp leS rissies isi a PERO KEYRRERE EE EN EU ERI FERT INSEYVRENE E RR AN REN PREN NEUE IK E VFEL E KE VUE 132 Moving Gaps and Samples ieieciisenee eiit ca naasser sa Eis aaeeea conv innen nu E ead inaa eiu cea dne cx MM se iaat 133 Moving gaps A OTOL och OIN EDS ems 1
68. description of the feature in our example Feature Low Quality Consensus twice in a row then Feature Discrepancy Use the keyboard shortcuts to move forward and backward between features You can also try changing the definition of features in the preferences View Print Export Features To get an overview of features in one or more contigs select the contig s in the project view and then choose Feature View from the View menu This will open a feature view window showing a table of all features in the contig or contigs You can double click on any feature to take a closer look at the feature or print the feature view for more information please read the feature view help page You can also export features from a selection of contigs or all contigs in a project to text files as described on the Exporting features help page Moving to Features 88 Finding Mutations When working with sequence traces from genomic PCR sequencing CodonCode Aligner can help you find and analyze homozygous and heterozygous mutations SNPs both point mutations and insertions and deletions of course you can also look for homozygous mutations by simply defining discrepancies and gaps as features Prerequisites To find point mutations the following pre requisites must be met Any sequences to be analyzed that have chromatograms must have base specific quality scores You can use the base calling with PHRED in Aligner to get qualit
69. end of the samples that had vector matches or you can press cancel and not apply the trim results for example to try different parameters You can repeat the vector trimming for example if you forgot to include a vector sequence the first time you trimmed To each sequence that has bases removed due to vector trimming Aligner will add a processing tag which Trimming Vector Sequences 47 CodonCode Aligner User Manual states how many bases were trimmed at the beginning and or the end You can see these tags in the feature view window if you have the processing tags included in your definition of features and in the tag dialog that is accessible from the sample information dialog Trimming Vector Sequences 48 Vector Library Files Vector sequences for vector trimming can be read from several files that were supplied with CodonCode Aligner or from your own custom files A Vector folder is created in the Aligner Data folder in the folder where CodonCode Aligner was installed on OS X the default folder is Applications CodonCode Aligner on Windows the default folder is C Program Files CodonCode Aligner Three files are installed in this vector folder two UniVec files from NCBI and an example custom vector file with some commonly used vector sequences To set up vector trimming you 1 Open the Vector trimming preference panel 2 Select the vector library file to use typically from your own Custom Vecto
70. from Left Same as Backspace key Selection Fill from Right Same as Delete key From Sample Start Deletes all bases to the left of the cursor for the selected sample To Sample End Deletes all bases to the right of the cursor for the selected sample Deleting Bases 131 Deleting Samples Deleting samples in Aligner is a two step process first you move samples to the Trash folder and then you empty the trash To move a sample to the trash select the sample for example in the project view and then choose Move to Trash from the Edit menu For samples in contigs some special considerations apply as described in the Editing Contigs section Samples in the trash can be re used by selecting them in the project view and then choosing Move to Unassembled Samples from the Edit menu To permanently delete samples from the trash and remove them from your project choose Empty Trash from the File menu The corresponding sample files in your project folder will be deleted when you save the project the next time Deleting Samples 132 Moving Gaps and Samples Sometimes you may find that some of the gaps introduced during assembly are not quite at the right positions and should be moved around a bit aligning gaps in all reads may even enable you to remove an entire column of gap characters Moving gaps in contigs To move gaps select the gaps in the contig view or in the base or trace view and then select Mo
71. from the University of Washington Academic users can obtain the source code for Phrap for restricted use directly from the authors at the University of Washington For more information on this please visit http www phrap org You can read the original documentation for Phrap at http www codoncode com support phrap doc html Please note that Phrap is a command line program not a typical Windows or Mac OS X application This makes it easy to run Phrap through scripts or from programs like CodonCode Aligner but it means you cannot simple double click on Phrap and expect to see a graphical user interface there is none When CodonCode Aligner is installed the installer also includes a special workstation version of PHRAP which can be only from CodonCode Aligner To run PHRAP from CodonCode Aligner you need either a trial license or a purchased license Licenses purchased for academic use allow the use of PHRAP free of charge Non academic customers who want to use PHRAP must either install their own PHRAP executables or pay a separate license fee for PHRAP Things to Note for Phrap Assemblies 64 NGS Error Correction CodonCode Aligner can use external programs to error correct NGS data e g Illumina reads Error correction reduces the number of random errors in the sequence data and results in better assemblies with fewer contigs and errors It is strongly recommended that you error correct NGS data before assembly One program f
72. have a project open and you need to be connected to the internet Also the accession numbers or GI numbers you enter must be valid Creating new text sequences You can create new text sequences by selecting New Text Sequence from the File menu you need to have a project open to do this This will show the following dialog r Clipboard You can use sequences copied to the clipboard to create new text sequences Sequences can be in any text format Aligner can read including plain text FASTA Genbank and EMBL Currently the clipboard does not contain text A One use of this option is to add new sequences from the contents of the clipboard for example sequences that you copied from a web browser CodonCode Aligner will analyze the clipboard contents before showing the dialog if the clipboard contains a text sequence in a format that CodonCode Aligner can read the dialog will look like this Import from GenBank 27 CodonCode Aligner User Manual ANOO Create New Text Sequence Sample Name ref A20 s1 r Clipboard Contents 1 FASTA sequence Name ref A20 s1 Length 400 bases Y Use clipboard contents Gia da teas Cancel When you select the checkbox labeled Use clipboard contents and then press OK CodonCode Aligner will create a new sequence and open the base view for this sequence If the clipboard contains multiple sequences in a format that allows multiple sequences per file fo
73. high quality through the entire region When editing contigs with Aligner you can define quality thresholds for the consensus sequence in the Feature preferences and use this to very quickly move to regions that need your attention To build a quality based consensus two prerequisites need to be met Editing Samples 121 CodonCode Aligner User Manual 1 The sequences must have base specific quality scores if you import sequence trace files that do not have quality scores you should first do the Base calling with Phred to get quality scores 2 You must have selected to build a quality based consensus in the Consensus preferences this is the default setting when you install Aligner In addition to the quality based consensus there are two other factors that enable you to get cleaner assemblies with much less need for contig editing are The ability to automatically clip low quality sequence from the end of reads thereby reducing the total number of discrepancies The use of local alignments as opposed to end to end alignments regions with high error rates tend to end up in the unaligned ends and can also be ignored Of course there will be times where contig editing is necessary and CodonCode Aligner does provide many editing functions that are described on the next pages Editing Samples 122 Windows for Editing Samples You can edit sample sequences in several different views windows the base view the trac
74. ignored You can add as many codingSequence tags as you like You can add the codonStart tag only to one of the first three bases in the first codingSequence if you try to place it anywhere else it will be ignored After defining you coding region Aligner will use this information next time you choose Find Mutations for Defining the Coding Region 94 CodonCode Aligner User Manual this contig There are a few things to keep in mind though The content of mutation tags is not updated when you change your reference sequence or consensus you can simply find mutations again to get the current results e If both the reference sequence and the consensus have a codingSequence tag the tag from the consensus will be used e The codingSequence tag from the reference sequence will only be used if the contig you are analyzing is an alignment not an assembly Numbering the Coding Sequence In mutation analysis projects you will often want to assign a base number to the first base in your coding sequence for example because it is not the first exon in a gene In Aligner you can do this by adding a codonStart tag and entering the corresponding nucleotide number in the Notes field The codonStart tag identifies the first base of the first complete codon and therefore must be assigned to any of the first three bases in the first coding region see Notes below Here is an example of what the Add Tag dialog looks like in thi
75. look for heterozygous insertions and deletions by checking Look for heterozygous indels If you have already searched for heterozygous insertions and deletions for example before end clipping you can uncheck this checkbox and the mutation finding will be a bit faster Keep in mind that it is generally recommended to search from heterozygous indels before end clipping since end clipping may clip the entire heterozygous part Marking mutations 265 Open amp Save Preferences In the Open amp save preferences you can set what Aligner does when opening and saving projects Preferences r Open amp save Base calling Number of projects in Open recent Base colors Default folder for new projects Consensus method Double clicking Users peter Documents Projects End clipping Features Highlighting Users peter Documents Projects License Server Memory v Always use the last used folder for importing Default folder for importing files Mutations C Set the project path when creating a new project n en amp save I vis Phrap assembly r When importing samples without qualities Preference options Printing Set the quality score for each base to 15 Fu Protein translation Sample names Startup Vector trimming Window placement Description The open and save preferences allow you to select the default location for new projects and importing and how many rec
76. ludit C P 303 Memory Requiremielits 200 e e p SEEERR RE NEM ERR EGER REEL EXRVEE RO REF EEUU REIR EAE nes 304 How Aligner memory on Windows is S6L ons eere HD te ore EE REUS PE EFE XXE ER ELTE ieee 304 How Aigner memory on MacOS X 185 8605 oeoxoco eer De suite SU UD E S ORI D Gee Exp 305 CodonCode Aligner Release INO GS 4c ii nririrekibrk ie FEE EERH EOD KEHDD FLYER ECHO KEEN RE LE CROCO V n 306 Checkins for Aligner Updates uoce ricos bebo Eni nDOE ED ERE E eE E ences danvies Y EN COP EE ERO ERE EDU RERD ape PV ERE LEN 307 Visiting tbe Aligner WED BLE serere rennes or Co via VER EELE beider b LP RE a i giras 307 xi About CodonCode Aligner Iis ita LLL KIENL Copyright 2002 2015 CodonCode Corporation All Rights Reserved Contains licensed copyrighted material from LI COR Inc For technical support e mail support codoncode com WWW www codoncode com USA 781 686 1131 System Requirements Mac OS X Requires Mac OS X version 10 5 8 or newer 10 6 8 or newer suggested 1024 MB RAM 2048 MB or more suggested Windows Requires Windows XP Vista Windows 7 or Windows 8 1024 MB RAM 2048 MB or more suggested and a 500 MHz or faster Pentium III or better processor Other operating systems CodonCode Aligner is not available for other operating systems Licenses After installing Aligner will start in Demo mode Demo mode allows you to use Aligner for viewing sequ
77. modify it as needed You can view how sample names will be interpreted by clicking on the Preview button This will bring up a preview dialog eoo Name parts preview Clone Direction EGFR_exon19 JJM EGFR exon19 JM R EGFR_exon19 JJM EGFR_exon19 NWS EGFR_exon19 NWS EGFR_exon19 XHS EGFR_exon19 XHS EGFR_exon20 JJM EGFR_exon20 JJM EGFR_exon2 O NWS EGFR_exon20 NWS EGFR_exon20 XHS EGFR_exon20 XHS R EGFR_exon20 XHS Tm nizimimimim IR F R F R s The default name scheme is clearly not a good one for these clones It seems that the name starts with the name of the gene EGFR followed by the name of the exon and a sample or patient identifier If we change the name parts definition to look like this Defining sample names 284 CodonCode Aligner User Manual Base calling Base colors Consensus method Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Restriction maps Sample names Window placement Define sample name parts Meaning Delimiter Exon dash z Patient period EX Direction plus bee Delete Delete Add name part Define delimiters C eren 3 Description The sample names preferences allow you to define how Aligner interprets sample names You can define different meaning
78. none Hide the script window Other commands openTraceView sample name any text to be used as comment setComments leave empty to erase existing comments Sets the comments for the currently selected samples and or contigs message text Show the given message full path to file where progress messages should be logged e g Users Shared Script_progress txt Log progress messages to the given file Optional Set whether to abort scripts when true default or false errors occur Note that most script commands require a selection that is valid for the command some commands also require that the appropriate view is open for example the contig view for deleteFromContigStart Scripting CodonCode Aligner 221 CodonCode Aligner User Manual Scripts can be added to the Scripts menu in CodonCode Aligner by putting them in certain directories On OS X in Library Scripts CodonCode Aligner for all users and in Library Scripts CodonCode Aligner the Library folder in your home folder for private scripts On Windows in a CodonCode Aligner Scripts folder in the My Documents or the Shared Documents folder Scripting CodonCode Aligner 222 Preferences and Settings You can customize many aspects of Aligner in the Preferences dialog To display the Preference dialog e On Mac OS X select Preferences in the CodonCode Aligner menu or press Option return On Windows select Prefer
79. of Contents Adding Sample Files to Aligner Projects Adding Entre Folders of Sample Pes retro tive EIO E EXP RH VER EIENEN PR EUR 24 Adding Entire Asses i ces seccosenio rH DE ERR E PUERO ROVER VASE RO UA hee ERE REFER MO Pe AT CUR 24 Importing Sequencher Projects CAF Pes ioa asewer ccs rrr matte ooo dle epe el ga 25 Bnporsms Phrap A Shem DG iio pepe bre hee dla pe DESEE pda abeo E pip ql a acide a TEOR 26 Tags in Phiap assemblies Er REI N EUR EENEVREU RR Reman Raa 26 Dopor ron Ced D GTC iso Dno Soto Tu UO Na recited RO MORE EA reo E MEM EE 26 Creatine nen text SECURES vis sui nC RO CEDERE HU RR EU mG AEDEM Liu HivRR RIE FR Lx MEER 27 Compatible File Potiats icsccs is2ccasiaszccstssaactentsestanuscadaessedtaesondeastoazscdnsaaccasadddaoascdiasaacnibond ii 28 Sample NATES ETE 29 Organizing Samples And Contigs In Folders snora a EARE ERRA 31 USD MESE ET D 1 OO E AAA E OLESTIE 31 Moving Samples and Contigs ta Folders iter rr Ire ote irre Ee EUR N 31 Remane FOE 555 eode I X UR DUM MG A es ae a NI DIE MEE 31 Delos Poldi nanona E E E G eee aia 31 Removing Samples from an Aligner Project sssscscscssnssiersvescnscopevocusvesseusebsceivoneveundsrcceuvsverescesvodnseoesteeusnssenso gt 33 Base Calling with PHREN eL sine one i i oa 34 Hew to call bases with PHRED from A lign t iuiiice rir ete nh reine rbe anu inked annn dans 34 Prerequisttes oo noscit econ PEE HOPES ee LN EH ce NO FN PR Cbr TNR e ICs 34 Sy lie sneer DOES S secte Tto too TO
80. of samples 5 by adding an entire assembly or project 6 by importing from Genbank 7 by creating new text sequences Aligner will always create copies of the samples you import Keep in mind though that these copies will be created only when you save the project so save on a regular basis For files that have pointers to associated files Aligner will also try to locate and import the related files for example PHD files and FASTA files may point to a chromatogram file in ABI or SCF format that contains the trace data Opening Single Sample Files To add a single sample to a project select Open from the File menu This will show the standard Open file dialog Select the file that you want to add to your project and click OK The file will be read and the sample s in it will be added to the Unassembled Samples folder Next Aligner will open one or more views for the sample s you just added based on your settings for which views to open when double clicking on a sample in the Double Clicking Preferences You can also add files or folders to projects by drag and drop from Finder or Explorer windows onto Aligner project views Adding Several Sample Files To add samples from a few files to a project select Import gt Add Samples from the File menu This will show an Open file dialog Select the files that you want to add to your project and click OK To select several files in a row click on the first
81. of sequences When importing sequences from NBRF PIR files CodonCode Aligner will check if the imported sequences contain gaps If the sequences contain gaps and are all of the same length Aligner will check the sequence names in the project to see if you are re importing contigs that have been edited with an external sequence editor like MacClade and offer the option to update existing contigs For more information read the Roundtrip Editing help page PHD files text files that contain information about base calls and quality scores PHD files are typically created by PHRED but a number of other programs including Aligner can also write PHD files PHD files typically contain the name of the chromatogram file they refer to which Aligner will then also read to get the trace data Plain text format text files that have only DNA sequence without any annotation Aligner will read all base letters ACGTUacgtu and IUPAC ambiguity symbols and ignore any spaces line endings and numbers Plain text files cannot contain any binary characters when creating text files in programs like Microsoft Word make sure to save the files as Plain text not in native formats like Microsoft Word Document doc SFF files binary files from 454 sequencers that contain multiple sequences and experimental flowgram data Please note that CodonCode Aligner only offers limited support for 454 data You can only import small 454 projects but not entir
82. preferences controls if you see bases or amino acids when you look at your sequences For the amino acid translation you can choose one of the three Protein Translation Preferences 275 CodonCode Aligner User Manual possible frames Changes to which frame to use are only visible if you are showing amino acids and not bases The sequence translation preferences control the display of your sequences in Contig View Base View and Trace View You can also access these options through the Sequence Translation submenu in the View menu Here is an example of a Contig View when showing amino acids for sequences eoo Contig2 EE F F Alli 4 Fu 123 8 Print Previous Feature Next Feature View Traces Colors Bases lt gt Transl NextFrame Preferences Help Show differences 9 l Doo E 472 bp of 472 bp jp 100 bp 200 bp 300 bp 400 bp lt lt ca 22 r In the picture above the sequences are drawn by using a translation based background this background scheme can be selected from the Base Color preferences To change the frame used for the translation you can either use the pulldown menu next to the Show amino acids for frame radio button or use the Sequence Translation submenu in the View menu or use the Next Frame E toolbar button The translations shown will always use a fixed frame where gap characters in sequences are treated the same
83. process all of your samples Please confirm the new entries for the Phred parameter file When you click OK Aligner will bring up a new dialog that allows you to edit the Phred parameter file It shows all the current entries in the Phred parameter file as well as one or more entries that need to be added ec oc Phred Parameter File 4 rPhred Parameter File Entries Primer ID Chemistry Dye Class Machine Class Status DT3700POP6 37C mob terminator big dye ABI 3700 P DT3700POP6 BD 40deg vl mob terminator big dye ABI 3700 DT3700FSP BD v1 mob terminator big dye ABI 3700 DT3700POPS dRhod v1 mob terminator d rhodamine ABI 3700 DT3700POP6 dRhod v3 mob terminator d rhodamine ABI_3700 DT3700POPS ET mob terminator energy transfer ABI_3700 DT3 100POP6 dRhod v1 mob terminator d rhodamine ABI 3100 DT3 100POP6 BD v2 mob terminator big dye ABI 3100 DT3 100POP6 BDv3 v1 mob terminator big dye ABI 3100 MegaBACE Mobility File unknown energy transfer MolDyn MegaBACE BeckmanCEQ terminator big dye Beckman CEQ 2 DT3100POPA4LR BD v1 mob terminator big dye ABI 3100 Samples missing primer ID primer rhodamine ABI 373 377 No matching primer ID primer rhodamine ABI 373 377 D Samples missing primer ID terminator rhodamine ABI 373 377 i DyePrimer 21m13 primer rhodamine ABI_373_377 New f Add r Description The Phred parameter file contains the information Phred needs to determine the best base calling
84. programs Viewing Chromatogram Information For samples that have chromatograms additional information about the chromatogram will be shown in the sample information dialog Editing Sample Information 136 CodonCode Aligner User Manual Sample Information Abi example ab1 Name Abi_example abl 690 bp 45 8 GC 165 A 190 C 107 G 187 T 41 other Q20 639 92 6 Q30 615 89 1 Comments Chromatogram Information SPAC 15 575864 LIMS 61c5c7773cc311d99967000d56be3557 GTYP POP7 Run_Start 2004 11 22 15 17 11 Run_Stop 2004 11 22 17 06 07 BCAL KB bcp BCSW KB 1 1 1 V Allow manual edits Cancel OK The example above shows information extracted from an ABI file Note that the last two lines show which base caller was used for this sample In this case the KB base caller which assigns quality scores to each base was used the newer replacement of the old ABI base caller which did not assign quality scores For sequences like this one that have valid quality scores a quality summary is given near the top below the base composition line For chromatograms that were base called with PHRED the last lines in the Chromatogram Information will still point to the KB or ABI base caller But if you scroll through the chromatogram information you can see entries added by PHRED Viewing Chromatogram Information 137 CodonCode Aligner User Manual Sample Information Phred example Name Phred example 6
85. samples that had aligned bases at the position of the split Aligner will put this either into the new right or the new left contig the right contig will be chosen for samples that had more aligned bases to the right of the split point and the left contig for samples that had more aligned bases to the left of it Here s an example of a contig before splitting o0 J4 Coni Show differences Mr 2710 bp of 2710 bp jp 1 000 bp 2 000 bp 1260 1270 128 L Pos 1283 2710 Qual 39 After splitting at the position indicated 1283 the two new contigs look like this Splitting Contigs 153 CodonCode Aligner User Manual OO 000 Contigl left Contigl right Show differences US Show differences 1571 bp of 1571 bp gt 1331 bp of 1331 bp gt 1 000 bp djs74 3174 s1 A s74 1802 s1 AGTCTCG djs74 824 s1 djs74 1180 s1 feTCcTG TCTECTGRYAGTcTC _ O djs74 996 s2 ontigl right PC ooo O Note that the sample djs74 1432 s1 ended up in the leftt contig Splitting Contigs 154 Unassembling Contigs To unassemble one or more contigs Go to the project view e Select the contig s Choose Unassemble from the Contig menu All samples in the contig will be put into the Unassembled Samples folder and any gaps in the samples will be r
86. software such as FigTree If you have one or more invalid trees in your selection of trees to export trees are marked as invalid due to contig edits after the tree was generated you will see a dialog asking you if you would still like to export the selected trees You have the option of canceling the export or exporting the trees even though they do not represent your current contigs Please note that sample names with funny characters such as spaces colons or brackets will be enclosed in single quotes Some tree visualization software may not be able to read the exported Newick files if your sample names contain any of the following characters single quotes double quotes brackets colons semicolons whitespaces or commas In this case please make sure to use a newer program such as FigTree Exporting Trees 178 Aligner Windows The Project View Window The project window is the main window in CodonCode Aligner most actions are started by selecting samples or contigs in the project window and then choosing a menu option or one of the buttons at the top of the project window eee example_project ei is B i 5c Save Project Add Samples Add Folder Add Assembly Align to Reference Sequence Assemble Unassemble Name Contents Length Quality Position Added Modified v ui Unassembled Samples 2 samples 0 3 11 3 11 03 B A454 s Trace 693 397 0 3 11 3 11 03 Bl A455 s Trace 750 343 0 3 11 3 11 03 v 3 Co
87. the page If space permits additional rows with sample and contig names followed by the sequences will be included on the page Poster Prints the sample and contig names with as much of the consensus sequence as will fit across the page Continues printing the sequences across additional pages without including the sample or contig names on those pages The Font size pull down menu selects the size of the font used for printing the contig If the Include colors and highlighting checkbox is checked the contig will be printed as it appears in the contig view including colored bases colored backgrounds and other highlights If this box is unchecked then Trace View Printing 273 CodonCode Aligner User Manual the bases will be printed as black letters on a white background ignoring all highlights other than underlining To print sequences grouped every 3 5 or 10 bases with spaces in between check the box labeled Print bases in groups of bases If this box is not checked bases will be printed continuously across the page Usually unaligned ends of samples are printed with the contig If you do not want to print the unaligned ends uncheck the Print unaligned ends checkbox Contig View Printing 274 Protein Translation Preferences The organism for which the sequence translation is being performed can be selected from the Organism list In the Sequence Translation section you can choose if you want to sho
88. the new folder Folders created this way can hold unassembled samples contigs or a mix of samples and contigs Moving Samples and Contigs to Folders You can move samples or contigs to and from folders in several ways By drag and drop Select the folders or samples you want to move in the project view and drag amp drop them onto the target folder Using Move to in the Edit menu Select the samples you want to move then choose to Move to from the Edit menu In the dialog that appears select the target folder that you want to move the samples to them press OK Using Move to in the popup menu Select the sample or samples you want to move in the project view and then right click OS X control click on one of the samples From the popup menu select Move to To move contigs from folders back to the same level as Unassembled Samples and the Trash select the contig choose Move to from the popup or Edit menu and then select top level You can also drag and drop contigs in folders onto empty space in the project view to see the same menu You cannot move unassembled samples to the top level and the top level option will not be available if your selection contains unassembled samples Renaming Folders To rename a folder you created click on the folder in the project view wait a little bit and click on it again You will see when the name becomes editable it may take a second or so
89. the project view you can also select samples and contigs by clicking or shift clicking and then viewing the bases traces or contigs assemble the samples and so on Base View Window The base view window shows all the bases for a sequence as shown below Project Window 8 e208 1 CodonCode Aligner User Manual TGGAGGAGGT 51 TTTGTTGTGG C c CACAGAGACC 101 CAGGTGCTGC AGCCACAAGA GGAAGCCTTG ACACAGGTGT GGATGCCATG 151 ATAGH MTTC CCCATCAATT TCCAAGACCG ACCTGAGCCC AGCAGTCAAA 201 GGGGTGGGCT TTCTTGTACT TAATGCTAGA TCTCTGCCAG TTTACAGTAG 251 ATGTAGCTTG Brectactat TTGTTCGTCC ACCCACTCAT CACTCACTCA 301 GCCTCTCATT CACTCATCCA TTCTCTGTGA erg BecacaTGEB 351 cc PeGcatccese 401 Acc TcTAATOCC 451 GAGGTCGAGA 501 CAACAANGAT 551 GTGGGATTCT w 601 4 A060 s Base 261 of 628 Quality 16 4 As in the other windows that show bases the quality scores for each base can be shown as a colored background In the example above base calls with qualities below 20 low quality bases accuracy below 99 are shown with a dark blue background base calls with quality scores between 20 and 30 on light blue background and base calls with qualities above 30 very high quality bases accuracy above 99 9 on a white background You can change the colors and thresholds in the Preferences dialog Trace Window The trace window allows you to view and edit sequences that have chromatogram data for example ABI and SCF files eoe Traces from Con
90. to exon 4 5 When specifying a base number in the codonStart tag the number refers to the nucleotide in the cDNA sequence Therefore the number must give a remainder of 1 when divided by 3 e g 1 4 7 10 3301 3304 Aligner will show a warning dialog when any one of these conditions is not met The easiest way to get the correct codingSequence and codonStart tags is by importing the reference sequence from a text file in Genbank format CodonCode Aligner will use the CDS features in the Genbank file and add corresponding codingSequence and codonStart tags If you have more than one coding sequence region defined Aligner will automatically keep track of the reading frame as the base numbering mutations in introns will be annotated using the standard n x or n y numbering Here is an example Numbering the Coding Sequence 96 CodonCode Aligner User Manual eo0 Mutation tags in Contig1 Feature Source Foundin Parent Stat End Comete codingSequence User Reference Contig 327 340 a codonStart User Reference Contig 328 328 basenumber 6667 heterozygoteAC Aligner va 23 x Contig 0033 343 Heterozygous 667943 C gt A noncoding region polymorphism Aligner Contigl Contigl 343 343 1 diffs 0 homo 1 hetero 3 not mutated heterozygoteGT Aligner va 23 x Contigl 356 356 Heterozygous 6680 7 G gt T noncoding region polymorphism Aligner Contigl Contigl 356 356 1 diffs 0 homo 1 hetero 3 not mu
91. to import all the files r 7 e Import Folder of Samples Do you want to import 20 sample files from Documents Do not show again If you click Yes Aligner will proceed to import sequences from all files in the directory This may take a while if the directory contains many files All imported sequences will be added to the Unassembled Samples folder Note Aligner will try to be reasonable when importing all files in a folder and not import some files that you probably did not really want to import For example Aligner will not import hidden files like files where the name starts with a period also when importing an ABI runfolder Aligner will import the abi or ab1 files but ignore all abi seq files if the corresponding abi file was present Adding Entire Assemblies To add an entire assembly to your project select Import gt Add Assembly from the File menu This will show the standard Open file dialog Next select the assembly file which can be an Aligner project file the file name must end in ccap or proj e a CAF Common Assembly Format file produced by Sequencher the file name must end in caf non e assemblies ACE files generated by Phrap the file name must end in ace ace 1 ace 2 etc The assembly files must have the correct extension either ccap proj caf or ace ACE files can also have a number appended for example ace 1 Note that depend
92. top lets you select the reference sequence s that you want to align to Typically the reference sequence will be in a file in FASTA format you can select this file after pressing the Select button at the top If you have already imported the reference sequence s into your CodonCode Aligner project and select the sequence s before selecting Align with Bowtie2 the Selected sequence radio button will be enabled The third option for the reference sequence is to align against an existing Bowtie2 index To use an existing index place all the bowtie2 index files inside a folder and place this folder into this directory CodonCode bowtie2 Index in your Documents folder The Sequences to align section in the middle lets you specify one or two sequence files that should be aligned to the reference sequence These files must be in a format that Bowtie2 can read typically FASTQ or FASTA Two files are used for paired end sequences where each file contains one of the two ends both sequence files must have exactly the same number of sequences in the same order The Options section lets you choose options for the Bowtie2 alignment The first option is whether bowtie2 should generate local alignments where some bases at the start and end of reads may remain Alignments with Bowtie 2 74 CodonCode Aligner User Manual unaligned or end to end alignments The next option lets you choose whether or not reads that do not align to th
93. unaligned dangling ends the updating will likely fail One way to create dangling ends is to generate contigs of contigs using the built in algorithm and then remove samples or contigs at the beginning or end of the contig This cannot happen if the contig of contigs is generated with ClustalW since ClustalW creates end to end alignments We plan to remove some of these restrictions in future releases How To Roundtrip Edit with CodonCode Aligner 157 Editing Contig Information You can rename contigs and add comments by selecting the contig in the project view and then choosing Contig Information in the Contig menu This will bring up the following dialog box 9 Sample Information Contig1 Name Contigl Comments You can change the name in the Name textfield at the top You can also add remarks about the contig in the larger text area below these will be shown in the Comments column in the project view If a contig has tags for example polymorphism tags added from finding mutations the button that is labeled No tags in the image above will be labeled Tags and become active Clicking on it will bring up a tag dialog that shows all tags for the consensus sequence The checkbox at the bottom indicates whether a contigs is an alignment to a references sequence as in the image above or a regular assembly Please note that contig names and remarks as well as tags added to a consensus seque
94. unaligned ends by default can also generate end to end alignments and large gap alignments Alignments may or may not include all input sequences depending on sequence similarities and assembly parameters Tends to be faster than ClustalW Comparisons must include at least one contig for samples only use Assemble Keeps existing gaps You can work with the new contig of contigs the same way you would with normal contigs Double clicking on a base for one of the contigs in the contig of contigs will open the trace views for this contig You can open separate trace views for different contigs to quickly check any discrepancies To cite muscle Edgar Robert C 2004 MUSCLE multiple sequence alignment with high accuracy and high throughput Nucleic Acids Research 32 5 1792 97 muscle is available from http www drive5 com muscle To cite ClustalW Thompson J D Higgins D G and Gibson T J 1994 CLUSTAL W improving the sensitivity of progressive multiple sequence alignment through sequence weighting position specific gap penalties and weight matrix choice Nucleic Acids Research 22 22 4673 4680 Assemble from scratch Sometimes you may want to re assemble a contig for example after you did some editing and ended up messing up the alignment of reads Or you may want to merge a contig with another contig and or additional Assemble from scratch 61 CodonCode Aligner User Manual samples without preservin
95. way as bases This is different from the way gaps are treated in the consensus translation described in the next section Consensus Translation The consensus translation preferences control the display of the protein translation only for the consensus sequence which are only visible in the Contig View Here is an example where the consensus translation for all three forward reading frames is shown Sequence Translation 276 CodonCode Aligner User Manual moo Contig2 amp F Ft ka ea 123 az Print Previous Feature Next Feature View Traces Colors Bases lt gt Transl NextFrame Preferences Help Lj g DoS O 472 bp of 472 bp 2p 100 bp 200 bp 300 bp 400 bp 0 46 GAGGCGGCTGAAATGAGGATATTTT AGCGT CAGGCCATTATTAT GAGGCGGCTGAAATGAGGATATT AGCG AGGCCATTATTAT GAGGCGGCTGAAATGAGGATATTTTACAGCGTTTCAGGCCATTATTAT GAGGCGGCTGAAATGAGGATATTTTACAGCGTTTCAGGCCATTATTAT GAGGCGGCTGAAATGAGGATATTTTACAGCGTTTCAGGCCATTATTAT AGGCGGCTGAAATGAGGATATTTTACAGCGTTTCAGGCCATTATTAT lt lt ca 9 r lt lt ca 22 r ca 23 s ca 9 s ca 21 s Contig2 GAGGCGGCTGAAATGAGGATATTTTACAGCGTTTCAGGCCATTATTAT Translation GlylTyr Phe lThrAla PPheGlnjAlallelIlelIl ER 4 Which consensus translation s are shown depends on the selection in the Display section You can choose between no translation the default the translation of one readin
96. 0 0 9 17 9 17 09 i CtgComparison branch 4contigs 183 0 ez 22 22211 gt AXE 3samples 183 0 0 9 17 12 22 1 gt 35 MEM 3 samples 183 0 0 9 17 12 22 1 L2 si NQ 3 samples 183 0 0 9 17 12 22 1 gt 3i zT 3 samples 183 0 0 9 17 12 22 1 gt Trash 0 samp 0 0 8 10 9 17 09 i Removed branch with 4 contigs from CtgComparison Z Building Trees for Selected Bases Only You can also build a phylogenetic tree for the selected bases only instead of for the whole contig Select the bases you want to use in the consensus of the contig view then choose Build Tree for Selected Bases from the Contig menu The options dialog that appears is the same as when building a tree for all bases in a contig The resulting Neighbor Joining tree takes only the selected bases into account when building the tree The example below shows a phylogenetic tree built for the selected bases only that shows the number of differences and was built including all internal gaps as differences Building Trees for Selected Bases Only 203 CodonCode Aligner User Manual GTACTCCTGTCCTGAANXe GTACTCCTGTCCTGAANXeE GTACTCCTGTCCTGAAM GTACTCCTGTCCTGAAM GTACTCCTGTCCTGAANXeE GTACTCCTGTCCTGAANXeE GTACTCCTGTCCTGAAM GTGCTCCTGTCCTGAA GTQCTCCTGTCCTGAAR GTACTCCTGTCCTGAAReRN P 100 110 Label branches Poms Masking Bases Matching the Consensus One way t
97. 101 CodonCode Aligner User Manual to each sequence where it finds a putative heterozygous insertion deletion When all samples have been analyzed Aligner will show a dialog that summarizes the results F e Heterozygous Indel Search Results Finished analyzing 2 samples found 1 possible heterozygous indel If any indels were found Aligner will open a new window that shows information about these indels similar to a feature view window 0 OOA Heterozygous indels in heterozygous_indel Feature Source Found In Parent Contig Start End Content heterozygotelndel Aligner heterozygous_indel Unassembled Samples 172 582 Score 29 i f I L Double clicking on any line in the table above will open a view for this sample so that you can verify the results typically the trace view will be opened unless you have changed the double clicking preferences To try this out with an example project that is included with CodonCode Aligner you can open the Hetero indel project in the Example Files folder in the directory where you installed CodonCode Aligner Hetero Indel Scores All heterozygous indels found by CodonCode Aligner will receive a score that is shown in the Content column Scores assigned range from 11 to about 35 with higher scores indicating higher confidence Indels with a score below 15 are more likely to be false positives the proportion of false positives in indels with scores above 20 is su
98. 15 bases long for example an artificial SCF file created with tools like mkt race or fasta2Phd perl a sequence from a PDF file was previously identified as having artificial sequences by Aligner and has a corresponding tag in the PHD file Changing this value will not affect any sequences you previously imported If you want to change the assigned artificial quality values for a sequence in your project you currently have to remove the sequence and than import it again What are artificial qualities good for Good question They cannot be used for end clipping since end clipping requires real quality scores assigned by programs like Phred However the qualities are used to determine the consensus sequence during assembly and alignment to a reference sequence In general you should use low artificial scores like the default value of 15 However if you want to make sure that a sequence without real qualities is used to contribute more to the consensus you can assign higher values all the way up to 90 Open amp Save Preferences 267 Phrap Assembly Preferences In the Phrap assembly preferences you can specify details needed for assembling samples with Phrap eoo Preferences Alignment Phrap Assembly Assembly Base calling Full path to the assembly program Phrap Base colors e e Cnm meth tions CodonCode Aligner Phred Phrap workstation phrap Double clicking End clipping Features Highlighting License Server Memory
99. 17 Aligner Projects An Aligner project contains all the information for a project you are working on the samples you added any contigs you may have assembled and so on Each project is contained in one file ending in ccap which is created by CodonCode Aligner when you first save a project After an Aligner project is created sample files can be added When alignments or assemblies are performed the resulting consensus is stored in the project upon saving Only one project can be open at any point in time The contents of a project are shown in the project window e080 example_project m is B i 5c Save Project Add Samples Add Folder Add Assembly Align to Referent uence Assemble Unassemble Name Contents Length Quality Position Added Modified v ud Unassembled Samples 2 samples 0 3 11 3 11 03 BU A454 s Trace 693 397 0 3 11 3 11 03 B A455 s Trace 750 343 0 3 11 3 11 03 v 3 Contig1 3 samples 966 917 3 11 3 11 03 Bd A326 r Trace 628 375 0 3 11 3 11 03 E A060 s Trace 645 389 221 3 11 3 11 03 Bd A333 r Trace 646 370 320 3 11 3 11 03 E Contig2 2 samples 755 720 3 11 3 11 03 gt Trash 0 samples 0 3 11 3 11 03 e Assembly completed in 1 62 seconds 1 successful join 1 island remaining i In the project window samples are treated like files and contigs are treated like folders directories in the Finder on MacOS or the Explorer on W
100. 19 JJM F abi If consists of The gene name EGFR e The exon exon19 A patient identifier JJM e The direction F for forward Assemble in groups 56 CodonCode Aligner User Manual The file type extension abi Most name parts are separated by underscores except for the last two parts which are separated by a period Obviously sample naming conventions will be different for different projects so you will need to tell Aligner how to interpret parse sample names You can do this in the Sample names preferences or by clicking on the Define name parts button in the Assemble in Groups dialog For the example above the definition would look like this r Define sample name parts Meaning Delimiter Exon W _ underscore E Delete Direction W period Delete Add name part Define delimiters CD Note that the last delimiter in this example does not matter since the last part of the sample name is the file type You can define the name scheme manually by using the Add name part button and the Meaning and Delimiter pulldown menus or use the Guess name scheme button to have CodonCode Aligner guess the name scheme for you Guessing the name scheme will typically work if the sample name parts are separated by delimiters and just one of the name parts varies To verify that the name part definition is correct you can press the Preview button this will show the
101. 2 Exclude Ns You can exclude all differences that contain a N by selecting this option The resulting difference table will omit any columns where the only different bases are N Exclude non gaps By checking the Non gaps option you can exclude all differences that do not contain any gaps The resulting difference table will only show differences that have a gap in at least one of the samples at a certain position Exclude high consensus quality Checking this filter excludes all differences with a consensus quality greater than the one set in the filter dialog You can set the quality by clicking on Set filters and thresholds which will show the filter dialog You have the option to set the qualtiy to 20 30 40 50 or 60 For example excluding all differences with a quality greater than 40 will only show differences at places of the alignment where the consensus quality is less than 40 Exclude low frequency changes If this filter is selected your difference table will exclude all differences with a frequency below the one set in the filter dialog You can set the frequency by clicking on Set filters and thresholds which will show the filter dialog For example if you set the frequency to 0 1 and select the filter your difference table would only show differences that occur in 10 or more of your samples Hide rows without changes This filter allows you to omit all samples from your difference table that do not have any d
102. 33 Mloxanes samples 10 COMES ion oie e Ent a e REI PIRE ped a a a 133 Moving samples to Linassembled Samples erc ERE HIERO RR EE ER ERE EEP TREE I REP edUs 133 Taserting Gaps and Bases is scssciscassncnavasavecesiexecamamcannsias oases ae aaeax NN ERU anMKIN UA RIA ARMENE ER 134 Adding Bases at the Exid ol Reads uieen acepte ttr ipee uer ya di be IRE E IRR Ee pMSE HE deaseeaaaneanas 134 CodonCode Aligner User Manual Table of Contents Editing Sample Information Contirming TABE rnor ren e rH e REPRE ERA ERU EE VINE NEERE ENEEU I Foe PME EUH EIE EENS 139 Seen Een BM Er c TT 139 E HDD EET PCT 140 Adding Tags to AI Sequeuces ii ettet en e Eee cs Saee ER SRA EE Ee ee ree ue PER ERE CERES RES RYE EE 140 Savine KAIS o oec XAR Y REX CE VILE EU A USE EDD RR ER EAE 141 Udo add BI GO oiov ERR ELAUESEDIM MR EEU cea FEPEREREFERR E EUR EU FUROR EE VRERE AA AAEREN OE E FERE ener 142 Copy and ICI E 9 G Stm 143 Cops Se erie Se UNCON csse perte Dr erede D er needed d nts ell aH da qul pP rwr Un MR RR 143 PASSI greta sich ssc acts cat wag DUMP MMMM LL LM AMI LU IDEM eo 143 Exlitino COlIgS uoto ei ERR EDU hws UU E eats anno ca subd Saad ww URL RR man adc 144 Adding Samples 0 Comit Sessie sarnane HARE XA i oa NEC ERR UA NER RAE ROS E NDO ERR KM DRM EK UA 145 Dupheat np Samples ue ose erre EE PE p ese a EM EPI e RIP B IRURE DESEE EFE NUR PELA ERES E elastase 145 Merpine C ontips iori rM ER oT NUMERI UU DIMINUER E MI
103. 4 Expottoptiong Tor FASTA Tes eco prod e utr eee RES ai VOd EE HEU EE AAAA 164 Exporting SCE ilesa titor ERI REEREAPE O AA O Q EPI E CERIS RU RIA bI MMEE 165 Exporting Consensus SeQiitCOs see near sk inia eR SERMO EUR IR IER a M n RR oma EU SUM NN SERE REM 167 Expottoptions Tor EASTA PIES esiis eee ar tite eet iss ntu e Er e EAS e e REP RERE SERRE CEPS BANNER Te een S Re essi 168 Exporting DIMePCUCES utei orit eiit hei parken Sepe peo I ate enura eiaa euP oo uu etu E KESS Ua taal nis S EnA E bns ep Un treu ai 176 Exporting tees riprese ehe Enni EE E ENE E NEA E N E NE EEE HAE aE ERE E DEL SER DU TEE 178 Aligner WV TNT EO E UTE 179 The Project V Ea Wy cu Deo ne TO EHE pened EV OPERE ESL olei eve qb E Gb emia ts 179 Selectmp Samples qud Contigs sesinin aadi PEE EMEN EINE EEH AERE TRESE AAAA UE dS 179 Menu shortcuts Buttons and Popup MENUS eoi ee cri eee roter eb tirer Ee QVE E AR EP PEDE REEF ERR ES 180 Project View Columbs And SOT soen Eros rai ERSE N PAM EFE OENAR NUS Fu ASSA 180 SAU LES TONES SU Be he parer vti ear niis Vena usi be edd ee a redet ado ude ve reed d d E 181 Cobe ao ka uu M I e aah a 181 RACE VIG s ast RAO ERA ERR ERN tes escent eee eReen 183 General Miorma iO ioca cas cetus Eos REX RD REEDRE ERE PER ERER CAVE D ead DO PAR DERE E Ra aaa NTA seen DS 183 Opemng a Trice View oiii cte tee aA E EM ola ui bapiitu c Maa Pont NN Ub dRp ME 183 Serelling and Scaling m Trace ViCi uei oder RIP CHE NN aE A O ERATE ERE NE RRE ATE 183 Tace
104. 61 bp 47 2 GC 166 A 197 C 115 G 183 T Q20 629 95 2 Q30 608 92 0 Comments Chromatogram Information SIGN A 500 C 719 G 278 T 699 SPAC 15 66 PRIM 0 MACH Geenie2 16110 028 DYEP KB 3730 POP7 BDTv3 mob TPSW NAME ABPS002 04F LANE 2 Tags V Allow manual edits Cancel OK In the example above you see an entry labeled CONV that point to PHRED and list the version of PHRED that was used The chromatogram information is read from ABI files or from the comment field in SCF files You cannot edit this information Viewing Sample Tags Samples may also contain tags which have been added by users other programs like PolyPhred or CodonCode Aligner during steps like end clipping or vector trimming If a sample contains tags you can click on the Tags button to display the tag dialog Viewing Sample Tags 138 CodonCode Aligner User Manual e Tags for va 16 x y Tags Tag Details nc ygoteT Program homozygoteCC Start 197 homozygoteAA heterozygoteAC End 197 dataNeeded Date vas tab Ghee EST 2007 dataNeeded Notes C Confirmed cSt m Cancel Delete You can also see all tags for a sample by selecting the sample in the project view going to the Sample menu and selecting Show All Tags from the Tags sub menu You can select a tag on the left to view details about the tag on the right You can change the start and end position
105. 612 Quality 13 4 Note that Phred typically lowers the quality scores of three bases not just one base in problem areas since neighboring bases are also more likely to be wrong The 3 color scheme is often useful to get a general idea of the sequence quality If you want more detailed color schading select the Quality based continuous scale color scheme Quality based 3 color scheme 239 Continuous quality based background colors In the continuous color scheme you can select two settings the background color for low quality bases and the minimum quality for which to use a white background Alignment Assembly Base calling Base colors Consensus method Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Restriction maps Sample names Startup Toolbars Vector trimming Views Warnings Window placement Base colors Trace colors A s green HJ rs Mies A N s d pink Show traces on black background Background colors f Quality based 3 colors e continuous scale By nucleotide ignore quality Translation based Select your main color scheme specify details below r Background color details continuous scale Color used for low quality bases J biue 4 Use white for quality 50 and higher Description The base
106. A GCAGCCAAGC CGA CGA The names for the entries are used when you select the vector sequences to screen against in the preferences that s why you cannot use plain text vector sequence files Using Custom Vector Files 50 Assembly and Alignment Sequence Assembly Assembly assembles sequence fragments into a larger sequence by identifying overlaps between sample sequences Samples that can be joined together are put into contigs Joins may fail because samples do not share overlaps that are long enough with other samples or contigs or because the overlap contains too many discrepancies Any sequences that cannot be put into contigs remain in the Unassembled Samples folder The result of the assembly can be one or more contigs plus samples that remain in the Unassembled Samples folder If none of the samples can be joined no contigs will be formed You can assemble any mix of unassembled samples and previously assembled contigs Contigs are assembled as they are they are not dissolved first However the consensus sequence of contigs may change where new samples are added The Advanced Assembly submenu in the Contig menu offers several advanced options for sequence assembly These include Assemble with pre processing this enables you to pre process unassembled samples automatically before assembly by base calling end clipping and or vector trimming Assemble in groups this option lets
107. AATAGACTGTTAGTGG 210 220230 240 TTAGTGGC TTAGTGGC Here discrepant bases the two T s near the middle are shown in red The lower case T in sample va 16 x was edited as shown by the underline The C s in the center have two different kinds of tags as shown by the pink and blue boxes You can change these settings for each of the four categories by choosing an option in the pulldown menu next to it Changes will take effect when you press OK Highlighting Preferences 258 License Server Preferences The License Server preferences allow you set whether CodonCode Aligner should use Aligner License Server and the name or address of the License Server computer used Most users will not need to use this preference panel since CodonCode Aligner can automatically find a local License Server to use when starting up Preferences Base calling Base colors Consensus method Double clicking End clipping Features Highlighting Phrap assembly Preference options Printing Protein translation Vector trimming Views Warnings Window placement rLicense Server Mi Use License Server Name or IP address of License Server 10 0 0 103 you start Aligner Changes to the License Server preferences will take effect the next time Description The License Server preferences allow specifying the License Server to use Changes to the License Server preferences will take effe
108. AG MIDI MID2 MID3 MID4 ATCAGACACG MIDS5 ATATCGCGAG MID6 CGTGTCTCTA MID7 CTCGCGTGTC TAGTATCAGC MID8 MID9 TCTCTATGCG MID10 TGATACGTCT MID11 TACTGAGCTA MID12 M TUI Only the first 50 bases will be searched for exact matches to these tags The samples which have the same multiplex tag will be grouped together Samples that do not have any tag or matches to more than 1 tag will not be assembed The names of the contig s formed for each group will start with the Group name as shown in the table above Some things worth noting for Assemble in groups You can also automatically pre process unassembled samples before the assembly in the Preprocess tab as described in Assemble with preprocessing Assembling in groups will try to group and assembly all samples and contigs in your current selection Any existing contigs in your selection will be unassembled before assembly After creating contigs by Assemble in Groups you can compare the contigs to each other by building contigs of contigs as described in the next section Compare contigs to each other A common DNA sequencing application is to first sequence the genes from several sources for example different species or patients and to then compare align the consensus sequences to each other CodonCode Aligner allows you to do this by creating contigs of contigs as follows Assemble the contigs separately for example generating one co
109. Assembling with SparseAssembler To assemble NGS data with SparseAssembler in CodonCode Aligner create a new project go to the Tools menu and select the Assemble NGS Data This will open a dialog where you can select the input files for the assembly and adjust assembly parameters Input files must be in FASTA or FASTQ format Reads from pair end and mate pair sequencing should be in separate files all reads from one end in one file and all reads from the other end in a second file with exactly the same read order CodonCode Aligner will then start SparseAssembler and display the progress output generated during assembly in a dialog When the assembly is complete the resulting contigs will be imported as text sequences into the project If mate pair sequences outward paired reads were included in the input CodonCode Aligner will use the mate pair information to find links between contigs and form scaffolds It does this by mapping reads to the contig sequences with Bowtie2 analyzing the mapping information for mate pair links between contigs and looking for sequence overlaps between linked contigs The resulting scaffolds will be imported as contigs into the project Before assembly with SparseAssembler sequence data should be error corrected Using uncorrected data will typically result in a large number of very small contigs You can error correct NGS data directly in CodonCode Aligner with SparseAssembler by selecting the Exr
110. B One 64 bit versions of Windows the maximum memory available to CodonCode Aligner is limited by the available physical memory RAM This number may be lower than the total amount of RAM because of memory use by other open applications The 1 4 GB limitation also applies on 64 bit Windows versions if 32 bit versions of CodonCode Aligner are used for example older versions before CodonCode Aligner 4 2 32 bit versions of CodonCode Aligner may use virtual memory if needed so the number shown as available may be larger than the amount of physical memory Please note however that using virtual memory may lead to substantially slower performance since memory must be swapped to and from the hard disk This will happen when the amount of memory used is larger than the amount of physical memory it can also happen earlier if you have other applications running The slowdown due to swapping can be dramatic 10 50 fold slowdowns and pauses of several seconds where nothing seems to happen are common If you work with large projects that need a lot of memory you may want to consider installing more memory RAM and quit other applications before starting CodonCode Aligner Changing memory on OS X If you are working with large projects on OS X and Aligner runs out of memory you can try to increase the memory Aligner can use using this panel Changing the memory requires that CodonCode Aligner restarts Therefore you can not change th
111. CA TGGGTCAAGC 1001 TCCCATGGGCHITTAAAAATTG EXHI 766 GAGCCCGAGG CAGGCAGATC ATGAGGTCAG 1051 1101 GAGATCGAGA CCAGCCTGGC CAACGTGGTG AAACCCCATC TCTACTAAAA Contigl 345 bases 722 1066 of 1660 Quality 90 i The selection also works the other way round When you select some bases in the base view trace view or contig view they will be highlighted blue in the single and multi line map Restriction Enzymes in Aligner The restriction enzymes used in Aligner are read in from a file This file is a text file called rebase_bairoch txt and is located in the folder Aligner Data in the CodonCode Aligner folder The enzymes in this file are listed in a certain format compatible with known formats such as the ones from EMBL PROSITE and SWISS PROT The file was obtained from REBASE RestrictionEnzyme dataBASE http rebase neb com The rebase file used is the file in rebase format 19 also called Bairoch format The current file and a help file describing its structure can be downloaded from http rebase neb com rebase rebase f19 html Aligner uses only the type II restriction enzymes that have known recognition sites from this file You can edit or update the file used by Aligner However if you decide to modify the file it is a good idea to first make a copy of it This way you have a working enzyme file in case something unexpected happens when editing the file You can open and edit the file with a text editor When the
112. Code Aligner will automatically try to use as much memory as needed up to the amount of available physical memory However on 32 bit versions of Windows or when running 32 bit versions of CodonCode Aligner on 64 bit Windows the maximum amount of memory is limited to 1 4 GB On Mac OS X the maximum memory available to CodonCode Aligner is initially limited to 512 MB This is sufficient for projects with several hundred reads You can increase the memory available to Aligner using the memory preferences and may need to do so if working with large projects Please note that the memory available to Aligner should not exceed the amount of installed memory RAM on your computer if you try to assign more memory CodonCode Aligner may not start or behave erratically On 64 bit capable Macs Intel Core 2 Duo processor or better OS X 10 5 or newer the amount of memory that you can assign to CodonCode Aligner is limited only by the amount of built in RAM On 32 bit Macs for example PowerMac G4 G5 the amount of RAM that you can assign is limited to about 1 4 GB even if the computer has more RAM installed If you are working on a computer with a limited amount of RAM you may get better performance by quitting other open applications and by reducing the amount of memory available to CodonCode Aligner You can always check how much memory CodonCode Aligner is currently using in the memory preferences How Aligner memory on Windows is set On
113. CodonCode Aligner User Manual CodonCode Aligner User Manual Table of Contents About Codont ode Agnete Prnt aeea E ERE MY X YR EEUU REFER DORAR CUN RE EEVAMERCH EEEIEE A 1 System RequiFGIDIEBDS oe poorer eniran rra ERUD EHE N E UEM ve N A OFE CHE LEER PEE HERR EFEPA ERIS UR RUFEN NER IA 1 UB sce AMEE ERIA OAA Tc RT AE A E IATA 1 Licenses for CodontCode ABE sd cocoa WERE HOREEHbDR WR CEU FERREA FUE rh lad E KI Ded 3 Ro E ram saec bacews bas coeet naan pala dooeg ta vaase ane tde Mace eae caebatavoeiaraaeamenen 3 CodonCode Aligner QE EI lt 7 Alnet Wimdouwsand Vier iss ood Godd ro ORO D r niis made pu abad aU S do re a The Main VTA cn wcosasrs ET EQ PERI peeves ell a a otro rib RR UR c AH T Pioject Wy IU uae es odi E SR EERHA SORORE eaa aa aaa E A a OEE Ai iNi 8 Bice Vie WON ire ui CU arises asa ES ee Reet 8 ANE EEE ERR Mm ERRASSE PURPOSE 9 MTV Aen Ve BOE cose respete tcn re a nU Rear bp da p o PEL UFU Efe 10 Contis View Window id icectotepdearedeckb eg nied Gants ed ak beca pede Rpbo dee E AS uae EK TAa ded beds 10 Restriction Map Window oic EE RUE E PER nee es ea ee TRA VER Ln WIS LOTTE MA ie POULDJIES oio s Gto eO M TUO NOT SoA ed UE RE RE REGOLE ORO SS 12 RG SIONS i ME a eoisod ton plc Se RRERU DI FURORE EHE ca atthe Sele alate pa bb a PARI ges GU RE DUO QUE EY puma Seed DU I2 Toke the Quick Tone nisi casto EUH ER o ere tb iem Bia diui ua EN en E dd RERO UA UR 13 Usage Tips for CodonCode ATlgBer uere etnies toad eae ed lop
114. E trial of CodonCode Aligner Congratulations As a new CodonCode Aligner user you are entitled to a free trial You will be able to use all functions of CodonCode Aligner for a limited time on After 30 days the program will automatically revert to Demo mode In Demo mode CodonCode Aligner is a fully functional trace editor you can also open and view existing projects If you already have a license for CodonCode Aligner please use the Enter license or Use License Server button Use License Server Enterlicense If you click the Use License Server button Aligner will attempt to locate a License Server for CodonCode Aligner on your local network If a License Server is found and a license is available it will be checked out and you can start using CodonCode Aligner The license key will be returned so that someone else can use it when you quit CodonCode Aligner If CodonCode Aligner cannot find a License Server the following dialog will be displayed Enter License Server Aligner was unable to find a License Server You may enter the name or IP address of the server to use Name or IP address of License Server Cancel Use Server If you know the computer name or the IP address for the license server computer you can enter it here if you do not know the name or IP address ask your local system administrator Firewall ports for License Server use If Aligner cannot conne
115. KE EO EEEVEE UE EM EUR PEL M HP IE 89 H w Wo Bind S NES oic porro E Ec ER ERE anemones REA EA Te OEE 89 FAXIDE EETOER pocos oc das eo nera ebat bet vd lee cut p tala seine waves tear eo pu e paa Pepsi T 92 LIEPCRUOSSNDIIPAUENISIERTE T D 0 7 70 01 0 LL 93 Defining the Coding Repone rct ERE RIP ER DUREE SENE CUR ERE EXT IE LCD BERE TAPER D VET 93 Numbermg the Codin SSquetiee sou ie tO OD MS UD Ua cae E 95 Excluding Regions from Xudlyelsg iiueLeue co nares racer aitaka 97 How Aligner Finds SNP ite ERE SERRHISUN E RF Aa TTE EE ER AAEE aAa 98 JETUE e PA AE EE A E A E P E EAE E E E A a eee mean 98 Heterozygous Insertions and Deke tins oer innen ene GR E R cobeaveessbansnesutieessseenesecsvaee 100 Binding Heterozygous Tnd ls o celo pcdedo T erred a per Eden ie Hatte e 101 Hetero endsl CONES o oso eet RH SEHR IER EE OI te E crea p tM ee a PT NERIS 102 False Wee aul es ccce EU E E A ae M M OE M OM UE 102 Pake OIM ASTE TURNER NER 103 Splitting Heterozygous Indels 5 iii ec riter HEU LII HERR I dE E AGER ERRARE EXE AEN ERR E UERS 103 Processing Heterozygous Indels o iar ERE XH PEE EIER RE ERBEN UEEFEERNT CHRIS EVE EREVR TURIS AARU 103 LET NSQNE 106 Processing Pre Requisites and titans as osse sees terere ke risen ia ro or enira pls v E ee 106 Lnierprctme Results boob tin rr bees bibi ded de DUE epe Flame abo e bei t eU Pb A 106 A cknowledeements rioria n ELE aint anaes N 107 Methylation A AY S95 E c 108 PETS ISS dienten EE MH iae Hd o
116. License Server Preferences suescsnse rx FER Feo IER FERE RENE EREXREE NR FERPER EUER FAR CREE FER YUAN RE EUFAN FERRE EP jiii A E kHPxN EE RE 259 Memory Preferences coin ia eee ci e i UE c Map E p M s ERE e cU iu Ese E teUE 261 Menor ONE ACRIOR NER ssc esee ofc P a a e Rv tates exe ee muda rdc n Er i repa Pn Fei Fed 261 Chanring memory on OS X ORE iaa E SEES 262 Mutation Detection Preferences cscs cciscusscicsesscadanahek PA URRI ES ER UrE GENERE ERU e au E E KERES EnS CONEA EEEE RAKENNE Akia 263 Ste CLOT senei D Loco castae ELE nESE a ee eT 263 Tp TEED IIS cassis cessed OO S STOLE TOES 264 Finding only homo 7y Sous Talons sssrinin S Ce PEE ERIEUI DER P ORATE REEE QUEE E CERE PUEDE PNE RE 265 PP CLA CIENTO OS LU Eme 265 Open amp Save Preferences sssini a an ia XH AEN ES E VENE eX EAI Ea OnE E aAa Ees Saaai aiar aE iih 266 Phrap Assembly Preferen Ges iiioisicssiscssccischscaientsontseusiavcand sda ceedsvedasposasbessscnnsnesntounbcnc URS SOHO RU aee ERES PENNE HRS ERR ERU 268 Preference pi iis socer tarte rmee ere pPEE Ten UE Eia EVEEXENEXFEENN SUED EUN EE Ie E UE VERRE EEN MERE RVENNE EU EKEEE KE VEFE KC VENE 270 Printing Prelerentes ioci prn eU RECO REFERO E EORR EORDURE EO RE Eod RUE KEV iene ae 272 Trace View FONS TE TEES 2T73 Contre View IPEIIUITIS uu igiene epa et D oo HI bees bb pda peteqi c dau ae pPH SERE em up p EH Pe itd is 273 Protein Translation Preferences iiss ccsscsnscicseescaauassdcavined ios aan ev dn paci v bap Urbes x E S dM Lor OX
117. MEE 146 Removing Samples Trom Consi cente bU ptus Urge cHr pe ENSE E CRAS PO a ue Maa Md RU UE e INS MU reed pao eUPN posu TU ve RUE 147 Deleting WOucE RT mM 148 Removing Consensus Gaps e docs ooo se Rte pe PAY r REEL IN EET RNISE pO e r E Sepe mE P Vra RE HU EUR 149 How to iemove ColseriSus PAPE eo co ee NO Por ENEE COR Ee ERG ORS eee 149 Aligument Locations Start and End siririna VERE EE aer iren E CE ELE E REEF ERE 151 Reverse Complementing ELO oom 152 MMHDUPAOIUI TETTE TT 153 Unasseambling Contigs satii M 155 Roundtrip Editing e N A 156 How To Roundtrip Edit with CodonCode Ahgner oi cicero re iii 156 ETETE OIT AE Sm EN NE SNE AE 157 Editing Contig Inforinabion suecrirerannrs ranees e SECO SEXE HQ RXTEEIIIE r a ar EAE E ESNEA AEEA 158 Search Tor S quelie s osscectiib lu cR E aE DUE EEEE EAE E e 159 BLAST Searches ck iin aaa ainda ae ee ee es 160 Mesa BLAS Earra r n iene iin nea enti ee eh Ae 160 Nuc Dieta pete BS season ob d an ches ER US Por e a RO NEGO Kei RF AS IUE c eee E CU 160 Translated 4 DIRE o ove ser D e 160 vi CodonCode Aligner User Manual Table of Contents BLAST Searches Translated BASRE oiii sas EDI ERR ERE a ER EXER REEF Id te EIER saan eee 160 POU EID eee M S 161 Export Project Sumidty coop S FURENT EE FERRE a eo eee 162 Exp r up Samni aee atu vei oReto ER Re utes MIS MUS editus tU eeis etse M EP DEI IDE CM E 16
118. Maximum Gap Size The bandwidth parameter allows you to set the half width of the diagonal used during the banded alignment This has an effect on the maximum size of gaps insertions or deletions in one sample that can still be aligned A bit simplified if one sample has an insertion or deletion that is larger than the bandwidth number the alignment will typically stop at the insertion deletion and the rest of the sample will be unaligned If the insertion or deletion is shorter than the bandwidth the alignment will continue after introducing the necessary number of gaps in one sequence as long as the aligned parts after the gaps are long enough the aligned regions before and after the gaps must be at least 1 and 1 2 times as long as the number of gaps and longer for any mismatches or ambiguities The discussion above is a bit simplified in reality what counts is the total number of gaps in one sequence minus the total number of gaps in the other sequence at any position since the alignment uses a banded Needleman Wunsch algorithm The bandwidth parameter has an impact on the assembly speed larger values mean slower assemblies For large projects you may want to reduce the bandwidth value for projects where you know that you have larger insertions and deletions you may want to increase it Note however that increasing the bandwidth will Maximum Unaligned End Overlap 232 CodonCode Aligner User Manual typically not be enou
119. Name or Organization Cancel Paste License Apply Enter the license string you received from CodonCode Corporation into the License String field preferably by using copy and paste use the Paste License button or the keyboard shortcut for pasting in Aligner Command V on OS X or Control V on Windows Then click the Apply button Licenses are bound to a single computer ID If you try to install CodonCode Aligner on different computers and use the license there the license will not be valid A single user license allows you to install Aligner on one computer If you plan to use your license on one of several computers you need a License Server License Using Phred and Phrap from CodonCode Aligner CodonCode Aligner allows you to use the base calling program Phred and the assembly program Phrap to base call and assemble your sequence data Phred and Phrap are separate programs and distributed by CodonCode Corporation through a distribution agreement with the University of Washington Users at academic and non profit institutions may use Phred and Phrap free of charge users at for profit institutions have to purchase separate licenses for Phred and Phrap When installing CodonCode Aligner special workstation versions of Phred and Phrap are also installed These workstation versions are identical to the regular Phred Phrap versions except that e the workstation versions of Phred and Phrap can only be run from CodonCode
120. PA UE RAKKE 275 Segueice PAIS IALION NT E D DTE 2175 Consens EE RIDERE ER 276 Restriction Map Preferences seia ca daitans UO d cec cei KU ER KE ead oa EO RE REC E DURER YR EE Reds 278 bevel Fore ETE ETE Oe eee reine Ce UE ch Ea QUI Con p o N eR tear Ped ass mere eee He ER E een Rada 278 Restriction Map Gps ccs cciccstoansoeiartseei ERE oa tes stao cae nae EE HGB eee ee M Eb UEBER Eds 280 Startup Preferenpes eene tenti eee eae edad eed ene le ee ee ee 288 PA Wie es ed A BI os A OA ENE baden apna nos ped vei rd ORE E Hd T 288 Foolbar Preteen 68 TE E DO S DICTOS 290 Vector Trimming Preferences ra H RBS A IL x EARUM NUM NU D FI M M MI MM E MM AM IE 292 View Preferente E E Qo S o LT 294 Warning PEeIeEentees co on bon mtd Seas an MM np 296 Window Placement P eferenbes usos coa e push eet pe eio NR R 297 CodonCode Aligner User Manual Table of Contents CodonCode Aligner Help by Ment ise coiere rrprtin Ee REX EXE DIR AER IEEE E EXERERRPXR MERE FERE EKANA E ERN EXTAT HEEEDM PERRO FPRRS MEHR 299 Aligner Menu on Mac OS X only uiui debr nienn ENEAN ANAAO EN EXE EAR NS EREL LEE NEUE UAE ORES 299 Ee VIG BE oso tei pub ERR TRO Fetal PROPER V RU rep TERA REY RYE E T Po Pb PR RE Ee DS 299 Tee NEED e ssp caspase E T ERE peta es EA I E S ed ees ob EYE ODER FUR DR Phi fa D rd 299 ETD Ean EE E E T UU E E T E E E cT NE 300 Sample Mei E 300 Coni MeN eraa a E TA S ree 301 Too M e RURSUS 302 Vica Moien i RI t ia eicit eiie E LI IM 302 RV NUIT 303
121. R HAS FERES RES DIR Eo ed da 203 Masking Bases Matching the Consenslls ooec eco tror tbe net eret eoo eerie SERVER EM E E IPIE b tS 204 2 Given Tin ca OS uc E Cc 205 Sorting Reads inthe CODES VEN cy cavae eto b E rtl eor mere v EF RR M px e mie eni 207 Autormsac PEACE CISC ION aic seznam tact a mid ken e c e eco as 208 Printing Gongs ie nena ian dienes eae ini aa ieee ie 208 Feature WIDIOW cisese seciessscciitsncaiionssccssessccesewsacsasesseesiescucsenas sssebennadesssaadassennatesenuecseesussseessuacetsuuacereourantesiemeies 210 X 34D Map ASIE 212 SHOTS Ene NISI out rH RR EU HRRI EA AREE HERI exa AA aad rers f plas Ehre ER E 212 DU HE BITES OUEST ENT 212 EK dun ELE 213 MARCIE Ee A I SU T ep eee 214 Selstbis Mea A ie a Rd ei a i NEMO ai as i d pe ME 215 Restriction Enzyines ati Uline uoc soos pee ba seen aie eel pl ihe ee eR paea melas 217 Closing VV IRS oi OL I o S e 218 Scripting udontode ATIQiek ede Eres Meteo e E IM i M EE EE I EE E I EM E E MUME 219 Pr f rences and Seb gs oe ciet eoe PESE RRMEL S eo I f o cIE A ARE RUE 223 CodonCode Aligner User Manual Table of Contents Alignment Preferences Base Color Preferences cid vo pr E RD ERE RI EVE iU a DoD NER UD RE PEFPN MR EURKRERE RAO 237 Swtehitis colt scheme g uis casser tr rrr inea Ver lee ra rd be n c o LER bei VR aq 238 Oualitvbased 3 color SCBeImie c ai be ete obe ette pedi pedet ee xb olde ie ea ee dam te pipa tA x pheRd ds 238 Continuous quality based backg
122. S Fr 1G 1T 1C 1A 1C 1A 1G 1C 1G 2C 1A Summary l1C lC IT lT lA lT 1C 1 1 1G 1G 2T 2C 2G 2G 1A 2G 2G 2T 1A 1G 1A 1A 24 1 1G 1N 1T 1 1IT 1T 1 1N IT 1G 1 ICTCCCCACATGCCAGGCACCAATABMITGGTAAATGCAGCCGGCACACTCTTA lt lt A819 r CTCCCCACATGCCAGGCACCAATAMPTGGTAAATGCAGCCGGCACACTCTTA A 910 980 990 Y 10096 Navigating using the difference table You can click in the difference table to move the cursor for example to examine a specific difference The corresponding read will be selected and the selected read and base will be shown in the lower aligned bases panel If you click in the top row the corresponding consensus base will be selected which will also select all bases in all samples at this position see picture above Aligned Bases and Consensus Protein Translation The lower half of the contig view shows the aligned bases for the samples in a contig It can also show the protein translation of the consensus sequence depending on how your preferences are set You can choose to show no translation one frame three frames six frames or the translation for an annotated coding region in the protein translation preferences and in the View menu The cursor position is indicated by a black line and the currently selected base or bases by a different background color in the example above by black background You can use the the cursor keys and the ho
123. Second Peaks Higher Than 129 CodonCode Aligner User Manual Use the radio buttons to choose how you want to change bases see below You can also choose whether or not you want to see a dialog summarizing the changes CodonCode Aligner will add tags to all auto edited bases You can undo all changes right after you made them or later with the Undo auto edits selection in this dialog Change Bases Options 130 Deleting Bases Using the Keyboard to Delete Bases Backspace Key Deletes the currently selected base or bases then for sequences in contigs the bases to the left of the cursor are shifted to the right Delete Key Deletes the currently selected base or bases then for sequences in contigs the bases to the right of the cursor are shifted to the left Note If the consensus is selected Delete or Backspace deletes not only the base s in the consensus but bases at that position in all samples having sequence at that position OS X Users On Macintosh keyboards the Backspace key is actually labeled delete not Backspace It is part of the main key group The Delete key is labeled del above an X in a box and usually is part of a small group of keys that include the page up and page down keys Menus for Deleting Bases Instead of using the keyboard shortcuts for deleting bases you can also go to the Sample menu select the Delete submenu and then choose one of the following items Selection Fill
124. Windows CodonCode Aligner will automatically try to use as much memory as needed The memory available to CodonCode Aligner will be limited by how much physical memory RAM is installed how much memory is used by other open applications on 32 bit versions of Windows by limitations of the operating system On 32 bit versions of Windows the maximum amount of memory that CodonCode Aligner can use is 1 4 GB the 1 4 GB limitatio also applies when running 32 bit versions of CodonCode Aligner on 64 bit Windows On 64 bit Windows CodonCode Aligner 4 2 and newer can use up to the total amount of available physical memory installed on the computer Other running applications will also require some memory which may limit the memory available to CodonCode Aligner Running other applications can also lead to paging where contents of the memory have to be written to and or read from the hard disk this can slow all applications down dramatically If this happens closing other open applications or installing more memory may help Memory Requirements 304 CodonCode Aligner User Manual How Aligner memory on Mac OS X is set On OS X the maximum memory is set in the file Info plist which is inside the CodonCode Aligner package When you change the memory settings for CodonCode Aligner in the memory preferences Aligner will edit this file and then restart itself so that the new memory settings take effect Please always use the memory preferen
125. a contig 1 Select a contig base in the contig view 2 Go to the Contig menu 3 Go to the Delete submenu 4 Select From Contig Start to delete all bases to the start of the contig or select To Contig End to delete all bases to the end of the contig If any samples are completely within the removed contig region these samples will be moved to the trash If the menu items are disabled you probably do not have a contig base selected You may have clicked on a sample accidentally or perhaps a view other than the contig view is in the foreground Note Deleting from the contig start or to the contig end cannot be undone so you may want to save your project first or to save a copy of your project using Save As in the File menu Deleting Parts of Contigs 148 Removing Consensus Gaps Gaps in the consensus sequence are caused by insertions in reads which are often due to random sequencing errors Often consensus gaps can be simply ignored but at other times it is desirable to remove consenus gaps Manual removal of consensus gaps is always possible select the gap in the consensus sequence and press the delete key but can be impractical for larger projects CodonCode Aligner provides a functions to automatically remove most consensus gaps by editing all aligned samples at consensus gap positions Since this will remove bases in the samples that caused the gap there are safeguards based on coverage and sequence quality
126. a license key for a time limited trial as explained in the next section Time limited Trials The first time you use CodonCode Aligner you will automatically receive a time limited trial that enables you to use all functions for 30 days After the initial trial expires Aligner will revert to Demo mode You will still be able to open any existing projects you may have but your ability to save or print will be limited as described above If you need additional time to evaluate CodonCode Aligner please contact us by email to support at codoncode com We will need to have your name and email address to send you a trial license note that the email address cannot be an anonymous email address like xx 9 yahoo com Licenses for CodonCode Aligner 3 CodonCode Aligner User Manual Single user Licenses Single user license keys that you purchased from CodonCode Corporation allow the use of CodonCode Aligner on a single computer To enter a single user license key that you received from CodonCode start Aligner and press the Enter License button in the startup dialog If Aligner is already running select License from the Help menu and then press the Enter New License button This will display the Enter New License dialog eoe Enter New License CodonCode Aigne F Enter New License License String
127. acement Description The warnings preferences let you control which warning messages you will see Cte The upper section affects most warnings that Aligner can show For new users we suggest that you display all warning dialogs as shown above Once you are familiar with Aligner you can choose to see only the more severe error messages and warning dialogs by selecting the checkbox in the second row If you really know what you are doing and do not want to see any warning dialogs select the checkbox in the third row In the lower section you can choose if Aligner should warn you before opening many windows for example because you accidentally double clicked on the Unassembled Reads folder which contains many samples You can also set the treshold for how many windows can be opened before Aligner shows a warning Please note that the warning dialog will not be shown if you turned off all warnings in the Warnings preferences Some warning dialogs also allow you to turn off the optional warnings which has the same effect as selecting Only severe warnings and errors Some dialogs can be turned off individually while others affect all optional warnings Warning Preferences 296 Window Placement Preferences You can control how windows are arranged in CodonCode Aligner in the window placement preferences Preferences Window placement r Contig view Base calling g Base colors Mi Place new Contig v
128. al processing by the ABI sequence analysis software In general traces created with old ABI sequencing chemistries e g POP6 or dye primer data or with non ABI sequencing machines cannot be analyzed If you have data were the stretching did not work properly but none of the above factors applies please contact CodonCode s support team Methylation Analysis Algorithm Viewing Raw Trace Data 110 CodonCode Aligner User Manual To calculate methylation CodonCode Aligner examines peaks near the base positions where the reference sequence contains Cs or Gs if the reference sequence was reverse complemented To limit the analysis to only CG sites it is important to convert other Cs in the reference sequence to Ts as decribed in the step by step instructions above Please note that any errors in the base calling or the alignment may lead to errors in the estimated methylation ratios To minimize errors from low data quality CodonCode Aligner will try to identify poor quality regions at the start and end of sequences such regions will be marked with a low quality tag and ignored in methylation analysis The first step in methylation analysis is to clip and horizontally stretch the raw traces so that peak positions roughly match the positions in the processed traces This step is computing intensive and may require several seconds per sample Next CodonCode Aligner looks for the maximum peaks intensities in the C and T lanes or G and A lan
129. alling is not enabled in demo mode Additional information about base calling can be found at the Base calling help page Please note that one important difference to the normal Call bases menu choice in automated pre processing samples that already have quality values for example from the ABI KB basecaller or from calling bases on the sample before will not be base called again e Find heterozygous indels This option will look for potential heterozygous insertion deletion indel mutations in the unassembled samples that have a chromatograms and b quality scores If you are sequencing PCR products from genomic DNA that may contain heterozygous indels you should check this option if you are sequencing from cloned DNA this option should not be checked For more information please read the Heterozygous insertions and deletions help page Align with Preprocessing 70 CodonCode Aligner User Manual Clip ends This will remove low quality sequence from samples that have chromatograms and quality scores For more information please read the End clipping help page Trim vector When checked this option will identify and remove vector sequence contamination from the samples in your selection You may need to set your vector trimming preferences before using this option For additional information please read the Vector trimming help page You will see progress dialogs for each of the steps performed after you click
130. anel moves indicating that a different part of the contig is shown but the blue line for the cursor position does not change until you also click on a base in the aligned base panel Using the keyboard you can move around as follows Move around with the right and left arrow keys you move one base at a time Press the page up and page down keys a few times this moves you by a full screen forward or backwards e Try the home and end keys they move you to the beginning respectively end of the selected sequence If the consensus sequence is selected you go to the beginning and end of the contig if you select a read you move to the beginning or end of the read If you have a mouse with a scroll wheel you can also use the scroll wheel to move around in a contig Moving the scroll down will move forward in a contig moving up will move backwards If you have a contig with many reads in it then pressing the control key while scrolling with the mouse wheel will move the read list Moving Around 191 CodonCode Aligner User Manual up and down Contig Overview Panel Some things worth noting for the graphical overview of the contig the overview panel in the upper half of the contig view e The zoom scale at the top right corner allows zooming in and out The box below shows which region of the contig is currently displayed in the coverage and arrows panels below e The coverage graph shows the coverage at each positi
131. ange is the space from the calculated position of the 3 end to both sides in which Primer3 picks the best primer The distance between the first primer and the target Lead defines the space from the 3 end of the primer to the point were the trace signals are readable Conditions amp Advanced Settings Parameters The conditions section allows you to set a mispriming library the reaction concentrations and the formulas used to calculate the metling temperature and the salt correction PCR Parameters 114 CodonCode Aligner User Manual Conditions Mispriming Repeat Library None H4 Concentrations Monovalent salt 50 mM Divalent salt 1 5 mM Annealing primer 50 lnm dNTPs 0 6 lmm SantaLucia 1998 Melting temperature formula Salt correction formula SantaLucia 1998 EZ Mispriming repeat libraries are files that contain sequences that the primers should not bind to These files are located in the folder CodonCode Aligner HelperPrograms Primer3 Libraries If you add libraries please note that the library file must be in FASTA format where each sequence entry must begin with an id line that starts with gt The contents of the id line is slightly restricted in that it should not contain any asterisk Cr The formulas for melting temperature and salt correction can also be set in the Conditions section The recommended formulas by Primer3 for tm and salt correction is SantaLu
132. antly The number of cores you can choose is limited to the number of cores that your computer has The second option allows you to keep the index files that Bowtie2 creates from your reference sequence If selected a new folder with the name of your reference sequence will be created in a folder called Index which in turn is inside the bowtie2 folder in the CodonCode folder in your Documents folder Keeping index files for future use can be especially useful when working with large reference sequences where the Alignments with Bowtie 2 76 CodonCode Aligner User Manual index file creation may take a long time Existing index files will be listed in the top section Existing Bowtie2 index the next time you start a Bowtie2 alignment from CodonCode Aligner It the Keep the index file option is not check any newly created index files will be deleted after the Bowtie2 alignment is complete The third option lets you choose to keep the alignment result file the sam file that Bowtie2 produces If this checkbox 1s checked the file fill be stored in a folder called Results which in turn is inside the bowtie2 folder in the CodonCode folder in your Documents folder If this checkbox is not selected the file will be deleted after CodonCode Aligner imported it However if CodonCode Aligner cannot import the result file for example because of insufficient memory you will be asked if you want to keep this file The additional o
133. aps The large gap algorithm can also be useful when analyzing samples with large insertions or deletions End to end alignment When this algorithm is used alignments always include the entire sequences this method is the default algorithm in other programs for example Sequencher When using this algorithm it is important that samples have been end clipped and vector trimmed This is the default algorithm for CodonCode Aligner version 2 0 1 and newer However if you used older versions of CodonCode Aligner before you may need to manually select this algorithm to use it Minimum Percent Identity This is the minimum percentage of identical bases in the aligned region The default parameter of 80 is relatively relaxed you may want to use a more stringent setting for your projects especially if you did use end clipping before the alignment Be careful about setting this value to the 100 only samples that fully agree with the reference sequence will be aligned samples with even a single discrepancy will not be aligned Minimum Overlap Length This is the minimum length of the aligned region If the aligned region is shorter than the value you set here with 30 being the default alignments will be rejected and samples will remain in the Unassembled Samples folder Minimum Alignment Score This parameter is similar to the Minimum Overlap Length but it takes discrepancies into account Scores will be scaled so that a match give
134. ar If you want to see toolbars in some views but not in other views you can simply use the Select None button to de select all buttons for the views where you do not want to see the toolbars Toolbar Preferences 290 CodonCode Aligner User Manual You can also customize your toolbars directly through the toolbar popup menus in each view Toolbar Preferences 291 Vector Trimming Preferences In the vector trimming preferences you specify which vector sequences Aligner screens against and what the minimum criteria for a vector match are e608 Preferences Alignment r Vector trimming Assembly r Vector Library Base calling Base colors I UniVec Consensus method O UniVec Core Double clicking __ lt lt lt OVO End clipping From File Jigner Data Vector CustomVectors txt Features Select vector sequences to screen against Highlighting BlueScribe cloning vector E License Server BlueScribe M13 Plus cloninc M1 ue BlueScribe M13 Minus ning vector SYNBLM131 a BlueScribe KS Minus cloning vector SYNBLKSMV v Open amp save Phrap assembly Preference options Search Criteria Printing npn TT Protein translation Minimum identity 80 Sample names Min overlap length 20 Minimum score 10 Startup Max distance from start 40 Max distance to end 100 Vector trimming Views r After Vector Trimming oe vi Move sequences shorter than 50 ba
135. ary If you need further assistance please contact us Exporting Differences 177 Exporting Trees If your contigs have phylogenetic trees you can export the trees in Newick format you can build phylogenetic trees for contigs and contigs of contigs with the Built Tree menu item in the Contig menu To export phylogenetic trees Go to the project view e Select the contigs you want to export use shift click to make continous selections and control click OS X command click to make discontinuous selections Choose Export gt Trees in the File menu If none of your selected contigs have phylogenetic trees you will not be able to export trees To export trees at least one of your selected contigs has to have a tree which can be built using Build Tree from the Contig menu If you have any trees in your project and choose to export them you will see the following dialog AOO Export Trees What to export O Current selection Entire project Format Newick Hd C Export Cancel A Use the radio button at the top to select whether you want to export only the selected contig s or all contigs in your project The file format used for exporting trees is Newick format When you click on the Export button Aligner will show you a Save As dialog where you can select the location of the exported file The exported file has the extension nwk for Newick and can be opened in tree visualization
136. ased on 454 MID tags You can define the meaning of different parts of the sample names by pressing the Define name parts button Any pre existing contigs in your selection will be unassembled first Using the radio buttons at the top select to assemble in groups by name part or by multiplex sequence tag Assemble in groups by name part You may want to use this option if you need to assemble contigs from a number of different sources for example species patients isolates and so on To assemble in groups by name part 1 Select the samples you want to assemble in the project view you can also include contigs which will be unassembled before building new contigs 2 Go to the Contig menu move to Advanced Assembly and select Assemble in Groups 3 Click the Define name parts button to define how sample names should be interpreted 4 Select the name part to assemble by in the pulldown menu at the top 5 Click the Assemble button You will see a progress dialog while CodonCode Aligner assembles separate contigs for each sample group in your selection You can also automatically pre process unassembled samples before the assembly in the Preprocess tab as described above To use assemble in groups by name part your samples must be named consistently Typically different parts of the name are separated by characters like underscores or periods Let us look at an example sample name EGFR exon
137. ation for these three bases Switching color schemes A quick way to switch between color schemes is to go to the View menu choose Sequence Colors and select the color scheme you want to use Another fast option is to use the toolbar button E Colors Pressing this button will switch between the different color schemes in the following order 1 Quality based 3 color scheme 2 Quality based continuous scheme 3 Base specific colors 4 Protein translation based background colors Then the circle starts over again after translation based background colors comes the quality base 3 color scheme again If the ttolbar button is not showing you can change the toolbar settings in the Toolbar Preferences The View menu and the corresponding toolbar icon provide a fast way to switch between the color schemes For full control for example to change colors or threshold use the Base Color preferences Quality based 3 color scheme The picture above shows the settings for the 3 color scheme In this scheme the background behind the bases is shown in different colors for low quality bases medium quality bases and High quality bases You can set the ranges for low and high quality bases with medium quality being the range in between by changing the numbers in the text boxes The most commonly used numbers are 0 to 19 for low quality and 20 29 for medium quality and 30 and higher for high quality You can also assign backgroun
138. bels on the branches By clicking on the Build Tree button in the dialog above you will generate a tree for the currently selected contig The calculated Neighbor Joining tree is then displayed in the contig view as shown in the example below e o CtgComparison e H d Di 4 pM e 7 Print Reverse Build Tree View Traces Colors Bases lt gt Transl MaskMatches Help Show overview Change size Exclude Position 22 23 24 25 26 42 45 53 56 69 103 121 122 123 124 147 148 149 155 156 183 Consensus A A GIC Cm AXE LS Vice Poe ol eee ee a cd de GD GGE IM EIEE FYC JRR UM DGO AXE e NO ZT MEM 7 7 7 8 6C 6T 9C 7CJ6C 7A 6 6 6 6 9G 7T 9T 8C 6G 6G 70 4A 4C IT 3T 4T 3G 4A 4T 4T 4A 1 2C 1 2T 4T 4 l EXIES BAR gart 6A 6A 6G 4 4 4 Summary ATTTGGGGAA ATTTGGGGAA ATTTGGGGAA ATTTGGGGAA ATTTGGGGAA ATTTGGGGAA ATTTGGGGAA ATTTGGGGAA ATTTGGGGAA ATTTGGGGAA 0 01474 0 00667 0 0 00579 ATTTGGGGAA _ Topology only m Label branches The part of the contig view that is showing the tree can be resized by pressing and holding down the left mouse buttonon top of the gray bar on the right side of the tree and then dragging the mouse to the left or right By clicking on the check boxes below the tree you
139. bstantially lower Indel scores are somewhat similar to Phred quality scores however unlike Phred quality scores indel scores are not accurately linked to error probabilities False Negatives The indel finding algorithm may sometimes miss real mutations especially if they are very close to the start or end of a sequence or if the sequence before the indel is of low quality In this case you can add a heterozygoteIndel tag by hand as follows n a trace view window select the base where the heterozygous indel starts for example base 175 in the heterozygous indel sample in the example project Bring up the popup menu by right clicking on this base on Windows or Control clicking on OS X e Select Add Tag from the popup menu This will open a new Add Tag dialog e n the Add Tag dialog select heterozygoteIndel as the tag type from the pull down menu at the top You can also enter 9999 in the End text field if you would like the tag to cover the entire rest of the sample instead of just one base Then click OK Hetero Indel Scores 102 CodonCode Aligner User Manual You should now see the tag displayed in the trace view for this sample unless you changed your highlighting preferences to not show tags False Positives Occasionally the indel finding may incorrectly identify artifacts in sequencing traces as heterozygous indels This can happen when the sequence quality suddenly drops dramatically in a se
140. ce dialog The list of tags in the tag selection dialogs may not show all the tags that are used in your projects To use any tags that are not listed make sure the All unlisted tags checkbox is selected Specifying subsets of tags 256 Highlighting Preferences You can select how Aligner highlights discrepancies ambiguities edited bases and tags in the highlighting preferences Preferences Base calling Base colors Consensus method Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Window placement Highlighting Select which items you want to highlight how Discrepancies base color Jj Ambiguities base color F Edited Bases underline 1 Tags box r Dimming v Dim unaligned ends Description The highlighting preferences control the base highlighting By default Aligner will highlight discrepancies and ambiguities by using a different background or foreground color depending on the color scheme and settings edited bases by underlining the base call and tags by a colored box that covers the bottom of the base An example is shown below Highlighting Preferences 257 CodonCode Aligner User Manual 9 M E LLL 458 bp of 458 bp 2p 100 bp 200 bp 300 bp CACCCCTGTTCHBAAAAACAGCAATAGACT ctf PO O O CACCCCTGTTCAGAAAAACAGC
141. ces Text Map The text map for the same example displaying fragment sizes is shown below eoo Contig1 Hind on zu amp 6 Enzymes Options Virtual Gel Multi Line Map Single Line Map TextMap Print Restriction map for Contig1 1660 bases linear DNA Displaying fragment sizes in base pairs BstXI 1 594 1066 EcoRI 1 628 1032 Pstl 3 42 267 454 897 Xbal 1 655 1005 Non cutters Acc65l Apal BamHI Bsp68l Hincll Hindlll Kpnl Notl Pael Sacl Sall Smal Xhol Xmil Multi Line Map 213 CodonCode Aligner User Manual The text map displays the cut results for each enzyme seperately like the multi line map In the screen shot above you see the fragment sizes generated from the contig by each enzyme The restriction maps can be printed and the text map and the summary of each map can be copied using keyboard shortcuts To copy a restriction map select the part you want to copy and use the keyboard shortcut Apple C on OSX and Ctrl C on Windows to copy and the keyboard shortcut Apple V on OSX and Ctrl V on Windows to paste Virtual Gel The virtual gel for the same example but not showing non cutters looks like this 3 Ano Contigl Eco Hind ar mun zu amp Enzymes Options Virtual Gel Multi Line Map Single Line Map Text Map Print Restriction map for Contig 1 1660 bases linear DNA Displaying fragment sizes in base pairs wu E E g E a
142. ces to change the memory available to Aligner on OS X Please do not change the memory available to Aligner by editing the Info plist file directly if you make any mistakes Aligner may not be able to start or may behave erratically How Aligner memory on Mac OS X is set 305 CodonCode Aligner Release Notes The release notes for the current version of CodonCode Aligner can be found in a separate file called ReleaseNotes txt in the Aligner directory CodonCode Aligner Release Notes 306 Checking for Aligner Updates You can check if your version of CodonCode Aligner is current by selection Check for Updates in the Help menu Aligner will then check CodonCode s web site to see if your version is current therefore this requires that you have an active internet connection If you are not currently connected to the internet you will see an error message Unable to verify the current Aligner version The same message can also result from other problems for example if CodonCode s web site is down which hopefully will be rare When you start Aligner Aligner also automatically tries to check for updates Aligner will let you know if a newer version is available or if there are any problems during the update check If your version is current which should be the case most of the time you start Aligner you will not be notified Updates may be free or charge or they may require the payment of additional license fees depending o
143. cia 1998 Breslauer et al 1986 as formula for the melting temperature and Schildkraut and Lifson 1965 as formula for the salt correction are formulas that were used in older versions of Primer3 and allow backward compatibility The salt correction formula can also be calculated using the formula Owczarzy et 2004 as described in the paper Owczarzy R Moreira B G You Y Behlke M A and Walder J A 2008 The concentration settings are used to calculare the oligo and primer melting temperature during the reaction Advanced Settings Max 3 End Stability 9 g Max PolyX 5 B Max Self Compl Any Tm 47 B GC Clamp 0 B Max Self Compl End Tm 47 g Max N Bases 0 8 Max Hairpin Tm 47 g Max GC End 5 8 Max Library Mispriming 12 g The advanced settings section contains primer and primer pair characteristics Most are self explanatory Max PolyX is the maximum allowable length of a mononucleotide repeat e g AAAAA GC Clamp is the required number of consecutive Gs and Cs at the 3 end of a primer Max GC End is the maximum Conditions amp Advanced Settings Parameters 115 CodonCode Aligner User Manual number of Gs or Cs allowed in the last five 3 bases of a primer Max 3 End Stability is the maximum stability for the last five 3 bases of a primer bigger numbers mean more stable 3 ends Selecting the tab Pairs at the top of this section will show primer characteristics for p
144. cking on a row in the table will open the related contig view and or trace view depending on the current double clicking preferences Viewing Raw Trace Data When viewing sequence traces CodonCode Aligner will by default show the processed data that are the final result of the manufacturer s image processing software However the processing software tries to even out intensities between lanes among other things to make the data look pretty This can lead to strongly enhanced peaks in the missing lane C or G which therefore cannot be used to calculate methylation Therefore CodonCode Aligner used the raw ABI data for methylation analysis and provides options to How to Analyze Methylation 109 CodonCode Aligner User Manual view the raw trace data When viewing traces right clicking in the trace view will bring up a popup menu where you can choose what to view v Show processed ABI traces Show raw ABI traces stretched Show processed stretched raw traces Show original raw ABI traces Show sharpened ABI traces For analyzing methylation you should generally use the second option Show raw ABI traces stretched or the third option Show processed stretched raw traces The next section explains how CodonCode Aligner stretches raw traces In the trace view it is also possible to display the intensities of the traces by hovering with the mouse while pressing the shift key After a short delay CodonCode Al
145. colors preferences control the colors used for drawing traces If By nucleotide is selected bases are drawn the same color as their trace colored bases use the same background color as traces With the settings shown above bases with a quality of O will be shown on blue background and bases with qualities of 60 and higher on white background Bases in between will be shown on varying shades of blue with darker blues for lower qualities Continuous quality based background colors 240 51 101 151 201 251 301 eoe crcccrca CCTCCCACAT TCAAACTTGT Gtaccacaa GCGGATCTCT AGCACAGAGA CodonCode Aligner User Manual CCTT ATGCATAAAG AGTGGCCCTG GTGGTTTCAA GAliccTCTA CCTGGAGGAG A326 r CCAGAGCTTC PETCTCCTCA TCTAATTCTG TTTTATTGAT GGAACAACCT GATTTGTTGT GTCAGGTGCT AGGAGCCCH AGACCTTGTC ATCATAAATC GCAAACCTAA TTAAGGATGG GGGGAAAGAT TTCCTCAGCT TGTTACACTC TGGAGATTT AATTCTTGAA CCTGAAGGAG 351 401 451 501 551 Ww 601 a Y A326 r Base 201 of 612 Quality 13 4 Note that both quality based color schemes require samples that have Phred qualities or Phred like qualities Aligner will work best with sequences that have such qualities If you do not have qualities you can use the base specific color scheme Continuous quality based background colors 241 Base specific colors The third color scheme ignores sequence qualities and chooses the colors from the bases Yo
146. consensus sequence It requires that sequences have base specific quality scores for example from base calling with Phred which can be done directly from Aligner 2 Majority consensus The majority consensus simply counts all bases at a given position If one base or gap are more than 50 of all calls the base or gap is used as the consensus otherwise an ambiguity code for the bases present is used this description is a bit simplified more details below 3 Inclusive consensus The inclusive consensus considers all aligned bases at a given position and uses the IUPAC ambiguity code that represents all bases present at a given location 4 Percentage consensus The percentage consensus considers all bases at a given position that occur at least as often as the set percentage A base that occurs less often than the set percentage at a specific position is ignored when building the consensus 5 Using the reference sequence as the consensus For contigs that were created by aligning to a reference sequence rather than by assembling you can choose to have the reference sequence be used as the consensus sequence This can be useful in mutation detection and clone verification projects You can set which consensus method is used in the consensus preferences Quality based Consensus To determine the consensus base and quality score for assemblies where the samples have qualities CodonCode Aligner tries to emulate what human finishers
147. consensus sequence or the reference sequence in alignments can be Excluding Regions from Analysis 97 CodonCode Aligner User Manual useful to limit the analysis to a region of interest or to avoid regions where all sample traces have artifacts How to add tags is described above of course you need to choose dontGenotype as the tag type to exclude regions from analysis How Aligner Finds SNPs When searching for heterozygous point mutations CodonCode Aligner does the following 1 Each sequence is analyzed for low quality sequence at the start and at the end Regions that fall below the threshold set in the mutation detection preferences are marked with a dataNeeded tag and ignored in the subsequent analysis 2 Aligner looks for heterozygous insertion deletion tags heterozygoteIndel in each sequence and excludes regions identified as heterozygote indels Note that the tags need to extend to the start or to the end of the sample tags that do not extend to the start are assumed to go to the end This step is omitted if Look for heterozygous indels is deselected in the mutation detection preferences or when only looking for homoygous mutations 3 Aligner loops through all the consensus bases In all samples that have aligned bases at a given position Aligner examines the traces in each direction Aligner looks for both secondary peaks and for drops in intensity that indicate a heterozygous base For text samples that do
148. contigs you can specify where you want to look for your search sequence only in the currently selected sample s only in the consensus or in all sequences and the consensus Note You can repeat any search by choosing Search Again from the Go menu Search for Sequences 159 BLAST Searches To start a BLAST search from CodonCode Aligner e Select the sample or contig that you want to BLAST in the project view or select the bases you want to search in a contig view trace view or base view Go to the Go menu and select one of the options from the BLAST Search submenu Aligner will open web browser page for the NCBI BLAST server and paste the selected sequence into the Search field You can now change the search options or database to search against on this web page and start the BLAST search If your security settings are very strict so that Aligner is not allowed to open a browser page nothing may happen you will need to change the security settings first For all BLAST searches except MegaBLAST the selection must be a single sequence or part of a single sequence For MegaBLAST your selection can include more than one sequence MegaBLAST MegaBLAST is a BLAST version that has been optimized for aligning sequences that differ only slightly for example because of sequencing errors It can be up to 10 times faster than other BLAST versions and allows the submission of multiple sequences in a single search Nucleotide b
149. copy for base calling First though you will need to tell Aligner where your copy of PHRED is installed you can do this in the base calling preferences Academic users who want to use their own copy of PHRED can obtain the source code for PHRED free of charge directly from the authors with certain usage restrictions please check www phrap org for details Base Calling with PHRED 34 CodonCode Aligner User Manual Users at for profit organizations need to purchase a license for PHRED Please check www phrap com for information about purchasing PHRED licenses from CodonCode What Aligner does In short all that happens is that the base calls in the samples will be replaced with PHRED base calls and PHRED s base specific quality scores But if you really want to know the details here is what happens when you start base calling in Aligner 1 Aligner will first create two temporary directories These are created in the system s default temporary directory for example in tmp on OS X the names of the directories will start with bscl 2 Aligner will write SCF files for each selected sample into the first folder from which PHRED will read the data 3 Aligner checks if all necessary entries are present in the Phred parameter file to process the traces you selected If any entries need to be added Aligner will show a warning dialog and then allow you to add the required entries using the Phred parameter file edit dialog as described b
150. ct the next time you start Aligner However you may need to specify the address of the License Server computer here if Aligner cannot automatically find the correct License Server This can happen if The License Server is on a different subnet for example in a different department A firewall between or on your computer and the License Server computer blocks the automatic License Server detection CodonCode Aligner finds a License Server different from the one you want to use for example the one from the neighboring lab You are switching from a single user license to using the License Server License Server Preferences 259 CodonCode Aligner User Manual You can specify the License Server address either as computer name for example mylicenseserver myuniversity edu or as an IP address for example 10 123 012 20 If you do not know the name or address to use please contact your local system administrator Any changes made will take effect the next time you start Aligner after quitting your current Aligner session License Server Preferences 260 Memory Preferences The memory preferences allow you to see how much memory CodonCode Aligner is currently using On Mac OS X it also allows you to set the memory available to Aligner Alignment r Memory Assembly S i in cole Memory options Base colors Maximum available memory MB 256 rey Consensus method
151. ct to the License Server it may be because Aligner License Server is not running or because a firewall is blocking the network traffic between your computer and the license server computer Please make sure that the License Server is running and to allow communication on the following UDP and TCP ports 123 16030 16031 32156 32157 54643 and 54644 Communication must be enabled on both the License Server computer and on the computers where CodonCode Aligner is used License Server Licenses 6 CodonCode Aligner Features CodonCode Aligner is a versatile powerful and easy to use DNA and RNA sequence assembler aligner and editor Aligner imports a wide variety of sample file types into projects Aligner projects are collections of sample files and their resulting alignments or contigs Aligner works best with sequences that have chromatograms and quality scores for example from SCF files generated with PHRED or ABI files that were base called with the KB base caller However you can also import text sequences without chromatograms and trace sequences without quality scores for example older ABI files or ABI files analysed with the ABI base caller Aligner protects your original sequence data by making copies of the original sample data when files are imported When you make edits in Aligner you change only the copied data files Aligner Windows and Views This section describes the most important Aligner windows or views br
152. cursor at the base after which you want to insert a gap Press the space bar or select Insert gap gt Shift Bases Right from the Sample menu A new gap will be inserted before the current cursor position If the sample is part of a contig the bases after the new gap will be shifted to the right One exception to this rule applies when the last base of a sample is selected in this case the gap will be inserted after the current base so that you can add bases to the end of reads If you want to insert a gap and shift the bases before the gap to the left instead of the bases after it to the right select Insert gap gt Shift Bases Left from the Sample menu Alternatively use the keyboard shortcut Shift Space keep the shift key pressed while pressing the space bar If you are working in the contig view and have a consensus base selected gaps will be inserted in the consensus and in all sequences at this position To insert a base e insert a gap character as described above then type the letter of the base you wanted to insert Since the gap you just inserted was selected after you inserted the gap you just replaced it with the character you typed Adding Bases at the End of Reads To add bases to the end of a read 1 Select the last base of the sample 2 Press the space bar to insert a gap 3 Press the letter of the base you want to add to change the gap to the base 4 Repeat steps 2 and 3 for each base you
153. d sequences after the end clipping and move those to the trash Such bad sequences can be due to failed sequencing reactions or any number of other problems We suggest to move all sequences that are too short after clipping for example less than 25 or 100 bases to the trash A second widely used method to identify low quality sequences is to count the number of bases with quality scores above 20 Phred20 bases With the settings shown in the picture above any samples that after the end clipping have fewer than 150 Phred20 bases or are shorter than 200 bases would be called bad and moved to the trash We suggest that you experiment with the different parameters and find a setting that works for your data For example if you sequence short PCR products you should definitely reduce the number of Phred20 bases required for a sequence to be kept or perhaps uncheck this option Additional details about the end clipping parameters can be found on the End Clipping Preferences help page End Clipping Algorithms This section briefly explains the different end clipping methods algorithms It is intended for the curious you do not necessarily need to understand the end clipping algorithms to use them All methods use the base specific quality scores to find the low quality regions For the end clipping to work correctly the quality scores have to be reasonably accurate however they do not have to be perfect Method 1 Maximizing r
154. d colors for each of these ranges We suggest to use darker colors for lower qualities and lighter colors for high quality bases These colors will be used to draw the bases in the base view contig view and the trace view windows Here is an example of the base view with this setting Switching color schemes 238 8608 o le Bererccrcc 51 101 151 201 251 301 351 401 451 501 551 601 GGcTCCCTCA CCTCCCACAT TCAAACTTGT Giitaccacaa GCGGATCTCT AGCACAGAGA TGN NGAGGT CodonCode Aligner User Manual A326 r ccrrTGABE ATGCATAAAG AGTGGCCCTG GTGGTTTCAA GATCTGTCTA CCTGGAGGAG GTGGATGCCA CCAGAGCTTC TCTCTCCTCA TCTAATTCTG TTTTATTGAT GGAACAACCT GATTTGTTGT GTCAGGTGCT 3 T AGACCTTGTC ATCATAAATC GCAAACCTAA TTAAGGATGG GGGGAAAGAT GCAGCCACEN T G CATCNN TTCCTCAGCT TGTTACACTC TGGAGATTT AATTCTTGAA CCTGAAGGAG Nc c a Nc r TTTCCAGGAC a 4 A326 r Base 201 of 612 Quality 13 Notice that there is a short stretch of low quality bases at the start of the sequence and a longer stretch at the end which is a typical picture There is also a short stretch of low quality bases near base 200 looking at the trace view you can see that this is due to multiple peaks at this location e00 Traces from Unassembled Samples GCAAACCTAATGGAGATTTERBEMBTACCAGAAGTGGTTTCAAGG A 190 200 210 20 0 ia aa A LLLA M tie n dicm c 4 no of ecl P O t jae A Scroll together A326 r Base 201 of
155. data 1 Open the CodonCode Aligner preferences in the Edit menu on Windows and the CodonCode Aligner menu on OS X 2 Select Open amp save on the left panel 3 Make sure the checkbox labeled Save ABI raw data for methylation analysis is checked 4 Click OK to close the preferences To analyze methylation in a set of ABI chromatograms follow these steps Methylation Analysis 108 CodonCode Aligner User Manual Create a new CodonCode Aligner project Import the reference sequence you want to use typically from a text file in FASTA or similar format 3 Select the sequence you imported and choose Make Reference Sequence from the Sample menu 4 Select the reference sequence in the project view or select all bases in the base view 5 Go to the Edit menu click on Change Bases and select Change Cs to Ts except CGs You should see a message telling you how many bases were converted 6 Import your ABI files Note that the files must be in abl or abi format The commonly used SCF format does not contain raw data 7 Select the imported ABI sequences in the project view go to the Contig menu and select Align to Reference Sequence 8 When the alignment is complete choose the resulting contig go to the Contig menu and select Analyze Methylation N e CodonCode Aligner will analyze the methylation in the contig which can take several seconds per sample When done a result view wil
156. deletion that is larger than the bandwidth number the alignment will typically stop at the insertion deletion and the rest of the sample will be unaligned If the insertion or deletion is shorter than the bandwidth the alignment will continue after introducing the necessary number or gaps in one sequence as long as the aligned parts after the gaps is long enough the aligned regions before and after the gaps must be at least 1 and 1 2 times as long as the number of gaps and longer for any mismatches or ambiguities The discussion above is a bit simplified in reality what counts is the total number of gaps in one sequence minus the total number of gaps in the other sequence at any position since the alignment uses a banded Needleman Wunsch algorithm The bandwidth parameter has an impact on the alignment speed larger values mean slower alignments For large projects you may want to reduce the bandwidth value for projects where you know that you have larger Maximum Unaligned End Overlap 227 CodonCode Aligner User Manual insertions and deletions you may want to increase it Note however that increasing the bandwidth will typically not be enough to extend alignments through very large gaps like large introns Support for Large gap alignments will be added to later versions of Aligner The bandwidth parameter does not apply to large gap alignments in large gap alignments gaps between aligned parts can extend for thousands of
157. depending on your settings Some files contain the sample name in the file e g FASTA files When this is the case the name specified in the file is used as the Aligner sample name When a file contains multiple samples the sample names must be specified in the file Within a project sample names must be unique If a sample name in a file already exists in the project the new sample is renamed so that the sample name is unique Samples are renamed by appending an underscore and a unique number e g name 1 Compatible File Formats 29 CodonCode Aligner User Manual To rename samples you can use the Sample Information dialog Alternatively you can first select the sample in the project view and then clicking on the sample name again similar to the way you would rename files in Finder windows on OS X or Explorer windows on Windows Sample Names 30 Organizing Samples And Contigs In Folders Aligner projects always contain the Unassembled Samples folder and the Trash folder However if your projects contain a lot of unassembled sequences or many contigs you may want to organize the sequences a bit better CodonCode Aligner allows you to create folders in projects to which you can move samples and contigs by drag and drop or by using the Move To menu item Creating Folders To create a new folder for organizing unassembled samples select New Folder from the File menu This will show a dialog where you can name
158. don starts and it will contain the correct base number for this base so that the mutation annotation after using Find mutations will be correct If you do not want to clip alignments select Leave as is from the pulldown menu Restoring default parameters To restore the default parameters click on the Defaults button near the bottom This will reset all parameters to the choices shown in the screen shot above Clipping Uncovered Regions 229 Assembly Preferences The assembly preferences allow you to specify parameters for sequence assembly eoe Preferences Alignment Ehta MM e Base calling Algorithm End to end alignments Base colors SER 2n n lise os cul Min percent identity 70 0 Double clicking Min overlap length 25 E End clipping Features Min score 20 Highlighting Max unaligned end overlap 50 0 ES License Server Memory Bandwidth max gap size 30 Mutations x Open amp save Word length 12 PU Phrap assembly Max successive failures 50 Ti Preference options Printing Match score 1 Ce Protein translation f Restriction maps Mismatch penalty 2 Ce Sample names Gap penalty 22 mm Startup Toolbars Additional first gap penalty 3 Vector trimming l Warnings Window placement Description The assembly preferences allows you to set criteria for overlaps during assembly
159. e gap penalty You can change the scoring within limits scores from 1 to 19 for matches and penalties of 1 to 19 In general we suggest that only experts change the match scores and penalties Bandwidth Maximum Gap Size 233 CodonCode Aligner User Manual Restoring default parameters To restore the default parameters click on the Defaults button near the bottom This will reset all parameters to the choices shown in the screen shot above Restoring default parameters 234 Base Calling Preferences In the base calling preferences you can specify details needed for running the base calling program Phred to use base calling in Aligner you need to have Phred installed on the system that you are running Aligner on of course OOA Preferences Alignment r Base calling Assembly Base calling Full path to the base calling program Phred rosis a ER tions CodonCode Aligner Phred Phrap workstation phred Select Double ciicking Full path to the Phred parameter file End clipping Features plications CodonCode Aligner Phred Phrap phredpar dat Select Highlighting License Server options 4 Edit Memory Mutations Additional command line options Open amp save Phrap assembly p Preference options Printing Protein translation Sample names Startup Vector trimming Views Warnings Window placement Description The base calling preferences let you specify the l
160. e sequence must be the same direction and chemistry and preferably use the same primer The subtraction step relies on the peak patterns being very similar in the two sequences This is generally not the case for sequences produced with different sequencing chemistries or sequenced from different strands The wild type sequence must be largely identical to one of the two alleles in the mutated sample This is typically the case when analyzing sequences from human samples however it may not be the case when analyzing regions with a high degree of lengths polymorphisms for example intronic sequences from different species The analysis may fail in obvious or non obvious ways While the trace subtraction should always produce a new subtracted sequence the resulting trace may not correctly show the presumed mutated allele In obvious cases the subtracted sequence will have peak patterns that are clearly incorrect and low quality scores In less obvious cases the subtracted sequence may look reasonable but individual peaks and corresponding bases may be missing Therefore it is essential to closely look at all three sequence traces together the indel sequence the wild type and the subtracted sequence If you happen to have examples of where the algorithm did not work as a expected we would certainly appreciate if you could send us your trace files so that we can continue to optimize CodonCode Aligner s algorithms Interpreting Results Wh
161. e base with the wrong tag and then choose Mark heterozygoteAC as False Positive from the popup menu If you did click on a base with a mutation tag this will be the second item in the popup menu The actual text will differ a bit depending on the original classification False positive tags get preserved when you re do the mutation detection Wrong classifications If a base is mutated but the classification by Aligner is incorrect you can change the tag in a two step process First bring up the tag information dialog as described just above right click resp control click on the base select Show tag from the popup menu In the tag dialog click on the Change button This will bring up another dialog where you can choose the correct tag from a Fixing Errors 92 CodonCode Aligner User Manual pulldown menu This allows you to for example change a tag from heterozygote CT to homozygoteCC When you change a tag this way Aligner will update the notation that shows the amino acid effect in the Notes section of the tag unless you have annotated a coding region and the mutation is in a non coding section of your sample Missed mutations If Aligner missed a mutation you can manually add a tag that describes the mutation In a trace view or contig view right click OS X control click on the mutated base and then choose Add Tag from the popup menu This will bring up the Add tag dialog an example is shown a bi
162. e consensus or samples This selection is used only for navigating the feature view windows will always show all features for the entire contig both in the consensus and in all samples Feature Preferences 255 CodonCode Aligner User Manual Specifying subsets of tags A number of different programs add tags to regions of sequences For example the assembly program Phrap adds tags for compressions and for regions that match regions in other contigs and PolyPhred uses tags to mark possible mutations it has identified You may want to use Aligner s feature view or feature navigation to look at only some of these tags for example only tags added by PolyPhred but not tags added by Phrap To do this click on the Specify button in the Feature preference dialog This will bring up the following dialog r eoo Tag Selection A r Select tag types to use CUriTpre ram consedFixedGoldenPath contigEndPair contigName All Phrap tags v All Mutation tags L All processing tags All unlisted tags endClipped 4 Bucessnsenceaca sceau Cancel dic dacs You can use the buttons and checkboxes on the left side to select or unselect groups of tags You can fine tune your selection in the list of tags on the right To make or change discontinuous selections use Control click on Windows and Command Click on OS X Your selections will take effect when you click OK in the tag selection dialog and then in the Preferen
163. e contig you are working with you can also use a base view e Select the first base of your coding sequence in the reference sequence or the consensus sequence Right click OS X control click to show the popup menu and select Add Tag or select Add Tag from the Tag sub menu in the Sample menu This will bring up the Add tag dialog E Add tag to Contig1 New Tag Type codingSequence i Tag Details Program Use Start 62 End 99999 Date Thu Ap 11 03 05 EDT 2004 Notes Tip If you want the tag to extend to the end of the contig or sample just enter a very large number in the End field f Confirmed Cancel Select codingSequence as the tag type from the pull down menu at the top Then enter the end coordinate of your coding sequence at the bottom you could also select the entire coding sequence before choosing Add Tag When everything looks right press OK If the first base of your coding sequence is NOT the first base of a codon you can also add a codonStart tag the codonStart tag must be within two bases of the codingSequence start though If your reference sequence was originally read from a file in Genbank format and contained a simple CDS annotation Aligner will use this to automatically create codingSequence and codonStart tags However any CDS tags in Genbank sequences that point to other sequences or join multiple sequences will be
164. e different depending on your base color preferences Also note that the T peak in the heterozygous samples is only about half the height of the T peak in the homozygous sample at the top Aligner uses these two pieces of information the secondary peak and the reduction in peak intensity to identify heterozygous bases To get more information about a tag you can right click OS X control click on the base with the tag and select Show Tag from the popup menu the menu text will show the type of the tag selected for example Show Tag heterozygoteCT Selecting the Show Tag popup menu item will display the following tag dialog e Tags for va 1 x at base 167 Tags Tag Details Program Start 168 End 168 Date Thu Jul 15 1 1 13 EDT 20 Notes Heterozygous 183 T gt C Cys61Cys Change Y Delete Confirmed f Cancel 5 You can quickly confirm a tag by clicking on the Confirmed checkbox delete the tag or add your comments in the Notes text area Fixing Errors There will be cases where you disagree with the classification made by CodonCode Aligner and want to change it Depending on the circumstances this is what you can do False positives If you think that a base is not mutated you can change the tag to a false positive tag The fastest way to do this is by using the popup menu from the trace view or contig view Right click OS X control click on th
165. e e bili DEED rH UE eU PMsR E ote ER PINE MOM UMS 108 Eae LAM ETERNI 108 Reference Sequence SDmlelll e eere AREER NO EANA arses UG uU POI Re rS 108 How Bei Analyze NM eth EoERORL coii eeu Epor dis yin VPN Hk ERA eE nis o A rci uke b E e cR 108 Prunbr DEJO oeie E adno vd acerba EEUU R EY RAV ERE D RARO D HR ERR C RN IHRE 112 Howto Pick Pinme VS i iiim moi mio ends wea cava PHadv A piv ppp eine d ION He cei omuia 112 Primer Dosen Patomelets esos nose aestuarii iene ORAL ee RE 112 ECR E O gasp hv E eee tee ee 113 Seguencite EISE T Qr c D acento 7 S A 05 SS SE 114 Conditions amp Advanced Settings P ramieters uai ecrire rete ee tree b REA THES edo 114 Prior B UU oo corio nao ARS MOT ERU ER bm MONS od ER MATE MEE 116 Exparios Primei ic asocio obice n EU mls ede ui Deu vu t EL pol A ent S ARE EM ee 118 CodonCode Aligner User Manual Table of Contents Primer Design Poe EIE BIO METRI TOTO TOT 119 Editing Samples dp x RI ak uM ar E MEE MM E qu EM A UE EE 120 Windows Tor Edine Samples scrip pU HIN SUn pe Chn dep ENS NEE CHRIS PED Usb b o quo PER NEUE VC MR a UK NINE NM r v P S 123 Cursor Positioning and MO YOemiekit susce net E ane rae 124 Moving to Features Ambiguities Mismatches or Edited Bases ssesssssss 124 Sethe Base Numbers souci e omnis eee ie 125 Selecting Bases aiie EE E FTD ai ean 126 Selecting from sequence start to current cursor POSITION cenres ninii 126 Selecting from current
166. e memory if a project has been edited you need to save your changes first If your project has unsaved changes this preference panel will be disabled The maximum amount of memory you can set here is determined by the amount of physical memory RAM installed in your computer On OS X Aligner will determine this amount and limit the memory you can set to the installed memory If you are working on a computer with a limited amount of physical memory e g 2 GB or less or if you have a number of other applications open you may experience slow downs due to swapping similar to what is described above in the Memory on Windows section In this case closing other applications and installing more memory can lead to dramatic performance improvements Memory on Windows 262 Mutation Detection Preferences To change the mutation preferences select Preferences from the Edit menu on Windows or from the CodonCode Aligner menu on OS X and then click on Mutations on the left panel The mutation preferences dialog looks like this Preferences r Mutation detection r Point mutation detection sensitivity sites where there is an intensity drop Base colors Consensus method O Low 9 Medium O High Double clicking End clipping At sites where there is NO intensity drop Features A Ou J Low Medium High Highlighting hd e x License Server Data quality Minimum quality at ends 30 HJ V
167. e of interest to you You can define your regions of interest in the feature preferences Tip the fastest way to navigate to the next or previous feature is by using the keyboard shortcuts On Windows use Control Right Arrow and Control Left Arrow on OS X use Command Right Arrow and Command Left Arrow Next or Previous High Quality Mismatch Moves the the next or previous high quality base that disagrees with the consensus Next or Previous Low Quality Consensus Moves the the next or previous place where the consensus quality is low Next or Previous Ambiguity Selects the next or previous ambiguity in the selected sample or consensus Next or Previous Mismatch Moves the cursor to the next or previous mismatch in the selected contig Next or Previous Edited Base Selects the next or previous edited base in the selected sample Base Number Displays a dialog where you specify a specific base number in the selected sample or consensus First Aligned Base Moves the cursor to the first aligned base in the current sample Last Aligned Base Moves the cursor to the last aligned base in the current sample In addition to the menu items in the Go menu and their keyboard shortcuts you can also use the home key to go to the first base of a sequence and the end key to go to the last base of a sequence Cursor Positioning and Movement 124 Setting Base Numbers Usually base numbers shown in CodonCode Aligner are relative t
168. e reference sequence should be imported The Paired end options section applies only if you are aligning paired end reads separated into two files specified in the Sequences to align section Make sure to specify the correct size range of your inserts in the given boxes and then choose whether or not you want to exclude reads where only one of the two mates align and whether to exclude pairs that have the wrong insert size or read orientation discordant pairs You can specify additional parameters for the Bowtie2 alignment by pressing the More options button This will bring up the following dialog Alignments with Bowtie 2 75 CodonCode Aligner User Manual BO Advanced Bowtie2 Options Advanced Bowtie2 options of cores to use Keep index files Keep result sam file 5 bases to trim 3 bases to trim Speed option Reads to skip at start 0 3t reads to align all default iw Match bonus 2 Mismatch penalty Penalty at Ns Read gap penalty 5 3 Reference gap penalty 5 3 Min score defaut W Max ambiguities default Max of pads 15 Gap distance from ends 4 Mate orientation fr Quality type phred33 Ignore qualities Defaults The first option lets you choose how many CPUs or cores Bowtie2 should use for the alignment If your computer has multiple CPUs or cores selecting more cores can reduced the time needed to create the alignment signific
169. e runs with hundreds of thousands of sequences Projects with about 20 000 to 40 000 samples from SFF files may be fine provided your computer has at least 2 GB of memory installed On OS X working with many samples will require that you increase the amount of memory that CodonCode Aligner can use in the Memory preferences SAM files text files that are used for storing large nucleotide sequence alignments and their information In addition to these sample files CodonCode Aligner can read sequence assembly files in ace format produced by Phrap or Consed and assemblies in CAF format produced by Sequencher as described above Sample Names When reading chromatogram files Aligner will use the name of the file as a sample name Since version 1 4 0 sample names can contain spaces accented characters and so on However if your sample names have funny characters like accents or umlaute keep this in mind e The names may not be drawn correctly in all views due to minor bugs in Java On Windows importing a folder of samples with special characters in their names may not work Aligner may report that it cannot find some of the samples Similar adding samples to a project by drag and drop may not work if the sample name contains unusual characters However you should always be able to add samples using Import gt Add Samples When exporting samples Aligner may replace unusual characters in the sample names with underscores
170. e sequence forward 3 frames The entire sequence all 6 frames The selected bases The defined coding regions The Format pull down at the bottom gives you the format choice of a single FASTA file and one FASTA file per sample Exporting Protein Translation 175 Exporting Differences Exporting Differences allows you to export the Difference Table you can see in the contig view in Aligner The information exported will be the information you see in the overview panel of the contig view window if you show the differences there This can exclude Ns non gaps or differences with a quality higher than the set threshold depending on the filters you use when showing the difference table in the contig view To export information about the differences in your contigs go to the File menu and select Differences from the Export sub menu This will show the following dialog AOO Export Differences Export differences for Current selection O all contigs Format Comma Separated Value CSV Bron Use the radio button at the top to select whether you want to export only the selected contig s or all contigs in your project Then use the pull down menu to select the file format and click on the Export button Next Aligner will show you a Save As dialog where you can select the location of the exported file The exported file is a text file and can be opened with text editor or spread sheet programs Here i
171. e the name of the FASTA file with qual appended at the end of the name If you are exporting individual FASTA files for each contig a separate quality file in FASTA format will be created for each sample When the Format sequences box is checked longer sequences will be split up into multiple lines with 50 bases per line This can be a problem for some older software which expects the sequence to be in a single line to write the entire sequence into a single line in the FASTA file simply uncheck the Format sequences box Export options for FASTA files 168 Exporting Assemblies You can export Aligner projects for importing into other programs for example the contig editor Consed You can export entire Aligner projects or parts of Aligner projects for example single contigs First select the contig s you want to export in the project window Then choose Export Assembly from the File menu This will bring up the following dialog Ez Export Assembly 3 r What TOCEX DOTT rt A Current selection Entire project Format FACERE You can choose to export the current selection or the entire project Currently only two formats are supported e the ACE format that is used by the Phred Phrap Consed package and also supported by other contig editors e the NEXUS PAUP format which is used by many phylogenetic analysis programs the Phylip format another format often used by
172. e view and for assembled or aligned samples the contig view The only views that do not allow editing are the views that do not display the bases the project view the quality view and the feature view In general we suggest to do most editing in the trace view window simply because you can see the underlying data while editing One possible exception of this rule is editing sequences that are part of contigs sometimes it may make sense to edit in the contig view but having a trace view open that shows the sequence is still a good idea All windows are linked If you move the cursor or make a selection in a contig window Aligner will scroll to the same position in any open base view and trace view windows for that sample Likewise when editing base calls changes are immediately made in all other open views for that sample Windows for Editing Samples 123 Cursor Positioning and Movement The cursor is positioned by clicking at the desired position in a sample or the consensus The cursor position is indicated by a vertical cursor position line displayed across all samples and the consensus Moving to Features Ambiguities Mismatches or Edited Bases The Go menu has selections for quickly moving through the sequence Next or Previous Feature Moves to the next or previous feature or region of interest Features can be discrepancies low quality consensus bases low coverage regions or a number of other things that may b
173. ead the Sequence Assembly With Phrap section Phrap Assembly Preferences 269 Preference Options CodonCode Aligner offers the option to save and load copies of Aligner s preferences in the Preference options panel of the Preferences dialog 608 Preferences Alignment Preference options Assemb e Preference file location Base calling Base colors fe Default location Consensus method Double clicking Users peter Library Preferences CodonCode Aligner Preferences End clipping Custom location Features Loads the preferences from the specified file and saves any future Highlighting changes back to this file To create a new preferences file please use License Server the Save copy function Memory Mutations Select Open amp save If selected any changes to the preferences since Aligner started will Phrap assembly not be saved Preference options Printing Do not automatically save changes made to preferences Protein translation Sample names r Advanced functions Startup Saves a copy of your current preferences that you can later reload Vector trimming Views Warnings Load a previously saved set of preferences This option will NOT Window placement change the file used for saving your preferences Description The Preferences options allow you to use a custom preferences file You may also save a copy of the current preferences or load preferences fro
174. ect the sample in the project view and then choose Qualities in the View menu to get information about the quality at any specific base you can click on the base in the base view window or the trace view window the quality of the selected base is shown at the bottom of the window you can also choose to have the background behind the bases in the base view trace view and contig view windows indicate the quality using either a continous scale or a three color scheme the Where quality values come from 16 CodonCode Aligner User Manual good the bad and the ugly you can set this in the Base colors preference panel Additional Reading R Durbin and S Dear 1998 Base Qualities Help Sequencing Software Genome Research 8 161 162 Available online at http www genome org content vol8 issue3 B Ewing B L Hillier L M C Wendl and P Green Base calling of automated sequencer traces using Phred I Accuracy assessment Genome Research 8 175 85 Available online at http www genome org content vol8 issue3 B Ewing and P Green 1998 Base Calling of Automated Sequencer Traces Using Phred II Error Probabilities Genome Research 8 186 198 Available online at http www genome org content vol8 issue3 P Richterich 1998 Estimation of Errors in Raw DNA Sequences A Validation Study Genome Research 8 251 259 Available online at http www genome org content vol8 issue3 Viewing qualities
175. ection part 2 is 60 complete MT aS Cancel After the assembly is done the progress window will disappear and the project window will now show the newly formed contig s unless no joins were successful in which case you will see a dialog telling you so When CodonCode Aligner assembles pre formed contigs it looks for matches between the consensus sequences and leaves the alignment of reads in the contig mostly unchanged If contigs are merged with other reads or contigs any necessary gaps will be added Advanced assembly options In addition to the simple assemblies described above CodonCode Aligner also supports several advanced assembly options including Assemble with preprocessing CodonCode Aligner can also automatically do common pre processing steps like end clipping and vector trimming before assembly Sequence Assembly 53 CodonCode Aligner User Manual Assemble in groups with this option CodonCode Aligner can automatically group samples based on their names or based on multiplex sequence tags and form separate contigs for each group This option can be a real time saver in phylogenetic and medical studies where you look at sequences from many species isolates or patients Compare contigs to each other this option allows you to compare several contigs for example when studying genes from different species isolates or patients The consensus sequences will be assembled into a new contig to chec
176. ects on a regular basis and especially before major processing steps like end clipping vector trimming or assembly If you are using CodonCode Aligner in Demo mode you can only save projects that a do not contain any contigs and b where you have not used any of the advanced Aligner functions like end clipping sequence assembly and so on Closing Projects Choose Close Project from the File menu to close the currently open project and all its windows Aligner will first check if you made any changes to the project since the last time the project was saved If any changes were made Aligner will ask you if you want to save the changes before closing the project If you answer Don t save all changes you have made since the last save will be lost Opening Existing Projects 21 Adding Sample Files to Aligner Projects CodonCode Aligner can import sequences from a variety of different file formats including chromatogram files in ABI and SCF format and text files in FASTA FASTQ SAM Genbank NBRF PIR PHD or plain text format Files in FASTA FASTQ SAM Genbank or NBRF PIR format can contain multiple sequences per file You can add sequences to Aligner projects by dragging and dropping files onto Aligner project views or by using one of several Open and Import options in the File menu 1 by opening single sample files 2 by adding samples from several files 3 by adding a subset of samples 4 by adding entire folders
177. ed background colors 246 CodonCode Aligner User Manual You can switch between showing bases and showing translations through the Sequence Translation submenu in the View menu The background colors in the default amino acid color scheme are similar to the GDE color scheme as used by the sequence editor Se Al However the scheme has been modified so that similar amino acids use similar but slightly different colors You can choose to use the GDE color scheme where similar amino acids lead to identical background colors in the Amino acid colors pulldown menu Translation based background colors 247 Consensus Preferences The consensus preferences allow you to specify how the contig consensus sequences are calculated OOo Prferemes 0 0 0 0 0 0 0 0 0 0 0 00 0 0 0 0 Alignment Assembly Base calling Base colors Clicking amp scrolling End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Restriction maps Sample names Startup Toolbars Vector trimming Views Warnings Window placement Description Consensus method Consensus method For regular contigs Quality based Es For contigs of contigs Quality based HH B aaa if any sample has bases f Replace in consensus with n Quality based consensus determination Subtract quality scores of mismatches 9 Ignore Subt
178. ed in You can change bases to lower or upper case as follows 1 Select the bases that you want to change you can do this in a base view trace view or contig view 2 To make these base lower case go to the Edit menu and select Make Lower Case To make base upper case go to the Edit menu and select Make Upper Case This will change any selected bases to the chosen case Upper and lower case regions in contigs are preserved when adding new samples to a contig and when exporting sequences to text files Note that editing bases in CodonCode Aligner will make bases in samples lower case unless you press the shift key while editing By definition lower case edited bases indicate lower quality confidence edits while upper case bases indicate higher quality edits Automatic Edits Changing Bases 127 CodonCode Aligner User Manual CodonCode Aligner offers several functions to automatically change bases for example to call heterozygous bases or to convert low quality bases to N To auto edit bases select the bases you want to edit go to the Edit menu and choose Change Bases This will show a submenu that allows you to choose the automatic edit you want to apply to your selection Available auto edits are Match Consensus Call Secondary Peaks Remove Ambiguities Change Low Qual Bases Undo Auto Edits For some of these auto edits you can set thresholds by selecting Change Bases Options from the
179. ed method to identify low quality sequences is to count the number of bases with quality scores above 20 Phred 20 bases With the settings shown in the picture above any samples that have fewer than 350 Phred 20 bases after the end clipping would be called bad and moved to the trash We suggest that you experiment with the different parameters for end clipping and find a setting that works for your data For example if you sequence short PCR products you should definitely reduce the number of Phred 20 bases required for a sequence to be kept or perhaps uncheck this option The results of end clipping are not saved until you save your project you can use this to try out different parameters Just close the project without saving open it again and end clip with different settings until you found settings that feel right to you Automatically removing short and low quality sequences after end clipping 254 Feature Preferences Aligner allows you to define criteria for places that you want to examine more closely called Features Your definition of features can include low quality consensus bases low coverage regions gaps ambiguities and tags you make your choices in the Features preferences Preferences r Features Feature Criteria Regions of Interest Base calling s z Base colors vi Low quality consensus quality lower than 30 r Consensus method V High quality discrepancy quality at lea
180. ed through the pop up menu in the graphic overview or by using the Arrow Layout button above it In addition to the sample layout you can also change if you want to view the arrows colored by strand or not Contig Difference Table Some things worth noting for the difference table of the contig which can be shown in the upper half of the contig view e You can move around in the difference table by using the scoll bar at the bottom and on the right side of the difference table The difference table lists all samples of your alignment and shows their names in the left column of the difference table e The right cloumn of the table contains the number of all differences for the sample in this row The top row of the difference table shows the position of the differences in this column in the contig and the contig base at this position e The bottom row of the difference table displays a summary of the differences in all samples at this postion The currently selected sample or samples are shown with a blue background in the table the selected base has a black background Changing the display of the sample arrows 194 CodonCode Aligner User Manual Display options for the difference table The toolbar above the difference table allows you to switch back to the overview but also to change the size of the difference table and to use filters for choosing which differences are displayed Changing the size of the difference table allows you t
181. egions with error rates below a given threshold First the quality scores at each base call are converted into estimated error rates The quality scores are on a logarithmic scale a quality of 10 corresponds to a 10 error rate a score of 20 to 1 30 to 0 1 and so on Next Aligner finds the longest region in the sequence where the following conditions are met the average error rate over the entire region is below the user defined threshold e if the region would be expanded on either side then the added sections would have an error rate that is above the threshold The region found by this method can contain some lower quality parts in the middle where the estimated error rate is above the threshold However such regions will only be included if they are followed by a region that has a lower error rate which drops the combined error rate over both regions below the threshold Individual bases and short regions outside of the good region may also have error rates below the threshold however they are not included when they are flanked by higher error regions The maximize region method is very similar to the method used by the base calling program Phred with the trim alt option and based on the Mott algorithm for sequence trimming It s a bit hard to understand but works rather well Method 2 Using separate criteria at the start and the end of the sequence In this method the clipping is done by coming in from the start and
182. ein translation of the sequences so that blocks of three bases will have the same color which will depend on the amino acid translation for these three bases Here is an example Translation based background colors 245 CodonCode Aligner User Manual eoo Contig1 amp u d D Print Reverse Build Tree View Traces Colors Show differences 123 e 1 Next Frame Mask Matches Bases Transl Help E 448 bp of 751 bp SAA gt 300 bp 400 bp 0 4 lt lt A819 r A819 r 1 A612 r 1 Contigl Pos 376 751 Qual 99 Using translation based background colors makes it easy to spot mutations that cause amino acid changes The reading frame that is used can be changed in the Sequence Translation submenu in the View menu Translation based background colors can be used when showing bases as above or when showing amino acid translations as shown below eoo Contigl amp ct D x Print Reverse Build Tree View Traces Colors Bases Transl Next Frame Mask Matches Help Show differences A 48 bp of 751 bp 300 bp 400 bp M 123 0 4 lt lt A819 r lt lt A819 r 1 A612 r 1 Contigl Pos 376 751 Qual 99 Translation bas
183. elow 4 Next Aligner will start PHRED using the path to the program that you can define in the base calling preferences the default is workstation phred in the Phred Phrap folder inside the CodonCode Aligner folder Aligner will also pass the location of the Phred parameter file as defined in the base calling preferences to PHRED Aligner will use the id and cd options to tell PHRED where the input files are and where to write the result files to 5 Aligner will wait for PHRED to finish If you are base calling several hundred traces this may be a good time for a coffee break If it s just a few traces it should take only a few seconds 6 When Phred is done Aligner will check to see if PHRED produced the expected number of result files if not Aligner will try to look at the PHRED output to find out what the problem was see below Aligner will also write the progress and error messages generated by PHRED into two files in the Aligner folder the file names are Basecalling errors txt for error messages and warning and Basecalling output txt for regular output typically the names of the files processed 7 Aligner will then rename the samples that were base called move them to the trash and read the base calls from the new SCF files that PHRED has just created 8 Finally Aligner will delete all the temporary files it and PHRED have created The temporary directories will be deleted when you exit Aligner If anything we
184. ements One exception where you may not want to use a quality based consensus are re sequencing projects where you align your sequences to a known reference sequence In such projects you may want to use the majority consensus so you can see the most common base at each position in the consensus sequence for details about how Aligner builds the majority consensus check the Algorithms section Alternatively you can use a percentage based consensus which lets you define a cutoff frequency only bases above this frequency will be included when building the consensus This allows you to ignore rare mistakes or mutants Using a percentage based consensus often makes sense for contigs of contigs that were generated with Aligner s Compare Contigs function Consensus Gaps By default CodonCode Aligner will use a character minus sign to indicate gaps in the consensus sequence However if you plan to align contigs with the program MUSCLE using CodonCode Aligner s Compare Contigs function this can sometimes cause problems since MUSCLE will remove all gaps before alignment When aligning consensus sequences this can lead to the deletion of bases in samples when importing the alignment results Similar problems might occur with other analysis programs if you export consensus sequences with gaps To avoid such problems CodonCode Aligner enables you to replace characters in consensus sequences with n characters To use this option
185. emoved Any samples that were reverse complemented in the contigs will be returned to the original not reverse complemented state Unassembling Contigs 155 Roundtrip Editing While CodonCode Aligner supports manual editing of contigs Aligner does not provide all the functionality of programs that were specifically developed to edit sequence alignments However CodonCode Aligner supports Roundtrip Editing exporting existing contigs for editing in external programs like MacClade or Mesquite and re importing the manually edited contigs The re imported contigs maintain the connection to the original chromatograms so you can quickly check any discrepancies by looking at the original sequence traces A typical example where roundtrip editing can make sense is a phylogenetic project where you go through the following steps Create a project in CodonCode Aligner with sequence traces from a number of different species isolates Create separate contigs for each species for example using Assemble in Groups e Edit the initial contigs Create an alignment of the contig sequences a contig of contigs with Clustal W from within CodonCode Aligner using Compare Contigs in Advanced Assembly e Export the contig of contigs for editing in MacClade or similar Use MacClade to move gaps around e Export the edited assembly from MacClade Re import the edited assembly into CodonCode Aligner thereby updating the positi
186. en interpreting the results of heterozygous indel processing done with CodonCode Aligner always keep in mind that CodonCode Aligner is only a tool that helps you to come to conclusions You will need to use caution whenever interpreting what you see Some specific things to keep in mind e The subtracted sequence you see is not a real allele sequence For example any mutations you see after the indel site could be on either allele or on both alleles e The base specific quality scores close to and after the indel site in the subtracted sequence should be used for guidance only They do not have the same mathematical accuracy as quality scores for real sequences However we believe that you can use the quality scores to quickly get an idea if the Limitations 106 CodonCode Aligner User Manual subtraction worked or not The algorithms for analyzing heterozygous indels have been developed and tested only on a limited number of sequences and have not been experimentally validated This is by no means a complete list so be cautious CodonCode Aligner is intended for research use only and has never been validated for any clinical or medical applications You should not base any medical decisions on any results obtained with CodonCode Aligner Acknowledgements The sequences used for the examples shown herein are from the PolyPhred examples by Dr Deborah Nickerson s group available at http droog mbt washington edu example csft2 tar gz T
187. ence traces as well as printing and editing unassembled traces You can also open existing Aligner projects However you cannot print save or export projects that contain contigs in demo mode Demo mode also allows you to try out most of Aligner s functions including end clipping assembly and so on but again you will not be able to save import export or print after trying these functions in demo mode The first time that you use CodonCode Aligner you will automatically receive a time limited trial which will enable you to use all functions for 30 days For more information about how to get licenses for regular use About CodonCode Aligner 1 CodonCode Aligner User Manual please check the Licenses for Aligner section Acknowledgements CodonCode Aligner contains licensed copyrighted material from LI COR Inc The Mac OS X version uses functionality provided by the Quaqua Look and Feel Copyright Werner Randelshofer and therefore is subject to the terms of the QuaQua Look and Feel License Agreement a copy of which is provided in the Mac OS X application package directory Licenses 2 Licenses for CodonCode Aligner After installing CodonCode Aligner will start up in Demo mode The first time that you use CodonCode Aligner you will automatically receive a time limited trial which will enable you to use all functions for 30 days When you are ready to purchase a license you can choose between single user licenses a
188. ences in the Edit menu or press Alt Enter This will show the preference window which looks like this Preferences r Vector trimming r Vector Library Base calling x Base colors I UniVec Consensus method O UniVec Core Double clickin End clipping 3 From File Volumes Aligner Idea Aligner Data Features Select vector sequences to screen against oe BlueScribe cloning vector SYNBLUEV a BlueScribe M13 Plus cloning vector So Mutations BlueScribe M13 Minus cloning vector SYNBLM13l4 BlueScribe KS Minus cloning vector SYNBLKSMV v aaa S F lt gt Phrap assembly Preference options Search Criteria Printing T s Protein translation Minimum identity 80 Sample names Min overlap length 20 Minimum score 10 Max distance from start 40 Max distance to end 100 r After Vector Trimming vi Move sequences shorter than 50 bases to the trash Window placement Description The vector trimming preferences control which vectors are used to screen against what the minimum match criteria are and how far vector matches can be from the ends of sequences On the left side you choose which specific preferences you want to edit In the image above Vector trimming is selected The right side changes according to the selection on the left side You can edit your settings on the left Any changes you make are only saved when you press OK or hit the return key
189. ent select the samples you want to add and then drag and drop them onto the contig that you want to add them to Note All tags that had been added to the consensus sequence including tags added by Aligner s mutation finding will be lost when you add sequences to an existing alignment Advanced Alignments Several options for advanced alignments to reference sequences are available through the Advanced Alignments submenu in the Contig menu Align with Preprocessing allows you to automatically do common pre processing steps like end clipping and vector trimming before alignment Align in Groups with this option CodonCode Aligner can automatically group samples based on their names and form separate contigs for each group This option can be a real time saver in phylogenetic and medical studies where you look at sequences from many species isolates or patients If you are working with 454 sequences samples can also be grouped based on multiplex sequence tags MID tags at the start of the sequences Align from Scratch this will unassemble any existing contigs in your selection before starting the alignments This option can be useful too if you want to undo manual introduction or movement of gaps or to try different alignment parameters To use the advanced alignment options select the samples you want to align and then choose Choose Advanced Alignments from the Contig menu This will display a submenu where you can
190. ent projects Aligner remembers Specifically you can determine how many recent projects CodonCode Aligner remembers and displays in the Open recent menu set default folders for saving your projects set default folders for importing tell Aligner to remember the last location from where you imported files so that Aligner will return to this folder the next time you choose an Import command Add Samples Add Folder or Add Assembly specify if you want to set the name and path of a project right away when creating new projects if not the name and location will be set the first time you save a project set the default quality that will be assigned to sequences without qualities when they are imported Open amp Save Preferences 266 CodonCode Aligner User Manual The default quality for sequences without qualities you set here will be applied to any sequences imported later where Aligner determines that the sequence has no qualities or has artificial qualities This value is used whenever you import sequences from text files for example FASTA files that do not have qualities you import sequences from files like PHD or SCF files that have qualities but Aligner determines that the qualities are artificial because all qualities are the O or 1 for example if an SCF file was created from an ABI file without qualities all qualities have exactly the same value and the sequence is at least
191. equence and possibly changing the extend of unaligned regions at the end of samples In addition the contig may be reverse complemented during assembly If you do not care about keeping the current arrangement of the samples in a contig you can choose Assemble from Scratch or Align To Reference from Scratch instead This will first unassemble the existing contigs and then re assemble or re align all reads that were in the contig s plus any other reads you have selected Duplicating samples You can duplicate samples in a project and create text sequences from consensus sequences as follows 1 Select the sample s or contig s you want to duplicate 2 Go to the File menu 3 Select Duplicate This will create a copy of every selected sample and a new text sequence for every selected contig Before using this option to align consensus sequences however please look at the help for Compare contigs in CodonCode Aligner you can compare contigs directly to each other and keep the relation to the sequences and their traces in a contig intact Adding Samples to Contigs 145 Merging Contigs To merge two or more contigs 1 Go to the project view 2 Select the contigs you want to merge you can also select reads in Unassembled Samples 3 Choose Assemble from the Contig menu Aligner will look for overlaps between the contigs and merge the contigs if the overlap meets the minimum assembly criteria If the overlap bet
192. eria defined in the alignment preferences Only if the alignment meets all the criteria the sample will be added If the alignment does not match any one of the criteria it will not be added and remain in the Unassembled Samples folder The parameters are similar to the parameters for sequence assembly but you can assign different values for assembly and alignment parameters The meaning of each parameter is discussed in the next sections Please note that the alignment parameters will not be used when comparing contigs from the Assemble with Options dialog Alignment Preferences 225 CodonCode Aligner User Manual Algorithm The algorithm pulldown lets you choose how CodonCode Aligner compares sequences during alignment with the following options Local alignments When this algorithm is used Aligner uses local alignments This means the start and the end of sequences is not necessarily included in the alignment the alignments stop when the alignment score would not improve anymore This can be due to for example too many discrepancies or unremoved vector sequences The resulting unaligned dangling ends are shown on gray background in the contig view base view and trace view This was the default algorithm for CodonCode Aligner version 1 6 3 and older Large gap alignments This algorithm is typically used when aligning cDNA to genomic DNA It allows for large gaps in between alignments without penalizing the large g
193. es Write FASTA quality files vi Format sequences Cancel Export oe The first option allows you to automatically replace problem characters in your contig names If you check the box Replace problem characters in names potentially problematic characters such as spaces or colons will be replaced by underscores If the box is not checked the contig names are exported as they are In this case importing the file into other programs might be problematic if contigs contain problem characters The second option allows you to append the number of samples in contigs The number of samples in a contig will be added to the first line of the FASTA file The third option allows you to append the sample or contig comments to the header of the FASTA file The comments from the sample information of each sample in CodonCode Aligner will be appended to the first line of the FASTA file If comments extend over several lines additional comment lines starting with will be added after the first header line By checking the box labeled Include gaps in FASTA files you can include gap characters in the output If the box is not checked the exported sequences will be ungapped If you check the box Write FASTA quality files a quality file in FASTA format will also be created If you are exporting a single FASTA file this file will be in the same folder as the FASTA file The name of the quality file will b
194. es when analyzing the reverse complement Background levels near the peak positions are estimated and subtracted from the peak intensities Finally CodonCode Aligner calculates methylation as M C C T Since most sequence traces contain some degree of uncorrected background noise from non specific peaks the calculated methylation is often slightly higher than 0 0 even at fully unmethylated sites and below 1 0 at fully methylated site In general the estimated methylation levels should be assumed to be inaccurate by 5 to 10 e g a level of 0 5 may well be 0 45 or 0 55 or even 0 4 or 0 6 However the calculated methylation can be useful to identify changes in methylation patterns between different samples If absolute methylation results are desired reference samples of fully methylated and fully unmethylated DNA should be included and used for post analysis correction of the calculated methylation values Methylation Analysis Algorithm 111 Primer Design CodonCode Aligner allows you to design primers for PCR cloning and sequencing Based on your selected sequence and the chosen primer design options primers are picked using Primer3 Results are then displayed and you can choose which primers you would like to import into CodonCode Aligner How to Pick Primers To design primers for one of your sequences follow these steps Go to the project view Select the sample or contig that you want to design primers for Choo
195. es and or contigs that you want to assemble in the project view Go to the Contig menu move to the Advanced Assembly submenu and select Assemble with PHRAP The assembly will start and show a progress window Depending on the size of your selection your depth of coverage and the number of repeats the assembly may take a while assemblies with several hundred reads typically take a minute or a few minutes How Aligner assembles using Phrap Aligner uses Phrap to assemble your selection as follows 1 Aligner checks if the Phrap program is indeed at the location specified in the Phrap Assembly preferences for example in the default location usr local genome bin on Mac OS X If the Phrap program is missing Aligner displays a warning and stops here 2 Aligner exports the selected samples to a single sequence text file in FASTA format and the corresponding qualities to a similar text file If you selected any contig then the samples in the contigs will be exported not the contig sequence since Phrap assumes that you always assemble from scratch The exported sequences will be without gaps 3 Aligner now starts Phrap in a separate process telling Phrap the name and location of the input files that were created in the previous step 4 Aligner waits until Phrap is finished with the assembly Aligner will display a progress dialog but since it cannot be predicted how long Phrap assemblies will take the progress window does n
196. es may be slow Opening a Trace View A trace view for a sample that has trace data associated with it can be opened by Selecting the sample then choosing Trace View from the View menu e Right clicking on the sample and choosing Trace View Double clicking on the sample if you selected to open a trace view in the double clicking preferences Scrolling and Scaling in Trace View The vertical sliders at the right side of each trace let you scale a trace vertically to make the peaks larger or smaller Trace View 183 CodonCode Aligner User Manual You can use the sliders at the bottom of each sample to scroll a trace Generally all traces will be scrolled together when you scroll one of the traces It is possible to scroll traces individually if you need to us this function please contact CodonCode Corporation s support team for instructions If the trace view window contains more traces than currently fit on the screen the vertical slider on the right allows you to scroll between the traces You can remove traces from the trace view window by clicking on the read X button on the left You can move individual traces up and down by clicking on the up and down arrows on the left If you have a mouse with a scroll wheel you can also use the scroll wheel to move around in the trace view window when the mouse pointer is positioned over a trace moving the scroll up or down will move horizontally to the right or to the left
197. eterozygoteAT Aligner va l x Contigl 107 107 Heterozygous 107A T STP36Leu heterozygoteAT Aligner va 23 x Contigl 107 107 Heterozygous 107A T STP36Leu homozygoteAA Aligner va 13 x Contig 107 107 No mutation homozygoteAA Aligner va 16 x Contigl 107 107 No mutation polymorphism Aligner Contig Contigl 107 107 2 diffs 0 homo 2 hetero 2 not mutated heterozygoteCT Aligner va 13 x Contigl 183 183 Heterozygous 183T gt C Cys61Cys heterozygoteCT Aligner va l x Contig 183 183 Heterozygous 183T gt C Cys61Cys heterozygoteCT Aligner va 23 x Contigl 183 183 Heterozygous 183T gt C Cys61Cys homozygoteTT Aligner va 16 x Contigl 183 183 No mutation polymorphism Aligner Contig Contig 183 1833 diffs 0 homo 3 hetero 1 not mutated heterozygoteGT Aligner va 13 x Contig 216 216 Heterozygous 216G T Gln72His heterozygoteGT Aligner va 23 x Contigl 216 216 Heterozygous 216G T Gin72His homozygoteGG Aligner va 16 x Contig 216 216 No mutation homozygoteGG Aligner va l x Contig 216 216 No mutation i polymorphism Aligner Contig Contigl 216 2162 diffs 0 homo 2 hetero 2 not mutated AL The table shows the characterization of samples at each consensus base where Aligner found at least one mutated base Aligner has added tags at these points to each sample that describe Aligner s classification For example at consensus base 183 in the table above Aligner classified three samples as heterozygous C T mixes and one sample as homozygous T T
198. etic tree right click on the branch of the tree where you want to split the contig This will open a popup menu as shown in the example below From the popup menu choose Remove Selected Branch Split Contig From Tree 202 CodonCode Aligner User Manual AAAACAAAACAATAACAATAGAI AAAACAAAACAATAACAATAGAI AAAACAAAACAATAABSAATAGAI A AMER TAA 0 00963 NAAACEAAACAATAACAAGAGA AAAACZAAACAATAACAAGAGAI AAAACZAAACAATAACAAGAGAI AAAACZAAACAATAACAAGAGAI Tree information Export Trees M Topology o M Label branc Build Tree Pir This will split your contig into two contigs One contig will contain the sequences that are part of the selected tree branch the other new contig will have all the other sequences In this example the bottom four sequences will be moved to the new contig a A FEN M Save Project Save Project As Add Samples Add Folder Assemble Align to Reference Unassemble Help Name Contents Length Qual Pos Added Modified Comments ul Unassembled Samples 1 sample 0 0 8 10 8 11 07 CtgComparison 6 contigs 183 0 9 17 12 22 1 gt 3 DCO 3samples 183 0 0 9 17 9 17 09 gt 3 FYC 3 samples 183 0 0 9 17 9 17 09 gt 3 GD 3 samples 183 0 0 9 17 9 17 09 gt 3 IM 3 samples 183 0 0 9 17 9 17 09 gt JRR 3 samples 183 0 0 9 17 9 17 09 be s UM 3 samples 183
199. ew window will be a bit lower and to the left of the window that was opened Window Placement Preferences 297 CodonCode Aligner User Manual last Window Placement Preferences 298 CodonCode Aligner Help by Menu File Edit Go Sample Contig Tools View Window Help Aligner Menu on Mac OS X only About Aligner Preferences Quit File Menu New Project New Text Sequence Open Open Recent Close Project Save Project Save Project As Import Add Samples Add Subset of Samples Add Folder Add Assembly Erom Genbank Export Export Project Summary Export Samples Export Consensus Sequences Export Assembly Aligner Project Old Format Export Features Export Protein Translation Export Differences Export Trees New Folder Delete Folder Duplicate Samples Exit on Windows Edit Menu Undo Redo Copy selected sequence Paste Select from Start to Here Select from Here to End CodonCode Aligner Help by Menu 299 CodonCode Aligner User Manual Select All Make Lower Case Make Upper Case Change Bases Match Consensus Call Second Peaks Remove Ambiguities Change Low Qual Bases Undo Auto Edits Change Bases Options Reverse complement Move to Unassembled Samples Move to Trash Preferences Windows only Go Menu Define Features Next Feature Next High Quality Mismatch Low Quality Consensus Ambiguity Mismatch Edited Base
200. f the mutated allele CodonCode Aligner uses two algorithms to deduct the sequence of the heterozygous indel The first algorithm looks at secondary bands and the reference or consensus sequence and replaces the Heterozygous Insertions and Deletions 100 CodonCode Aligner User Manual basecalls in the indel region with the likely sequence of the second allele The second algorithm creates a new subtracted artificial sample by subtracting a scaled version of the wild type sequence base calling the new subtracted trace with Phred After this both sequences are re aligned or re assembled with the rest of the original contig Here is an example of a subtracted sequence that was created by CodonCode Aligner from the heterozygous indel trace shown above eoe Traces from Contig1 yECCAG AGAAATT G GTCAG G AGCAC AA ARG GG G CACTAAG AGCAAA I 170 180 190 v Scroll together heterozygous indel sub Base 173 of 594 178 in contig Quality 62 Cons 62 w a v jaie In the processed sequence where the allele that corresponds to the wild type sequence has been subtracted it is very easy to see the one base T insertion To someone experienced in analyzing sequence traces with heterozygous indels this example may appear trivial after all we could determine the mutation quickly by looking at the original trace However CodonCode Aligner s algorithm will work as well even for large insertions or deletions which o
201. file and then keep the shift key pressed while clicking on the last file To select several files that are not right next to each other keep the control key OS X the command key pressed while clicking on files The screen shot below shows an example of the Import Samples dialog with four selected files Adding Sample Files to Aligner Projects 22 CodonCode Aligner User Manual e Import Samples gt chromat dir 4 chromat dir s A060 s 69 Network edit dir i B A326 r PB800HD _ gt Examplel proj Gi WEEER phd dir A454 s B Desktop A455 s LM Documents v A612 4 peter Format All Files HJ When you are done making your selection press the Open button CodonCode Aligner will read the files you selected and add the samples to the Unassembled Samples folder If any problems where encountered during import Aligner will tell you so by showing a dialog box For example if you already have a sequence with the same name as an imported sequence in the project you will be given a choice to ignore the duplicated sequences or to automatically rename them Adding a Subset of Samples To add only a subset of samples in a file to a project select Import gt Add Subset of Samples from the File menu This will show the following options dialog BOD Add Subset of Samples e Add samples that match the selected sequences O Add every 10 th sequence Cancel siii
202. file is open the version of the file is shown in the first line and the date of this version a few lines below To add your own enzymes to the file please make sure to use the right format Restriction Enzymes in Aligner 217 Closing Windows You can close regular Aligner windows for example the trace view and project view windows either by clicking on the close button at the top of the window or by choosing Close from the Window menu Aligner dialog windows for example the preference window can be closed by clicking on one of the buttons at the bottom often labeled Cancel and OK If a dialog window is active you need to close it before you can do anything else If you close the project view Aligner will check if the project has been modified since the last save If the project has unsaved changes Aligner will ask you if you want to save the changes first Closing the project window will also close all open windows that belong to the project If you are running Aligner on a Microsoft Windows operating system you also have a main root window which contains all other windows Closing the main window will exit Aligner again with the option to save unsaved changes in open projects On Mac OS X there is no main window You have to choose Quit in the Aligner menu to exit Aligner Closing Windows 218 Scripting CodonCode Aligner Some functions in CodonCode Aligner can be executed from scripts text files that conta
203. fore version 2 0 1 the local alignment algorithm is probably still being used unless you changed your assembly and alignment preferences Using the Reference Sequence as Consensus 84 CodonCode Aligner User Manual When working with samples that have large insertions or deletions or if you are trying to align cDNA to genomic DNA you should change the alignment algorithm to Large gap alignment in the assembly preferences and or the alignment preferences This will allow the alignment of multiple parts in one sequence to different sections in a second sequence for example exons in a cDNA sequence to the corresponding regions in a genomic DNA Local large gap and end to end alignments 85 Regions of Interest Features When looking at sequences or contigs you often may want to not look at the entire sequence but rather move quickly to specific regions of interest Of course what is interesting to you will depend on the kind of project you are doing For example if you are assembling a shotgun sequencing project you may be interested in regions of low coverage or low consensus quality but in a mutation analysis project you may instead be interested only in potential homo or heterozygous mutations To enable you to quickly find and navigate to your regions of interest CodonCode Aligner allows you to define features You can define a variety of different things as features for example gaps in samples or contigs discrepancies low
204. format is not intended for large projects with many samples for example Next Gen projects The old format creates at least two files for every sample in your project and needs significantly more disk space than the newer ccap format Exporting Aligner Projects in the Old Format 174 Exporting Protein Translation You can export protein translations to text files in FASTA format as follows Go to the project view e Select the sequences you want to export protein translations for use shift click to make continous selections and control click OS X command click to make discontinuous selections Choose Export gt Protein Translations in the File menu A dialog will appear where you can specify details about the output format BOD Export Protein Translation What to Export Selected Hd Consensus Sequence HH Region to translate Entire sequence frame 1 H Format FASTA Single file Cancel Export In the What to Export section at the top you can specify what part of the project you want to export protein translations for Use the left pull down to select whether you want to export only the current selection or all samples and or contigs The second pull down on the right allows you to select if you want to export samples consensus sequences or both You can choose between different regions to translate using the pull down in the middle The entire sequence frame 1 2 or3 The entir
205. from the end of a sequence and chewing into the sequence until a region that is good is encountered There are two different ways to define what is a good region End Clipping Algorithms 45 CodonCode Aligner User Manual 1 the average estimated error rate in a region calculated from the quality scores and 2 the number of bad bases bases with a quality below the defined threshold You can also define the length of the region and use different regions at the beginning and at the end of a sequence At the beginning where sequence quality improves rapidly a short window e g 20 bases can make sense while at the end where the sequences quality drops slowly a longer windows e g 50 bases can make sense You can use either one of the two definitions or you can use both together The advantages of this method are that a it is a bit easier to understand and b it gives you more options to tune the trimming exactly like you want it Method 2 Using separate criteria at the start and the end of thesequence 46 Trimming Vector Sequences Vector sequences in your sample sequences can lead to incorrect assemblies and therefore should be trimmed before assembly or alignment f you also plan to use end clipping to remove low quality sequence we strongly suggest that you do the end clipping before the vector trimming To remove vector contamination from samples follow these steps 1 Check your Vector trimming Preference
206. g above If you did not rename the executable and the problem persists it s time to contact CodonCode support Please send an email and include the following as attachments The Basecalling errors txt file the error dialog will tell you where exactly to find it The Aligner errorlog txt file from the CodonCode Aligner directory The status log file from the project directory A screen shot of the error message Please send all this by email to support codoncode com More about the Phred parameter file The newest versions of PHRED from the 2002 releases on optimize the base calling for different sequencing chemistries dye types and machines This requires that Phred can somehow determine the chemistry dye type and machine Phred does this by extracting the primer ID string from the input files The primer ID string looks something like this DyePrimer 21m13 or ET MegaTerm or DT3700POP5 BD v3 mob PHRED looks up the primer ID string in the Phred parameter file which tells it the dye type chemistry and machine through lines like this one DT3700POP5 BD v3 mob terminator big dye ABI 3700 There are many different dye primer strings and new ones get added all the time If your sequence traces contain one that is not yet in the Phred parameter file PHRED will refuse to call the bases in this trace and generate an error message In Aligner this leads to the Missing entries in the Phred parameter file err
207. g fe Maximize region with error rate below 0 1 Use separate criteria for start and end r Trim from start until Double clickin nd clipping 2 Se v Error rate is below 0 1 ina 25 base window M D ESSERE Features There are fewer than 3 bases with quality Highlighting below 20 ina 25 base window License Server Memory Mutations Open amp save Phrap assembly Preference options below 20 ina 25 base window Printing Protein translation Sample names Startup Vector trimming Trim from end until PE v Error rate is below 0 1 ina 25 base window There are fewer than bases with quality r After end clipping vi Move all sequences shorter than 25 bases to trash v Move all sequences with fewer than 50 f Phred 20 4 bases to trash Description The end clipping preferences control how low quality bases are clipped from samples end clipping works only on samples with qualities On the top you have the choice between two different end clipping methods 1 a method that maximizes the region with an estimated error rate below the threshold you define and 2 a method that uses different criteria at the beginning at at the end of the reads The first method is similar to the way Phred trims sequences with the trim alt option The second method gives you more options and is hopefully a bit easier to understand With typical parameters both methods tend to give simila
208. g frame all three forward frames all six forward and reverse reading frames and annotated coding regions To see the translation of annotated coding regions the reference sequence for alignments to a reference sequence or the consensus sequence for other contigs must contain codingSequence tags that describe which regions are coding Typically this display is used together with reference sequences imported from Genbank or EMBL formated files CodonCode Aligner will use the coding sequence annotation from these files if it is present Amino acid names are commonly represented by a single letter A Alanine or an abbreviation Gly Glycine The Single Letter and Abbreviation choices let you set your preference for the consensus protein translation The color of start and stop codons in the consensus translation can be changed to make them easier to see Use the Start and Stop color lists to select the colors you want For the consensus translation any gaps in the consensus sequence are ignored in the translation This is different from the translation of individual sequences described in the previous section Consensus Translation 277 Restriction Map Preferences In the restriction map preferences you specify which enzymes to use for generating restriction maps and how to display the results To change the restriction map preferences select Preferences from the Edit menu on Windows or from the CodonCode Aligner menu o
209. g the existing alignment of reads in the contig To re assemble one or more contigs from scratch Go to the project view e Select the contig contigs or contig s and sample s you want to assemble from scratch keep the shift control or command key pressed to make continuous or discontinous selections as described above Go to the Contig menu and move to Advanced Assembly e Select Assemble from scratch Aligner will first unassemble the contigs you selected and then assemble all the samples in the contig s and any other samples you had selected You will see a progress dialog while Aligner is assembling Note that the resulting number of contigs may be different from the initial number of contigs if you want to just re assemble contigs without merging the contig with other samples make sure to just select one contig before choosing Assemble from Scratch If your selection contained only unassembled samples assemble from scratch will do exactly the same thing as Assemble would do Assemble from scratch 62 Sequence Assembly With Phrap While CodonCode Aligner allows you to do assemblies with its own built in assembly algorithm Aligner also supports assembly with the assembly program Phrap see below for more information about Phrap Using Phrap to generate assemblies may give better results in large projects for example for shotgun assemblies of BACs To assemble sequences with Phrap e Select the sampl
210. g view that shows the contig select the bases you want to tag in the consensus sequence and then right click OS X control click on it to display the popup menu The second menu item in the popup menu will be Add Tag to AII Selecting it will bring up the same dialog as when adding a tag to one sample Instead of using the popup menu to add tags to all sequences at the same position you can also go to the Sample menu and select Add Tag to All from the Tags sub menu Adding Tags 140 Saving Edits Edits to the consensus sequence or sample sequences are not saved until you save the project by selecting Save Project in the File menu or using the corresponding toolbar buttons or keyboard shortcut Command S on OS X Control S on Windows If you are experimenting and think you might want to go back to a previous state that your project was in you should save the project under a new name by going to the File menu and selecting Save Project As This will save all data for your current project to a new location You can change the name of individual samples which will then save them under a different name the next time you save the project by selecting the sample and choosing Sample Information from the Sample menu and editing the sample name For more information please read the Sample Information Dialog help page Saving Edits 141 Undo and Redo In the current version of Aligner only limited suppor
211. gh to extend alignments through very large gaps like large introns Support for Large gap alignments will be added to later versions of Aligner The bandwidth parameter is ignored when the large gap alignments algorithm is used for assembly Word Length The word length parameter determines the size of words that CodonCode Aligner uses when looking for potential overlaps between sequences Only sequence pairs that have perfect matches of at least this length will be considered for merging If you are trying to assemble sequences with high error or mutation rates reducing the word length may help to get samples aligned For very large projects or projects with many repeat sequences larger numbers may give faster assemblies and better results The impact of the word length setting on the assembly speed depends on the size of the project for large projects larger word length values can lead to faster alignments Maximum Successive Failures This parameter is only relevant for larger assemblies with tens or hundreds of reads It can be used to limit how long Aligner will try to merge contigs for very large projects with larger numbers meaning more tries and longer assembly times but potentially fewer contigs In detail Aligner will initially look for overlaps between all samples and then use this map of overlaps to merge samples into larger and larger contigs If two samples are already in contigs Aligner will try to merge the con
212. ginal base calls to the trash and imports the subtracted trace with the new Phred base calls Finally Aligner re aligns or re assembles the original contig adding the newly created subtracted traces Here is what the final result looks like Processing Heterozygous Indels 104 CodonCode Aligner User Manual oo Hetero indel i B i m x Save Project Add Samples Add Folder Add Assembly Align to Reference Assemble Unassemble Contents Length Quality Position Added Mo C ul Unassembled Samples 0 samples 0 0 4 28 3J v BS Contigi 3 samples 595 0 3 16 3 wildtype Trace 592 510 09 26 3 heterozygous_indel Trace 590 155 5 9 26 3 BB heterozygous indel Trace 580 436 12 3 16 3 gt C Trash 1 samples 0 4 28 3 a Processing heterozygous indels completed Contig1 v Scroll together heterozygous indel Base 173 of 590 178 in contig Quality 39 F The newly created subtracted sample is called heterozygous_indel_sub Note that a its sequence after the single T insertion is identical to the wild type unlike the original sample where the extra peaks led to extra base calls and that b the quality scores of the sequence after the T insertion are higher as indicated by the lighter background colors Before getting too excited however please read the next section Processing Heterozygous Indels 105 CodonCode Aligner User Manual Limitations Wh
213. gl csv C D i Found In Parent Contig Start heterozygoteCG va l x Contigit heterozygoteCG va 23 x Contigit homozygotecC va 16 x Contigi 53 homozygoteCC polyPhred va 13 x Contigi 6 polyPhredRank3 polyPhred Contigit Contigi heterozygoteAT polyPhred va 13 x Contigi 8 hemezygoteAA polyPhred va i x Contigi homozygoteAA polyPhred va 16 x Contigit homozygotes A polyPhred va 23 x Contigi polyPhredRanki polyPhred Contigi Contigi heterozygoteAC polyPhred va 16 x Contigi homozygoteCC polyPhred va 1 x Contigi homozygotecc polyPhred va 23 x Contigit 15 lhomozygoteCC polyPhred va 13 x Contigi 16 polyPhredRank3 polyPhred Contigi Contigi Contigl sv Sum OSCRL OCAPS 8 7 Exporting Features 173 Exporting Aligner Projects in the Old Format Older CodonCode Aligner versions before 4 0 cannot read Aligner project files create by version 4 0 and newer If you or a collaborator needs to open a CodonCode Aligner project with an older version of CodonCode Aligner you need to export the project in the old format To export projects in the old format choose Export gt Aligner Project Old Format in the File menu This will create a new folder with the project name that contains a proj file and several sub directories The project folder and all its contents and not just the proj file constitute a project in the fold format Please be aware that the old project
214. gram files in SCF Standard Chromatogram Format format as follows Go to the project view e Select the samples you want to export use shift click to make continous selections and control click OS X command click to make discontinuous selections Choose Export gt Samples in the File menu This will display the following dialog Export Sequences r What to export fe Selected sample Q All samples Format FASTA Single file Hj Options gt Cancel Cr Using the radio buttons at the top select to export just the selected samples or all samples in the project The Format pull down menu gives you the following format choices Single FASTA file This will generate a single text file in FASTA format which contains all the exported sequences You can specify the name and location of the file in a Save As dialog box that will be shown when you click the Export button Individual FASTA files This option allows you to create a separate file for each sample Again this is a text file in FASTA format each file contains exactly one sequence You can choose the folder where the files are created in a Save As dialog that will be shown once you click on the Export button All files will be created in the same folder the names of the files will be the sample name with fasta appended e SCF files SCF files contain the current base calls as well as the chromatogram data and allow you
215. he bottom determines the highest quality a base can have to be edited with the default setting any base with a quality score of 30 or higher will not be edited Call Second Peaks Higher Than The Call second peaks option allows you to convert all bases with a significant secondary peak to ambiguities You can set the threshold of secondary peaks relative to the intensity of the first peak in the Change Bases Option dialog the default is 25 Automatic Edits 128 CodonCode Aligner User Manual This method can sometimes be useful in mutation detection Please note however that it is much simpler than the methods used in CodonCode Aligner s Find mutations function and therefore much more prone to both false positives and false negatives For example the Find mutations function compares peaks at a given position to other peaks in other samples at this position and can therefore detect heterozygous bases from a drop in peak intensity even if the secondary peak is very small Change Ambiguities to Single Bases This is the reverse of the previous function any bases with ambiguity codes will be converted to regular bases A C G or T according to the highest peak at the base position This option is useful if you have sequences that contain ambiguity codes but you know that there are no heterozygous bases for example because you sequenced a clone not a PCR product Change Low Quality Bases to N This option allows y
216. he list Selecting Enzymes 279 CodonCode Aligner User Manual The enzyme name and recognition sequence for the enzyme currently selected are shown below the list Restriction Map Options The Restriction Map Options tab in the restriction map preferences allows you to change how the map is displayed and which DNA type to use ANON Preferences Alignment Restriction maps Assembly Base calling Restriction Enzymes Base colors r Clicking amp scrolling V Display Non Cutters Consensus method isplay Cutters End clipping M Mcd Features r Show only enzymes that cut Highlighting cuenta License Server M 1x M 2x M 3x V 4x amp More pets Memory oe E Mutations r Map style Open amp save 9 Single Line Multiple Lines Text Virtual Gel Phrap assembly Preference options Show results as Printing Protein translation e Cut Positions Fragment Sizes Sample names V List cutters at bottom of map Startup Toolbars DNA type Vector trimming 9 Linear DNA Circular DNA Views eit E i Warnings Window placement Description The restriction map preferences control which enzymes to use for creating the restriction map and how to display the results Help Cancel In the first section you can select if cutting and or non cutting enzymes should be displayed If you choose to display cutters you can set how to show them and the cut results in the
217. he names of the sequences used from this collection were changed for illustrative purposes We thank Dr Nickerson and all others who have made traces with heterozygous indels available to us The use of trace subtraction to identify heterozygous point mutations was originally described by Staden Rada and Bonfield and implemented in the program TraceDiff Bonfield JK Rada C and Staden R 1998 Nucl Acids Res 26 3404 3409 Early work on the algorithms for analyzing heterozygous insertions and deletions used in CodonCode Aligner was funded by the National Cancer Institute SBIR grant 1R43CA83384 01 Interpreting Results 107 Methylation Analysis CodonCode Aligner can be used to analyze methylation of cytosines after bisulfite modification PCR and capillary sequencing In the sequencing traces non methylated Cs will be converted to Ts while methylated Cs in CGs will remain as Cs If the original template DNA was partially methylated mixed C T peaks will be observed at methylation sites Often the reverse strand is sequenced so that Gs are converted to As at non methylated sites and remain as Gs at fully methylated sites Please note that methylation analysis is a new feature in CodonCode Aligner that has been developed with only a limited set of test data Performance may vary for your data If you have data where the results seem questionable please contact CodonCode s support team Prerequisites Raw ABI Data To analyze meth
218. he new color then press OK to use this color or Cancel Preview Sample Text Sample Text Sample Text Sample Text 244 Base specific colors Translation based background colors To draw based on a background that indicates the amino acid translation select the Translation based radio button in the Base colors preferences Alignment r Base colors Assembly Trace colors Base calling Ba A s green HJ Consensus method We A red Double clicking Ts B End clipping G s Bf black Features Highlighting C s Miu 9 License Server N s Memory iani _ Show traces on black background Open amp save r Background colors Phrap assembly Preference options Quality based 3 colors continuous scale Printing By nucleotide ignore quality Protein translation eo Translation based Restriction maps Sample names Select your main color scheme specify details below Startup r Background color details translation based 2 ee Amino acid color scheme Modified GDE F Vector trimming Views Warnings Window placement r Description The base colors preferences control the colors used for drawing traces If By nucleotide is selected bases are drawn the same color as their trace colored bases use the same background color as traces This scheme will use background colors that are based on the prot
219. iefly For more detailed descriptions follow the links for each window or read the sub topics in the Aligner Windows help section The Main Window On Windows opening CodonCode Aligner will open the main application window root window which contains the application menu and all other windows opened by Aligner Since CodonCode Aligner follows the common user interface standards for Windows and Mac OS X there are some user interface differences between the Windows and OS X versions On Mac OS X there is no such root window Instead the main menu bar at the top of the screen is used When you first start Aligner on Mac OS X a startup dialog is displayed that allows you to open an existing project or create a new project e CodonCode Aligner Startup Aligner 9 Open a recent project Users Shared Projects MyProject1 7 Open an existing project Create a new project No longer show this dialog FROME Cancel After selecting or creating a project the project window described in the next section will be shown If you hit cancel or previously selected the No longer show this dialog checkbox you will not see this window the application will have only a menu bar without any windows On Windows the same dialog is also shown upon startup CodonCode Aligner Features 7 CodonCode Aligner User Manual Project Window To do anything in CodonCode Aligner you must create a project or open a p
220. iew windows at the _ top left x Consensus method corner of the screen Double clicking End clipping r Trace view Features Highlighting fV Place new Trace view windows blow ss License Server Memory Mutations rFeature view Open amp save Phrap assembly fV Place new Feature view windows _ to the right of kA Preference options Printing the Project view HJ window Protein translation Sample names Startup Vector trimming the Contig view window Description These preferences allow for placement of new windows relative to other windows or the screen If no placement option is selected for a view new windows will be added cascaded Cancel OED Using the check boxes and drop down menus you can select where Aligner places contig views trace views and feature views when opening new windows For contig views you can select any of the four corners of the screen or the root window on Windows For trace views you can select where to place trace views relative to the contig view common choices are to put trace views below or to the right of the corresponding contig view For feature views you can select where to put newly opened feature view windows relative to the project view or relative to the corresponding contig view If the check boxes are unchecked or if a window used for relative placements are not shown Aligner will add windows cascaded so that each n
221. ifferences compared to the consensus after considering all other filters Without checking this filter if one of the samples has a difference at a position your difference table will include the base for each sample at this position Checkign the filter will only show the samples that have the difference Display options for the difference table 196 CodonCode Aligner User Manual Show all columns and rows will cancel all filters and show the difference table with all differences for this contig Clicking on Set filters and thresholds opens a dialog that allows you to set the thresholds for some filters Here you can set the quality threshold for the filter that shows only differences below a certain consensus quality and you can set the frequency cutoff for the filter that allows you to only show differences above a certain frequency CY Difference Table Filters Exclude Ns _ Exclude non gaps V Exclude high consensus quality q gt 40 M Exclude low frequency changes f 0 02 _ Hide rows without changes C ms GOD The example below shows a difference table where all filters were used The resulting difference table does not contain any columns where the only differences are Ns all of the shown differences have a gap the table only includes differences that have a consensus quality of less than 60 all differences shown occur in at least 2 of the samples and rows without changes relative to the consensus are not
222. igner may differ from the parameters found in the Primer3 online help Additional Information 119 Editing Samples CodonCode Aligner allows you to edit your sequences but before you start editing remember that You may not need to edit This is because Aligner will examine the quality scores of all aligned bases at each contig position when building the consensus in other words Aligner typically builds a quality based consensus rather than a majority based consensus In the days before Phred quality scores editing discrepancies was important consensus sequences were always majority based and the only way to make sure that the consensus sequence was indeed correct was to look at the discrepancies Typically scientists would simply correct any wrong base calls so that they would not have to look at the same region again With samples that have Phred or Phred like quality scores and sequence assembly algorithms that use the quality scores a lot of this editing is not necessary anymore Typically wrong bases will have lower quality Scores and the correct consensus can be determined automatically by just looking for the highest quality base at any position The low quality discrepancies can often safely be ignored Here is a typical example a region covered by two sequences which differ at several places Editing Samples 120 CodonCode Aligner User Manual Show differences e
223. igner will display the intensities for the four lanes If both processed and stretched raw traces are currently displayed the value for both traces sets will be shown Stretching raw data When comparing raw ABI data to the processed ABI chromatograms one problem is that the base positions in the processed traces can be very different from the raw data Often the raw data have many additional data points that have been clipped off in the processed data furthermore peak spacing in the raw data can be very different from the processed data since the ABI processing software tries to even out the spacing between peaks To enable the comparison between raw and processed ABI data CodonCode Aligner tries to clip and stretch the raw data so that the base positions roughly match the base positions in the processed data There are some important differences however e Data are only stretched horizontally not vertically intensities are not changed e Shift between the lanes is only partially corrected e Stretching is estimated and will not be exact This is especially true near the start of a trace therefore bases near the start of the trace will be excluded from methylation analysis For some sequence traces the raw data stretching algorithm fails and such traces cannot be used for methylation analysis Such failures may be caused by a number of factors which include poor quality low raw data intensity high background levels and unusu
224. ile gt Open Sample You should see the following dialog NYDN Roundtrip Editing 156 CodonCode Aligner User Manual eoo Update Existing Contig The samples you are trying to import are part of a contig Do you want to update the contig from the imported samples or add a new contig to the project e oS Do not show this warning again Add Click on Update Aligner will import the sequences and update the existing contig to reflect your edits Limitations Currently this Roundtrip Editing functionality is limited You can move gaps around in external editing programs but you cannot change or delete any bases Here is a list of additional restrictions Updating existing contigs will work only when importing files in NBRF PIR format All sequences in the file must be exactly the same length including leading and trailing gaps note that some programs e g BioEdit may not always make sequences of equal length when exporting in NBRF PIR format e The names of the samples in the imported file must be identical to or sufficiently similar to the names already in the project Note that some programs do not allow spaces dashes or other funny characters in sequence names and that many programs and file formats restrict the length of sequence names The only edits currently supported are gap movements if you edit insert or delete bases the updating will fail e If the exported contig had
225. ile we believe that CodonCode Aligner s functions for analyzing heterozygous insertions and deletions can be a valuable tool it is important to keep a number of limitations in mind limitations regarding the performance of the algorithms and limitations regarding the interpretation of the results Processing Pre Requisites and Limitations Finding heterozygous indels requires base specific quality scores The algorithm will not work on sequences that do not have quality scores Most testing so far has been done on sequences processed with the base calling program PHRED The analysis will work only in regions of reasonably high quality and not close to the start or end of sequence traces Both the finding and the subtraction step require that sequence quality before the heterozygous indel is reasonably high for example multiple peaks need to be well resolved and the indel cannot be closer than approximately 50 bases to the start or end of the sequence In addition indels in or after long mono or dinucleotide repeats will generally not be found since such repeats often result in polymerase stutter which looks very similar to heterozygous indels Trace subtraction requires a sequence without heterozygous indels If all your sequences have heterozygous indels the subtraction does not work Ideally the wild type sequence should not have any heterozygous mutations however isolated heterozygous point mutations may be tolerable The wild typ
226. imer M Reverse Primer Target region 51 to 1610 Primer length 18 2 to 22 B Tm C 57 to 62 GCX 20 to 80 7 PCR Primer Details Choose optimal primer location within 50 bp of target f Primers end exactly at region to amplify Add Hybridization Probe Set Probe Characteristics Number of primer pairs to show 5 g gt Conditions gt Advanced Settings Defaults Based on your selection if you want to design primers for PCR or for Sequencing the details for this dialog will change Cloning primers can be created by selecting PCR and choosing Primers end exactly at the region to amplify in the PCR primer details When the dialog is first shown the target region is either set to the whole sample minus the range to pick primers in or to the selected bases of the sequence template The maximum primer length is 35 bases The optimal primer length and optimal Tm are always the median value of minimum and maximum All values except for the target region are remembered Original values can be restored at any time by pressing the Default button at the bottom of the dialog PCR Parameters When designing PCR primers you have the following options as can be seen in the image above Primer Design Parameters 113 CodonCode Aligner User Manual Choose primers within a certain range of your target region or pick primers exactly at the ends of the target region
227. in a collection of commands and have the extension alscpt Scripts can be opened using Open from the File menu or by drag amp drop Some commands allow you to specify files or folders for example for importing Please note that any file or folder names that contains spaces must be surrounded with quotes If the file or folder names contain quotes change the quotes in the names to double quotes For example a file Users Shared Name with quote should be written as Users Shared Name with quote In scripts the same logic as when using CodonCode Aligner normally applies Specifically to do something like end clipping or assembling you must first select the samples or contigs to work with Here is an overview of the available commands File menu Command Parameter Comments newProject Creates a new project full path to project file e g Users Shared My Project My Opens an existing project Project proj full path to folder Imports a folder of samples full path to project file Imports a project full path to sample file Imports a sample Required file full path to sample file Optional exportConsensus exportAll true or false Exports consensus sequences writeQuals true or false gapped true or false format Fasta or Haplotypes none Closes a project Saves a project full path to project file e g Users Shared My Project My Project proj emptyTrash none Empties the trash Selecting
228. in contig Quality 21 Cons 90 _ Hiding lanes will affect only one trace and only until it is closed re opening the trace will show all traces again You can also press the shift key and or the alt key while clicking in the base boxes to hide more than just one trace Shift click to hide all traces except the one for the base you are clicking on in the current sample shift click again to show all traces again Alt click to hide the trace for this base in all samples in the trace view window alt click again to show the trace in all windows again OS X users can also use the command key instead of the alt key Alt Shift click to hide all other traces in all samples Repeat to show all traces in all samples again Try it out Hiding Some Traces 186 CodonCode Aligner User Manual Printing Traces To print the traces that are currently in your trace view first select the trace view and then choose Print from the File menu or use the keyboard shortcut Control P on Windows Command P on OS X This will show the a print preview dialog like the one below eoe Print Preview of Trace View r Trace Printing Options Page Setup What to print Entire traces HJ Vertical trace scaling f Scale each panel to highest peak 1 Fit traces to page l Print trimmed ends Cancel C Print On the left you can choose whether to print the entire traces or just what you see on the scree
229. in the overview can be displayed stacked or packed The stacked layout stacks the samples one under the other This layout is great for small projects or if you sort your samples 1 fr MPS MEZNE Show differences Arrow Layout gk Qe d Packed V Stacked Color arrows by strand CACCTCCTCCACAAAAAAA MaAAAATACTAAGTAGATGA AGAACH CA CAAAAATACTAAGTAGAT CA Contigl CACCTCCTCCACAAAAAAAGAAC AAAAATACTAAGTAGATGATCACAC comtat soo to fazo 830 84 Pos 817 2531 Qual 10 C The packed layout packs the samples in the overview so you can see more of your sample arrows at once Navigating using the overview panel 193 CodonCode Aligner User Manual Fo Tor Contig x pd d S Fe 7 A Xr LL Stacked p 3 v Color arrows by strand 2 000 bp ap 0 11 djs74 2361 s1 T ACCTC TCCACAAAAANAGAACAARNATACTAAGTAGATGATCACA lt lt djs74 1802 s1 TCACCTCCTCCACAAAAAAAGAACAAAAATACTAAGTAGATGATCACAC djs74 996 s2 djs74 2689 s1 Contigl Pos 817 2531 Qual 10 C 4 gt This layout is very useful for larger projects The packed layout dismisses the sort order of the samples to pack them if you want to see your samples in the same order in the bases panel and in the arrow panel use the stacked layout The arrow layout can be chang
230. in your contig not counting the reference sequence and if all samples overlap by at least 20 bases Phylogenetic trees can become invalid if you change the contig that was used to build the tree Actions that will invalidate a phylogenetic tree include for example base edits changing the start or end position of the alignment moving gaps and deleting bases An invalid tree is shown with a red cross drawn through it as shown in the example below Phylogenetic Trees 201 CodonCode Aligner User Manual e tgComparison E Hu t i 3 o 7 Print Reverse Build Tree View Traces Colors Bases lt gt Transl MaskMatches Help Exclude v AAAACAAAACAATAAQAAT AAAACAAAACAATAABAATI AAAACAAAACAATAAQA AAAACAAAACAATAAQAAT MeAAAACAAAACAATAACAA RAAACAAAACAATAACAA RAAACAAAACAATAACAA MRAAACAAAACAATAACAA LAACAAAACAATAAGAA M Topology only 30 M Label branches If a tree is invalid can also be seen in its tooltip when moving the mouse over the tree Building a tree again will generate a new valid tree and delete the old tree Split Contig From Tree If you have a phylogenetic tree for your contig you can split the contig using the tree For example if you want a separate contig for a part of the tree where the samples have many differences compared to the rest you can use this feature to split the original contig To split a contig using its phylogen
231. indows Two other folders also exist in every project the Unassembled Samples folder and the Trash Any samples that have been added to a project but not yet assembled or deleted get added to the Unassembled Samples folder If you don t want a sample in your project anymore you can move it to the Trash by selecting the sample in the project window and then selecting Move To Trash in the Edit menu If you later change your mind you can move samples from the trash back to the Unassembled Samples folder Within the project view you can also use drag and drop to move samples and even contigs around You can drag samples from the Unassembled Samples folder to the Trash and the other way round you can drag samples in contigs or entire contigs to the trash or to the Unassembled Samples folder and you can add samples to existing contigs by dragging them from the Unassembled Samples folder onto the contig you want to add them to of course the samples then align with the contig for more details check the Assembly and Alignment help section Please note that CodonCode Aligner version 4 0 introduced a new project format Older CodonCode Aligner versions saved projects in a separate folder that contained several files and sub directories CodonCode Aligner version 4 0 and newer saves projects in a single file with the file extension ccap which you may Aligner Projects 18 CodonCode Aligner User Manual not see depending
232. ing on your system settings you may not be able to see the extension After you selected the assembly file CodonCode Aligner will read the file and any associated files like chromatogram files If any of the samples or contigs in the imported assembly have the same names as files that are already in your project Aligner will give you a choice to either rename the files or to cancel the Adding a Subset of Samples 24 CodonCode Aligner User Manual import Importing Sequencher Projects CAF Files Many current and former users of the assembly program Sequencher have expressed the desire to import existing Sequencher projects into CodonCode Aligner While CodonCode Aligner cannot read Sequencher project files directly it is easy to export Sequencher projects in a file format that CodonCode Aligner can read the CAF file format for Common Assembly Format Exporting Sequencher Projects as CAF Files To import a Sequencher project into CodonCode Aligner you must first export the project from Sequencher in CAF format as follows 1 Open the project in Sequencher 2 Select the reads and contigs you want to export use Select All from the Select menu to export the entire project 3 Go to the File menu and select Export gt Selection As Subproject This will open a Save dialog 4 Click on the File Format pulldown menu and select CAF 5 Use the New folder button or icon to create a new folder to export your pr
233. ing with large reference sequences for example genomic sequences for multi exon genes CodonCode Aligner can automatically trim the alignment to the covered region For example you may use Align in Groups to generate separate contigs for each of the exons for a gene with many exons where the reference sequence may be 100 000 bases long Clipping uncovered regions can reduce the size of each exon alignment to just the size of the exon optionally leaving 50 100 or 250 bases additional sequence on each side Clipping is done after alignment based on a coverage by samples other than the reference sequence and b coding sequence annotation of the reference sequence For example when clipping to 100 bases and all your sample align inside the coding region the resulting contig will be clipped so that 100 bases before the start and after the exon of the exon region remain If the alignment of samples extends to before the start of the coding sequence then the clipping will be moved accordingly leaving 100 bases before the first aligned base Bandwidth Maximum Gap Size 228 CodonCode Aligner User Manual If the clipped reference sequence contains multiple exons and a valid codonStart tag the codonStart tag will be moved as needed For example if the first two exons are removed when clipping a codonStart tag will be added to the third exon It will be placed on the first second or third base depending on where the first complete co
234. ing with less than perfect data To go back to the original traces just click the little button in the bottom left corner again You will notice that showing the sharpened traces may take a few seconds the first time especially if the trace view shows several traces This is because the trace sharpening is rather computation intensive When looking at the sharpened traces keep in mind that you are looking at a mathematical artifact which occasionally may give an incorrect impression so always look back at the original traces too and use your scientific judgement Colors and Highlighting The colors in the Trace view are determined your color preferences in the example above a quality based 3 color scheme was used You highlighting preferences determine how discrepancies edits and tags are displayed For more information please check the Preferences help section Automatic Trace Selection For trace views that show samples in contigs CodonCode Aligner can automatically pick traces to display while you are moving around in a contig You can turn this option on or off by selecting Auto Select Traces in the View menu You can also set the number of traces to be displayed in the Views preferences For automatic trace selection to work you need to first open both the contig view and the corresponding trace view for example by double clicking in the overview panel in the contig view Once both views are open Aligner will aut
235. is position are summed up Now if one of the four possible bases A G C or T got more than 5046 of the total score this base is used as a consensus Otherwise an ambiguity code that represents all base calls at this position is used For example if there are just two samples one A and one W meaning A or T then A will be used for the consensus If one base is A and the other B then N will be used for the consensus For sequencing projects where the goal is to determine the correct sequence of a gene a quality based consensus sequence will generally be better than a majority based sequence For example if a region is covered by only two samples the majority consensus will contain ambiguity codes at all discrepancies while the quality based consensus will pick the higher quality base which is most often the correct one However a majority based consensus can make sense for other types of sequencing one example is genotyping a number of samples where the majority sequence will show the most common allele Inclusive Consensus The inclusive consensus method looks at all aligned bases at each position and generally uses the IUPAC ambiguity code that represents all bases present at a given location If the majority of bases at a location are gaps then a gap character will be used Percentage based Consensus The percentage based consensus method is similar to the inclusive method except that you can set a threshold perce
236. ith muscle CodonCode Aligner does the following 1 Aligner examines your current selection to see if any contigs or samples need to be reverse complemented before alignment and reverse complements these contigs and or samples 2 Aligner generates an input file for muscle 3 Aligner starts muscle and waits for the alignment to finish During this time a progress dialog is shown Please note that alignments with muscle can be slow especially if you align many contigs or samples and if your contigs are large 4 When muscle is finished CodonCode Aligner analyzes the output generated by muscle and creates a new contig from the muscle alignment Aligner also calculates a consensus sequence for the alignment Please note that muscle removes any existing gaps before performing alignments Unless gaps are re introduced at the same position during the alignment CodonCode Aligner will have to delete the gaps in the contigs when importing the alignment results This can in turn lead to the deletion of non gap characters in samples at this contig position Typically these deleted bases are random errors If you want to avoid such automatic edits you can either use ClustalW or the built in algorithm to create the alignments or you can change the Consensus method preferences to replace in the consensus sequences with n Algorithms for comparing contigs ClustalW muscle built in Compare contigs to each other 60 CodonCode Aligner User
237. k out any differences double clicking on a sequence in this contig of contigs will bring you straight to the sequence traces You can choose between the widely used alignment programs ClustalW and muscle or use the built in algorithm Assemble from scratch this will unassemble any existing contigs in your selection before starting the assembly This option can be useful too if you want to undo manual introduction or movement of gaps or to try different assembly parameters Assemble with PHRAP this option will use the assembly program PHRAP rather than CodonCode Aligner s built in methods for sequence assembly It can be useful for larger shotgun assemblies Assemble with preprocessing Assemble with preprocessing lets you do common pre processing steps like end clipping and vector trimming before assembly 1 Select the unassembled samples and contigs you want to work with in the project view 2 Go to the Contig menu move to the Advanced Assembly submenu and select Assemble with Preprocessing 3 In the dialog that pops up click on the Preprocess tab and select the checkboxes you want to use Here is what the dialog looks like BOO Assemble with Preprocessing vi Pre process unassembled samples Base call samples without qualities Find heterozygous indels v Clip ends v Trim vector This panel lets you choose how Aligner should pre process any unassembled samples before assembly Note that your pre p
238. l Hindlll Kpnl Notl Sacl Sacll Sall Smal Xbal Xhol You can change the display options and the enzymes used to generate the restriction map Customizable Toolbars All the views described above have the option of showing a customizable toolbar The toolbar contains buttons which provide quick access to the different features in CodonCode Aligner without having to go through the menu You can customize the toolbar for each view either through the toolbar preferences or directly through a popup menu from each toolbar When using the popup menu you can remove a selected button by choosing Remove Item from the popup To add buttons to the toolbar using the popup menu choose Customize Toolbar from the popup which will open the toolbar preferences for you The toolbar buttons can be shown as text as icons or as text amp icons which can also be set directly by using the popup menu or through the toolbar preferences You can hide the toolbar by selecting Toolbars gt Hide Toolbars in the View menu If you do not see the toolbar at the top select Toolbars Show Toolbars in the View menu to make it visible Regions of Interest One concept in CodonCode Aligner that deserves a closer look is the ability to define regions of interest more often called features Aligner lets you define what is of interest to you for example low quality consensus regions discrepancies mutation tags and so on You can then use this defini
239. l be displayed Methylation results in Contig1 143 Feature Source Found In Parent C Start End Content methylation Aligner Sample3 Contigl1 135 135 0 946 G 3421 64 3357 A 371 178 2193 128 methylation Aligner Samplel Contigl 135 135 0 124 G 114 38 76 A 634 95 539 128 methylation Aligner Sample2 Contigl 135 135 0 242 G 884 112 7772 A 2621 202 2419 128 methylationRange Aligner Contigl Contigl 135 135 Methylation range 0 124 0 946 methylation Aligner Sample3 Contigl1 144 144 0 933 G 3070 50 3020 A 401 183 7218 137 methylation Aligner Samplel Contigl 144 144 0 075 G 75 36 39 A 551 71 480 137 methylation Aligner Sample2 Contigl1 144 144 0 253 G 779 108 671 A 2237 254 1983 137 methylationRange Aligner Contigl Contigl 144 144 Methylation range 0 075 0 933 In this example the result window shows regions that were of low quality and therefore not analyzed at the top Below are methylation results for individual samples and a summary for a given contig base that shows the observed methylation range The numbers in the Content column are as follows 1 The calculated methylation ratio 2 The intensities of the raw data peaks in the analyzed region for the two analyzed lanes C and T or G and A The lane is shown first followed by the raw intensity the estimated background at the peak location and the net intensity raw background 3 The ungapped contig coordinates of the analyzed base Double cli
240. lastn The Nucleotide blastn option can be used to initiate a comparison of nucleotide sequences against nucleotide databases Translated blastx The Translated blastx option can be used to initiate a comparison of a protein translation of your nucleotide sequences against protein databases Translated tblastx The Translated tblastx option can be used to initiate a comparison of a protein translation of your nucleotide sequences against a protein translation of the nucleotide databases For more information about BLAST please visit http www ncbi nlm nih gov blast BLAST Searches 160 Exporting Sooner or later you will probably want to use the data you see with Aligner with other programs For example you may want to use BLAST to compare the consensus sequences to nucleotide databases or you may want to export read names and reads lengths for importing into spreadsheets or databases You can export the key data in Aligner projects using the various sub menus in the Export menu in the File menu To export samples or consensus sequences first select what you want to export in the project view Then choose one of the following export options Export Project Summary Export Samples Export Consensus Sequences Export Assembly Export Aligner Project Old Format Export Features Export Protein Translation Export Differences Export Trees Aligner will then sho
241. litting will typically have missing peaks or lots of double peaks The separated pseudo alleles are currently only intended for indel size estimates and manual verification Specifically any differences in peaks between the shorter and the longer allele after the indel site may or may not be real even real differences may be attributed to the wrong allele Processing Heterozygous Indels To analyze process heterozygous indels in Aligner the samples to be analyzed need to have a heterozygoteIndel tag These tags can be added by CodonCode Aligner or manually as described in the preceding section In addition the sample to be analyzed and the corresponding wild type trace must be in the same contig before heterozygous indels can be processed since CodonCode Aligner uses the alignment information when subtracting the wild type trace To illustrate the entire process of analyzing heterozygous indels let us process the Hetero indel example project that comes with CodonCode Aligner False Negatives 103 CodonCode Aligner User Manual e Open the Hetero indel example project in the Example Files directory inside the directory where you installed CodonCode Aligner e Select the sample named heterozygous indel Go to the Sample menu and select Find Heterozygous Indels When Aligner is done with the previous step select the Unassembled Samples folder in the project view Go to the Contig menu and select
242. low Phrap down dramatically In extreme cases for example trying to assemble a bacterial genome on an underpowered computer this can even lead to system crashes Phrap tries to identify different copies of repeats during assembly based on the quality scores of samples This means that assemblies will be better if you have accurate quality scores rather than just dummy qualities If your samples have high quality discrepancies for example because you are trying to assemble samples with homozygous mutations this may lead to a higher number of contigs than you would expect Occasionally contigs created by Phrap will contain reads that are not aligned to the consensus sequence You can manually remove these reads in Aligner using one of the different Move To options Like every assembly program out there Phrap will occasionally produce incorrect assemblies For example multiple copies of highly identical repeats may all be piled up on top of each other You can use Aligner s interactive features to move such misassembled reads to the trash or the Unassembled Samples folder About Phrap The assembly program Phrap was developed by Phil Green at the University of Washington Phrap was widely used for sequence assembly in the Human Genome Project and still is often regarded as the standard for sequence assembly CodonCode Corporation distributes Phrap executables for a variety of platforms including Windows and Mac OS X under license
243. lt gt ke ta edit_dir E contains the ACE file and related text files gt phd dir contains the Phred gencrated PHD files Tags in Phrap assemblies Phrap assemblies can contain tags which are especially important when you are using PolyPhred Aligner will import and preserve tags and display tags based on your highlighting preferences You can add notes to existing tags and edit such notes To do so open a contig view select a base that contains a tag and then right click OS X control click on it to display the popup menu The first item in the popup menu will be Display Tag but only if you clicked on a base with a tag You can also view all tags for a sample in the Sample information dialog and add tags Import from GenBank You can import DNA sequences directly from GenBank by using GenBank accession numbers like EU203333 or GI numbers like 166029874 To import one or more sequences from GenBank go to the File menu move to the Import submenu and select From Genbank In the dialog that pops up enter the GenBank accession number s or GI number s you want to download You can also use ranges as shown Importing Sequencher Projects CAF Files 26 CodonCode Aligner User Manual in the next screen shot When you click OK CodonCode Aligner will connect to the NCBI web site and try to import the selected sequence s as text sequences into your project Of course you need to
244. m an existing file An example of typical use is a group of several scientists who want to share a locked set of preferences so that all analyses will be performed with the same settings This can be done as follows 1 Change all preferences to the desired settings 2 Open the Preferences dialog and select Preference options on the left 3 Save a copy of the preferences by using the Save copy button The following dialog will appear Preference Options 270 CodonCode Aligner User Manual eoo Allow Changes Should users be allowed to make changes to this saved settings file You may want to select No if this saved copy will be shared by multiple users who should always use the same settings Allow Changes A on t Allow Changes If you want to protect the saved file against changes press the Don t Allow Changes button A Save As dialog will be shown next where you can choose the name and location the preferences are saved to Choose a folder that all users can access for example on a file server or shared disk 4 Each user that wants to use the shared preferences now has to choose this file by starting CodonCode Aligner opening the Preference options dialog and clicking the Select button After selection the locked shared preferences file they will see the following dialog eoo Preferences Not Changeable dom The custom preferences file you selected is non modifiable Changes yo
245. mbiguity codes for heterozygous point mutations Aligner will change the call for all heterozygous point mutations it identifies to IUPAC ambiguity codes You may also need to be able to identify homozygous mutations in exported sequences If you mark the checkbox Change homozygous mutations to lower case Aligner will change the base calls of all homozygous mutations it identifies to lower case e g from A to a Please note the changed base calls and the tags are currently not linked if you would want to manually change a base that Aligner identified incorrectly as a heterozygote you will need to change both the base and the tag Finding only homozygous mutations In some projects you may know that you do not have any heterozygous mutations for example when you are sequencing clones rather than PCR products When looking for mutations in such project make sure that the checkbox look only for homozygous mutations is checked Of course when looking for homozygous mutations you could just look for any discrepancies rather than using Aligner s mutation finding However there are several reasons to use Aligner s Find Mutations Aligner can automatically ignore the low quality regions at the end as defined in the Data quality pulldown Aligner adds mutation tags which can be printed and exported for analysis in other programs like Microsoft Excel Finding indels When looking for mutations you have the option to also
246. mming Views Overview Print Options Warnings _ Print contig overview Window placement Print Preview M Show preview before printing Description The printing preferences control how Aligner prints Currently you can only set options for trace view printing and contig view printing If you would like more options for printing other views please let us know Printing Preferences 272 CodonCode Aligner User Manual Trace View Printing What to print when printing traces is determined in the first pull down menu Your options are Entire traces this will print the entire sequence trace for each sample currently in the trace view Each sample will be printed using several panels on one or more pages before the next sample is printed Only visible regions this will print just the part of the traces that is currently showing on the screen If your trace view window contains multiple traces one panel for each trace will be printed similar to the way the sequences are shown on the screen The vertical trace scaling lets you select how the traces are scaled when printed Use Trace view scaling will print traces using a constant scale factor for all panels in a sample the scale factor used will be the one currently used for this sample in the trace view e Scale each panel to highest peak will calculate a separate scale factor for each panel in each sequence based on the highest peak in this section of the
247. mple would leave a gap in a contig thereby splitting a contig in two pieces you would not be able to remove the sample we plan to add the functionality to automatically split a contig in later versions You can also move entire contigs to the trash this way This will move the contig and all samples in it to the trash Moving samples to the trash does not delete them from your project If you change your mind about a sample in the trash you can select it and then choose Move To Unassembled Samples or Move To from the Edit menu To permanently delete samples from you project first move the samples to the trash and then choose Empty Trash from the File menu Removing Samples from an Aligner Project 33 Base Calling with PHRED Aligner works best if sequences have quality scores but what if you have sequence traces that do not have quality scores for example ABI files Well you can simply run Phred to re do the base calling and assign quality scores from within Aligner Phred was developed by Phil Green and Brent Ewing at the University of Washington more about PHRED below How to call bases with PHRED from Aligner To call bases for sequence traces with PHRED 1 Select the samples in the project view The sequences must be unassembled you can also select the entire Unassembled Samples folder If you want to call bases for samples that are already in a contig you must first unassemble the contig 2 Cho
248. n how to scale traces and a few more options On the right side you get a preview of the print results with your current settings The different options are decribed in detail on the Printing Preferences page Printing Traces 187 Base View Window Choose Base View from the View menu to display the bases for a sample or consensus e080 1 51 101 151 201 251 301 TTTGTTGTGG CAGGTGCTGC ATGTAGCTTG GCCTCTCATT AGCCACAAGA CCCATCAATT TTCTTGTACT TCcTACTAT CACTCATCCA TGAAGGAGAG GGAAGCCTTG TCCAAGACCG TAATGCTAGA TTCTCTGTGA CACAGAGACC ACACAGGTGT ACCTGAGCCC TCTCTGCCAG ACCCACTCAT TGGAGGAGGT GGATGCCATG AGCAGTCAAA TTTACAGTAG CACTCACTCA BecacaTGBB 351 401 451 501 551 601 A TTGGT ccactccoccH cc cc TTAAAAATTG GcTGGAGAGG GOCGNGCGCGG TGGcTCAAGC hae A M A A060 s Base 261 of 628 Quality 16 You can edit sequences in the base view if they are editable but for sequences with traces it s generally a better idea to edit in the trace view The bases are displayed according to your color preferences At the bottom of the base view window you see the name of the sample the current cursor position and if the sample has qualities the quality at the cursor Base View Window 188 Quality View Window Choose Quality View from the View menu to display a graph of the quality values for the selected sample or consensus e608 A326 r 70 210 A326
249. n when you purchased your Aligner license and the terms of your license Visiting the Aligner Web Site You can visit the Aligner web site by selecting Aligner Web Site from the Help menu This will open a browser window and point it to the CodonCode Aligner web site the starting point for downloading updates requesting trial licenses and the latest Aligner news The address of the Aligner web site is http www codoncode com aligner Checking for Aligner Updates 307
250. n OS X and then click on Restriction maps on the left panel You can also access the restriction map preferences from the restriction map view by clicking on the restriction map icons in the toolbar The restriction map preferences are displayed in two different tabs One tab allows you to change the restriction map options the other tab allows you to select enzymes for the digest The tabs are shown at the top of the restriction map preferences and you can switch from one to the other by clicking on the tab Selecting Enzymes The Restriction Enzymes tab in the restriction map preferences allows you to select enzymes for the digest Restriction Map Preferences 278 CodonCode Aligner User Manual eoo Preferences Alignment Restriction maps Assembly Base calling Rest 1 nz Restriction Map Options Base colors Double clicking Subsets End clipping Features By Manufacturer Highlighting f Invitrogen Corporation E License Server By Size Of Recognition Site Memory SR Mutations LJ 4 base cutters Open amp save C S base cutters Phrap assembly Preference options Printing vi 6 base cutters large base cutters gt 6 Protein translation By Cut Result Sample names all cutters Restriction maps N estricion maps 5 overhan Startup Ss g Vector trimming Enzyme Name J 3 overhang Views EcoRI O blunt cutters Warnings Recognition Sequence
251. n cutters is shown at the bottom of the map You can change how the map is displayed and what enzymes to use in the restriction map preferences You can open the preferences through the icons in the toolbar of the restriction map view Multi Line Map The multi line map for the same example is shown below Restriction Map View 212 CodonCode Aligner User Manual fied eS ats e Enzymes Options Virtual Gel Multi Line Map Single Line Map TextMap Print Restriction map for Contig1 1660 bases linear DNA Displaying fragment sizes in base pairs 1066 594 BstXI 1 628 1032 EcoRI 1 267 454 897 42 Pstl 3 655 1005 Xbal 1 Non cutters Acc65l Apal BamHI Bsp68l Hincll Hindlll Kpnl Notl Pael Sacl Sall Smal Xhol Xmil The multiple line map displays a separate graph for each enzyme The number after the enzyme name tells you how often this enzyme cuts In the screen shot above fragment sizes rather than cut positions as in the first screen shot are displayed The fragment sizes are displayed in base pairs in the middle of each fragment For example BstXI cuts one time generating two fragments with 1073 bp and 600 bp At the bottom of the map a list of all enzymes that do not cut in Contig1 is given It is possible to show only cutting enzymes only non cutting enzymes both or no summary at all You can choose what to display in the restriction map preferen
252. n the last item you want to select control click OS X command click to make a discontinous selection Aligner Windows 179 CodonCode Aligner User Manual Your current selection determines which menu items and buttons are active For example you need to have at least two samples or contigs selected before you can choose Assemble from the Contig menu or the Assemble button at the top of the window the Unassemble menu item and button require that your selection contains only contigs and so on If a menu item is not available and the button is grayed out you have not selected the item or items required for this action Menu shortcuts Buttons and Popup menus The most commonly used actions are available as buttons on the top of the project view and as popup menus You can hide the buttons by selecting Toolbars Hide Toolbars in the View menu If you do not see the toolbar at the top select Toolbars Show Toolbars in the View menu to make them visible If you press the right mouse button on Windows or control click on Mac OS X in the project window a popup menu with the most commonly used actions will be displayed The content of the popup menu will depend on what you currently have selected just try it out Two example popup menus are shown below View Bases View Contig View Quality View Quality View Features Move to Trash Unassemble Sample Information Move to Trash Preferences
253. nce it first looks at the minimum match criteria you defined If the match is not good enough for example because it is too short then it will be ignored Two parameters that need explanation are the Max distance from start and Max distance from end numbers To understand the meaning of these numbers keep in mind that matches between sample sequences and vector sequences are local matches that is the matches do not necessarily extend to the beginning or the end of the sample If there is low quality sequence at the beginning or end of your samples errors in these parts will often lead to alignments that start a few bases into the sequence and or do not extend all the way to the end Aligner uses the Max distance parameters to determine how far from the start or end of a sample a match can be For example if a match starts 35 bases from the start of the sample and the maximum distance from the start is set to 50 then Aligner will trim the first unaligned 35 bases plus the bases that actually match But if the maximum distance from the start was set to less than 35 Aligner would ignore this match and not trim If you use end clipping before vector trimming you can use low numbers for the max distance parameters for example 20 and 50 With samples that are not end clipped first higher numbers like 50 for the start and 150 250 for the end may make more sense The alignment score is calculated based on the number of matche
254. nce will change or get lost when you later unassemble the contig or merge it with other contigs or unassembled reads Editing Contig Information 158 Search for Sequences Aligner allows you to look for short sequences within your samples and contigs First select the sample or contig that you want to look in and open a base view trace view or contig view for it Then selected Search Sequence from the Go menu This will display the following dialog r x e Search For Sequence Sequence to find Start searching from the beginning f from the cursor f Cancel You type the sequence to find in the text box at the top and then press the OK button The sequence you can look for may contain the four bases A G C and T as well as ambiguity codes gaps are ignored If you search for ambiguity codes note that you will get a match only if the ambiguity code is found for example AGTN will match AGTN but not AGTC If Aligner finds your search string it will position the cursor to the first occurence if Aligner cannot find the sequence it will tell you so If you started the search from a contig window the dialog will be slightly different x e Search For Sequence Sequence to find CCCGGG Start searching from the beginning from the cursor Search in Selected sample s 47 Consensus only O all f Cancel When searching in
255. nces when importing in the consensus method preferences CodonCode Aligner s support for CAF files is currently limited to CAF files exported by Sequencher Aligner will generally not be able to read CAF files produced by other programs If you encounter any problems when importing CAF files into CodonCode Aligner please send a description of your problem together with the CAF file to support codoncode com Importing Phrap Assemblies To import a Phrap assembly into CodonCode Aligner select have the Phrap generated ACE file in the file dialog you see after choosing Import gt Add Assembly from the File menu you must have a project open for this option to be available In addition to the ACE file you should also have the PHD and SCF files for the assembly located in exactly the same directory structure as Consed would expect as described below When importing Phrap assemblies all the contigs that Phrap has created will remain intact and detailed information like unaligned ends and tags will be reserved Aligner will read the assembly information from the ace file and try to get additional information from the other files typically used with Phrap the PHD files in the sister folder phd dir and the chromatogram files in the sister folder chromat dir An overview of the typical directory structure used with Phrap assemblies is as follows vw Project folder contains the chromatogram files ABI or SCF files L chromat_dir
256. nd license server licenses All license keys other than the demo key are specific to a given computer and will not work if transferred to a different computer Certain changes on your computer for example installing a new operating system or certain repairs may also invalidate your license so that you will need to request a new license key Demo Mode In Demo mode CodonCode Aligner works as a fully functional trace viewer and editor you can open view edit and print unassembled sequences You can also save projects that contain only unassembled sequences unless you have processed any of the sequences with Aligner s functions for end clipping base calling sequence assembly and so on Aligner will warn you before doing anything that will disable saving and printing You can also open existing Aligner projects in demo mode for example the projects in the Example Files folder inside the CodonCode Aligner folder However if an opened project contains any contigs you will not be able to save import export or print in demo mode The demo mode also allows you to test most of Aligner s advanced functions with the following exceptions Base calling with Phred Assembly with Phrap however you can assemble using Aligner s own assembly algorithm Finding mutations and heterozygous indels Processing of heterozygous insertions or deletions indels If you would like to fully test Aligner with your own data you can request
257. nd select Show Local Tags from the Tags sub menu Confirming Tags 139 CodonCode Aligner User Manual Adding Tags You can also add your own tags to any base or range of bases in a sample Open a view that shows the bases a trace view base view or contig view select the bases you want to tag and then right click OS X control click on it to display the popup menu The first or second menu item in the popup menu will be Add Tag Selecting it will bring up the following dialog Add tag to va 16 x k New Tag Type Tag Details Program Use Start 168 End 168 Date Tue Jan 06 12 44 12 EST 201 Notes C Confirmed PUE atasnacenssanecapcx C Cancel The default type of the new tag is userDefined You can change this to any of the other pre defined tag types using the pull down menu at the top You can also edit the start and end position and add comments about the tag in the Notes text field If you want a tag to extend to the start of a sequence just enter 0 in the Start field If you want a tag to go to the end of the sample enter a large number like 9999 in the End text field Changes will be saved when you press the OK button Instead of using the popup menu to add tags you can also go to the Sample menu and select Add Tag from the Tags sub menu Adding Tags to All Sequences Tags can also be added to all sequences in a contig at the same time Open the conti
258. nding on which program generated the SCF files SCF files generated by PHRED contain quality scores but some other programs like some versions of Sequencher do not write quality information into SCF files Quality Values In CodonCode Aligner 15 CodonCode Aligner User Manual When importing Phrap assemblies that where generated with quality scores Aligner will read the quality information from the corresponding PHD files regardless of whether or not the chromatogram files for the assembly were in ABI or SCF format When reading sequences from FASTA files Aligner will also read quality scores from qual files text files in FASTA like format that contain quality scores The name of the qual file must be the same as the name of the FASTA file with qual appended for example seq fasta and seq fasta qual The quality file must be in the same directory as the FASTA file Note that not all ABI chromatogram files have quality scores Only ABI chromatograms processed with the KB base caller have quality scores ABI chromatograms processed with the older ABI Basecaller do not have quality scores For questions about the KB base caller please read the KB Base Caller Frequently Asked Questions brochure When importing chromatogram sequences that do not have quality scores Aligner will assign artificial quality scores to all bases as described in the next section You can identify sequences without quality scores quickly in the pr
259. nds can be mapped unambiguously to one contig is then used to find links between contigs and to create scaffolds Contigs that contain highly identical repeat sequences for example rRNA sequences will typically remain as single contigs after this step Scaffolds will then be imported as contigs into CodonCode Aligner Scaffolding 67 Alignments to a Reference Sequence To perform an alignment to a reference sequence 1 Open an existing project or create a new project see Creating Projects 2 Add the desired sample files see Adding Samples to a Project 3 Designate the reference sequence Select the reference sample in the project window Choose Make Reference Sequence from the Sample menu 4 Select the reference sequence and the samples you want to align to it in the project view 5 Choose Align to Reference Sequence from the Contig menu Note To select all unassembled samples simply click on the Unassembled Samples folder To make a continuous selection keep the shift key pressed while clicking on the samples you want to select in the project view To make a discontinuous selection press the control key on Windows or the command key on OS X while clicking on samples in the project view Alignment begins immediately and a progress window shows the status of the alignment O Sequence Aligner Progress rSequence Aligner Phases v Initialization Overlap Detection Alignment Data Model Update
260. ne Custom Vector PBS oco ebbe Porn ree pod onde len i eda ate deo pn la p Da ras eda ad 40 Assembly anil A miei sssaaa ia ra re ane eee eens 51 CodonCode Aligner User Manual Table of Contents Sequence Assembly sssini aa Exe TRU ENT a REED ERE ae aE a a e naia Before assemblies rtr ertet a eN i Er REOR ERE ERE M ERE AA Is HEEL SE KEEN ERI VEM R DP HL MEER IRE 53 Es Tes ASST uia ese co rn eoo FOR OFEN TRO FR Ex EOS e NEA od uxo Da Uo AD aE FE ROS ER ERO REE 53 Advanced assembly OBS ca coe ederet rd gU HS d rre a v a Rota Oba gi a Rd 53 Assemble with pieproc ssii rciris id eret edet eaa oce d a ebbe IRR Ve UNE NEED o pud rhet aa iiaa 54 eee toa Reference ISSUE E E E I S 80 PUBS ERIDIY m mn m 80 Comensus Calculatia RETE T Hem 81 Quality based CODSEIDBUEeisrerti Fe HR EOD RERO NE ERENS ER HL ERO aan Feb R Ee DU ET 81 Majority C OTIS EI dssdo e Po eb ht pte QU Xr qao QE EREA uc el la xc EV Er 82 euere OD SEHRLIS cosi cot SG b OH HG HR b D Hc deb eimi 83 Pereentage pased Consensus ocio Ce eder iene Hee EINE EXER IP EN D IRURE TN PERI AERE 83 Using the Reterences Segustice as CODBenallS oce toD OR I DO EU EDI OO RUD RU ees 83 Rebuilding ihe Consensus SOQUEDUR eoe ce ea aont P C pat ned ole OER Ul Ker FR FE ai 84 CodonCode Aligner User Manual Table of Contents Aligner Algorithms for Assembly and Alignments Finding LLENO TERT 89 PrefeQquisItes ocio oir Er RE rea NN CERIS PEE DRE PEE ke MEL CHEM DEVE NNI PIE RR EERAR
261. ne or more contigs from scratch 1 Go to the project view 2 Select the contig contigs or contig s and sample s you want to align from scratch keep the shift control or command key pressed to make continuous or discontinous selections as described above 3 Go to the Contig menu move to Advanced Alignments and choose Align from Scratch Aligner will first unassemble the contigs you selected and then align all the samples in the contig s and any other samples you had selected to your reference sequence s You will see a progress dialog while Aligner is aligning Note that the resulting number of contigs may be different from the initial number of contigs You can also choose Align to Reference from Scratch with just a contig selected as long as your project contains a reference sequence If your selection contained only unassembled samples align from scratch will do exactly the same thing as Align to Reference Sequence would unless you also have preprocessing options selected Align to Reference from Scratch 72 Alignments with Bowtie 2 Bowtie 2 is a fast and memory efficient tool for aligning sequencing reads to long reference sequences Bowtie2 is available from http bowtie bio sourceforge net bowtie2 executable versions of Bowtie 2 are installed into the HelperPrograms folder when you install CodonCode Aligner 5 0 or newer Bowtie 2 can be run directly from CodonCode Aligner Since Bowtie 2 is intended fo
262. ner and requires either a valid trial license or a valid full purchased license that includes a license for the Workstation Phred module Licenses purchased by academic customers automatically include a license for the Workstation Phred module free of charge users at for profit organizations need to pay a separate license fee for the workstation version of Phred If you started using CodonCode Aligner with a version before 1 2 5 beta 5 and would like to use the workstation version of Phred please 1 Check if your license includes a license for Workstation Phred go to the Help menu select License and check the module permissions in the license dialog 2 Click on the upper Select or Browse button in the base calling preferences and navigate to the workstation phred executable 3 Select workstation phred and then click OK in the file dialog and in the preference dialog One note of caution CodonCode Aligner uses the location and name of the Phred executable to determine whether you are using the workstation version or the regular version both versions perform identically but the workstation version can only be run from Aligner with a valid license Aligner will assume that you are using the workstation version if it finds workstation phred anywhere in the name which includes the directories Therefore please do not change the name of the Phred executable installed by Aligner If you are using
263. newly defined delimiters in the sample name preferences Defining delimiters 287 Startup Preferences The Startup Preferences allow you to control what happens when you start CodonCode Aligner Aligner can automatically open the last project you worked on or present dialogs to open existing projects or create a new project or show the Startup Wizard dialog or run the specified script The following picture shows the startup preference dialog Startup preferences At startup Base calling Open the last project Base colors Consensus method Open an existing project Double clicking End clipping Features Show the startup dialog Highlighting X o License Server Run script Select Memory Do nothing Mutations Open amp save Phrap assembly Preference options Printing Protein translation Restriction maps Create a new project Window placement Description The startup preferences control how Aligner starts If you select Do nothing Aligner will start but not open any project or show any dialogs On Windows you will see an empty Aligner window On Mac OS X the only thing you see will be a change in the menu bar Aligner will not open any windows You will need to select Open Project New Project or Open Recent before you can do anything else other than looking at the online help The Startup Dialog If you choose Show the star
264. nnot find the dye primer string in the Phred parameter file since version 1 1 1 of Aligner this should not happen anymore since Aligner tries to help you in adding the missing entries before running PHRED as described above however you might still see this problem if you accidentally edited or misspelled a primer ID string pressed Cancel in the Phred Parameter File dialog or against all our warning used a text editor to edit the Phred parameter file Go ahead and open the file Basecalling errors txt in Phred Phrap directory inside the CodonCode Aligner directory In there you will see one or more entries like this SampleFileName abi unable to match primer ID string Skipping chromatogram unknown chemistry DT3730POP7 BD mob in chromat SampleFileName abi add a line of the form DT3730POP7 BD mob chemistry dye type machine type to the file usr local genome lib phredpar dat Cannot find base calling program 38 CodonCode Aligner User Manual To fix this problem you need to add the line as requested to the Phred parameter file as described above At the top of the file it tells you the known chemistries dye types and machines pick the one that is closest to what was used for your sample For example the line you add may read DT3730POP7 BD mob terminator big dye ABI 3700 for the most commonly used sequencing chemistries from ABI 3700 or ABI 3730 sequencers Save the changed Phred paramete
265. not have chromatograms Aligner just compares the base to the consensus base 4 When a potential heterozygous base is found Aligner examines the peaks and secondary peaks in the other samples at this position and in the same direction to see if the secondary peak may be due to random noise This noise filter can be turned off in the mutation detection preferences 5 Aligner classifies each base as homozygous or heterozygous based on the height of the secondary peak and the intensity drop Note that peaks may be classified as heterozygous even if there is no clear intensity drop for example if all bases at this position are heterozygous 6 If any of the samples at a given consensus position is classified as having a heterozygous base tags are added to all analyzed samples at this position unless Add tags only to mutated bases is selected in the mutation detection preferences The sensitivity of the detection can be adjusted in the mutation detection preferences Keep in mind however that Aligner may classify some bases incorrectly and miss some heterozygous bases regardless of the setting Limitations CodonCode Aligner s detection of heterozygous point mutations is intended for research use only It has not been verified for any diagnostic or clinical applications Aligner will miss certain mutation and incorrectly classify others False positive and false negative rates depend on the current sensitivity settings but are neve
266. nt mutations for example if the secondary peak is weak On the other hand a high sensitivity setting will miss few if any heterozygous point mutations but may incorrectly identify some secondary peaks as heterozygous point mutations when they are really caused by noise in the sequence traces Your choices in the Data quality panel also affect the false positive to false negative balance At the start and end of sequence traces secondary noise peaks are most common which can lead to false positives Aligner tries to reduce this problem by examining sequence quality at the start and end of each trace and excluding low quality regions You can determine the stringency of this step by setting the Minimum quality at start and end The value chosen there is the sequence quality Phred quality required before Aligner starts analyzing choosing higher values e g 40 will give fewer errors near the end of sequences You can see which regions Aligner excluded from analysis by looking at the dataNeeded tags which are shown as yellow boxes depending on your highlighting preferences In general the medium sensitivity settings should work reasonably well however you should adapt the settings to the particular needs of your project and the quality of your sequence data If identifying every single potential point mutation is important select high in the sensitivity check boxes and uncheck the Use noise filter check box We strongly s
267. nt wrong Aligner will leave the samples as they were you will first need to correct the problem and try to do the base calling again The next section describes some of the most common problems and their solutions Editing the PHRED parameter file The first time you try to base call your own data with PHRED you will probably need to add entries to the Phred parameter file PHRED uses this file to determine which sequencing chemistry dye type and sequencing machine were used to generate each individual sequence PHRED does that by trying to match a primer ID string that is hidden in your chromatogram files with entries in the Phred parameter file Since sequencing vendors often come out with slightly changed chemistries that have a new primer ID string chances are that you have to add one or more strings to the Phred parameter file Fortunately CodonCode Aligner makes adding new entries to the Phred parameter file relatively easy by providing a convenient editor for the Phred parameter file and by making educated guesses for the entries that need to be added Before running Phred Aligner checks all samples which you selected for base calling to see if their primer ID string can be found in the Phred parameter file If any entries are missing you will see the Prerequisites 35 CodonCode Aligner User Manual following dialog 5 eoc Phred parameters missing A The Phred parameter file does not have the required entries A to
268. ntage for inclusion of bases in the consensus An example where this method can be useful is the sequencing of many isolates where you want to build a consensus sequence that includes common variants but excludes rare mutations The percentage threshold can be set in the consensus preferences when the percentage based consensus method is selected You can set different thresholds for regular contigs and for contigs of contigs Using the Reference Sequence as Consensus When you are comparing samples to a known reference sequence you may not be interested in building a consensus sequence you just want to know where your samples differ from the reference Aligner supports this by letting you use the reference sequence as the consensus sequence To use the reference sequence as the consensus sequence 1 In the consensus preferences select Use the reference sequence as the consensus sequence then click OK 2 Create your contig by Align to Reference Sequence not by Assemble or Assemble with Phrap Note that assembled contigs may contain the reference sequence that alone does not mean that the contig is an alignment to a reference sequence Only contigs that were created by Align to Reference Sequence can be alignments Majority Consensus 83 CodonCode Aligner User Manual Note that if you merge an aligned contig with other contigs by using Assemble or Assemble with Options the contig will change from an alignment to
269. ntig from several forward and reverse reads for each species e Select the contigs you want to compare in the project view You can also include individual sequences for example text sequences that you downloaded from sequence databases Go to the Contig menu move to Advanced Assembly and choose Compare Contigs A dialog opens that looks like this CodonCode Aligner User Manual e 00 Compare Contigs f Contigs Preprocess Compare contigs keeping existing contigs using A Muscle O ClustalW C Built in algorithm Compare contigs Aligner will build contigs from the consensus sequences of the contigs in your selection contigs of contigs You can use the radio buttons to choose the algorithm used to generate the alignment Note that using Muscle may result in contig gaps being deleted A typical application would be to compare genes you sequenced from different species Help Cancel Click on Compare Aligner will start comparing the contigs to each other showing you a progress dialog during the assembly By default CodonCode Aligner version 1 6 and newer will use the program muscle to generate contigs of contigs muscle is a program that is widely used to generate alignments for phylogenetic studies a copy of the program is included with the CodonCode Aligner distribution and installed in the Phred Phrap folder inside the CodonCode Aligner install folder To generate alignments w
270. ntig1 3 samples 966 917 3 11 3 11 03 B A326 r Trace 628 375 0 3 11 3 11 03 E A060 s Trace 645 389 221 3 11 3 11 03 Bd A333 r Trace 646 370 320 3 11 3 11 03 b a Contig2 2 samples 755 720 3 11 3 11 03 gt Trash 0 samples 0 3 11 3 11 03 e Assembly completed in 1 62 seconds 1 successful join 1 island remaining D The project window is organized similar to the familiar list view in the Macintosh Finder or the detail view in Windows Explorer Every project has two folders e The Unassembled Samples folder contains samples newly added to a project and not yet assembled or moved to the trash e The Trash folder which contains samples marked for deletion but not yet removed from the project In addition projects that have been assembled or aligned will have one folder for each contig formed You can expand or condense folders by clicking on the little triangle on the left of each folder In the example above the Unassembled Samples folder and Contig1 are expanded showing details about the samples in Unassembled Samples and in Contigl Selecting Samples and Contigs For most things you do in CodonCode Aligner you start by selecting the samples or contigs you want to do something with for example vector screen or assemble You can click on a sample or contig to select the item shift click to make a continous selection press on the first item then press shift while clicking o
271. o either look at an overview of the differences or to look at the differences in a way that you can see the single base differences You can change the size of the difference table by pressing the Change size button The overview of the differences is a condensed version of the difference table and can be highlighted by colors as shown in the example below Z 3h IL sti Position M S LEER onsensus CITED c dis 74 dis 74 ini ee lt lt djs74 1432 ATAACTGATGTATCTTGGGCCACAGTGC AAGACATTGTCAGCAACq djs74 2931 51 dien i ATAACTGATGTATCTTGGGCCACAGTGC IAAGACATTGTCAGCAACqQ 1280 1290 1300 1310 13 Pos 1505 2 You have the option to exclude certain differences by using the difference table filters The filters can be changed by clicking on the Exclude button above the difference table Display options for the difference table 195 CodonCode Aligner User Manual Contigl eo Pe gy XOX 5 oF Show overview Change size Exclude vk Show all columns and rows Exclude Ns v Exclude non gaps Exclude high consensus quality Exclude low frequency changes Hide rows without changes Set filters and thresholds djs74 1180 s1 djs74 1532 djs74 237 lt lt djs74 1432 djs74 2931 s1 djs74 3174 Contigl There are five types of filters you can use to look at the difference table l
272. o focus on bases that differ from the consensus sequence is by going to the View menu and selecting Mask Bases Matching Consensus If checked any bases in aligned regions that are identical to the consensus sequences are replaced by dots only bases that differ from the consensus sequence and the consensus sequence itself are shown as letters Here is an example eoo Contigi H c M 4 M e 7 Print Reverse Build Tree View Traces Colors Bases lt gt Transl MaskMatches Help Show differences 7 A Doo Oe 330 bp of 330 bp Ip 100 bp 200 bp 300 bp 0 11 lt lt CFTR 3 R lt lt CFTR 5 R lt lt CFTR Norm R lt lt CFTR 1 R lt lt CFTR 4 R CFTR 4 F CFTR 5 F CFTR Norm F Contigl Pos 162 330 Qual 20 C 90 Masking Bases Matching the Consensus 204 CodonCode Aligner User Manual To revert back to the normal display where all bases are drawn just select Mask Bases Matching Consensus or the Mask Matches toolbar button again Zooming in the Contig View You can zoom in the aligned bases panel at the bottom of the contig view as well as in the overview panel shown at the top Zooming in the overview panel at the top can be done by using the zoom scale at the top right corner of the contig view When zoomed out all the way the overview shows the complete contig as shown int he example below eoo C
273. o the first base in a sample or contig and gaps are included in the count Sometimes you may want to change the numbering for example to indicate the start of a region that you are interested in You can set the base numbering for any sample or contig as follows 1 Select the base that you want to assign a number to you can do this in a base view trace view or contig view 2 Go to the Sample menu and select Set Base Number This will open a dialog 3 Enter a base number greater than 0 and press OK When setting base numbers for contigs please note that adding additional samples to an existing contig will re built the contig and the base numbering will be reset so the first base in the contig is base 1 Setting Base Numbers 125 Selecting Bases To select bases move the mouse cursor over the first base you wish to select in the base view contig view or trace view Click and hold down the mouse button drag the cursor horizontally over the base s and release the mouse button after dragging the cursor over the last base This can be a bit slow for large selections if you want to select all bases to the start or end of the sequence it can be a lot faster to use one of the options described below so please read on Selected bases are displayed with a different background color than surrounding bases If the selection was made in the consensus the selection is also shown in all samples that are part of the consensus
274. ocation of the base calling program Phred the Phred parameter file and for experts only additional command line parameters for Phred You specify the location and name of the base calling program in the upper text field Currently Phred is the only base calling program that is supported by Aligner In the second text field you specify the location of the Phred parameter file which is typically called phredpar dat For more information about the Phred parameter file please check the base calling help page It also gives you some more details about how to edit the Phred parameter file which you can do by pressing the Edit button If you installed Phred with Aligner the path to Phred and to the Phred parameter file should be correct and not need any changes However if you use your own installation of Phred you may need to specify the location of both files on your system The default location and names are Base Calling Preferences 235 CodonCode Aligner User Manual On OSX Application CodonCode Aligner Phred Phrap workstation phred Application CodonCode Aligner Phred Phrap phredpar dat e On Windows C Program Files CodonCode AlignerPhred Phrap Workstation phred exe C Program Files CodonCode Aligner Phred Phrap phredpar dat Note that since Aligner version 1 2 5 beta 5 Aligner will use the workstation versions of Phred and Phrap by default The workstation version of Phred can only be run from CodonCode Alig
275. of tags and add comments about the tag in the Notes text field You can also delete tags Changes will be saved after you press the OK button Confirming Tags One common use of the tag notes is to mark tags as confirmed after looking at the trace data You could do this by typing Confirmed in the note box or simply by clicking on the Confirmed checkbox Clicking on the checkbox when it is unchecked will add the word Confirmed at the beginning of the text clicking it when is is checked will remove all occurences of the word confirmed from the check box Tip If you find a tag that is wrong you can either delete the tag or you could mark it in the Notes section We suggest that you do not write Not confirmed but rather use different words like Disagree or Incorrect The contents of the Notes field are shown in the Content column in the Feature View and when exporting features to text files Viewing Local Tags You can also view tags at specific locations in a sample from trace view base view and contig view windows Select a base that contains a tag and then right click OS X control click on it to display the popup menu The first item in the popup menu will be Display Tag but only if you clicked on a base with a tag This will bring up the tag dialog as above except that only tags at this position in the sample will be shown Instead of using the popup menu you can also go to the Sample menu a
276. of the Phred parameter file defined in the base calling preferences Aditional tips for common problems with running Phred can also be found at http www codoncode com support faqs phedpar html If you want to you can read more about Phred in the original Phred documentation which is available at http www codoncode com support phred doc html About Phred The base calling program Phred was developed by Phil Green and Brent Ewing at the University of Washington Phred was widely used for base calling in the Human Genome Project and still is often regarded as the standard for base calling CodonCode Corporation distributes Phred executables for a variety of platforms including Windows and Mac OS X under license from the University of Washington Academic users can obtain the source code for Phred for restricted use directly from the authors at the University of Washington For more information on this please visit http www phrap org Trial versions of CodonCode Aligner may include time limited trial versions of Phred Any use of such trial versions are subjected to the license agreements displayed when you installed Aligner or Phred In particular you may not use the time limited trial versions for any commercial purposes Please note that Phred is a command line program not a typical Windows or Mac OS X application This makes it easy to run Phred through scripts or from programs like CodonCode Aligner but it means you cannot simply d
277. of the peaks are also less tall than the peaks before base 172 This is typically caused by an insertion or deletion indel in one of two chromosomes that you sequenced by a heterozygous indel Let us look at a homozygous wild type sequence at this location eoe Traces from Unassembled Samples CCAGAGAAATTGGTCAGGAGCACAAAGGGGCACTAAGAGCAAAA 180 190 lt gt x g A e A f DA ja gt A CY v Scroll together wildtype Base 172 of 582 Quality 62 If you compare the wild type sequence to the indel sequence above you will notice the additional red T peak at base 172 You also can see that the first yellow G peak is only about 50 of the intensity in the wild type trace followed by 3 G peaks of regular height and then an extra G peak that is half as high as the three preceding G peaks From this we can conclude that the indel event here is a one base T insertion on one of the two chromosomes sequenced Analyzing heterozygous indel traces this way is possible but it can be tedious and error prone especially if the insertions or deletions are longer than one or a few bases CodonCode Aligner provides two functions that can help you in analyzing heterozygous insertions and deletions The Find Heterozygous Indels function in the Sample menu can automatically identify potential heterozygous insertions and deletions The Process Heterozygous Indels function can help you see the sequence o
278. oject to 6 Choose a name for the exported file Make sure that the name ends with caf Here is an example of what the dialog looks like with Sequencher 4 1 on Mac OS 9 CPNewFolder Export Selected Icons as File Format Export Chromatograms as amp SCF Version 2 0 Q SCF Version 3 0 O Export Contents of Selected Refrigerators When you click Save Sequencher will export your selection to a text file in CAF format In addition Sequencher will create chromatogram files in SCF format for all reads that have traces this is why we suggested to create a new folder in step 5 above You can now quit Sequencher and import the CAF file you just exported into any open CodonCode Aligner project using Import gt Add Assembly Please keep a few things in mind when importing CAF files Adding Entire Assemblies 25 CodonCode Aligner User Manual e Sequences in old Sequencher projects often do not have base specific qualities but many functions in CodonCode Aligner either require quality scores or work better with quality scores For unassembled samples that have chromatogram traces you can use Call Bases to run Phred on the imported samples and thereby get quality scores Consensus sequences generated in Sequencher are not quality based and therefore likely to contain more errors and ambiguities than consensus sequences built in CodonCode Aligner You can choose to have CodonCode Aligner re build the consensus seque
279. oject view the Quality column shows 0 as the number of high quality bases for such sequences To assign sequence quality scores to chromatograms without qualities you can base call the samples with PHRED which may require a separate license for PHRED Artificial qualities There may be times where you need to use sequences that do not have quality values for example Genbank sequences When importing such sequences into CodonCode Aligner Aligner will assign artificial qualities to all bases in these sequences The default value for artificial qualities is 15 but you can change this in the Open amp save preferences If you import sequences into Aligner which have quality scores that seem artificial for example because all scores are 0 or 1 or all scores have the same value Aligner will also assign artificial quality scores Gap qualities Quality values are associated with base calls so gaps do not really have quality values However since it is often convenient to have some quality value even for gaps Aligner does assign qualities to gaps the assigned quality is the average of the two bases on either side with gap characters and edited bases being ignored For bases at the start or end of the sequence that have only one neighboring base the quality value of this base is used Viewing qualities In CodonCode Aligner you can see quality values in a variety of ways to get an overview of the quality in a sample sel
280. ojects by default If you would like CodonCode Aligner to re build consensus sequences when you open projects go to the consensus preferences and select the radio button Rebuild external consensus on import in the External Consensus section Local large gap and end to end alignments By default CodonCode Aligner version 2 0 1 and newer will perform end to end alignments Assemblies and alignments generated this way will always end at the end of one sequence not before In contrast to the the local alignment algorithm end to end alignments will never generate dangling unaligned ends When using this algorithm samples should always be end clipped and if necessary also vector trimmed When using the Local alignment algorithm Aligner automatically uses the maximum amount of each sequence without requiring end clipping before assembly When using local alignments the alignment only extends as far as the alignment scores improve This means that low quality ends of sequences where high error rates would reduce the alignment score are left unaligned or dangling Unaligned parts of sequences are shown on light gray background in the contig view the alignment end points can manually be changed using Mark Start Alignment Location and Mark End Alignment Location in the Sample menu The local alignment algorithm was used by default in CodonCode Aligner version 1 6 3 and older If you started using CodonCode Aligner be
281. omatically add and remove traces when you go to a new location in a contig for example by clicking in the overview panel or by moving the cursor in the bases panel The trace view window will grow larger and smaller depending on the number of traces shown and the available space on your screen If you want to see more than 2 or 3 traces you may want to change the height of the trace panels to Small or Tiny in the Views preferences Hiding Some Traces Trace Sharpening 185 CodonCode Aligner User Manual You can hide traces for one or more bases by clicking on little colored boxes with the corresponding letter of the trace on the left side This can be very useful when analyzing heterozygous mutations where a peak for one base may obsure a second peak Below is an example the same traces as above but the T lane is hidden eoe Traces from Contig2 CAAGGCATGTGGTGTACACAAGT a 100 AGAGAAGTACAAPERMICAAGGCATGTGGTGTACACAAG ole Ca 2zz r D P ca22r Base 112 of 457 114 in contig Quality 21 Cons 90 _ The red line through the T box at the left indicates that the T lane is hidden Clicking on it again will show the T lane and clicking on the C will hide the C lane as shown below 8080 Traces from Contig2 TG AG AG AAGT ACAATACAAG GCATGTGGTGTACACAAGT ca 22 8 90 100 110 5 vi 7 dar K GAAGTACAAPMENMICAAGGCATGTGGTGTACACAAG AGA 006a 22 r 110 120 130 gt ca22r Base 112 of 457 114
282. on as well as color highlighted differences with a settable threshold for the allele frequency the default is 0 1 e The arrows panel shows the location and orientation of individual samples in the contig unless you are working with very large contigs and have zoomed out to show a large region When zoomed in the sample arrows show differences to the consensus sequence as colored bars Moving the mouse over an arrow will display some information about the read the name direction alignment start location current cursor location base and quality at this position for the sample base and the consensus base e The sample arrows can be displayed in a stacked or packed layout and you can color them by direction Unaligned dangling ends of reads are shown in a light gray color in projects where ends were clipped before assembly samples will typically have no or just short unaligned ends A vertical blue line shows the current cursor position in the contig The currently selected sample or samples are drawn in a lighter color in the example at the top of this section the orange read in the middle of the overview panel is selected e You can click in the overview panel to move around in a contig as explained in the section Navigating using the overview panel below Coverage graph in the overview panel The coverage graph in the overview panel shows the converage at each position in your contig The displayed coverage range i
283. on of gaps in the contig of contigs Verify and edit discrepancies between the species in CodonCode Aligner you can quickly go back to the original sequence traces by double clicking in the contig view for the contig of contigs Export the final assembly in PIR format or similar for further analysis How To Roundtrip Edit with CodonCode Aligner Here s how to roundtrip edit in CodonCode Aligner The starting point assumes you have a project where you already have a contig or contig of contigs that you would like to edit with an external editor like MacClade 1 Check names before exporting check the names of the contigs you want to export Many export formats and external editors restrict how long names can be and which characters can be used in names To be safe use short names with only numbers and letters Names of 10 or fewer characters are safest although up to 30 characters may also work 2 Select the contig s to export in the project view 3 Go to the File menu and select Export Assembly From the format pulldown menu select a format that works for the program you want to use for example Interleaved NEXUS PAUP and then export the file Import the file you just created in your favorite sequence editor for example MacClade Edit the alignment but limit your edits to moving gaps Export the edited alignment in NBRF PIR format with gaps Open the NBRF PIR file in CodonCode Aligner using drag and drop or F
284. on your system settings You can export Aligner projects in the old format using Export gt Aligner Project Old Format form the File menu Aligner Projects 19 Working with Aligner Projects Creating New Projects To create a new project choose New Project from Aligner s File menu Aligner will create a new project and show a project view window for it The project will be empty except for the Trash and the Unassembled Samples folders You can specify where a project will be saved when you first save the new project If you prefer to set the project path when creating a new project you can change the Open amp Save Preferences accordingly Now when creating a new project Aligner will show the Create New Project dialog r e Create New Project Folder Users peter Documents Projects Name MyProject f Cancel The simplest way to set the project name and location is to click on the Select button This will bring up a standard Save As dialog Save Select Project Folder and Name Save As MyProject Where Projects 4 fa M 5 America Online 4 MyProject1 1 3 Documents p 3 PhrapExample Projects A New Folder dd to Favorites f Cancel Save After clicking OK a new project window will be opened which contains no samples only the Unassembled Samples and the Trash folders Working with Aligner Projects 20
285. ontig1 Show differences Arrow Layout 19 kb of 19 kb gt 10 000 bp AACCTGATAGAG ACCTGATAGAGCT ACCTGATAGAGC TCACTAAAATAATITTTCAATGCAATCAC 1 IACCTGATAGAGCTGAAAAACTCACTAAAATAATITTTCAATGCAATCAC 12200 122 Y Pos 12197 19863 Qual 11 Zooming in allows you to see and navigate to the colored differences in the sample arrows bases are shown as colored rectangles in the base color gaps are shown as black box on white background The red box on the rectangle at the top of the overview highlights which region is displayed as sample arrows Below that you can see how many bases are diplayed out of the whole contig and which region Zooming in the Contig View 205 CodonCode Aligner User Manual eoo Contig1 amp 1r P i ocius 1 Show differences Arrow Layout UC re rr T 3 149 bp of 19 kb gt 12 150 bp 122501 10 9 lt lt 273 L53 s1 AGCTGAAAAACTCACTAAAATAATITTTTCAATGCAATCACAAATATTA lt lt 273 L68 s1 AGCTGAAAAACTCACTAAAATAATITTTCAATGCAATCACAAATATTA 273 L45 s1 AGCTGAAAAACTCACTAAAATAATITTTTCAATGCAATCACAAATATTA 273 E16 s1 ATTTTTCAATGCAATCACAAATATTA 273 M22 s1 ACTAAAATAATITTTCAATGCAATCACAAATATTA To see regions with few differences more quickly you can zoom in and out on the aligned bases in the contig view If yo
286. or described above As described above you will need to edit the Phred parameter file and add a new line for Problem running the workstation version of Phred 40 CodonCode Aligner User Manual each new primer ID string The possible entries are for chemistry primer terminator unknown for dyes rhodamine d rhodamine big dye energy transfer bodipy unknown e for machines ABI 373 377 ABI 3100 ABI 3700 Beckman CEQ 2000 LI COR 4000 MolDyn MegaBACE PHRED versions released in 2004 and later also support ABI 3730 as the machine type at the time of writing the new versions are still in beta testing and have not yet been released For more information please check the discussion groups on CodonCode s support site In general do not use the unknown tags If your dye or machine is not listed use the one most similar to it for example ABI 3700 for ABI 3730 XL sequencers if you are using PHRED version 0 020425 The most common combination for ABI sequencing is terminator big dye ABI 3700 The Phred parameter file can be in different locations on different systems On Mac OS X the default location is usr local genome lib On Windows the default location is C Program Files CodonCode To find out where the Phred parameter file is located Phred checks the environment variable PHRED PARAMETER FILE This environment variable is temporarily set by Aligner when Aligner starts Phred using the location
287. or Correct NGS Data menu item in the tools menu Other NGS Assembly Programs CodonCode Aligner also supports the use of other NGS assembly programs through a simple XML file based mechanism To add another assembler a new folder for the program must be created inside the ExternalAssemblers folder in the HelperPrograms folder where CodonCode Aligner is installed The program executable is placed in this folder and the parameters for the program are defined by creating an XML file in this folder If you are interested in using a different assembly program in CodonCode Aligner please contact CodonCode Corporation s support team Scaffolding NGS Assembly 66 CodonCode Aligner User Manual For NGS sequencing projects that include mate pair sequences CodonCode Aligner can form scaffolds of contigs by analyzing the linking information provided by the mate pairs To create scaffolds 1 Create a new project or open an existing project 2 Go to the Tools menu and select Scaffold NGS Contigs 3 A dialog will be shown where you can define a pair of files with the sequence information for the reads one file for each end Scaffolds can be built either for contig sequences in a file or for sequences that are already in your project and selected before starting the scaffolding 4 Press the OK button CodonCode Aligner will then map the reads to the contig sequences using Bowtie2 Information from mate pairs where both e
288. or correcting errors in NGS reads SparseAssembler Ye et al BMC Bioinformatics 2012 13 Suppl 6 S1 is included in the CodonCode Aligner installation Please note that NGS error correction and assembly in CodonCode Aligner is currently only intended for small NGS projects for example bacterial genomes NGS error correction and assembly requires a 64 bit operating system and is not available on 32 bit Windows Error Correction with SparseAssembler To error NGS data with SparseAssembler in CodonCode Aligner create a new project go to the Tools menu select the Error Correct NGS Data This will open a dialog where you can select the input files and adjust parameters Input files must be in FASTQ format Reads from pair end and mate pair sequencing should be in separate files all reads from one end in one file and all reads from the other end in a second file with exactly the same read order CodonCode Aligner will then start SparseAssembler and display the progress output generated during error correction in a dialog SparseAssembler will create new files with the error corrected read sequences which will be placed in a new folder This folder is located in the CodonCode SparseAssembler Denoiser folder inside your Documents folder SparseAssembler will create a new file for input file by added Denoised to the start of the file name If the input sequences contained read pairs in two separate files SparseAssembler will also crea
289. ores as described in the Base Calling with Phred section The following sections briefly explain the relation between quality scores and error probabilities which files Aligner can read quality scores from and how to view quality scores in Aligner Quality values explained Phred quality values represent the probability of error for each base call The quality value q assigned to each base call is defined to be q 10 xlogig p where p is the estimated error probability for the base call As indicated below a base call with a 1 in 100 probability of being incorrect will be assigned a quality value of 20 Quality Value Error Probability 10 lin 10 20 in 100 30 in 1000 40 in 10000 50 in 100000 For additional details about Phred quality scores you can read the articles listed below Where quality values come from The first widely used program to produce highly accurate quality scores for each base call was the program PHRED Since then a number of other base calling programs have been introduced and modified to also produce Phred like quality scores The two most common file types with quality scores are e SCF Standard Chromatogram Format files produced by PHRED e ABI chromatogram files ab1 files processed with the KB base caller older ABI chromatogram files and files produced with the ABI base caller do not contain quality scores Chromatograms SCF format may or may not contain quality values depe
290. ors that do not influence the correctness of the consensus base however you can tell Aligner that you think differently and subtract the quality scores of discrepant bases You can also set the quality values used for edited bases when calculating consensus quality Internally Aligner uses qualities of 98 for low quality edits and 99 for high quality edits This follows conventions Consensus Method 249 CodonCode Aligner User Manual used by the contig editing programs Gap4 and Consed and it allows Aligner to take edited bases into account when it matters for example when counting Phred20 bases When calculating the consensus quality Aligner will substitute the quality scores with the scores you specify here the default values are 10 for low quality edits and 30 for high quality edits Reference Sequence Alignments When building the reference sequence for contigs that were generated by aligning to a reference sequence the default behaviour is to ignore the reference sequence when building the consensus However instead of building a consensus using one of the consensus methods from the top section Aligner can also use the reference sequence as the consensus sequence for contigs that were generated by alignment to a reference sequence To do this check the box labeled Use the reference sequence as the consensus Whenever the reference sequence is used to build the consensus Aligner will also use tags for mutation finding that are
291. ose Call Bases from the Sample menu Depending on the number of samples you have chosen base calling may take a while up to a few seconds for each sample and you will need to wait until it s done before you can do anything else Prerequisites To use base calling in Aligner your sequences must have traces any sequences from text files that do not have traces will be ignored Furthermore base calling with PHRED requires that you have PHRED installed on the computer that you are running Aligner on This can either be the workstation version of PHRED that is included with Aligner or your own copy of PHRED Using the workstation version of PHRED When you install CodonCode Aligner a workstation version of PHRED is installed in the Phred Phrap folder inside the CodonCode Aligner folder This workstation version can only be run from CodonCode Aligner but is otherwise identical to PHRED To use it you must either have a valid trial license for Aligner or a full purchased license that includes license permissions for the workstation version of PHRED CodonCode Aligner customers at academic and non profit institutions can use the workstation version of PHRED free of charge customers at for profit institutions need to purchase a separate license for the workstation version of PHRED Using your own copy of PHRED If you already have a licensed copy of PHRED installed on the computer that you are using Aligner on you can use this
292. osition CodonCode Aligner can automatically pick traces to display while you are moving around in a contig You can turn this option on or off by selecting Auto Select Traces in the View menu You can also set the number of traces to be displayed in the Views preferences For automatic trace selection to work you need to first open both the contig view and the corresponding trace view for example by double clicking in the overview panel in the contig view Once both views are open Aligner will automatically add and remove traces when you go to a new location in a contig for example by clicking in the overview panel or by moving the cursor in the bases panel The trace view window will grow larger and smaller depending on the number of traces shown and the available space on your screen If you want to see more than 2 or 3 traces you may want to change the height of the trace panels to Small or Tiny in the Views preferences Printing Contigs To print a contig Automatic Trace Selection 208 CodonCode Aligner User Manual open and select the contig view for the contig you want to print then choose Print from the File menu or use the keyboard shortcut Control P on Windows Command P on OS X This will show the following option dialog eoo Contig View Print Options r Contig Bases To Print II Print entire contig Print contig from base 1 to base 36 r Contig Print Options Page layout
293. ot really indicate how far along the assembly is 5 When Phrap is finished Aligner will read the Phrap result file the ace file and update the project based on the Phrap results Any samples in your initial selection that Phrap did not include in contigs will be in the Unassembled Samples folder Please note that CodonCode Aligner is currently limited to projects with several hundred or at most a few thousand samples even though PHRAP can handle much larger assemblies Things to Note for Phrap Assemblies While Phrap typically produces very good assemblies Phrap also sometimes produces results that can be puzzling to the novice Phrap user Some of these things are e Phrap disregards previously formed contigs and always assembles from scratch this is different from Aligner s assembly method which leaves pre existing contigs as they are and looks for overlaps between the contig sequences Sequence Assembly With Phrap 63 CodonCode Aligner User Manual Phrap sometimes generates contigs with only one read in it This happens if the sample has a significant overlap with other samples but the overlap was not good enough to justify a merging Aligner will unassemble such single read contigs and move the samples into the Unassembled Samples folder For very large assemblies or on computers with low amounts of memory Phrap may run out of memory Before running out of memory Phrap may need to use virtual memory which can s
294. ou to change all bases with a quality below a given threshold to N The default threshold is 20 you can change it in the Change Bases Option dialog Undo Auto Edits This option will undo all previous auto edits any of the options described above for your current selection and convert bases back to the base calls before the first auto edit To function properly this requires that the auto edit tags that Aligner added originally are still present As long as your samples stay in the same project this is usually not a problem However if you export samples and then re import them the tags will typically be lost and undoing auto edits with this option will not be possible Change Bases Options The Change Bases dialog shows all options available to auto edit bases It allows to set certain options that are used when doing bases edits for example changing only bases below a certain user settable quality to N It also enables you to show or hide a result dialog for the auto edits To show the options dialog for changing bases go to the Edit menu select Change Bases and choose Change Bases Options This will show the following dialog 00 Change Bases 9 Match consensus Options Q Call second peaks higher than 25 X of first peak Change ambiguities to single bases to N 4 gt O Change bases with quality below 20 QO Undo auto edits Mi Show results summary dialog Cancel 0K Call
295. ouble click on Phred and expect to see a graphical user interface You can read the original documentation for Phred at http www codoncode com support phred doc html and more about Phred in the following two articles B Ewing B L Hillier L M C Wendl and P Green Base calling of automated sequencer traces using Phred I Accuracy assessment Genome Research 8 175 85 Available online at http www genome org content vol8 issue3 More about the Phred parameter file 41 CodonCode Aligner User Manual B Ewing and P Green 1998 Base Calling of Automated Sequencer Traces Using Phred II Error Probabilities Genome Research 8 186 198 Available online at http www genome org content vol8 issue3 About Phred 42 End Clipping Typically sequence chromatograms have low quality sequence at the beginning and at the end of the sequence If you have sequence traces with quality values you can use the quality values to automatically remove the low quality sequence at the ends a process called end clipping or end trimming If you plan to use Aligner s features to detect and process heterozygous insertions and deletions you should search for heterozygous indels before you end clip Otherwise end clipping will probably remove the parts of samples that have heterozygous insertions or deletions and some heterozygous indels may not be detected But if you first search for heterozygous indels end clipping will lea
296. ow Features There are fewer than 3 bases with quality Highlighting below 20 ina 25 base window License Server Memory r Trim from end until Kami Vv Error rate is below 0 1 ina 25 base window pen amp save Phrap assembly j There are fewer than 3 bases with quality Preference options below 20 ina 25 base window Printing Protein translation r After end clipping Sample names rent vi Move all sequences shorter than 25 bases to trash Vector trimming vi Move all sequences with fewer than 50 Phred 20 E bases to trash Window placement Description The end clipping preferences control how low quality bases are clipped from samples end clipping works only on samples with qualities Cancel GOED On the top you have the choice between two different end clipping methods a method that maximizes the region with an estimated error rate below the threshold you define and a method that uses different criteria at the beginning and at the end of the reads The first method is similar to the way Phred trims sequences with the trim_alt option The second method gives you more options and is hopefully a bit easier to understand With typical parameters both methods tend to give similar results and remove the junk sequence at the end of chromatograms The methods are explained in more detail below End Clipping Parameters 44 CodonCode Aligner User Manual You have the option to automatically identify ba
297. phylogenetic analysis programs Please note that many formats may not really export the entire selection or project For example the ACE file generated when exporting in the ACE file format will contain only contigs but not unassembled reads or samples in the trash ACE Format Exports The ACE format for exporting projects is modeled after the format used by the Phred Phrap Consed package which is also supported by other sequence editors Exporting will create three directories as illustrated below 600090 7 export dir 10 items 24 2 GB available Name i v edit dir j Contigl ace v chromat dir A455 s A454 5 A326 r v phd dir O Ad55 s phd 1 O A454 s phd 1 4326 r phd 1 Exporting Assemblies 169 CodonCode Aligner User Manual The folder edit dir contains a single file the ace file This is a text file that contains the information about the assembly for example the number of contigs and the consensus sequences The second folder chromat dir contains the chromatogram files format for the exported traces The trace files are in SCF Standard Chromatogram Format format The third folder called phd dir contains PHD files for each sample The PDH files are text files which contain the base calls qualities and additional information like tags You should be able to directly open the exported project in Consed and hopefully in other contig editors that support the ACE file fo
298. ples by In the Contig view Trace View interaction panel you can choose what happens when you have the contig view and the trace view for a contig open If the check box before Automatically pick 3 traces to show is checked Aligner will try to pick 3 traces to show every time you move around in a contig However please note that Aligner will not automatically open the trace view for you You can choose how many traces Aligner should pick we suggest to use smaller numbers for faster performance In the Trace view panel you can set the default height of traces in trace view windows try it out In the Feature view panel you can determine how feature views will behave Since Aligner version 1 1 2 feature views can show the features for more than one contig For example you may be interested in viewing all PolyPhred tags in all of your contigs in a single table You can do this by selecting all contigs and then selecting Feature View in the View menu If you have Allow feature views to show features from multiple contigs checked you will get just one window But if you have Show separate feature views for each contig checked you will get an individual window for each contig you guessed that much didn t you There s just one thing to notice when you allow feature views to show features for multiple contigs any feature will be shown in only one window This means that Aligner may sometimes close older feature views If
299. ptions in this dialog let you fine tune how Bowtie2 creates the alignment Most of these options are intended for expert use only For additional information about these options please check the Bowtie2 documentation in the HelperPrograms folder inside the folder where CodonCode Aligner is installed or at http bowtie bio sourceforge net bowtie2 Hovering oven an option with the mouse will show a tooltip text that shows the corresponding command line option Alignments with Bowtie 2 77 Contigs Successful assemblies or alignments result in one or more contigs Contigs are named Contig1 Contig2 and so on and shown as folders in the project view If you select a contig in the project view and then double click on it or choose Contig from the View menu you will see the contig view which shows a graphical overview as well as the aligned bases You can edit samples in contigs as described in the Editing Samples section and you can edit contigs as described in the Editing Contigs section Here is an example of a contig view eoo Contigl MF PON se Show differences Arrow Layout M 4768 bp of 19 kb 7 000 bp 8 000 bp 9 000 bp 10 000 bp 11 000 bp 273 E57 x2 lt lt 273 M36 s1 273 M36 x2 273 M36 x1 273 M69 s1 lt lt 273 E02 s lt lt 273 L12 81 Contigl 9060 78 Unassembling Contigs To dissolve an existing contig and
300. quence for example due to polymerase stutter after poly A runs Also please keep in mind that the heterozygous indel finding is intended only for sequences from genomic PCR You can easily remove incorrect heterozygous indel tags as follows Open a trace view that shows the indel tag the easiest way to do this is to double click on the line describing the indel tag in the report view shown above or in a feature view Right click OS X control click on any base with the indel tag to bring up the popup menu e Select Show local tags from the popup menu to open the tag dialog n the tag dialog select the heterzygousIndel tag then press the Delete button followed by the OK button Splitting Heterozygous Indels You can split heterozygous indels into two new pseudoallele samples as follows e Select the sample s with a heterozygous indel tag Go to the Sample menu and select Split Heterozygous Indels For each sample with a heterozygous indel two new samples will be created in the Unassembled Samples folder CodonCode Aligner will try to separate the traces starting at the indel site into a longer and a shorter pseudo allele This often works reasonably well but please keep these limitations in mind e Splitting will work only for heterozygous indels up to about 25 bases and only if the indel is in a region where peaks are reasonably well separated For other indels the sample traces that result from the sp
301. r file 3 Select the sequences you want to screen against Using UniVec Library Files UniVec is a database created by the NCBI where redundant sub sequences from vectors have been removed UniVec also contains sequences for linkers primers and adapters that are commonly used in cloning Two UniVec library files have been installed in your Vector folder inside your settings folder UniVec txt UniVec Core txt For more information about UniVec refer to http www ncbi nIm nih gov V ecScreen UniV ec html http www ncbi nIm nih gov V ecScreen Interpretation html Definitions The typical use of UniVec for vector screening would be to screen against all sequences in UniVec In CodonCode Aligner this is currently not supported it would take a really long time You can select several sequence fragments from UniVec to screen against but typically it s a better idea to use a custom vector file Using Custom Vector Files Custom vector files can contain any collection of vector linker etc sequences that you want to screen against in FASTA format An example custom vector file called CustomVectors txt is installed in your Vector folder inside your Preferences folder It includes some common vectors like BlueScript M13 pBr pGEM and pUC Custom files can be kept in the same vector folder as the UniVec files or in any folder that you choose To add sequences you want to screen against we suggest that you make a copy of the Cus
302. r Base 200 of 628 Quali 13 The Quality View graphs quality value Y axis versus base position X axis for all base calls The quality graph can be enlarged or reduced by resizing the Quality View window click and drag a corner of the window Clicking in the quality view window will move the cursor in all views for this sample This can be useful to quickly check out problem regions like the low quality region near base 200 in the example above Just open a trace view and a quality view for a sample and click at the low quality regions in the quality view then look at this region in the trace view Quality View Window 189 Contig View Window Choose Contig View from the View menu to display a window showing an overview or the differences of the alignment and the aligned bases for a contig eoo Contigl amp MF P Ee Show differences Arrow Layout Y a er eae ERES C 4768 bp of 19 kb 7 000 bp 8 000 bp 9 000 bp 10 000 bp 11 000 bp 273 E57 x2 lt lt 273 M36 s1 273 M36 x2 273 M36 x1 273 M69 s1 lt lt 273 E02 s1 lt lt 273 Ll7 Sl Contigl The upper half of the contig can either show a graphical overview or a difference table of the contig The graphical overview is shown in the example above If you press the button Show differences you will see the difference table for the same alignment Contig View Window 190 CodonCode Aligner User
303. r Manual Base calling Base colors Clicking amp scrolling V Display Non Cutters Consensus method End clipping Features pese only enzymes that cut Highlighting License Server M 1x M 2x M 3x V 4x amp More M Display Cutters Memory Mutations Map style Open amp save O Single Line Multiple Lines Text virtual Gel Phrap assembly Preference options Virtual Gel Options Printing Protein translation Marker 100 bp Ladder ree Restriction maps V Show one digest for all enzymes M List cutters at bottom of map DNA type 9 Linear DNA Circular DNA Window placement Description The restriction map preferences control which enzymes to use for creating the restriction map and how to display the results Cenc GED Restriction Map Options 282 Sample Name Preferences Defining sample names CodonCode Aligner can interpret parse sample names to automatically group samples and assemble samples in groups You can define how sample names should be parsed in the Sample name preferences Define sample name parts Meaning Delimiter alarm ll Lon en Base colors Clone period Consensus method Direction _ underscore Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Restriction maps Startup Toolbars
304. r added by users and not the program will remain this includes confirmed tags and tags where the tag type was changed for example from homozygous to heterozygous When removing tags from previous mutation detection rounds Aligner will also undo automatic edits like changes to ambiguities done during previous Find mutation cycles If the Add tags only to mutated bases checkbox is checked Aligner will add tags only to bases that differ from the consensus sequence This is useful if for example you are looking for rare mutations SNPs In other cases for example when genotyping you may want to add a tag to all samples at each consensus position where a mutation is found to do so make sure the Add tags only to mutated bases checkbox is not checked Then Aligner will add tags that characterize the base at a given consensus position to all samples even if just one sample out of a hundred differs from the consensus base Detection sensitivity 264 CodonCode Aligner User Manual The last two checkboxes in the Marking mutations section determine if Aligner will change base calls at homo or heterozygous mutations The default behaviour is that Aligner will leave the bases unchanged and only add tags at mutated bases If you want to export your data for subsequent analysis with other programs for example the population genetics program Arlequin you may need to have ambiguity codes at heterozygous bases If you mark the checkbox Use a
305. r example FASTA or Genbank format Aligner can also create multiple new samples from the clipboard contents Compatible File Formats The following sample file types can be read by Aligner e SCF files Standard Chromatogram Format commonly available and generated by Phred LI COR software and many other programs This is the preferred format especially if the SCF files were generated by Phred It is also the format used by Aligner to store chromatogram information Note Sometimes SCF files have the the file extension scf this will be hidden in Windows even if you have your preferences set to display file extensions However Aligner will recognize this file extension ABI chromatogram files Files generated by systems from Applied Biosystems software Typically have the extension abi or ab1 but Phred generated SCF files will typically have the same name and extension Note that older ABI files may not contain base specific quality scores after importing ABI files that do not have quality scores you should first base call to get quality scores FASTA files text files with one or more DNA sequences where each new sequence starts with a line that starts with a gt sign followed by the name of the sequence If the FASTA header line also contains the name of corresponding PHD or SCF files Aligner will try to read these files too FASTO files text files with one or more DNA sequences and their qualities A FASTQ file no
306. r expected to be zero All results obtained with Aligner should be checked by a qualified scientist The following is an incomplete list of some known limitations and suggestions Identification of heterozygous point mutations requires sequencing reactions generated from PCR products from heterozygous template DNA e Random peaks in sequence traces may cause mis classifications you can add a dontGenotype tag in such regions so that Aligner will ignore it the next time you choose Find Mutations Aligner relies on peak patterns that are very similar between the different samples in an analysis Any experimental changes including but not limited to the use of different sequencing primers kits enzymes dyes sequencing machines and running conditions may result in peak pattern variations How Aligner Finds SNPs 98 CodonCode Aligner User Manual that cause increased error rates The base calls need to be correct in the analyzed regions at heterozygous bases one of the two bases must be called correctly or the correct IUPAC ambiguity code must be used Homozygous bases that have ambiguity base calls are likely to be classified incorrectly Vector sequences in the samples may cause analysis errors e Sequence quality must be high and base specific quality scores must be reasonably accurate but need not be perfect Mistakes are most likely in low quality parts of samples and may affect other samples at this position Mi
307. r file make sure to save it in a Text only format if using Word as the editor and try the base calling again Problems reading the Phred parameter file If PHRED cannot find or read the Phred parameter file you will see the following error message E 1 eoo Base calling error The following error occurred during base calling Phred produced no result files Probable cause problem finding or reading Phred parameter file For more information check the error messages in Applications CodonCode Aligner Phred Phrap Basecalling errors txt To fix this problem you can do the following 1 Make sure that the path to the Phred parameter file that is specified in the base calling preferences is correct and that the Phred parameter file is readable 2 Check the Basecalling errors txt in the Aligner directory for hints about what is wrong 3 Verify that the Phred parameter file is a plain text file and not a binary format like RTF or Microsoft Word s doc format 4 Make sure that the file has the correct line endings especially on OS X due to it s mixed origins OS X files can have either Macintosh style line endings or UNIX style line ending Phred requires UNIX line endings on OS X You can use tools like BBEdit Lite or LineBreak 2 2 to convert line endings if needed Wrong command line parameters If you see the following error message r e Base calling error The following error occured during base
308. r large data sets it is generally used with external data files In other words the sequences to be aligned are not imported into a CodonCode Aligner project first Instead the alignment results imported into CodonCode Aligner projects Please note that CodonCode Aligner is currently not intended for working with large genomes or very large datasets While Bowtie2 can align large data sets to entire genomes importing the results into CodonCode Aligner will typically not be possible On most computer CodonCode Aligner can work with alignments of several hundred thousand short reads to single chromosome on computers with large amount of memory RAM working with several million reads may be possible To perform an alignment with Bowtie2 1 Open an existing project or create a new project see Creating Projects 2 Choose Align with Bowtie2 from the Contig menu This will display the following dialog Alignments with Bowtie 2 73 CodonCode Aligner User Manual fixo Bowtie2 Alignment Align to 9 Sequences from file Sequences to align First sequence file to align Select Second sequence file for paired end alignments Options Local alignments End to end alignments fV Exclude unaligned reads Paired end options Insert size range from 0 Exclude unpaired ends _ Exclude pairs with wrong insert size or orientation More options Cancel ox The Align to section at the
309. r results and remove the junk sequence at the end of chromatograms The methods are explained in more detail on the End clipping algorithms help page If you choose the first method you only have to specify one parameter which is the maximum error rate for the clipped region If you select the second trim method you can define the end clipping stringency in more End Clipping Preferences 252 CodonCode Aligner User Manual detail as illustrated below eoe Preferences Alignment End clipping Assembly A E Base calling 7 Maximize region with error rate below 0 1 Base colors II Use separate criteria for start and end Consensus method r Trim from start until Double clickin e I r End clipping da ERU V Error rate is below 0 1 ina 25 base window Features f There are fewer than 3 bases with quality Hon below 20 ina 25 base window License Server Memory r Trim from end until Mutations v Error rate is below 0 1 ina 25 base window Open amp save Tu Phrap assembly L There are fewer than 3 bases with quality Preference options below 20 ina 25 base window Printing Protein translation After end clipping cea names vi Move all sequences shorter than 25 bases to trash Vector trimming v Move all sequences with fewer than 50 row f Phred 20 HJ bases to trash Warnings Window placement Description The end clipping preferences control how low quality bases a
310. r than the value you set here with 25 being the default alignments will be rejected and samples will remain in the Unassembled Samples folder Minimum Alignment Score This parameter is similar to the Minimum Overlap Length but it takes discrepancies into account Scores will be scaled so that a match gives a score of 1 for each matching base in the aligned region a score of 1 will be added With the default settings a score of 2 will be subtracted for each mismatch for single base insertions or deletions a score of 5 will be subtracted 3 gap introduction penalty and 2 gap penalty additional gaps in the same run lead to a subtraction of 2 per base In general your minimum alignment score should be lower than your minimum overlap length to allow for some level of discrepancies between the sequences Algorithm 231 CodonCode Aligner User Manual Maximum Unaligned End Overlap This parameter is perhaps the hardest to understand After doing an alignment Aligner looks at the unaligned dangling ends of both reads Since Aligner does local alignments two aligned sequences may have unaligned bases at the same end This will happen for example when aligning two different copies of a repeat sequence or if one of the samples is a chimeric clone It can also happen if the sequence of one or both clones has a very high error rate as typically seen towards the end of reads that have not been end clipped To illustrate how thi
311. ract Default qualities for Low quality edits f 10 H High quality edits 30 R4 Align to reference sequence consensus determination Use reference sequence as the consensus Exclude reference sequence when building consensus In uncovered regions use H as consensus External Consensus Conserve external consensus O Rebuild external consensus on import Low coverage regions Q If coverage is less than 2 use N 7 The consensus method preferences control how the consensus sequence is formed Consensus Method In the section Consensus method at the top you choose whether Aligner will use a quality based consensus a majority consensus an inclusive consensus or a percentage consensus For the percentage consensus you can set the minimum percent that a base has to occur to be included in the consensus You can set different consensus methods for regluar contigs and for contigs of contigs The default setting in CodonCode Aligner is to use a qualtiy based consensus for both regular contigs and contigs of contigs For most projects we strongly suggest using a quality based consensus for most contig A quality based consensus mimics what a human contig editor would do to determine the correct consensus sequence Aligner looks for the highest quality sample at each position taking into consideration confimation by Consensus Preferences 248 CodonCode Aligner User Manual samples in reverse direction as well as disagre
312. re clipped from samples end clipping works only on samples with qualities Help Cancel You can choose to trim from the start until the estimated error rate drops below the cutoff you choose and also specify the length of the window over which to calculate the expected error rate Alternatively you can clip until there are only very few low quality bases in a window specifying the window length the maximum number of low quality bases and what low quality means to you typically Phred scores lower than 20 You can also combine these two measures or choose neither one if you do not want to end clip at the start The same applies to clipping from the end you can choose different numbers at the end of sequences For example it often makes sense to use longer windows at the end than at the start since the quality rapidly improves at the start of sequences but only slowly deteriorates at the end Automatically removing short and low quality sequences after end clipping You have the option to automatically identify bad sequences after the end clipping and move those to the trash Such bad sequences can be due to failed sequencing reactions or any number or other problems We Automatically removing short and low quality sequences after end clipping 253 CodonCode Aligner User Manual suggest to move all sequences that are too short for example less than 25 or 100 bases after clipping to the trash A second widely us
313. re using PHRED version 0 020425 c use ABI 3700 for data from ABI 3730 and ABI3730XL sequencers and use ABI 3100 for data from ABI 310 sequencers You can also add new entries by pressing the Add button but that should usually not be necessary After verifying the new entries press the Save button to save your changes f you press Cancel your changes will not be saved and you will most likely see the Missing entries error described below You could also use a text editor to edit the Phred parameter file but unless you really know what you are doing we strongly suggest that you use Aligner s build in editor instead as described above You can also check and edit the Phred parameter file by pressing the button labeled Edit in the Base Calling Preferences Base calling problems When using Phred for base calling a number of things can go wrong This section describes the most common problems and how to solve them e Cannot find the base calling program Missing entries in the Phred parameter file Problems reading the Phred parameter file Wrong command line parameters Problems running the workstation version of Phred Many of the problems are related to the Phred parameter file This is a file used by Phred to determine which dye type sequencing chemistry and sequencing machine were used to a given trace For more information please read the About the Phred parameter file section below Cannot find
314. relative to the reference sequence and if present the coding sequence annotation of the reference sequence With the default settings aligning a cDNA sequence with several exons to a genomic sequence will typically fail or give a bad alignment However you can change this by selecting the Large Gap algorithm in the alignment preferences the Large Gap algorithm is specifically intended for cDNA to genomic alignments Assembly and Alignment 52 Sequence Assembly Before assembling Before performing an assembly in CodonCode Aligner you ll need to create or open a project and import the sample files you want to assemble You also may want to pre process your samples by end clipping and vector trimming it s a good idea to save your project now before starting the assembly How to assemble Go to the project view e Select the samples and or contigs that you want to assemble Choose Assemble from the Contig menu Note To make a continuous selection keep the shift key pressed while clicking on samples or contigs To make a discontinuous selection press the control key on Windows or the command key on OS X while clicking on samples or contigs The assembly will start and show a progress window i eo Sequence Assembler Progress Algorithm Phases Vv Initialization V Overlap Detection part 1 Overlap Detection part 2 Alignment Data Model Update dye Tete eri efi AREER HN DU B Pee Overlap Det
315. restriction map You have the option to show only those enzymes that cut a specific amount of times For example the restriction map will show only unique cutters if you have only the 1x checkbox selected You can set the map style Restriction Map Options 280 CodonCode Aligner User Manual A Single Line map displays a graphical map where all enzymes that cut are shown together on a single line The Multiple Lines map shows a separate graph for each enzyme that cuts The Text map lists the cut results in text format The Virtual Gel shows a simulated gel with one lane for each enzyme The results for the single line multi line and text map can either be displayed as Cut Positions or as Fragment Sizes The cut positions and fragment sizes are shown in base pairs You also have the option to list the cutters in a summary at the bottom of the map The summary shows the cutters sorted by the number of cuts A summary of non cutters is always listed if the Display Non Cutters checkbox is selected In the second section you set the DNA type used for the digest to be either linear or circular DNA This can affect your results for fragment sizes and cut positions shown in the map For the virtual gel you can also choose the marker to use in the gel and show one lane with a digest for all selected enzymes Fragments in the gel are always shown in base pairs Restriction Map Options 281 CodonCode Aligner Use
316. return the samples in it to the Unassembled Samples folder select the contig in the project view and choose Unassemble from the Contig menu or click on the Unassemble button in the project window toolbar Any gaps created by Aligner are removed and samples that were reverse complemented are returned to their normal state You can also unassembled contigs by first selecting the contig in the project view and then dragging amp dropping the contig onto the Unassembled Samples folder Before unassembling contigs this way Aligner will show a warning dialog asking you if you really want to unassemble the selected contig s Unassembling Contigs 79 Aligner Algorithms for Assembly and Alignments CodonCode Aligner uses a fast banded dynamic programming Smith Waterman algorithm for pairwise alignments in both assembly and alignments By default CodonCode Aligner version 2 0 1 and newer will use end to end alignments however you can instead choose to have large gap or local alignments This section describes how Aligner generates assemblies and alignments to reference sequences Alignment to a Reference Sequence When aligning to a reference sequence the selected samples are successively aligned to the reference sequence Alignments that meet the stringency criteria set in the alignment preferences are accepted those that do not meet the minimum criteria are rejected If your selection contains more than one reference
317. reviously created project This will create a Project Window where the contents of the project are shown similar to the way Finder or Explorer display contents of disks and folders 099 example_project i us B E w b Save Project Add Samples Add Folder Add Assembly Align to Reference Sequence Assemble Unassemble s y Name Contents Length Quality Position Added Modified v ui Unassembled Samples 2 samples 0 3 11 3 11 03 BU A454 s Trace 693 397 0 3 11 3 11 03 B A455 s Trace 750 343 0 3 11 3 11 03 v 3 Contig1 3 samples 966 917 3 11 3 11 03 B A326 r Trace 628 375 0 3 11 3 11 03 E A060 s Trace 645 389 221 3 11 3 11 03 H A333 r Trace 646 370 320 3 11 3 11 03 3 Contig2 2 samples 755 720 3 11 3 11 03 gt Cj Trash 0 samples 0 3 11 3 11 03 G I Assembly completed in 1 62 seconds 1 successful join 1 island remaining In the project window you can add samples an entire folder of samples or CodonCode Aligner projects and Phrap assemblies using the buttons on the top or the corresponding items in the File menu You can also add sequence files to a project by dropping the files onto the project view Newly imported samples will be in the Unassembled Samples folder Any contigs that are created or imported from other assemblies are shown as separate folders You can also create manual folders to organize your samples and contigs In
318. rimer pairs Primer Results After clicking the Pick Primers button in the primer design dialog CodonCode Aligner will run Primer3 and then show you the results fou Primer Results for Contig1 7 m Bd zi Select the primers to import Select All Select None M Primer Pair 1 Name Sequence Start Length Tm GC Self Any Hairpin 3 Stability PrimerlF GATCGTCTCTCCTCCCCTCA 20 59 82 60 0 0 00 0 00 3 86 PrimerlR GGGGATCGTATGCCATTTCT Product size 1657 Pair Any 0 0 Pair End 0 0 M Primer Pair 2 Name Sequence Start Length Tm GC Self Any Hairpin 3 Stability Primer2F ATCGTCTCTCCTCCCCTCAC 0 00 Primer2R GGGGATCGTATGCCATTTCT Product size 1656 Pair Any 0 0 Pair End 0 0 Mv Primer Pair 3 Name Sequence Start Length Tm GC Self Any Hairpin 3 Stability Primer3F GATCGTCTCTCCTCCCCTCA 0 00 0 00 3 86 Primer3R GGGGATCGTATGCCATTTCTT Product size 1657 Pair Any 0 0 Pair End 0 0 Primer Pair 4 Name Sequence Start Length Tm GC Self Any Hairpin 3 Stability Primer4F GTCTCTCCTCCCCTCACCTC 0 00 3 85 Primer4R GGGGATCGTATGCCATTTCT 2 52 Product size 1653 Pair Any 0 0 Pair End 0 0 Primer Pair 5 Name Sequence Start Length Tm GC Self Any Hairpin 3 Stability PrimerSF ATCGTCTCTCCTCCCCTCAC 5 20 60 11 60 00 0 00 0 00 0 00 3 51 LY To import the primers into your Aligner project select the primers you
319. rizontal scroll bar at the bottom to move around in a contig You can zoom in and out using the zoom popup control at the bottom left of the base panel or by changing the font size for the contig view in the view preferences The bases are displayed according to your color preferences In the picture above a quality based three color scheme was used You can resize the panels by dragging the bar between the panels Navigating using the difference table 198 CodonCode Aligner User Manual The names of the samples are shown on the left side of the aligned bases panel Reverse complemented samples are indicated by before the name and by red sample names You can select samples by clicking on the sample Phylogenetic Trees The contig view can also display a phylogenetic tree for its contig to the left of the sample names You can Fel nck the tree by going to the Contig menu and selecting Build Tree or by using the toolbar button Build Tree This will show a dialog with different options of how to build the tree ROL Build Tree Method Neighbor Joining Distance Model Number of Differences 9 p distance Gaps Missing Data Pairwise Deletion Complete Deletion Consider Internal Gaps O Consider All Gaps Display vi Topology only M Label branches PLT YE CodonCode Aligner allows you to build a Neighbor Joining tree with the following options 1 Distance Model The distance Number of Difference
320. rmally uses four lines per sequence The first line starts with a character and is followed by followed by the name of the sequence Line 2 contains the sequence Line 3 begins with a character Line 4 encodes the quality values for the sequence in Line 2 and must contain the same number of symbols as letters in the sequence GenBank files text files exported from Genbank and many other programs Genbank files are often used for the reference sequence in re sequencing and mutation detection projects When reading Genbank files Aligner will read the CDS coding sequence annotation including the codon start tag this tag indicates the number of the base after the CDS start which start the first whole codon and can either be 1 2 or 3 In Aligner the CDS region is shown as a codingSequence tags and the codon start annotation as a codonStart tag EMBL files text files exported from ENSEMBL and many other programs in EMBL format Like Genbank files EMBL files can be used for the reference sequence in re sequencing and mutation detection projects Aligner will read the CDS coding sequence annotation similar to the way described for Genbank files Creating new text sequences 28 CodonCode Aligner User Manual e NBRF PIR files text files in NBRF PIR format a simple format that can contain multiple sequences per file Sequences in NBRF PIR format may contain gaps in the sequences as well as at the start and end
321. rmat However if you transfer the exported files to a different operating system make sure that the files are transfered correctly The chromatogram files must be transfered as binary files and the other files must be transfered as text files Incorrectly transfered files will likely cause problems when you try to open them NEXUS PAUP Format Exports The NEXUS PAUP format allows you to export projects for phylogenetic analysis programs like MacClade or PAUP Only contigs will be exported with a single file being created for each contig Note that the exported files only contain information about the bases and gaps but not about associated chromatograms or sequence qualities You have a choice of exporting in either interleaved or sequential format Different phylogenetic programs have different restrictions on which kind of files they can read so you may need to try both to see which one works for the program you plan to use If you have sample names that are very long and or contain spaces or other unusual characters it may be necessary to truncate or change the name of the samples in the exported files Again different programs have different restrictions If sample names may to be changed in the exported files Aligner will present you with a list of choices on how to change the sample names Phylip Format Exports The Phylip format allows you to export projects for phylogenetic analysis programs like MacClade or PAUP Only contig
322. rocessing choices are not applied to samples that are already in contigs Help Cancel Advanced assembly options 54 CodonCode Aligner User Manual The checkbox at the top determines whether or now your samples will be pre processed before assembly the four lower check boxes let you pick the pre processing steps that will be done The choices are Base call samples without qualities Any samples that have chromatograms but no base specific quality scores will be base called with PHRED To use this option you will need either a trial license or a purchased license base calling is not enabled in demo mode Additional information about base calling can be found at the Base calling help page Please note one important difference to the normal Call bases menu choice in automated pre processing samples that already have quality values for example from the ABI KB basecaller or from calling bases on the sample before will not be base called again Find heterozygous indels This option will look for potential heterozygous insertion deletion indel mutations in the unassemble samples that have a chromatograms and b quality scores If you are sequencing PCR products from genomic DNA that may contain heterozygous indels you should check this option if you are sequencing from cloned DNA this option should not be checked For more information please read the Heterozygous insertions and deletions help page Clip end
323. roject view 2 Select both the contig and the samples that you want to add to it to make continous selections use shift click to make discontinuous selections use control click on Windows and command click on OS X 3 Go to the Contig menu 4 Choose Assemble or if your contig is an alignment to a reference sequence choose Align To Reference Sequence Aligner will try to merge the samples with the contig If samples share an overlap that meets the minimum criteria you defined they will be added to the contig Samples that do not overlap the contig or where the overlap is not good enough will remain in the Unassembled Samples folder You can also choose more than one contig and one or more samples for example two neighboring contigs and some finishing reads that bridge the gap between the contigs Alternatively you can use drag and drop in the project view to add samples to contigs First select the samples and or contigs you want to add in the project view and then drag and drop them onto the contig to which you want to add them this target contig cannot be in the initial selection Once you release the mouse CodonCode Aligner will start the assembly of the samples and contig s When you use the Assemble or Align To Reference Sequence menu with existing contigs the arrangement of the samples in the contig will remain the same changes are limited to any gaps that need to be introduced re building of the consensus s
324. round colors eee eee eee ee sees esee eee eene te sense tn setas senes eso nas 240 Basesspeckfie olgES ae ceeessesee trennt etre oi EEDI E eo KESU EH URS UH a EFE AX EERE FI VU UNEE 242 Translation based background COlOES eo bees hte ontas EE iss Feb ereou srr Uk RE CH Y bKE GEXE RE NAE UE ER FUE EE FEY ENNES Y ERE REUS 245 Consensus Preferences PEPE A P erhebt ee e HI IURE EIE dd 248 Come SUNS EO he cates a me 248 AE TT CUA eA oco oo rotor e nee s a ck MSS E E E EE 249 Quality Scores At Discrepancies Amd Pais siue OR E ei 249 Reference Sequence ATIS pr HE prot DE IE ERU EE AQ XMAUERH LH Lean PMER KE SEEMS LAN peII QR dS 250 External Consensus Sequences uisi ec ip ren n EA NE E AT FEE eee PENNE V EE EM Peia 250 Misk ma Low orent e Ree One s us pio UO ROH URINE EE acu ENTIS E E EE Re ENO IRE ER FRU AR URP ARU EE 250 Clicking amp Scrolling Preferentes cie nire A YR EEYER FEEDER ERREUR 251 End Clipping Prelerences asco setis tk ota traen oiseau ia cU M Uue e Ve ions S RP DNA aa eb a eS ed tae AN oO P RS 252 Automatically removing short and low quality sequences after end clipping 253 Featur Prelerent S soson eaeoe aaa aee a aeae r IN QUA eoo canes ae oeeo URN 255 ENE TEOT IE Dee Sc ros carie A E A E E O uU E A A 256 Highlighting Preferences Pe AANE PEE TE A E E E dnd ne esi bie rds aao CodonCode Aligner User Manual Table of Contents
325. rse complement a sample or contig Go to the project view e Selec the contig or a sample in the Unassembled Samples folder Choose Reverse Complement from the Edit menu In most views you will be able to identify samples that have been reverse complemented by the prefix before the name and by the fact that the name is drawn in red In the project view you can identify reverse complemented samples by the icon it has red rather than black borders Reverse complementing of unassembled samples is possible but usually not necessary since samples will be reverse complemented as needed during assembly and alignment You cannot reverse complement samples in contigs directly since that would destroy the alignment to the consensus If you select Reverse Complement when a contig view is in the foreground the entire contig will be reverse complemented Reverse Complementing 152 Splitting Contigs Like other assemblers that use a greedy assembly algoritm CodonCode Aligner will occasional misassemble contigs You can manually split misassembled contigs into two parts as follows Open the contig view for the contig in question e Set the cursor to the position where you want to split up the contig e Select Split contig from the Contig menu Aligner will create two new contigs one containing the samples that were to the left of the point where you split the contig and one containing the samples to the right For any
326. rse complementing of unassembled samples is possible but usually not necessary since samples will be reverse complemented as needed during assembly and alignment You cannot reverse complement samples in contigs directly since that would destroy the alignment to the consensus If you select Reverse Complement when a contig view is in the foreground the entire contig will be reverse complemented Reverse Complementing 135 Editing Sample Information To view information about a sample or to change a sample name e Select a single sample in the project view or in trace view or contig view Go to the choosing Sample menu and select Sample Information or use the keyboard shortcut control I on Windows command I on OS X This will show the sample information dialog r Name va 16 x 423 bp 44 7 GC 107 A 114 C 75 G 127 T Comments Tags VY Allow manual edits Cancel OK You can edit the sample name in the Name filed and add or change remarks about the sample in the comments field The length and base composition is shown below the name You can also designate a sample file as read only by unchecking the Allow Manual Edits checkbox Changing Sample Names You can change the sample name by editing the Name field Note that we do not recommend using spaces or other funny characters in the sample names since such characters can cause problems when using these sample files in other
327. rt description Basically Aligner will use the most common base at each position as the consensus unless no base accounts for more than 50 of the base calls there in which case an ambiguity code will be used Well this is actually a bit simplified here is how the majority consensus is determined in detail The long description First Aligner looks at all the bases and gap characters in the aligned parts of all samples at this consensus position If more than 50 of the samples have a gap here the consensus will be a gap Otherwise the gaps will be ignored for the following analysis If none of the base calls are ambiguities here the rest is simple If one base A G C or T accounts for more than 50 of all non gap base calls here it is used as the consensus base If no base accounts for more than 5096 a IUPAC ambiguity character is used based on all the base calls here The IUPAC ambiguity codes are Ambiguity Code M CorG AorGorT R W S Y K V H D B N Quality based Consensus 82 CodonCode Aligner User Manual If at least one of the base calls in the samples at this position already is an ambiguity code determining the majority consensus is done as follows Each regular base call here gets a score of two For ambiguity codes each base represented by the code gets a score of one for example at a M call both A and C would gets a score of one The scores for all samples that have aligned bases at th
328. rt them into a simple csv comma separated value format The exported file contains one line for each sample which consists of the primer name and the sequence Exporting Primers 118 CodonCode Aligner User Manual You can export primers by choosing Export gt Samples from the File menu In the upcoming export dialog choose Primer CSV as the format Note All sequences in the folder called Primer will be treated as primers and will be exported Additional Information CodonCode Aligner runs Primer3 to pick primers Primer3 Copyright c 1996 1997 1998 1999 2000 2001 2004 2006 2007 2008 2009 2010 2011 2012 2013 Whitehead Institute for Biomedical Research Steve Rozen http purl com STEVEROZEN Andreas Untergasser Maido Remm Triinu Koressaar and Helen Skaletsky All rights reserved If you use primer design in CodonCode Aligner please cite the use of Primer3 in publications as Untergasser A Cutcutache I Koressaar T Ye J Faircloth BC Remm M and Rozen SG Primer3 new capabilities and interfaces Nucleic Acids Res 2012 Aug 1 40 15 e115 The paper is available at http www ncbi nlm nih gov pmc article PMC3424584 Source code available at http sourceforge net projects primer3 Additional information and documentation about Primer3 and many of the parameters available for primer design can be found at http primer3 ut ee primer3web help htm Please note that some of the parameters available in CodonCode Al
329. s Make sure that you have selected the cloning vector s that you used 2 Since vector trimming cannot be undone it s a good idea to save your project now 3 In the Project window select the samples that you want to screen You can screen only unassembled samples not samples in contigs Typically just select the Unassembled Samples folder to screen all unassembled samples 4 Select Trim Vector in the Sample menu Aligner will start to look for matches between the samples you selected in the project window and the vectors you selected in the Preferences You will see a progress window e Vector Trimming Progress Find Matches Find Matches is 16 complete XXE Mes Cancel P You can cancel the vector trimming at any time before it is complete 5 After Aligner has found all vector matches that fit the criteria you defined in the Preferences a new window will show the results Vector Trimming Results Sample Name S Bases 5 Vector djs74 2361 s1 0 djs74 237 s1 djs74 996 s2 djs74 564 s1 djs74 690 x1 djs74 561 s1 djs74 824 s1 djs74 932 s1 djs74 423 s1 0 Phage M13 genome eo ouc a amp N 3 Bases 3 Vector 6 Cloning vector pBR322 4 oOogocoooococcoco K X Cancel You will see a different dialog if no matches between your samples and the vector sequences were found You can now choose to apply the trim results and remove the bases at the start or
330. s This will remove low quality sequence from samples that have chromatograms and quality scores For more information please read the End clipping help page Trim vector When checked this option will identify and remove vector sequence contamination from the samples in your selection You may need to set your vector trimming preferences before using this option For additional information please read the Vector trimming help page You will see progress dialogs for each of the steps performed after you click the Assemble button Note that any samples that are already in contigs will not be pre processed the preprocessing steps are only applied to unassembled samples in your selection Assemble in groups Assemble in Groups allows you to automatically build separate contigs for different sample groups based on sample names or multiplex sequence tags MID tags After selecting the samples you want to assemble in the project view go to the Contig menu move to Advanced Assembly and select Assemble in Groups This will display the following dialog Assemble with preprocessing 55 CodonCode Aligner User Manual f Contigs Preprocess Assemble in groups by fe Name part Define name parts Multiplex tag for 454 data Assemble in groups Aligner will build separate contigs for each group of samples in your selection ISamples will be grouped together either based on their jnames or b
331. s discrepancies and insertions deletions in a match Each matching bases gives a score of 1 while mismatches and insertions deletions reduce the score Therefore your minimum score should be lower than the minimum overlap length Keep in mind that there is always a trade off between sensitivity and specificity If you use very stringent match criteria you are likely to miss some vector matches if you use very loose criteria you may end up trimming sequences from random hits Vector Trimming Preferences 293 View Preferences The view preferences allow you to set options for the different views r View preferences Contig view Base calling Base colors Sort samples by e Contig position Clicking amp scrolling Direction and contig position Consensus method vat End clipping 7 Sample name Features Mask bases that match the consensus sequence Highlighting License Server Memory Automatically pick 3 E traces to show Mutations Open amp save r Trace view r Contig view Trace view interaction Phrap assembly Preference options Height for trace view windows Small Hd Printing Protein translation r Feature view Restriction maps P O Show separate feature views for each contig 9 Allow feature views to show features from multiple contigs r Font Size Project view 13 Hd Contig view 13 HA Window placement Feature views 11 Hd Other views 13 HJ r Description
332. s in regions with low coverage to the chosen character You can specify in which regions you want to replace the consensus bases with the masking character by setting the minimum number of coverage needed to show the original consensus base If the coverage is less than the set number the consensus base at this position will be replaced with the chosen character Please note that the default behavior in CodonCode Aligner is to not use this option Quality Scores At Discrepancies And Edits 250 Clicking amp Scrolling Preferences The clicking amp scrolling preferences allow you to choose what happens if you double click on one or more samples in the project view windows and to set how your scroll wheels are used r Double clicking in Project View r Views to open Base calling p Base colors When double clicking on samples in project view open Consensus method V Trace view _ Base view Quality view End clipping Features r Samples in contigs Highlighting ae P R License Server If a sample is in a contig double clicking on it will Memory also open the contig view Mutations Open amp save ak Phrap assembly 7 not open the contig view only open the contig view Preference options Printing r Scroll wheel handling Protein translation Restriction maps Horizontal scrolling O Bi directional or vertical scrolling Window placement Description The clicking amp
333. s in the Open dialog to be able to import the file Here is an example of what the exported data look like after importing into Microsoft Excel Export Project Summary 162 Contig count Sample count Total sample bases Average sample length Average sample quality Average contig length 10 Average contig quality 12 Contig Name 13 Unassembled Samples 14 Contigi 15 Contig2 16 Trash 18 Sample Name 19 va 1 x 720 va 13 x _21 va 23 x _22 va 16 x 23 ca 9 r 24 ca 22 r 25 ca 22 s 26 ca 9 s ii ca z1 5 28 ca 23 s Export Project Summary Poly Phred_summary cs v CodonCode Aligner User Manual PolyPhred summary csv PolyPhred proj 11 21 03 10 01 f UsersfShared Documents Projects PolyPhred 2 io 9018 901 387 597 o Number of Samples 4 6 Sample Location Contigi Contigi Contigi Contigi Contig2 Contig2 Contig2 Contig2 Contig2 Contig2 Contig Length 0 473 722 0 Sample Length 1058 1020 1240 1025 869 860 765 742 745 694 Quality Coverage 0 0 3 9 0 4 0 0 Quality Direction 372 Fwd 406 Fwd 354 Fwd 382 Fwd 415 Rev 400 Rev 305 Fwd 394 Fwd 406 Fwd 437 Fwd Estimated Error Rate 0 00E 00 2 20E 02 3 55E 01 0 00E 00 Contig Offset 0 0 En 1 396 385 18 19 18 163 Exporting Samples You can export samples to text files in FASTA format or to chromato
334. s is the number of sites at which two sequences differ Please note that we suggest using the complete deletion method with this distance model since the pairwise deletion method does not normalize the number of differences if you have gaps in your alignment The p distance model uses the proportional distance between different nucleotide sites and the number of compared sites in two samples 2 Gaps Missing Data The Pairwise Deletion method removes all sites that contain gaps or missing data from each sequence pair during the analysis as needed When selecting Complete Deletion these sites are removed prior to the analysis from the whole sequence alignment Consider Internal Gaps considers all internal gaps as differences and removes only external gaps Choosing Consider All Gaps includes all gaps and missing data as differences when building the tree When including gaps note that a difference between a gap and a base has the same value as a difference between two non matching bases 3 Display options The check box Topology only ignores the branch lenghts when checked showing only the relationship between samples or if unchecked displays a tree where the branch lengths are Aligned Bases and Consensus Protein Translation 199 CodonCode Aligner User Manual proportional to the calculated evolutionary time between the sequences By clicking on the check box Label branches you can switch between showing and hiding the distance la
335. s a score of 1 for each matching base in the aligned region a score of 1 will be added With the default settings a score of 2 will be subtracted for each mismatch for single base insertions or deletions a score of 5 will be subtracted 3 gap introduction penalty and 2 gap penalty additional gaps in the same run lead to a subtraction of 2 per base In general your minimum alignment score should be lower than your minimum overlap length to allow for some level of discrepancies between the sequences Algorithm 226 CodonCode Aligner User Manual Maximum Unaligned End Overlap This parameter is only effective when the Local Alignments algorithm is used After doing an alignment Aligner looks at the unaligned dangling ends of both reads Since Aligner does local alignments two aligned sequences may have unaligned bases at the same end This will happen for example when aligning two different copies of a repeat sequence or if one of the samples is a chimeric clone It can also happen if the sequence of one or both clones has a very high error rate as typically seen towards the end of reads that have not been end clipped To illustrate how this parameter is calculated consider the following diagram 123456 7890123456 7890123456 7890 tctctctctcAGCGATCAATaaaaattttt LLEELELET TL LG I gggggAGCGATCAATaggcccaggcccgggacccag 12345 12345678901234512345 The sequence at the top has 10 unaligned bases at the start and end
336. s an example of what exported differences can look like after importing an exported differences file into OpenOffice p A B C D E F G H PolyPhred example proj Exported 0 Mar 2009 10 33 Excluded Nothing Differences in Contig1 Position 107 183 222 363 386 406 Total differences Consensus A Li va 13 x Ww Y va 16 x A T va 1 x w Y va 23 x Ww Y Summary 1A 3W 1T 3Y 1C 3S 3T 1W 3A 1W 3C 1M ooooo0 s4244 2z oozoo A NO 0H amp meme e UJ NJ m oO 2 NOV AWN m Y JOO sheets qu 17 Please note that columns and rows will be automatically swapped if you have more than 256 columns and more columns then rows This is because all spreadsheet programs have a limit on the number of columns they can handle the limit of 256 was chosen for old Excel versions You can adjust the threshold for the automatic row column swapping as follows 1 Create a text file that contains just a single line like the following one ExportDiffsTransposeColMin 64000 Exporting Differences 176 CodonCode Aligner User Manual The file has to be a pure text file not a Word document or similar and the extension has to be alpref 2 Drag and drop the file onto an Aligner project view or use Open to open the file 3 Export export again The example above will allow you to export up to 64000 columns before CodonCode Aligner would automatically swap rows and columns you can use different numbers if necess
337. s are independent Error probabilities for confirming reads in the same direction are NOT independent since most sequencing errors are due to systematic problems like polymerase stops GC compressions etc Therefore qualities of confirming reads in the same direction cannot simply be added Arguments can be made for and against subtracting the quality scores of discrepant bases Some scientists feel that having a discrepant base should make a difference in the consensus quality while others use statistical arguments why qualities of discrepancies should not be subtracted You can decide for yourself and change this in the Preferences if you have a confirmed high quality base and a low quality random discrepancy the difference in the consensus quality will be zero or very small anyway The algorithm used by Aligner is similar to the algorithm used by the assembly program Phrap but it is not identical Phrap s algorithm is more complicated and uses for example confirmed sequence segments rather than individual bases However the quality scores assigned by Aligner will often but not always be identical to the scores Phrap would assign to the same assembly Majority Consensus The majority method will be used to make the consensus sequence if you select Majority as the consensus method in the consensus preferences unless the contig is an alignment and you selected to use the reference sequence to build the consensus The sho
338. s case e Add tag to ReferenceExample New Tag Type codonStart v Mi Tag Details Program Us Start 90 End 90 Date Thu Jul 15 19 48 08 EDT 20 Notes 3301 f Confirmed MG E dp EM If you prefer you can write basenumber 3301 or your number of course or basenumber 3301 in the Notes field You do not have to enter this information when adding the tag you can do it later by editing the tag in the Show tag dialog Numbering the Coding Sequence 95 CodonCode Aligner User Manual e Tags for ReferenceExample at base 89 Tags Tag Details codingSequence Program User Start 90 End 90 Date Thu Jul 15 19 48 08 EDT 20 Notes AL LSSSELEDLLLELLLLLLLU LELL D basenumber 3301 C Confirmed The number you set this way for the codonStart tag is the nucleotide number at this position Note Keep in mind that the codonStart tag identifies the start of the first complete codon in this exon Therefore 1 You must add codingSequence tags before adding the codonStart tag 2 The codonStart tag must be in the first three bases of a codingSequence tag 3 You can add only one codonStart tag per gene in your reference sequence 4 If your reference sequence has several exons the codonStart tag must be added to the first exon in the reference sequence For example if your reference sequence contains exons 4 and 5 add the codonStart tag
339. s for parts of sample names and then use these name parts to assemble samples in groups based on their names and then press Preview again we get Defining sample names 285 CodonCode Aligner User Manual eoo Name parts preview Exon Patient Direction EGFR exon19 J M F jexon19 JJM EGFR_exon19 JJM R exon19 WJM exon19 NWS Jexon19 NWS exonl9 XHS exonl9 XHS EGFR exon20 JJM F exon20 JM GFR_exon20 JJM R exon20 JM exon20 NWS lexon20 NWS exon20 XHS EGFR exon20 XHS R exon20 XHS 4 aA nD Aa Aa DA yin Currently the only time where CodonCode Aligner uses the name part definition is when assembling by group available through Assemble with Options in the Contig menu When assembling by groups Aligner can use any of the name parts you define to group samples together for forming contigs Aligner will try to assemble only samples that belong to the same group For additional information please read the assemble in groups help Defining delimiters CodonCode Aligner offers two different ways to parse sample names Using delimiters to separate name parts as shown in the example above Using a fixed number of characters for a name part Aligner has several pre defined delimiter characters if you want to use a different character as a delimiter or if you want to use a fixed number of characters click on the Define delimiters
340. s parameter is calculated consider the following diagram 123456 7890123456 7890123456 7890 tctctctctcAGCGATCAATaaaaattttt LILEEEE T TG LG I gggggAGCGATCAATaggcccaggcccggacccgg 12345 12345678901234512345 The sequence at the top has 10 unaligned bases at the start and end and 10 aligned bases in the middle The bottom sequence has 5 unaligned based at the start and 20 unaligned based at the end Between the two sequences there are 15 additional bases that could possibly have been aligned the 5 unaligned bases at the start of the bottom sequence and the 10 bases at the start of the top sequence Aligner calculated the relative amount of unaligned sequence that could have been aligned by dividing the overlapping bases in the unaligned ends by the length of the shorter sequence In our example this is 15 30 the length of the top sequence or 50 With the default setting of 70 for the Maximum Unaligned End Overlap our example would have passed at least for this parameter You may need to adjust this value depending on the kind of project you are doing If you aligned cDNA sequences to genomic DNA use values of or near 10046 since large stretches of exons may be unaligned But if you expect your samples to match end to end and pre processed your sequence with end clipping and vector trimming you can use lower values to reduce the chance that different copies of repeats will be incorrectly assembled together Bandwidth
341. s shown on the left side of the coverage panel e g 0 10 The coverage panel shows differences between the samples as colored bars that represent the amount of bases in base colors To control which differences are displayed the allele frequency threshold is settable through the pop up menu in the coverage panel 0 340 Navigating using the overview panel You can click in the overview panel to move the cursor If you click on an arrow the corresponding read will be selected and selected read and base will be shown in the lower aligned bases panel If you click somewhere else in the white spaces the corresponding consensus bases will be selected you may have to use the vertical scroll bar to see bases for aligned reads at this location You can also select the consensus by clicking in the coverage panel or on the ruler dislpaying the base pair numbers Another way to move around in the overview panel is by clicking on the top bar representing the contig or moving the red bar which highlights the currently displayed section of the contig This allows you to move around in the overview panel without updating the selection in the aligned bases panel Holding the left mouse button pressed and moving the mouse to the left or right after clicking in the overview panel will update the overview display the same Contig Overview Panel 192 CodonCode Aligner User Manual way Changing the display of the sample arrows The sample arrows
342. s will be exported with a single file being created for each contig Note that the exported files only contain information about the bases and gaps but not about associated chromatograms or sequence qualities You have a choice of exporting in either interleaved or sequential format Different phylogenetic programs have different restrictions on which kind of files they can read so you may need to try both to see which one works for the program you plan to use If you have sample names that are very long and or contain spaces or other unusual characters it may be necessary to truncate or change the name of the samples in the exported files Again different programs have different restrictions If sample names may to be changed in the exported files Aligner will present you with a list of choices on how to change the sample names ACE Format Exports 170 CodonCode Aligner User Manual Other Formats for Exporting Assemblies We plan to add support for other formats in the future If you need a specific format please let us know the format and the program that you need if for Other Formats for Exporting Assemblies 171 Exporting Features In Aligner Features are regions which for one reason or another deserve special attention They can include discrepancies regions of low coverage bases with tags or a number or other criteria which you can define in the feature preferences To exports features for a set of contigs Go to
343. sample names are exported as they are In this case importing the file into other programs might be problematic if samples contain problem characters The second option allows you to append the sample comments to the header of the FASTA file The comments from the sample information of each sample in CodonCode Aligner will be appended to the first line of the FASTA file By checking the box labeled Include gaps in FASTA files you can include gap characters in the output If the box is not checked the exported sequences will be ungapped If you check the box Write FASTA quality files a quality file in FASTA format will also be created If you are exporting a single FASTA file this file will be in the same folder as the FASTA file The name of the quality file will be the name of the FASTA file with qual appended at the end of the name If you are exporting individual FASTA files for each sample a separate quality file in FASTA format will be created for each sample When the Format sequences box is checked longer sequences will be split up into multiple lines with 50 bases per line This can be a problem for some older software which expects the sequence to be in a single line to write the entire sequence into a single line in the FASTA file simply uncheck the Format sequences box Exporting SCF files If you select SCF files as export format the export dialog will look like this Export options for FASTA files 165
344. se Design Primers from the Tools menu The Primer Design dialog is displayed where you can adjust primer picking parameters Click Pick Primers to start finding primers for the paramters you selected 5 If primers are found they are displayed in the Primer Result dialog Select the primers that you want ot import as new primer sequences in your project then click the Create Primers button 6 The selected primers can be found in the folder called Primer in your project UP eR When finding primers CodonCode Aligner uses Primer3 Primer picking parameters can be set in the Primer Design dialog see section Primer Design Parameters You can design PCR sequencing and cloning primers Only primers that you select in the displayed primer results and choose to create are imported in your Aligner project Information about imported primers like Tm GC etc can be seen for each primer in the sample information dialog for more details see section Primer Results The template sequence that was used to pick primers for will have feature tags that show primer annotations Primer information can be exported for ordering primers see Exporting Primers Primer Design Parameters When designing primers in CodonCode Aligner the first dialog you see lets you choose your primer design parameters Primer Design 112 CodonCode Aligner User Manual BOL Primer Design Design primers for PCR Sequencing m Forward Pr
345. sequence Aligner will align each sample to the reference sequence that shares the most words typically 8 mers first alignments to other references will be tried only if this alignment is rejected Typically this will result in alignments to the reference sequence with the highest similarity however there can be exceptions to this rule When aligning to a reference sequence any sequence parts that extend beyond the ends of the reference sequence are not included in the alignment Assembly For assembling contigs the following simple greedy algorithm is used 1 Find potential overlaps between samples by looking for shared 12 nucleotide words in the sequence 2 Find the pair of samples that has the highest number of shared words Perform a pairwise alignment between the two samples or contigs in later cycles 4 If the alignment is good enough keep it as a new contig and calculate the consensus sequence otherwise reject the merger and leave the two samples separate 5 Find the next pair of sequences looking again for the highest number of matching words If a sample is in a contig use the consensus sequence for the contig If the two samples are already in the same contig get the next pair 6 Go back to step 3 and continue the pairwise joins until all possible joins have been tried or until the maximum number of merge failures in a row has occured ios The algorithm typically performs well enough for projects
346. sequence This will give you a nicer looking printout more even peak intensities when printing entire sequences Equalize traces for each panel is useful if the intensities for the four bases are very different in your samples This will calculate separate scaling factors for each of the four traces in each panel based on the highest peak in this section of the trace If you select Fit traces on one page Aligner will try to fit everything onto one page scaling traces as needed If you chose to print Entire traces each sample will be printed onto a separate page If the Fit traces on one page checkbox is not checked the height of each panel will be determined by the height of the trace view windows defined in your View Preferences when printing entire traces or by the height of the panels on the screen when printing only visible regions Usually only the trace between the first called base and the last called base is printed If you want to also print the trace before the first base and after the last base make sure Print trimmed ends is checked Contig View Printing The Page Layout used when printing is determined by the first set of radio buttons note that this is not the same thing as selecting the page orientation i e Portrait or Landscape in the Page Setup dialog The page layout options for contig printing are Normal Prints the sample and contig names with as much of the sequences as will fit across
347. ses to the trash Window placement Description The vector trimming preferences control which vectors are used to screen against what the minimum match criteria are and how far vector matches can be from the ends of sequences To setup or change your vector screening parameters follow these steps 1 Choose the vector library by pressing one of the radio buttons on the top the vector library is a collection of vector sequences in FASTA format It s a good idea to select your own vector sequence file by pressing the Browse button Vector sequence files must be in FASTA format and can contain one or many sequences 2 Choose the vector sequences to screen against in the scroll pane below You can select multiple vector sequences by pressing the shift key while clicking on a vector name or the command or control key for discontinuous selections In general you should select only one or a few vector sequences to screen against 3 Set the search criteria for the stringency and sensitivity you desire The settings shown in the image above will work fine for most projects Vector Trimming Preferences 292 CodonCode Aligner User Manual 4 If you want Aligner to automatically move sequences to the trash if they are too short after vector screening check the check box at the bottom and enter a minimum sequence length for example 100 When Aligner finds a match between a sample sequence and a vector seque
348. shown iad a a NN 2 o 3j Print Reverse Build Tree ViewTraces Colors Bases Transl NextFrame Mask Matches Help Exclude wy Ever ERE Show all columns and rows Consensus T T A454 s 2 v Exclude Ns L1 1 1 8 v Exclude non gaps a v Exclude high consensus quality 3 V Exclude low frequency changes z4 V Hide rows without changes CES EN ES M HB EX 2T 7 GTCTCCCCACATGCCAGGCACCAATAR SEPP ae pe ee GTCTCCCCACATGCCAGGCACCAATAR TGGTAAATGCAGCCGGCACACTCT GTCTCCCCACATGCCAGGCACCAATAM GGTAAATGCAGCCGGCACACTCT nsspeesceeerenentreds M M EE CNN SS CU be 7 hes B 980 230 100 Set filters and thresholds lt lt A455 s A326 r Display options for the difference table 197 CodonCode Aligner User Manual Here in comparison the difference table for the same contig showing all columns and rows eoo Contig1 amp ct D 4 Print Reverse Build Tree View Traces Colors La Bases Transl 1s e Next Frame Mask Matches Help Show overview Change size Exclude v Position 1 1 1 2 2 2 2 2 2 4 7 Consensus GIT CIJA CI AI GICIGICI A A454 s we JN p DAN ESN PRT TSS SN UE TA sm ER I A455 s fes A326 r EFREN ETETEA ATAN D S jos Tet repe et BRR li Ea eee eae eas um LL 9234 ER P
349. ssembled first Help Cancel Align Using the radio buttons at the top select to align in groups by name part or by multiplex sequence tag Align to Reference in Groups 71 CodonCode Aligner User Manual To align in groups by name part e After selecting the radio button Name part press the Define name parts button to specify how CodonCode Aligner should interpret sample names e Select the sample section you want to use to group the samples in the pulldown menu close to the top For a description of how to use sample names to group samples please see the Assemble in groups help page To align 454 sequences in groups by multiplex tag MID tag e Select the radio button Multiplex tag for 454 data For a description of the multiplex sequence tags and the resulting group names please see the Assemble in groups by multiplex sequence tag help page You can also choose to pre process unassembled samples before alignment by clicking on the Preprocess tab and then selecting the appropriate checkboxed as described above Click the Align button to start the alignment Align to Reference from Scratch Sometimes you may want to re assemble a contig for example after you did some editing and ended up messing up the alignment of reads Or you may want to merge a contig with another contig and or additional samples without preserving the existing alignment of reads in the contig To re align o
350. st 40 Double clicking Low coverage regions _ Total coverage less than 3 pm Highlighting _ Covered in just one direction License Serves O Ignore tags All tags O Some tags Memory Mutations f Gaps in sample Any ambiguity Edited bases Open amp save M Gaps in consensus 2 Any discrepancy Phrap assembly ERES Preference options When navigating Printing rLook for features in Protein translation Sample names 7 Startup 7 Consensus only Vector trimming O All samples only Current selection only Consensus and all samples Window placement At each consensus location O Find all features Find just the first feature Description The features preferences let you define features Regions of Interest that are shown in the feature view windows Features are also used for quick navigation using Next Feature and Previous Feature in the Go menu Cancel OED In the top panel you define the criteria of features interesting regions Any place where one or more of the selected criteria are met will become a feature This definition of features will be used by the Feature View window for contigs and when navigating in a contig view using Next Feature and Previous Feature in the Go menu In the lower panel you can define where Aligner should look for features when navigating in the consensus sequence and all samples or just a sub set of th
351. stakes at the beginning and end of samples can be reduced by increasing the minimum data quality requirement at the start and end in the mutation detection preferences e If any samples contain heterozygous insertions or deletions they should be identified before searching for heterozygous point mutations for example by checking the Look for heterozygous indels check box in mutation detection preferences Otherwise many false classifications may result especially if the minimum quality at start and end is set to low values You should always adjust the mutation detection preferences to your specific needs All results obtained with Aligner should be checked by a qualified scientist If you find any examples where Aligner s classification seems to be incorrect and is not due to low quality data or similar potential causes decribed above please let us know by sending an email with your data attached as a Stuffit or Zip archive to support codoncode com Limitations 99 Heterozygous Insertions and Deletions When sequencing PCR products from genomic DNA for mutation analysis you will sometimes encounter traces that look like this eoe Traces from Unassembled Samples Eu S E LA RE NIE cd GAGCAC AA AMIG CHEESE MEINEM PM Vale ae Scroll together RTL aE uit Base 172 of 582 Quality 39 Up to base 174 you have a nice clean sequence but from base 172 on you see double peaks at many but not all locations Many
352. t for undoing and re doing is provided Most actions for example adding samples assembling unassembling endclipping and vector screening cannot be undone Therefore please save your project frequently You can however undo simple edits Just choose Undo from the Edit menu to undo an edit and restore the sequence to the state it was before the edit If you change your mind you can choose Redo from the Edit menu to re do the edit that you just undid If you did anything else that is not undoable Undo from the Edit menu will not be available grayed out We plan to add Undo and Redo support for more actions in future Aligner releases If undo support for a particular feature is important to you please let us know about it Undo and Redo 142 Copy and Paste Copy selected sequence If your current selection is a single sample or contig or part of a single sample you can copy sequences and parts of sequences by selecting Copy selected sequence in the Edit menu If the active window is a trace view base view or contig view then the currently selected bases will be copied to the clip board If the currently active window is the project view and a single sample is selected then the entire sequence of this sample will be copied to the clip board If you have selected a single contig in the project view then the consensus sequence for this contig will be copied If you have more than one sample or contig selected
353. t further below Select the tag type for your mutation from the pullup menu near the top for example heterozygoteCT or homozygoteA A Aligner will show the amino acid effect in the Notes section Click OK when you re done If Aligner misses a lot of mutations in your project or if finding all mutated bases is important to you you may want to make sure that you have set the mutation detection sensitivity to High in the mutation detection preferences The three actions described above Show tag Add tag and Mark as False Positive are also available from the Sample Tag menu but usually using the popup menu as described will be faster and easier Please note that any mutation tags that you change or add except for False Positive tags are usually deleted when you repeat Find Mutations for the same contig Tags for Finding Mutations To fine tune mutation detection you can use tags to Define the coding region in your consensus or reference sequence Exclude regions in samples or the contig from mutation finding Defining the Coding Region You probably noticed that the tag content contains a summary of the mutation which also indicates the amino acid change 183 T gt C Cys61Cys in the example above Unless you give Aligner more information this annotation will be relative to the first base in the consensus sequence However the coordinates used will be ungapped after removing any gaps from the consensus
354. t least one of these Sets alignment parameters for algorithm local or large or end subsequent alignments to a minPercentIdentity 50 100 a number reference sequence between 50 and 100 minOverlapLenth 10 500 minScore 10 500 maxUnalignedEndOverlap 0 0 100 0 bandWidth 10 100 wordLength 6 24 Scripting CodonCode Aligner 220 CodonCode Aligner User Manual matchScore 1 19 mismatchPenalty 1 19 gapPenalty 0 19 additionalFirstGapPenalty 0 19 Aligns selected samples to a alignToReference reference sequence Aligns to reference sequence by alignByName name in groups Finds mutations in the selected contigs Optional distanceMethod number or p distance pairwise true or false Editing amp Go menu gotoBase Base number Move to the given base search Sequence to find Find the given sequence dekene bue Deletes all bases from the contig start to the current base deleteToContigEnd aie Deleted all bases from the current position to the contig end callSecondaryPeaks threshold 1 99 Call secondary peaks changeLowQualToN threshold 0 90 Change low quality bases to N Build a phylogenetic tree for the selected contig changeAmbigsToSingleBases none Change ambiguities to single bases View menu openBase View sample or contig name Open a base view Open a contig view for the given contig openContig View contig name Open a trace view for the given sample hideScriptWindow
355. tated codingSequence User Reference Contig1 363 375 heterozygoteAT Aligner va 13 x Contigl 371 371 Heterozygous 6688 A gt T Ser3Ser polymorphism Aligner Contigl Contigl 371 371 1 diffs 0 homo 1 hetero 3 not mutated ba heterozygoteAC Aligner va 16 x Contigl 391 391 Heterozygous 6692 16 C gt A noncoding reg w The corresponding contig view of this region shows the coding sequence regions red boxes the codonStart tag light blue box and the mutations found pink boxes in the samples dark blue boxes in the consensus OOO Le Contig1 Show differences 4 Loo E 443 bp of 443 bp 3p 100 bp 200 bp 300 bp 400 bp Excluding Regions from Analysis You can exclude regions from being analyzed when Aligner finds mutations by adding dontGenotype tags You can add dontGenotype tags to Individual samples to exclude tagged regions in the sample only The consensus sequence to exclude the tagged region in all samples The reference sequence to exclude the tagged region in all samples if a the analyzed contig is an alignment to the reference sequence and b the reference sequence is used as the consensus sequence as defined in the consensus method preferences Adding tags to a region in a sample can be useful to skip regions with sequence artifacts which can throw off Aligner s analysis Adding tags to the
356. te a third file named Denoised Single followed by the input file name which contains sequences where one of the two paired sequences was rejected during error correction for example because of low quality Other NGS Error CorrectionPrograms CodonCode Aligner also supports the use of other NGS error correction programs through a simple XML file based mechanism To add another program a new folder for the program must be created inside the NGSTools folder in the HelperPrograms folder where CodonCode Aligner is installed The program executable is placed in this folder and the parameters for the program are defined by creating an XML file in this folder If you are interested in using a different program for NGS data error correction in CodonCode Aligner please contact CodonCode Corporation s support team NGS Error Correction 65 NGS Assembly CodonCode Aligner can use external assembly programs to assemble NGS data e g Illumina reads and import the resulting contigs One such assembly program SparseAssembler Ye et al BMC Bioinformatics 2012 13 Suppl 6 51 is included in the CodonCode Aligner installation CodonCode Aligner also supports the creation scaffolds from NGS contigs using mate pair sequences Please note that NGS assembly in CodonCode Aligner is currently only intended for small NGS projects for example bacterial genomes NGS assembly requires a 64 bit operating system and is not available on 32 bit Windows
357. the Align button Note that any samples that are already in contigs will not be pre processed Align to Reference in Groups If you want to compare samples from a number of different sources species patients isolates to one or more reference sequences the Align in Groups option in CodonCode Aligner can simplify your work Align in Groups uses sample names or multiplex sequence tags MID tags to group samples together and to form separate contigs for each group A copy of a reference sequence will be included in each contig To align to reference sequences in groups 1 Go to the project view 2 Select the samples you want to align and the reference sequences to use keep the shift control or command key pressed to make continuous or discontinous selections as described above 3 Go to the Contig menu move to Advanced Alignments and choose Align in Groups This will show the following dialog BOL Align in Groups f Contigs Preprocess Align in groups by f9 Name part Define name parts Multiplex tag for 454 data Align to reference in groups Aligner will build separate contigs for each group of samples in your selection ISamples will be grouped together either based on their names or based on 454 MID tags You can define the meaning of different parts of the sample names by pressing the Define name parts button Any pre existing contigs in your selection will be una
358. the contig view e Select the contig s for which you want to export features or if you want to export features for all contigs select any contig Choose Export Features in the File menu A dialog will appear where you can specify details about the output format e Export Features Export features for fe Current selection O all contigs Format Comma Separated Value CSV J Use the radio button at the top to select whether you want to export only the selected sample or all samples in the contig Then use the pull down menu to select the file format and click on the Export button Next Aligner will show you a Save As dialog where you can select the location of the exported file or files The exported files are text files and can be opened with text editor or spread sheet programs One thing to note when exporting features is that CodonCode Aligner will always export all features in the consensus sequence and in all samples in a given contig This is true even if you used the Feature preferences to specify to look for features only in the consensus sequences or the samples or the current selection when navigating this selection does apply only for navigating not for feature views or exports Here is an example of what exported features from the PolyPhred example project can look like after importing an exported feature file into Microsoft Excel Exporting Features 172 CodonCode Aligner User Manual Conti
359. therwise can be very hard to analyze There are of course some limitations which are described below Finding Heterozygous Indels CodonCode Aligner s Find Heterozygous Indel function analyses sequence chromatograms for characteristics that are typical for heterozygous insertions and deletions In traces where Aligner finds a putative heterozygous indel Aligner adds a tag that extends from the start of the putative indel to the end of the sequence To find heterozygous indels do the following e Select the traces you want to analyze in the project view Traces can be unassembled or in contigs but must have base specific quality scores run base calling with Phred first if needed e Heterozygous indel detection works best if the samples have not been end clipped End clipping will typically remove the parts of sequences that have heterozygous indels While Aligner tries to compensate for this the detection rate for samples that have not been end clipped is slightly higher than that for end clipped samples f your samples have been end clipped you can simply re do the base calling to get end to end sequences Go to the Sample menu and select Find Heterozygous Indels Aligner will show a progress bar while looking at your traces one by one The analysis may take a few seconds per trace Aligner will show the results for each sequence analyzed in the status area and add a heterozygoteIndel tag Finding Heterozygous Indels
360. tig1 GTGAAT EAAACTATGTTAAGGGAAATAGGACAACTAAAA TA cen NbrmR R 50 60 70 Ner a mi a aal TAAG GG AAATAG G ACAACTAAAATAT 4 s L 4 Quality 68 Cons 68 E O crFrR Nom R Base 43 of 290 43 in contig Base View Window CodonCode Aligner User Manual Each contig has its own trace window which can show the traces for one or more sequences If the traces for all sequences cannot be shown in the window at the same time you can use the scroll bar on the right to scroll through the different sequences Quality View Window For sequences that have qualities for example Phred generated SCF files you can get a quick overview of the quality by selecting the sample in the project window and then choosing Qualities in the View menu This will open up a window like this one eoo A060 s 7 140 ELH MAL EFT v PEN eh A060 s Base 157 of 628 Quality 10 4 The picture shown above is pretty typical a bit of low quality sequence at the beginning followed by rapidly increasing sequence quality and then several hundred bases where the quality is mostly very high except for some short problem regions If you open a trace view window for the same sequence then clicking somewhere in the quality view will reposition the trace to the same region This allows you to quickly check out problem regions in the sequence try it out Contig View Window The contig window shows detailed informa
361. tigs If the merger is rejected and Aligner later finds two other overlapping samples in the same contigs Aligner will try to merge the contigs again If the contigs have changed in the meantime this can make sense since the merger may now work For very large projects with many repeats however this may mean that Aligner tries the same mergers many times The Maximum Successive Failures parameter can be used to stop such fruitless efforts after Aligner has tried many times default 50 in a row to merge contigs without success the assembly will stop Yes we do realize that the assembly algorithm could be made smarter here and we may modify it in the future but we think that most users will not be doing such large assemblies with Aligner anyway There are other assemblers out there that can handle large assemblies for example Phrap and you can import Phrap assemblies into Aligner for editing Match scoring The last four alignment parameters determine how matches are scored The Match score is used when two aligned nucleotides are identical the Mismatch penalty when two base calls are different The Gap penalty and the Additional first gap penalty is used when one of the two sequences has a deletion relative to the other sequence For single base deletions the penalty score will be the sum of the gap penalty and the additional first gap penalty for additional deleted bases multiple gaps in a row the penalty will be just th
362. tion about contigs a graphical overview about how the samples are aligned or a difference table for the alignment the aligned bases and the protein translation of the consensus sequence It is also possible to show a phylogenetic tree to the left of the sample names Trace Window 10 CodonCode Aligner User Manual Show differences 111 bp of 2711 bp op 0 14 lt lt djs74 423 s1 A TCACCTAAGGGAGAATGCTGGA AGAGAAGTGACAGGA 4 TCACCTAAGGGAGAATGCTGGAATTCAATAGAGAAGTGACAGGA TAGAGAAGTGACAGGA You can edit sequences directly in the contig window or select samples and then open trace base or quality windows for the sample You can also set if and how the protein translation is shown using the Protein translation sub menu in the View menu Restriction Map Window The restriction map window shows a restriction map for the selected sample or contigaligner_features htm Contig View Window 11 CodonCode Aligner User Manual eoo Contigl Restriction map for Contig1 2711 bases linear DNA Displaying cut positions EcoRI 873 Xmil 1010 Pstl 1026 Pael 1616 Xmil 2187 EcoRI 530 Apal 1074 Pael 1731 EcoRV 2317 BstXI 649 Apal 1219 Apal 1872 EcoRI 2465 Unique cutters BstXl EcoRV Pstl Enzymes that cut two times Pael Xmil Enzymes that cut three times Apal EcoRI Enzymes that cut four and more times None Non cutters Acc65l BamHI Bsp68l Hincl
363. tion to get an overview of all the features in a contig or the entire project in a feature view window or to quickly navigate from feature to feature or to export features to text files For more information about region of interest features check the feature help page Restriction Map Window 12 CodonCode Aligner User Manual Take the Quick Tour To quickly learn about the most important features in CodonCode Aligner we suggest that you take the Quick Tour available online at http www codoncode com aligner quicktour It takes about an hour to complete but will probably save you quite a few hours for example by showing you some very useful features that you otherwise might miss You can access the Quick Tour by selecting the Quick Tour menu item from the Help menu in CodonCode Aligner This will open a new web browser window and point it to the start of the quick tour Alternatively you can look at the Quick Tour in Adobe PDF format which was installed as QuickTour pdf in the directory where you installed CodonCode Aligner typically Applications CodonCode Aligner on OS X and C Program Files CodonCode Aligner on Windows you may not see the pdf extension depending on your system settings Take the Quick Tour 13 Usage Tips for CodonCode Aligner These tips are short explanations of features in CodonCode Aligner that are often overlooked Tips are shown automatically when CodonCode Aligner starts Here is
364. to import the sequences into programs that support the standard SCF format You can choose the folder where the files are created in a Save As dialog that will be shown once you click on the Export button All files will be created in the same folder the names of the files will be the sample name Single FASTQ file This will generate a single text file in FASTQ format which contains all the exported sequences and their quality scores You can specify the name and location of the file in a Save As dialog box that will be shown when you click the Export button Export options for FASTA files If you choose to export a single FASTA file or individual FASTA files you can set several options To see these options press the Options expand button the triangle next to Options The dialog will then look like this Exporting Samples 164 CodonCode Aligner User Manual BO Export Sequences What to export Selected sample All samples Format FASTA Single file B Options v Replace problem characters in names _ Append comments _ Include gaps in FASTA files Write FASTA quality files M Format sequences The first option allows you to automatically replace problem characters in your sample names If you check the box Replace problem characters in names potentially problematic characters such as spaces or colons will be replaced by underscores If the box is not checked the
365. tom Vectors txt file and edit the copy If you use linkers or PCR primers in your subcloning it s a good idea to add the sequences of the linkers and primers to the custom vector file and select them to be included when screening in the Vector trimming preference panel When screening against short sequences like primers however keep in mind that short matches may not meet the minimum match criteria and therefore not be masked Minimum match criteria are discussed under Vector screening preferences Vector Library Files 49 Note When editing a custom vector file please make sure that it is saved as a text txt file Aligner will not be able to read files in other formats like Microsoft Word s doc format CodonCode Aligner User Manual Custom vector files must be in FASTA format each sequence must have a line that has a greater than gt sign followed by the name The file can have multiple entries here is an example gnl uv L09150 1 3248 3353 pUR291 cloning vector CGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCGGGGA ATAAGCTGTCAAACATGAGAATTCT GAAGACGAAA CCGTCGACC gnl uv L09151 1 3249 3332 pUR292 cloning vector GCCGGTCGCTACCATTACCAGTTGG ATAAGCTGTCAAAC CTGGTG CAGGGGA gt pUR278 cloning vector bases 3239 3335 GCAGCCAAGC CCGTCGACC CCAGCTGAGCGCCGGTCGCTACCAT ACCAGT AGCTTATCGATGATAAGCTGTCAAACA GGTCTGG GTCAAAAAGGGGATCCGTCGACTCTAGA
366. ttons as icons 3 Show text buttons Show icons and text rRestore defaults Defaults icons only Defaults icons amp text rButtons to show f Project view E v Save Project As Print vi Add Samples V Add Folder Eod Add Assembly C Export Samples Export Consensus f Export Assembly Export Features New Folder C Undo Y gt Haera A Description The toolbar preferences control which toolbar buttons are shown in the different views If no buttons are selected for a view the toolbar will not be shown C B On the left side you can choose whether or not to show toolbars for all windows and if toolbars should be shown as buttons text or buttons and text You can also restore the default settings by clicking on one of the Defaults buttons The Defaults icons only button will restore the initial buttons settings on Windows where buttons are shown as icons only The Defaults icons amp text button will restore the initial buttons settings on Mac OS X where toolbar buttons are by convention shown as icons and text and therefore need more space However you can use either button on both operating systems On the right side you can select which buttons will be shown for the different views Select the view to customize at the top then check or uncheck the items you want to see or not see in the toolb
367. tup dialog the following window will be shown when Aligner starts Startup Preferences 288 CodonCode Aligner User Manual e CodonCode Aligner Startup Aligner Open a recent project O Open an existing project Users peter Documents Projects test1 Nc JUsers peter Documents Projects poly2 4 Sole aT PECs Users peter Documents Projects std23 No longer show this dialog f Cancel ox J This allows you to quickly open one of the projects you worked on recently or to open another project or to create a new project Note The first time you start CodonCode Aligner the list of recent projects will be empty The list will also be empty when you clear the recent project list by choosing Clear Menu in the Open Recent submenu in the File menu The currently open project and any projects that are currently unavailable will be unavailable grayed out in the Open Recent menu The Startup Dialog 289 Toolbar Preferences The toolbar preferences allow you to customize toolbars for the different views in CodonCode Aligner Preferences Base calling Base colors Consensus method Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Restriction maps Window placement r Toolbar preferences r Show toolbars Show toolbars Hide toolbars r Button style Show bu
368. tween the exon 19 and exon 20 sequences the assembly would generate 2 separate contigs for each of the patients for exon 19 and for exon 20 for a total of 6 contigs Choosing Direction would assemble all the forward F reads together and all the reverse R reads separately The contigs created will be named according to the name part used to group samples for example assembling by patient would create contigs called JJM NWS and XHS It is possible that the assembly will create more than one contig for each group for example if some of the samples in a group do not overlap or are too different from each other If more than one contig per groups is created the contigs will be named by adding numbers to the end for example JJM and JJM1 CodonCode Aligner s name parsing scheme is very powerful and flexible in addition to separator characters you can also use fixed length name parts and even patterns Additional information about defining name parts is available on the Sample names preferences help page Assemble in groups by multiplex sequence tag When assembling 454 data you can use Assemble in groups and multiplex MID tags to sub divide your samples into smaller groups CodonCode Aligner will look for the following multiplex tags in your samples ERN Assemble in groups by multiplex sequence tag 58 CodonCode Aligner User Manual Multiplex Tag Group Name ACGAGTGCGT ACGCTCGACA AGACGCACTC AGCACTGT
369. u also set your highlighting preferences to show a box for ambiguities and discrepancies you can zoom out to easily spot very different and preserved regions An example like this is shown below Zooming in the Contig View 206 CodonCode Aligner User Manual glLomparison kl amp o Hl fF P Pees S ydo SERRE BEEN onsensus e Bur Ls TRE The contig view above uses a zoom level of 16 which can be set in the bottom left corner of the aligned bases panel in the contig view You can also use the view preferences to change the zoom level by setting the font size The zoom level of 16 is equivalent to a font size of 2 Sorting Reads in the Contig View In the contig view samples can be sorted in one of several ways by position in the contig the default by sample name by direction forward or reverse and then by position in the contig by the user The default sort method for samples in the contig view can be set in the View preferences If you change the sort method in the view preferences the new setting will affect only contig view windows opened after the change To change the sorting of reads in an open contig view window right click OS X command click anywhere in the aligned bases panel to display a popup menu like this Sorting Reads in the Contig View 207
370. u can either have bases drawn on colored background or colored bases on white background Here s an example of a trace on a colored background Traces from Unassembled Samples G C1A Fel Cc G en Texe 190 200 210 i w NW A i Iu Va j elus m NA tN A ALK of lech PR allen alk yale vi Scroll together A326 Base 201 of 612 Quality 13 The same trace with colored bases eoe Traces from Unassembled Samples x GATGCAAACCTAATGGAGATTTTHT TACCAGAAGTGGTTTCA A 190 200 210 22 i Nw J ih ii j Wa l elus m NA SEA ACA ofA laan allie oft pair v Scroll together A326 Base 201 of 612 Quality 13 The base specific color scheme makes most sense when samples do not have qualities or sometimes when looking for differences in aligned or assembles samples You can assign the color for each base in the top section of the Base colors preference panel as shown below Base specific colors 242 CodonCode Aligner User Manual Alignment r Base colors Assembly r Trace colors Base calling Base colors As Consensus method T s Double clicking 7 End clipping G s Features Highlighting C s License Server N s Memory Mutations C She bind Open amp save r Background colors Phrap assembly 3 3colors continuous scale gt z Preference options O Quality based Printing f9 By nucleotide ignore quality Protein translation O Translation based Restriction maps A s
371. u make to these preferences will NOT be saved After clicking OK in this dialog and then also in the Preferences dialog the shared preferences will be used Note that each user can still change settings while Aligner is running however such changes will not be saved when Aligner quits To change back to separate preferences a user can select the Default location button Preference Options 271 Printing Preferences The Printing Preferences allows you to determine how different windows will be printed To see the printing preferences select Preferences from the Edit menu on Windows repectively the CodonCode Aligner menu on OS X On the left side of the preference dialog click on Printing your dialog should now look like this BOO Preferences Alignment Printing Assembly NU Base calling Trace view Base colors What to print Entire traces eed Clicking amp scrolling Consensus method Vertical trace scaling Scale each panel to highest peak r2 End clipping Features _ Fit traces to page Highlighting ae License Server _ Print trimmed ends Memory m Mutations poContM WOW re P E TIT Open amp save O Phrap assembly Page layout 9 Normal Poster Preference options Font size 10 1 point Protein translation V Include colors and highlighting Restriction maps Sample names V Print bases in groups of 5 rs bases Startup Toolbars V Print unaligned ends Vector tri
372. uences The resulting unaligned dangling ends are shown on gray background in the contig view base view and trace view This was the default algorithm for CodonCode Aligner version 1 6 3 and older Large gap alignments This algorithm is typically used when aligning cDNA to genomic DNA It allows for large gaps in between alignments without penalizing the large gaps The large gap algorithm can also be useful when analyzing samples with large insertions or deletions End to end alignment When this algorithm is used alignments always include the entire sequences When using this algorithm it is important that samples have been end clipped and possibly also vector trimmed This is the default algorithm for CodonCode Aligner version 2 0 1 and newer However if you used older versions of CodonCode Aligner before you may need to manually select this algorithm to use it Minimum Percent Identity This is the minimum percentage of identical bases in the aligned region The default parameter of 70 is relatively relaxed you may want to use a more stringent setting for your projects especially if you did use end clipping before the alignment Be careful about setting this value to 100 only samples that fully match each other in the overlapping regions will be assembled samples with even a single discrepancy will not be aligned Minimum Overlap Length This is the minimum length of the aligned region If the aligned region is shorte
373. uggest that you try the different settings with your own data to find out which setting works best for you Note that most detection sensitivity settings only apply to samples that have chromatograms for text samples the bases can be analyzed as they are The only exception is the Data quality section low quality sequence at the ends of text sequences will also be ignored if the text sequences have quality scores Marking mutations The section labeled Marking mutations lets you fine tune how CodonCode Aligner marks mutations it finds The main method Aligner uses if to add tags to mutated bases To facilitate analysis with other programs however Aligner can also convert heterozygous mutations to ambiguities e g using R for heterozygous A G and change the case of homozygous mutations to lower case e g changing A to a Aligner will add mutation tags at bases where it finds a putative heterozygous or homozygous mutation except at bases where mutation tags have been edited or confirmed by the user and kept between successive rounds of mutation detection as explained in the next paragraph If you perform mutation finding more than once you should check the Remove existing mutation tags checkbox If this checkbox is checked Aligner will remove existing mutation tags in the samples that you have selected before finding mutations You can either remove only unedited tags or all tags If unedited is selected any tags edited o
374. um quality from 20 to 29 isi medium green Hd Warnings i M f z Window placement High quality 30 and higher white d Description The base colors preferences control the colors used for drawing traces If By nucleotide is selected bases are drawn the same color as their trace colored bases use the same background color as traces Select your main color scheme specify details below At the top you can set the colors used to draw the traces and if you are using the By nucleotide color scheme for the bases Usually traces will be shown on a white background If you prefer to see traces on a black background make sure the checkbox Show traces on black background is selected In the middle the Background colors panel allows you to choose between different color schemes 1 Quality based background colors Here you can also choose between a three color scheme for low medium and high quality bases similar to Sequencher and a continuous color scheme with darker backgrounds for low qualities and lighter backgrounds for higher quality similar to Consed 2 By nucleotide colors that vary by base and ignore base quality Base Color Preferences 237 CodonCode Aligner User Manual 3 Translation based Background colors that are based on the protein translation of the sequences so that blocks of three bases will have the same color which will depend on the amino acid transl
375. ve Gap Left or Move Gap Right from the Sample menu You can also use the keyboard shortcuts Option F5 for Move Gap Left Option F6 for Move Gap Right Due to a Java bug on OS X the keyboard shortcuts are not always shown in the menus In the contig view you can also move gaps around by drag and drop select the gaps then click on them again but keep the mouse pressed and move the cursor to where you want the gaps to be then release the mouse Contig gaps at positions where one or more samples have bases that are not gaps can only be moved if the bases are deleted CodonCode Aligner will show a warning dialog before deleting bases to move gaps the first time Moving samples in contigs You can also move entire sequences one base to the left or to the right within a contig by selecting the sequence and then choosing Move Sequence Left or Move Sequence Right from the Sample menu Moving samples to Unassembled Samples You can move samples from contigs or from the Trash folder to the Unassembled Samples folder by selecting the sample s and then choosing Move to Unassembled Samples from the Edit menu For samples in contigs some special considerations apply as described in the Editing Contigs section In the project view moving samples to the Trash or Unassembled Samples can also be done using drag and drop Moving Gaps and Samples 133 Inserting Gaps and Bases To insert gaps Position the
376. ve the parts of sequences that have heterozygous indel tags unclipped To end clip a set of sequences do the following 1 Select the sequences to be clipped in the project window Typically you can just select the Unassembled Samples folder to end clip all samples only unassembled samples can be end clipped Select Clip Ends from the sample menu This will show the Clipping preview window that summarizes the clipping results if you have selected many samples it may take a few seconds for the dialog to show up If the end clipping results look ok to you press the Clip button to apply the calculated clips The low quality bases at the end of each sequence will be removed and any sequences that do not match the minimum quality criteria will be moved to the trash If you would like to change the settings for end clipping press the Change parameters button instead of the Clip button This will open a new window where you can change the end clip settings After making your changes and selecting OK the clipping preview window will re appear showing the effects of the new parameters The clipping preview window is shown in the next picture eoo Clipping Preview Preview of clipping results Number of samples clipped Average length before clipping 595 Average length after clipping 461 Average number of 5 bases clipped Average number of 3 bases clipped 129 Number of samples moved to Trash a
377. views as defined in the double clicking preferences typically the trace view for the sample and the contig view for the corresponding contig unless you have changed the preferences Feature Window 210 CodonCode Aligner User Manual The Start and End numbers are the positions of the feature within the contig gaps are included in the count If you changed the numbering of the consensus sequence by using Set Base Number this will be reflected in the start and end positions Feature Window 211 Restriction Map View Choose Restriction Map from the View menu to display a window showing the restriction map for the selected sample or contig A restriction map can be displayed in four different map styles Single Line Map Multiple Line Map Text Map and Virtual Gel Single Line Map The single line map is shown below eno Contig1 Restriction map for Contig 1 1660 bases linear DNA Displaying cut positions EcoRI 629 Xbal 656 Pstl 268 Pstl 722 BstXI 1067 Pstl 1619 Unique cutters BstXl EcoRI Xbal Enzymes that cut two times None Enzymes that cut three times Pstl Enzymes that cut four and more times None Non cutters Acc65l Apal BamHI Bsp68l Hincll Hindlll Kpnl Notl Pael Sacl Sall Smal Xhol Xmil In the example above you see a single line map for linear DNA that displays cut positions The cut positions are shown behind the enzyme names A summary of the cutters and no
378. w a dialog box where you can set options like file formats Next Aligner will present a standard Save As dialog where you can choose the folder for your exported files and if you are exporting to single files the file names If you are exporting multiple items to individual files Aligner will automatically determine the file names and extensions If any files with the same name already exist in the folder where you want to save your files Aligner will warn you that the existing files will be replaced Exporting 161 Export Project Summary This allows you to export project data like sample names read lengths and so on to text files that can be imported into external spreadsheet programs or databases The information exported will be the information you see in the project view window and optionally summary information about your project To export project summary information go to the File menu and select Project Summary from the Export sub menu This will show the following dialog r e Export Summary r Project data to export M Project overview vi Contig summary vi Sample summary Format Comma Separated Value CSV Cancel gt When you press the Export button a standard Save dialog appears where you can choose the name and location of the exported file The file is a text file and can be imported into word processors or spread sheets like Microsoft Excel you may need to select All File
379. w the sequences as bases or as translated as amino acids this affects the contig base and trace views The Consensus Translation section allows you to choose settings for the protein translation of the consensus sequence in the contig view Most of these settings can also be selected from the View menu OOO Preferences 00000000 Alignment Assembly Base calling Base colors Consensus method Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Restriction maps Sample names Startup Toolbars Vector trimming Views Warnings Window placement r Protein translation M i gt Organism Universal Sequence Translation o Show Bases Show Amino Acids for frame 1 n Consensus Translation r Display No Translation C Single 1 Translation for frame 1 a One Strand 3 Translations Both Strands 6 Translations Annotated Coding Region r Presentation O Single Letter Justification Left i Abbreviation 3 letter r Codon Color Start i green ES Stop fred HJ Description The protein translation preferences control the display of protein translations for sequences and the consensus in the Contig View Sequence Translation The Sequence Translation section of the Protein translation
380. want to add The gaps and bases that are added this way will not necessarily line up exactly with the peaks instead they will be spaced evenly with the same spacing as the last 20 or so bases before the last base This is usually ok if you need to add just a few bases If you need to add many bases you may be better off repeating the Base Calling for this sample if the sample is in a contig you first have to move it to Unassembled Samples You cannot directly insert a gap or a base right before the last base in a sample but there is an easy workaround just insert a gap after the last base and then choose Move gt Gap Left from the Sample menu Note Aligner is not intended as an editor where you enter sequence by hand there are plenty of other programs out there that allow you to do that Aligner is intended to be used with sequence traces preferably traces with Phred or Phred like qualities Inserting Gaps and Bases 134 Reverse Complementing To reverse complement a sample or contig Go to the project view e Selec the contig or a sample in the Unassembled Samples folder Choose Reverse Complement from the Edit menu In most views you will be able to identify samples that have been reverse complemented by the prefix before the name and by the fact that the name is drawn in red In the project view you can identify reverse complemented samples by the icon it has red rather than black borders Reve
381. want to import and click the Create Primers button The results for primer pairs as shown above include information about each pair and some statistics at the bottom which tells you how many primers were considered and why primers might have been rejected Primer results for sequencing primers look a little different since there are no primer pairs all forward and all reverse primers are listed together An overview showing where primers are located on your template sample is also displayed Primer Results 116 CodonCode Aligner User Manual When no primers are found Aligner displays a dialog that should show you why no primers were found The most likely cause is that your settings were too strict in which case looking at the statistics in the dialog might give you a good idea which parameters you can change to get results If you have primers and choose to import them new primers are put into a folder called Primer in yoru Aligner project The folder is created if it does not already exist eoo exlassembled kl Zi B ox 7 Name Contents Length Quality Position Added Modi Com gt ful Unassembled Samples 0 samples 0 0 29 4 21 gt 3 Contig1 7samples 1660 1636 4 21 4 21 Y 3 Primer 6 samples 0 0 4 27 4 27 Primer1F Text 20 0 0 4 27 4 27 ES PrimerlR Text 20 0 0 4 27 4 27 B3 Primer2F Text 20 0 0 4 27 4 27 id Primer2R Text 20 0 0 4 27 4 27 Primer3F Text 20
382. ween the contigs is not good enough for example because it is very short or has a high discrepancy rate Aligner will reject the merger and leave the contigs as they were When you use Assemble with existing contigs Aligner will compare the consensus sequences of the two contigs to look for an overlap The relative arrangement of the samples in each contig will remain unchanged Changes are limited to any gaps that need to be introduced reverse complementing if needed re building of the consensus sequence and possibly changing the extend of unaligned regions at the end of samples There are two alternatives to using the Assemble menu item using Assemble with Phrap and Assemble from Scratch Both options will first unassemble the existing contigs and then assemble the existing reads using either Phrap or CodonCode Aligner s build in assembly algorithm to build the contigs for profit users need to have a separate license for Phrap The potential drawback of both of these options is that any edits made by moving gaps or samples around will be lost but other edits like change base calls or removed ends will of course remain Merging Contigs 146 Removing Samples from Contigs Occasionally Aligner may put a sample into a contig where it does not belong or you may want to remove a read from a contig for other reasons To remove a sample from a contig select the sample in the contig view by clicking on it s name or a base in it
383. while other coordinates shown by Aligner are typically gapped they include the count of gaps in the consensus In the example above the gapped and ungapped coordinates are identical since the consensus does not contain any gaps The amino acid change or lack of change is shown for the first of the three possible forward reading frames In your own analysis that may not be what you want your coding sequence may start at base 2 or 3 or even further in for example because you included a part of the sequence before the start codon in your reference sequence To define where the coding region is you can add a codingSequence tags to the consensus or to your reference sequence If you have a reference sequence you should add codingSequence tags to the reference sequence not to the consensus sequence create your contigs by aligning to a reference sequence not by assembling you can use the Contig information menu item in the Contig menu to verify this if in doubt Tags for Finding Mutations 93 CodonCode Aligner User Manual For contigs formed by alignments to reference sequences the coding sequence tags will always be taken from the reference sequence not from the coding sequence If your original sequences were in Genbank or EMBL format that had coding sequence annotation this annotation will be used Otherwise you can add coding sequence tags manually To add a codingSequence tag Open a contig view for th
384. y scores if needed Sequences without traces text sequences do not need to have quality scores if they have quality scores the quality scores will be used to ignore low quality sequence at the ends The sequences must be in a contig The contig can be generated with Aligner by assembling or aligning to a reference sequence or it can be from importing an assembly Only samples that have sequence traces as well as base specific quality scores can be analyzed Detection of point mutations in Aligner is intended for re sequencing projects only The sequences to be analyzed should have the same sequencing chemistry and primers mixing different chemistries for example dye primer and dye terminator sequencing will likely result in many false identifications How To Find SNPs Go to the project view e Select the contig or contigs you want to analyze Choose Find Mutations from the Contig menu Finding mutations should take only a few seconds for small projects Aligner will show a progress dialog which allows you to cancel if things take to long When the finding of heterozygous indels is done Aligner will open a new window that shows the analysis results in a table like the one shown below Finding Mutations 89 CodonCode Aligner User Manual e 09O Mutation tags in Contig1 Feature Source Found In Parent Start End Content mutationSumm Aligner Contig Contigl 14 mutated bases at 8 positions in 1626 bases analyzed h
385. ygoteGT polyPhred ca 23 s Contig2 172 172 homozygoteGG polyPhred ca 9 r Contig2 172 172 homozygoteGG polyPhred ca 9 s Contig2 172 172 polyPhredRank1 polyPhred Contig2 Contig2 172 172 COMMENT co heterozygoteGT polyPhred ca 22 r Contig2 229 229 heterozygoteGT polyPhred ca 22 s Contig2 229 229 heterozygoteGT polyPhred ca 21 s Contig2 229 229 homozygoteTT polyPhred ca 9 r Contig2 229 229 homozygoteTT polyPhred ca 23 s Contig2 229 229 homozygoteTT polyPhred ca 9 s Contig2 229 229 polyPhredRank1 polyPhred Contig2 Contig2 229 229 COMMENT co dataNeeded polyPhred ca 22 s Contig2 333 722 A heterozygoteCG polyPhred ca 22 r Contiq2 401 401 J A feature view window shows the features for one or more contigs depending on your selection when you opened the feature view You can also look at the features for all samples in the Unassembled Samples folder by selecting it in the project view and then opening a feature view You can determine which features are shown in the feature preferences In the example above low quality consensus regions and tags are shown You can sort the table by clicking on the column headers You can also print and export features through the corresponding file menu items you may have to switch to the project view first and select the contig or contigs you want to print or export in the project view You can double click on any item in the feature view to take a closer look at the feature This will open the
386. ylation in bisulfite sequencing traces CodonCode Aligner examines the raw ABI data For other purposes the processed ABI trace data will generally be used When converting raw data to processed data the ABI software adjusts traces to even out spacing between peaks and to adjust the peak intensities in all four lanes to similar levels However these adjustments can artificially increase the peak heights in lanes with overall low intensities like the C lane in bisulfite sequencing this in turn can lead to large errors when trying to calculate methylation By default CodonCode Aligner and similar programs ignores and discards raw ABI data since they significantly increase memory requirements and file size For methylation projects you need to change this behaviour in the Open and Save preferences as described below You may then need to re import the original ABI sequences or re create the project Reference Sequence Alignments For methylation analysis CodonCode Aligner requires a reference sequence where all Cs have been converted to Ts except for potentially methylated Cs in CG dinucleotides Only contigs that have been created by alignment to such a reference sequence can be analyzed CodonCode Aligner provides a function to automatically convert Cs to Gs except in CGs as described below How to Analyze Methylation Before analyzing methylation for the first time you need to tell CodonCode Aligner to read and save ABI raw
387. you define how CodonCode Aligner should group samples based on their names Aligner will then build separate contigs for each sample group Compare contigs this lets you build Contigs of contigs for example for phylogenetic studies You can choose between three different algorithms the built in assembly algorithm and the alignment programs ClustalW and muscle Assemble from scratch this option dissolves existing contigs before assembly Assemble with PHRAP With this option you also have a choice between two assembly algorithms the built in assembly algorithm and the assembly program PHRAP note that users at companies may have to pay a separate license fee to use PHRAP Alignment to a Reference Sequence Alignment to a reference sequence is used to determine differences between sequences and a known sequence This requires that you first designate one sequence as the reference sequence All other samples are then aligned to this sequence If necessary the samples are reverse complemented before alignment Alignment results in one new contig that contains the reference sequence as well as any samples that could be aligned to it If no samples could be aligned to the reference sequence with the current alignment criteria no new contig will be formed and all samples will remain in the Unassembled Samples folder The new contig will be limited to the length of the reference sequence plus any gaps introduced during alignment
388. your own copy of Phred rather than the workstation version please make sure to not call it workstation phred or put into a folder hierachy that contains workstation phred In the bottom text field you can specify additional command line options for Phred In general please leave this line blank only experts who really know what they are doing should specify command line options here Also note that Aligner uses the id and the cd options to specify input and output directories for Phred for more details please check the base calling help page Base Calling Preferences 236 Base Color Preferences CodonCode Aligner can use several different color schemes to display bases You can control and fine tune these schemes in the Base Color Preference dialog Alignment Base colors Assembly Trace colors Base calling Base colors A s green H4 Consensus method Brea i red Double clicking Ts E End clipping G s E black Hd Features Highlighting C s Wou blue License Server N s T pink HM Memory Mutations Show traces on black background Open amp save Background colors Phrap assembly Preference options o Quality based 3 colors continuous scale Printing By nucleotide ignore quality Protein translation O Translation based Restriction maps Sample names Startup Background color details 3 colors Toolbars f Necker intend Low quality from 0 to 19 3 green ES Views Medi
389. zymes PstI cutting at position 722 and BstXI cutting at 1067 is selected Here is a screen shot of the same fragment being selected in the virtual gel Virtual Gel 215 CodonCode Aligner User Manual Restriction map for Contig1 1660 bases linear DNA Displaying fragment sizes in base pairs Ef E R E ui lt 50 bp Ladder BstXI EcoRI Pstl Xbal nd UJ Ww eo 200 A Ww eo 150 100 mum A 50 o TERERRIRIIIIIIIS um The single and multi line map also allow continuous selections by holding the Shift key pressed while selecting regions in the view with your mouse The selection updates accordingly in the other views like the base view the contig view and the trace view The region selected in the screen shot above from base 722 to base 1066 is now selected in the base view for this contig Selecting Fragments 216 CodonCode Aligner User Manual eno Contig1 651 TCTGTCTAGA TTTGTTGTGG GGAAAGATCC TGAAGGAGAG CACAGAGACC 701 TGGAGGAGGT CAGGTGCTGC AJEN GGAAGCCTTGHACACAGGTGT eepeecGATGCCATGMATAGTGATTCHCCCATCAATT CCA ACCTGAGCCC 301 GCAGTCAAABGGGGTGGGCTHITTCTTGTACTHTAATGCTAGABTCTCTGCCAG 851 pee Meh Xd Wiehe Meee iee siete Cem wi fee plditblseM Veleler Commer wu ERI 301 eX EXER dueibELPEPEEPE HEVEDESREIYHSES G P ER EREtRE ENEBddEd4Wi 951 CCACATGCCHAGGCACCAATHATTGGTAAATBGCAGCCGG

CodonCode Aligner User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents