Home

PichiaPink Expression System

1. If your protein is hyperglycosylated e Try intracellular expression as your protein will not go through the secretion pathway and therefore will not be modified e Try deglycosylating the protein with Peptide N Glycosidase F New England BioLabs or other enzymes see next page 45 Protein Glycosylation Analyzing Glycoproteins Enzymes for Analyzing Glycoproteins 46 When expressing and purifying a glycosylated protein in a heterologous expression system it is desirable to quickly determine whether the protein is glycosylated properly Refer to published protocols for carbohydrate analysis of proteins to characterize glycosylated proteins of interest Ausubel et al 1994 unit 17 Further information about glycosylation in eukaryotes is also available in published literature Varki and Freeze 1994 These are just a few of the enzymes available for carbohydrate analysis Abbreviations are as follows Asn Asparagine GlcNAc N acetylglucosamine Enzyme Type of Specificity enzyme Endoglycosidase D Endo Cleaves various high mannose glycans Endoglycosidase F Endo Cleaves various high mannose glycans Endoglycosidase H Endo Cleaves various high mannose glycans Peptide N Glycosidase F Endo Glycoproteins between Asn and GlcNAc removes oligosaccharides Scaling Up Expression Guidelines for Expression Scale up Protocol Concentrating Proteins Once you have
2. Continued on next page Overview continued Expression ADE2 gene Selection Expression of the AOX1 gene is controlled at the level of transcription In methanol grown cells approximately 5 of the polyA RNA is from the AOX1 gene The regulation of the AOX1 gene is a two step process a repression derepression mechanism plus an induction mechanism e g GAL1 gene in Saccharomyces Johnston 1987 Briefly growth on glucose represses transcription even in the presence of the inducer methanol For this reason growth on glycerol is recommended for optimal induction with methanol Note that growth on glycerol alone derepression is not sufficient to generate even minute levels of expression from the AOX1 gene The inducer methanol is necessary for even detectable levels of AOX1 expression Ellis et al 1985 Koutz et al 1989 Tschopp et al 1987a The ADE2 gene encodes phosphoribosylaminoimidazole carboxylase which catalyzes the sixth step in the de novo biosynthesis of purine nucleotides Jones amp Fink 1982 In Saccharomyces cerevisiae ADE2 transcription is regulated by adenine and general amino acid control where gene expression is repressed in the presence of adenine and activated in the absence of adenine Gedvilaite amp Sasnauskas 1994 Expression can also be slightly enhanced under general amino acid starvation conditions Gedvilaite amp Sasnauskas 1994 Som et al 2005 Stotz et al 1993 Although
3. 6 After incubation spread 100 300 uL of the cell mixtures on PAD selection plates and incubate at 24 30 C for 3 10 days until distinct colonies are formed 7 Pick3 8 white colonies from each plate and restreak on fresh PAD selection plates Proceed to small scale expression to test for secreted expression of your gene see Expressing Recombinant PichiaPink Strains page 38 Note You may also wish to analyze the integration of your insert in the PichiaPink strain you have transformed See PCR Analysis of PichiaPink Integrants in the Appendix page 64 The color of the colonies indicates the relative expression levels of your protein of interest The pink colonies express very little ADE2 gene product while the white colonies express higher amounts of the ADE2 gene product suggesting that those colonies have more copies of the integrated construct See pages 7 8 for more information Continued on next page Transforming PichiaPink Strains by Electroporation continued Troubleshooting The table below provides solutions to possible problems you may encounter when preparing and transforming competent PichiaPink cells by electroporation Problem Probable Cause Possible Solution Low efficiency of transformation Too little DNA used in transformation Check the concentration of linearized DNA used for transformation For optimum transformation efficiency you should use 5 10 ug of linear
4. continued High throughput Transformation 36 Procedure continued from previous page 7 10 11 12 Pellet the cells by centrifugation at 3 000 x g for 5 minutes at room temperature Discard the supernatant Resuspend each tube of cells in 500 ul of Solution III and combine the cells into one tube Pellet the cells by centrifugation at 3 000 x g for 5 minutes at room temperature Discard the supernatant Resuspend the cell pellet in 100 to 150 ul of Solution III Plate the entire transformation on PAD selection plates using a sterile spreader Incubate the plates for 3 to 10 days at 30 C Each transformation should yield approximately 50 colonies Pick 3 8 white colonies from each plate and restreak on fresh PAD selection plates Proceed to small scale expression to test for secreted expression of your gene see Expressing Recombinant PichiaPink Strains next page Note You may also wish to analyze the integration of your insert in the PichiaPink strain you have transformed See PCR Analysis of PichiaPink Integrants in the Appendix page 64 TM You can easily adapt the procedure for chemically transforming PichiaPink Strains with the Pichia EasyComp Kit by using 96 well plates and multi channel pipettors You can perform the heat shock step and subsequent incubation in a water bath heat block or thermocycler set to the appropriate temperature and the centrifugation step by using a 96 well plate swing
5. Direct PCR Screening or PichiaPink CIoDesua voee dac dote eed detto itle eec deve dee 66 Total PNA Isolation frombPIebaP His Posi co re d Saepe Rt nee nete ei eL UU Da siete fried 68 Genomic DNA Isolation from PichiaPink for PCR Analysis sse 70 Total RNA Isolation from Rica PR Eso eo oe e eas ittan eam ade tin tpe ett RM C SINE 71 Technical SUpport ansi s omen iie on at ats bese decn east lh dtu ee te eam 73 Purchaser Notificatiori 2 ettet rep chee Pee re etre tne t m i i dere dee 74 References cssc ud eeu ER ene eme Rn e ba eed s 75 iii Kit Contents and Storage Introduction This manual provides guidelines and instructions for high level and large scale expression and secretion of bioactive recombinant proteins using the PichiaPink TM Expression System and is supplied with the products listed below Product Cat no PichiaPink Secretion Optimization Kit A11150 PichiaPink Secreted Protein Expression Kit A11151 PichiaPink Vector Kit A11152 PichiaPink Secreted Protein Vector Kit A11153 PichiaPink Expression Strain Kit A11154 System Each PichiaPink product contains the following components For a detailed Components description of the contents of each component see pages v vi Component Cat no A11150 A11151 A11152 A11153 A11154 A11155 A11156 PichiaPink Vector Kit y 4 PichiaP
6. Yeast 11 1331 1344 Romanos M 1995 Advances in the Use of Pichia pastoris for High Level Expression Curr Opin Biotech 6 527 533 Romanos M A Scorer C A and Clare J J 1992 Foreign Gene Expression in Yeast A Review Yeast 8 423 488 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Ed Cold Spring Harbor Laboratory Press Plainview New York Scorer C A Buckholz R G Clare J J and Romanos M A 1993 The Intracellular Production and Secretion of HIV 1 Envelope Protein in the Methylotrophic Yeast Pichia pastoris Gene 136 111 119 Som I Mitsch R N Urbanowski J L and Rolfes R J 2005 DNA bound Bas1 recruits Pho2 to activate ADE genes in Saccharomyces cerevisiae Eukaryot Cell 4 1725 1735 Sreekrishna K Nelles L Potenz R Cruse J Mazzaferro P Fish W Fuke M Holden K Phelps D Wood P and Parker K 1989 High Level Expression Purification and Characterization of Recombinant Human Tumor Necrosis Factor Synthesized in the Methylotrophic Yeast Pichia pastoris Biochemistry 28 4117 4125 Sreekrishna K Potenz R H B Cruze J A McCombie W R Parker K A Nelles L Mazzaferro P K Holden K A Harrison R G Wood P J Phelps D A Hubbard C E and Fuke M 1988 High Level Expression of Heterologous Proteins in Methylotrophic Yeast Pichia pastoris J Basic Microbiol 28 265 278 Stotz A Muller
7. e 3M sodium acetate e TE buffer see page viii e 100 and 70 ethanol ice cold e Phenolchloroform isoamyl alcohol 25 24 1 v v v 1 Scrape some material off the YPD plate into 1 mL of sterile water in a microcentrifuge tube Vortex 2 Centrifuge at full speed for 10 seconds Remove the supernatant 3 Resuspend the pellet by adding 200 uL of smash and grab buffer 200 uL of phenol chloroform isoamyl alcohol and 0 3 g acid washed glass beads 0 45 uL and vortexing for 3 minutes 4 Add 200 uL of TE buffer and vortex for 5 seconds to mix Centrifuge at full speed for 5 minutes and transfer the supernatant to a microcentrifuge tube 5 Add1mL of ice cold 100 ethanol and centrifuge at full speed for 15 minutes Carefully remove the supernatant and keep the pellet 6 Resuspend the pellet in 400 uL of TE buffer and 1 uL of RNAse A Incubate at 37 C for 5 minutes 7 Add 1 uL of 4M NaCl 10 uL of proteinase K and 20 uL of 10 SDS Incubate at 37 C for 5 minutes 8 Add 400 uL of phenol chloroform isoamyl alcohol Vortex to mix and centrifuge at full speed for 5 minutes 9 Transfer the supernatant 400 uL to a new microcentrifuge tube 10 Add 40 pL of 3 M sodium acetate and 1 mL of ice cold 100 ethanol Vortex to mix and centrifuge at full speed for 15 minutes Remove the supernatant and keep the DNA pellet 11 Add 70 ice cold ethanol to wash the DNA Carefully decant the alcohol 12 Dry the DNA pellet
8. pPink LC RE 2 Rsr ll Soh Stu Kpn Nae Fse or Swa blunt Mly DNA 5 end 3 end pPink HC and pPink LC vectors EcoR I Rsr IL Sph I Stu I Kpn I Nae I Fse lor Swa I Secretion signal sequence EcoR I phosphorylated Blunt phosphorylated Insert containing gene of Blunt phosphorylated Rsr IL Sph I Stu I Kpn I interest most easily accomplished Nae I Fse I or Swa I by adding an Mly I site phosphorylated Continued on next page 17 Cloning into pPink HC and pPink LC continued MCS of pPink HC Below is the multiple cloning site MCS for pPink HC Restriction sites are labeled to indicate the cleavage site The multiple cloning site has been confirmed by sequencing and functional testing The vector sequence of pPink HC is available for downloading at www invitrogen com or from Technical Support see page 73 For a map of pPink HC see page 56 5 end of AOX1 mRNA 801 CCCTGTCTTA AACCTTTTTT TTTATCATCA TTATTAGCTT ACTTTCATAA TTGCGACTGG 5 AOX1 priming site 861 TTCCAATTGA CAAGCTTTTG ATTTTAACGA CTTTTAACGA CAACTTGAGA AGATCAAAAA EcoR Rsr ll Sph Stu Kpnl Nael I l l l l l 921 ACAACTAATT ATTCGAAACG GAATTCCGGA CCGGCATGCC AAGGCCTCAG GTACCGGCCG Fse Swa CYC1 transcription termination region l 981 GCCATTTAAA TACAGGCCCC TTTTCCTTTG TCGATATCAT GTAATTAGTT ATGTCACGCT MCS of pPink LC Below is the multiple cloning site MCS for pPink LC Restriction sit
9. Buffer pH 8 before use Source Saccharomyces cerevisiae Length 19 aa amino acids MW Molecular Weight 2000 3 Da Nucleotide sequence of oligo 1 AATTCGAAACGATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCT Complement nucleotide sequence of oligo 2 AGCTAATGCGGAGGATGCTGCGAATAAAACAGCAGTAAAAATTGAAGGAAATCTCATCGTTTCG Source Aspergillus niger Length 20 aa MW 2207 6 Da Nucleotide sequence of oligo 1 AATTCGAAACGATGGTCGCTTGGTGGTCTTTGTTTCTGTACGGTCTTCAGGTCGCTGCACCTGCTTTG GCT Complement nucleotide sequence of oligo 2 AGCCAAAGCAGGTGCAGCGACCTGAAGACCGTACAGAAACAAAGACCACCAAGCGACCATCGTTTCG Source Aspergillus awamori Length 18 aa MW 1825 2 Da Nucleotide sequence of oligo 1 AATTCGAAACGATGTCTTTTAGATCCTTGITGGCTTTGICIGGITIGGTTIGITCTGGTTIGGCT Complement nucleotide sequence of oligo 2 AGCCAAACCAGAACAAACCAAACCAGACAAAGCCAACAAGGATCTAAAAGACATCGTTTCG Source Homo sapiens Length 18 aa MW 2140 5 Da Nucleotide sequence of oligo 1 AATTCGAAACGATGAAGTGGGTTACCTTTATCTCTTTGTTGTTTCTTTTCTCTTICTGCTTACTCT Complement nucleotide sequence of oligo 2 AGAGTAAGCAGAAGAGAAAAGAAACAACAAAGAGATAAAGGTAACCCACTTCATCGTTTCG Continued on next page PichiaPink Secretion Signal Sequences continued Inulinase presequence Invertase signal sequence Killer Protein signal sequence Lysozyme signal sequence Source Kluyveromyces maxianu
10. Excess foam may cause denaturation of your needed to eliminate foam secreted protein and it also reduces headspace Carbon source variable Must be able to add different carbon sources at rate different rates during the course of fermentation volume of oxygen liters per volume of fermentation culture liters per minute Monitor cell growth at various time points by using the absorbance at 600 nm OD and the wet cell weight Monitor the metabolic rate of the culture by observing changes in the concentration of dissolved oxygen in response to carbon availability see next page Continued on next page PichiaPink Fermentation continued Maintaining the Dissolved Oxygen Concentration DO Use of DO Measurements Manipulation of DO The dissolved oxygen concentration is the relative percent of oxygen in the medium where 100 is air saturated medium Pichia will consume oxygen as it grows reducing the dissolved oxygen content However because oxygen is required for the first step of methanol catabolism it is important to maintain the dissolved oxygen DO concentration at a certain level 22076 to ensure good growth of your PichiaPink strains on methanol Accurate measurement and observation of the dissolved oxygen concentration of a culture will give you important information about the state and health of the culture Refer to your operator s manual to accurately calibrate your equipment 1 Maintaining the di
11. Kpn I Nae I Fse I or Swa I to create compatible ends to the phosphorylated 5 EcoRI end of the signal sequence and the phosphorylated 3 end of your gene of interest We recommend dephosphorylating the vector using Calf Intestinal Alkaline Phosphatase CIAP prior to three way ligation to prevent self ligation of the vector Note Alternatively you may pre digest the vectors with any one of the restriction enzymes that cuts between EcoR I and RE 2 see page 17 in the MCS prior to EcoR I and RE 2 digestion to help reduce possible background of vector self ligation due to incomplete digestion Materials needed EcoR I 10 units uL Rsr IL Sph I Stu I Kpn I Nae I Fse I or Swa I 10 units pL Calf Intestinal Alkaline Phosphatase CIAP 1 unit pL PureLink Quick Gel Extraction Kit see page vii Procedure 1 Set up a restriction digest as follows pPink HC or pPink LC 0 5 pg uL 2 uL 10X Restriction Enzyme Buffer 1 pL Sterile water 5 pL EcoR I 10 units pL 1 uL RE 2 10 units uL 1 uL 2 Incubate for 2 hours to overnight at 37 C 3 Optional Add 2 units of CIAP at 1 unit yL to the reaction mix and incubate for 1 hour at 37 C 4 Gel purify the digested vectors using the PureLink Quick Gel Extraction Kit and proceed to Three way Ligation Protocol next page RE 2 Rsr II Sph I Stu L Kpn I Nae I Fse I or Swa I Continued on next page 19 Cloning into pPink HC and pPink LC continued Thr
12. PCR Buffer 5 pl Genomic DNA 50 300 ng 5 pl 100 mM dNTPs 25 mM each Tul 5 AOX1 Primer or 5 a factor primer 500 ng 1 5 ul 3 CYC1 Primer 500 ng ul 5 pl Sterile water 29 ul Taq Polymerase 5 U l 0 25 ul 2 Load thermocycler and run the following program Step Temperature Time Cycle Initial Denaturation 94 C 2 minutes 1X Denaturation 94 C 1 minute Annealing 55 C 1 minute 25X Extension 72 C 1 minute Final Extension 72 C 7 minutes 1X 3 Remove 10 pl from the reaction and analyze by agarose gel electrophoresis Parent plasmids will produce the following sized PCR products Add the size of these products to the size of your insert to interpret your PCR results Vector PCR Product pPink HC 355 bp insert secretion signal and GOI pPink LC 351 bp insert secretion signal and GOI pPinka HC 586 bp insert GOI using the 5 AOX1 primer pPinka HC 297 bp insert GOI using the 5 a factor primer GOI Gene of interest 65 Direct PCR Screening of PichiaPink Clones Introduction Lysing PichiaPink 66 The following high throughput protocol is designed to directly test PichiaPink TM clones for insertion of your gene by colony PCR Briefly the cells in a 96 well plate are lysed by five rounds of heat treatment in a microwave oven followed by overnight freezing The genomic DNA is then used directly as a PCR template 9o mU gg
13. PichiaPink recombinant strains which you have confirmed by PCR analysis to contain your insert see page 65 This section provides guidelines to determine the optimal method and conditions for expression of your gene We recommend that you consider the factors and guidelines below before starting secreted expression in PichiaPink strains As with any expression system optimal expression conditions depend on the characteristics of the protein being expressed TM The PichiaPink System offers four ade2 strains strains that differ in their protease knockout genotypes to help reduce the impact of proteases and the need for heavy protease inhibitor use during protein expression see page 5 for more information In addition the PichiaPink Secretion Optimization Kit provides you with eight separate secretion signal sequences to help you optimize secreted expression of your protein of interest We recommend that you perform pilot experiments using 3 8 white colonies from each combination of PichiaPink strain vector and secretion signal before scaling up expression The pilot experiments involve growing a small culture of each recombinant taking time points and analyzing the cell pellet and supernatant from each time point by SDS polyacrylamide gel electrophoresis SDS PAGE You may also perform your pilot expression experiments in tubes 15 mL or 50 mL conical tubes multi well plates or small shake flasks if so desired Higher den
14. Step Action Page 1 Generate recombinant PichiaPink vectors containing your 13 25 gene of interest 2 Transform TOP10 Electrocomp E coli and analyze 26 28 transformants for the correct insert 3 Prepare recombinant plasmid DNA to transform PichiaPink 29 Strains Prepare PichiaPink strains for electroporation 30 5 Transform PichiaPink strains by electroporation and select 32 transformants Optional Transform PichiaPink strains using the Pichia 33 37 EasyComp Kit 6 Perform pilot expression experiments using recombinant 38 40 PichiaPink strains Analyze recombinant protein expression by SDS PAGE 41 43 Optimize protein expression and secretion in recombinant 44 45 PichiaPink strains 9 Scale up protein expression in recombinant PichiaPink 47 strains 10 Express your secreted protein in recombinant PichiaPink 48 53 strains using a fermentor 10 Methods PichiaPink Strains Introduction Genotypes of PichiaPink Strains PichiaPink strains are mutants of Pichia pastoris designed for high level g liter and large scale 1000 liter production of secreted bioactive recombinant proteins Their general growth conditions and handling requirements are quite similar to Saccharomyces cerevisiae however we recommend that you familiarize yourself with basic microbiological and sterile techniques as well as with basic molecular biology and protein chemistry before attemptin
15. This consensus sequence corresponds to the Kozak sequence taken from the native AOX1 gene GAAACGATGNN Note that other sequences are also possible Hamilton et al 1987 Although not as strong as the mammalian Kozak translation initiation sequence the yeast consensus sequence is thought to have a 2 3 fold effect on the efficiency of translation initiation The native 5 end of the AOX1 mRNA is noted in the diagram for each multiple cloning site pages 18 and 23 This information is needed to calculate the size of the expressed mRNA of the gene of interest if you need to analyze mRNA for any reason Continued on next page 15 Cloning into pPink HC and pPink LC Introduction Note Considerations for pPink HC and pPink LC for Secreted Protein Expression 16 Cloning of the secretion signal sequences and the gene of interest into pPink HC and pPink LC vectors is a three way ligation This section provides detailed protocols for preparing the PichiaPink vector and the insert containing your gene of interest and performing the three way ligation Three way ligation is used for cloning your gene of interest for secreted expression If you prefer to express your protein intracellularly but still wish to utilize the easy selection scheme of the PichiaPink System you may clone your gene in either the pPink LC or the pPink HC vector without the secretion signal provided that you include the yeast consensus sequence a
16. Transfer the white colonies on the transformation plates to master plates using a 48 colony grid and incubate at 24 30 C until colonies form Aliquot 75 uL of TE Buffer into the 96 wells of a PCR plate Using sterile pipette tips scrape a small amount of PichiaPink cells off the master plates and drop the tips into the wells of the PCR plate Using an eight channel pipette pick up the tips from the PCR plate eight at a time pipette up and down several times and discard the tips Close the wells of the plate using 8 well strip caps Place the 96 well plate into the insert of a pipette tip box so the plate doesn t touch the microwave turntable and microwave on high for 3 5 minutes Vortex briefly Note If overheating occurs because of the power level of the microwave shorten the microwave times accordingly Microwave on high for 2 minutes Vortex briefly Microwave on high for 1 5 minutes Vortex briefly Microwave on high for 1 minutes Vortex briefly Microwave on high for 0 5 minutes Vortex briefly and freeze at 80 C for 10 minutes or overnight Thaw at 95 C for 2 minutes in the PCR machine and centrifuge for 15 minutes at 2 500 rpm using a 96 well plate swing out centrifuge insert 10 Use 5 pL of the supernatant as template in the following PCR reaction Continued on next page Direct PCR Screening of PichiaPink Clones continued PCR Procedure Using the 5 AOX1 forward primer pPink HC pPink LC and pP
17. any technology that was developed without the employment of this product shall not constitute a Patented Improvement and any protein including any recombinant protein expressed through use of this product shall not constitute a Patented Improvement The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research under the terms of this Limited Use Label License and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject
18. be advantageous when a transformed PichiaPink strain is grown in a bioreactor Strains that are ade2 knockouts grow slowly in rich and minimal medium If a production strain transformed with an ADE2 vector were to loose copies of the vector marker the strain would revert to its slow growth phenotype and would not be able to outgrow the desired production strain Consequently the batch could still be productive and generate the desired protein titer It is also important to note that all PichiaPink strains are ade2 full deletion strains thus will not revert to Ade due to a simple point mutation or through a process called gene conversion during which only the marker of the plasmid integrates into the genome and the rest of the plasmid is not integrated After isolating your Pichia recombinants on minimal medium lacking adenine test the expression and secretion of your protein interest using 3 8 white colonies from each combination of PichiaPink strain vector and secretion signal This involves growing a small culture of each recombinant taking time points and analyzing the cell pellet and supernatant from each time point by SDS polyacrylamide gel electrophoresis SDS PAGE You may also perform your pilot expression experiments in multi well plates which greatly simplifies testing all strain vector and secretion signal combinations especially if you are using the PichiaPink Secretion Optimization Kit We suggest that you an
19. for flasks or at 250 300 rpm if you are using a table top shaker for flasks that sits inside an incubator If you are growing your cells in a well plate we recommend that you use a shaker with a very small orbital throw 3 mm and run at a high rpm to ensure adequate mixing and aeration 700 950 rpm Continued on next page 39 Expressing Recombinant PichiaPink Strains continued Important Guidelines for Expression Expressing Recombinant PichiaPink Strains Important 40 Since recombination can occur in many different ways that can effect protein expression clonal variation we recommend that you screen 6 10 verified recombinant clones for expression levels Start with colonies from the freshest plates available Colony viability drops over time so if you have any doubts it is better to streak out your strain The following steps should be viewed as guidelines and are presented to get you started with expression You may have to change the conditions to optimize expression for your particular protein Use bottom or side baffled flasks whenever possible These are available in a variety of sizes 50 2000 mL If you are analyzing a number of recombinants you can try 50 mL conical tubes or multi well plates Be sure that the medium is well aerated by increasing the rate of shaking or placing the tubes at an angle in the shaker Follow the protocol below to test the effectiveness of your expression condition
20. in a 37 C incubator for 10 minutes and resuspend in 200 pL of TE Total RNA Isolation from PichiaPink Introduction Solutions Growing Cells This protocol is designed to isolate 60 300 ug total RNA Schmitt et al 1990 from PichiaPink which is suitable for mRNA isolation using Invitrogen s FastTrack 2 0 or Micro FastTrack 2 0 mRNA Isolation Kit see page vii for ordering information If you wish to use another protocol scale up the reaction to yield about 2 mg of total RNA per time point The mRNA is for northern blot analysis of PichiaPink recombinants to determine if the gene of interest is being induced and transcribed You should isolate the RNA from induced cultures using an uninduced culture as a negative control You will need to make the following solutions e BMGY medium see Recipes page 62 e DEPC treated water e AE buffer 50 mM sodium acetate pH 5 3 1 mM EDTA e Buffered phenol e 10 SDS in DEPC treated water e 3Msodium acetate pH 5 3 e Chloroform isoamyl alcohol 24 1 v v e Phenol chloroform 1 1 v v 1 Grow two cultures 100 200 mL in BMGY but induce only one of them Use the same protocol for induction that you used in the Expression section 2 Take 10 mL time points at 1 2 3 4 and 6 days 3 Harvest the cells from each time point by centrifugation at 1 500 x g for 10 minutes at room temperature 4 Resuspend cell pellet in 400 ul AE buffer and transfer to a
21. microcentrifuge tube Continued on next page 7 Total RNA Isolation from PichiaPink continued Lysis of Cells mRNA Isolation and Northern Analysis 72 1 Add 40 ul 10 SDS to the cells from Step 4 previous page and vortex for 20 seconds 2 Add an equal volume 450 500 ul of buffer saturated phenol and vortex for 20 seconds Incubate at 65 C for 4 minutes 4 Incubate ina dry ice ethanol bath until crystals show 1 minute Centrifuge at maximum speed for 2 minutes at 4 C 5 Transfer aqueous phase to new centrifuge tube and add an equal volume of phenol chloroform and vortex for 20 seconds Centrifuge at maximum speed for 2 minutes at 4 C 6 Remove upper phase to a new tube and add 40 ul of 3 M sodium acetate pH 5 3 and 2 5 volumes of 100 ethanol 20 C Centrifuge at maximum speed for 15 minutes at 4 C Remove ethanol 7 Wash pellet with 80 ethanol and air dry briefly Resuspend total RNA in 20 pl of DEPC treated water and store at 80 C Yield is 60 300 ug total RNA See Ausubel et al 1994 for a protocol for mRNA isolation and northern analysis The FastTrack 2 0 mRNA Kit is designed to isolate mRNA from 0 2 to 1 mg total RNA The Micro FastTrack 2 0 Kit is designed to isolate mRNA from 100 ug total RNA You will need 1 5 ug mRNA per time point Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources i
22. only to pPinka HC For a detailed protocol on cloning your gene of interest in frame with the a mating factor pre sequence into pPinka HC see page 24 e You do not need to include the ATG start codon or the yeast consensus Kozak sequence in your gene of interest as they are already present in the a mating factor pre sequence on pPinka HC However you must clone the open reading frame ORF of the mature gene of interest in frame and downstream of the o mating factor pre sequence e The ATG start codon in the a mating factor pre sequence in pPinka HC corresponds to the native initiation ATG of the AOX1 gene e Prior to performing ligation reaction to clone your insert you must digest the pPinka HC vector with Stu I creates a blunt end and an appropriate restriction enzyme in the multiple cloning site downstream of the Stu I site that does not cut within your gene of interest e g Kpn I Nae I Fse I or Swa I This double digestion creates compatible ends to the 5 Mly I end of the signal sequence and the 3 end of the insert containing your gene of interest e The insert containing your gene of interest must have a phosphorylated 5 blunt end most easily accomplished by adding an Mly I site and a 3 overhang after the stop codon that is compatible to the restriction enzyme used to linearize pPinka HC i e Kpn I Nae I Fse I or Swa I Make sure that your gene of interest does not contain internal restriction sites for Mly I and th
23. or implied including any warranty of merchantability or fitness for a particular purpose 73 Purchaser Notification Introduction Limited Use Label License No 334 PichiaPink 74 Use of the PichiaPink Kits is covered under the licenses detailed below This product is produced subject to an exclusive license to Invitrogen Corporation for US Patents and foreign equivalents owned or controlled by MERCK amp Co Inc the MERCK Patents and related technology The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product including its progeny and derivatives and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity as set forth in the accompanying product instruction manual By purchase and use of this product the buyer agrees to grant to MERCK amp Co Inc and its AFFILIATES a non exclusive non assignable non sublicensable fully paid up royalty free license to all Patented Improvements made by or on behalf of the buyer through the use of this product Patented Improvements means any modification of this product or its use a that is the subject of an issued claim in a patent wherein the issued claim is directed to an invention that was conceived by the buyer or a person under the direction or supervision of the buyer and b which was developed through the use of this product For clarity
24. synthesizing proteinase B a vacuolar serine protease of the subtilisin family PichiaPink Strain 4 is double knock out for both proteinases A and B i e pep4 and prb1 therefore has the lowest protease activity amongst the PichiaPink strains Continued on next page 11 PichiaPink Strains continued Growth of PichiaPink Strains Important Growth on Methanol 12 The growth temperature of PichiaPink strains is 24 30 C for liquid cultures plates and slants Growth above 32 C during induction can be detrimental to protein expression and can even lead to cell death Other important facts TM e Doubling time of log phase untransformed PichiaPink strains i e ade2 in YPD is 6 to 8 hours e Untransformed prb1 PichiaPink strains i e PichiaPink Strains 3 and 4 grow slightly slower than PichiaPink strains expressing functional PRB1 gene product TM e Doubling time of log phase transformed PichiaPink ADE2 gene product in BMGY is 4 hours e Doubling time of log phase transformed PichiaPink strains in BMMY is 16 hours One ODeoo 5x 107 cells mL Note Growth characteristics of PichiaPink strains may vary depending on the recombinant protein expressed strains i e expressing TM The protease deficient Pichia pastoris strains i e PichiaPink strains 2 3 and 4 are not as robust as wild type Pichia pastoris and require greater care in growth and storage especi
25. to cut your vector downstream of the EcoR I site in the MCS you can use gene synthesis to generate your insert with appropriate ends compatible with this scheme TM e The phosphorylated 5 end of the PichiaPink Secretion Signal duplexes has an EcoRI compatible overhang lacking the G i e AATTC see the PichiaPink Secretion Signal Sequences on pages 54 55 in the Appendix e Refer to the diagrams depicting the multiple cloning sites of pPink HC and pPink LC on page 18 to develop a cloning strategy Continued on next page Cloning into pPink HC and pPink LC continued Three way Ligation The figure below schematically depicts the three way ligation reaction see next page for protocol Prior to performing the three way ligation you must digest the pPink HC and pPink LC vectors with EcoR I and an appropriate restriction enzyme in the multiple cloning site downstream of the EcoR I site that does not cut within your gene of interest e g one of Rsr IL Sph I Stu I Kpn I Nae I Fse I or Swa I This double restriction digest will create compatible ends to the phosphorylated 5 EcoR I end of the signal sequence and the phosphorylated 3 end of your gene of interest see diagram below Refer to the diagrams depicting the multiple cloning sites of into pPink HC and pPink LC vectors on the next page to develop a cloning strategy P blunt eee L inte NENNEN ncop SigSeq GOI EcoR RE 2 Prox pPink HC or
26. to multiple limited use label licenses the most restrictive limited use label license terms apply The research use limitation stated above shall not preclude the buyer from the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that i neither this product nor any of its components was used in the manufacture of such product and ii the product or its components are not included in the therapeutic prophylactic or diagnostic product If the buyer is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Barr K A Hopkins S A and Sreekrishna K 1992 Protocol for Efficient Secretion of HSA Developed from Pichia pastoris Pharm Eng 12 48 51 Brierley R A Bussineau C Kosson R Melton A and Siegel R S 1
27. to room temperature You will need one plate for each transformation e You may want to include controls to check for contamination We recommend a no DNA and a plasmid only control 1 For each transformation thaw one tube of competent cells at room temperature and aliquot 50 ul into a sterile microcentrifuge tube If transforming fresh cells use 50 ul of cells from Preparing Competent Cells Step 7 previous page 2 Add 5 10 ug of linearized PichiaPink expression vector DNA to the competent cells Note The volume of DNA should not exceed 5 ul You may use linearized DNA directly from a restriction digest reaction without affecting transformation efficiency Phenol chloroform extraction and ethanol precipitation are not necessary 3 Add 1 mL of Solution II to the DNA cell mixture and mix by vortexing or flicking the tube 4 Incubate the transformation reactions for 1 hour at 30 C in a water bath or incubator Mix the transformation reaction every 15 minutes by vortexing or flicking the tube Failure to mix the transformation reaction every 15 minutes will result in decreased transformation efficiency 5 Heat shock the cells in a 42 C heat block or water bath for 10 minutes 6 Split the cells into 2 microcentrifuge tubes approximately 525 ul per tube and add 1 mL of YPD medium to each tube Procedure continued on next page Continued on next page 35 EasyComp Transformation continued Transformation Protocol
28. 7732 nucleotides 5 AOX1 promoter region bases 1 940 Multiple cloning site bases 942 988 CYC1 transcription termination region bases 993 1267 ADE2 promoter region bases 1282 1363 ADE2 ORF bases 1364 3049 TRP2 gene bases 3273 5084 pUC ori 5453 6126 c Ampicillin b a resistance gene bases 6271 7131 c c complementary strand 57 Map of pPinka HC Map of pPinka HC 58 pPinka HC 7667 bp is a PichiaPink secreted protein expression vector containing the Saccharomyces cerevisae a mating factor pre sequence for secretion of recombinant proteins It also expresses the full length ADE2 gene product from a truncated 13 bp ADE2 promoter Nett 2008 and is considered a high copy plasmid The backbone of the plasmid is based on pUC19 and contains the Ampicillin bla resistance gene for selection in E coli The map below shows the elements of the pPinka HC vector The vector sequence of pPinka HC is available at www invitrogen com or by contacting Technical Support page 73 X All Spel EcoN Comments for pPinka HC 7898 nucleotides 5 AOX1 promoter region bases 1 940 a mating factor secretion signal 941 1194 Multiple cloning site bases 1196 1222 CYC1 transcription termination region bases 1228 1502 ADE2 promoter region bases 1517 1529 ADE2 ORF bases 1530 3215 TRP2 gene bases 3439 5250 pUC ori 5619 6292 c Ampicillin bla resistance gene bases 6437 7297 c c complem
29. 990 Fermentation Development of Recombinant Pichia pastoris Expressing the Heterologous Gene Bovine Lysozyme Annals New York Acad Sci 589 350 362 Buckholz R G and Gleeson M A G 1991 Yeast Systems for the Commercial Production of Heterologous Protein Bio Technology 9 1067 1072 Cereghino G P Cereghino J L Ilgen C and Cregg J M 2002 Production of recombinant proteins in fermenter cultures of the yeast Pichia pastoris Curr Opin Biotechnol 13 329 332 Cregg J M Cereghino J L Shi J and Higgins D R 2000 Recombinant protein expression in Pichia pastoris Mol Biotechnol 16 23 52 Cregg J M and Higgins D R 1995 Production of Foreign Proteins in the Yeast Pichia pastoris Canadian J Botany Supp 73 5981 5987 Cregg J M Vedvick T S and Raschke W C 1993 Recent Advances in the Expression of Foreign Genes in Pichia pastoris Bio Technology 11 905 910 Daly R and Hearn M T 2005 Expression of heterologous proteins in Pichia pastoris a useful experimental tool in protein engineering and production J Mol Recognit 18 119 138 Deutscher M P ed 1990 Guide to Protein Purification Vol 182 Methods in Enzymology Edited by Abelson J N and Simon M I Academic Press San Diego CA Ellis S B Brust P F Koutz P J Waters A F Harpold M M and Gingeras T R 1985 Isolation of Alcohol Oxidase and Two other Methanol Regulatable Genes from the Yeast Pichia pasto
30. Buffer and 7 5 ul of NuPAGE Sample Reducing Agent see page vii M Boil 10 minutes then load 10 30 ul onto the gel You may store the remaining sample may be stored at 20 C for western blots if necessary You may store the supernatants at 80 C for further analysis 4 If you do not see any protein by Coomassie or by western blot then concentrate the supernatant 5 10 fold and analyze samples again by western blot Centricon and Centriprep filters Amicon are very useful for this purpose You may also silver stain your gels for better detection You may perform Lowry BCA Pierce or Bradford protein assays to quantify the amounts of protein in the cell lysates and medium supernatants PichiaPink medium supernatants will vary in protein concentration primarily due to the amount of your secreted protein PichiaPink secretes very few native proteins If the protein concentration of the medium is gt 50 ug mL a 10 ul of sample from the medium will give a faint band on a Coomassie stained SDS PAGE gel Include the following samples as controls on your SDS PAGE e Molecular weight standards appropriate for your desired protein e A sample of your protein as a standard if available e A sample of your PichiaPink strain transformed with the parent plasmid i e without your insert This shows the background of native PichiaPink proteins that are present intracellularly Inclusion of this sample will help you differe
31. I Insert containing gene of Mly I blunt Kpn I Nae I Fse I or Swa IL interest phosphorylated phosphorylated 22 Cloning into pPinka HC continued MCS of pPinka HC Below is the multiple cloning site MCS for pPinka HC Restriction sites are labeled to indicate the cleavage site The multiple cloning site has been confirmed by sequencing and functional testing The vector sequence of pPinka HC is available for downloading at www invitrogen com or from Technical Support see page 73 For a map of pPinka HC see page 58 811 871 931 980 1028 1076 1124 1172 5 end of AOX1 mRNA 5 AOX7 priming site AACCTTTTTT TTTATCATCA TTATTAGCTT ACTTTCATAA TTGCGACTGG TTCCAATTGA os il CAAGCTTTTG ATTTTAACGA CTTTTAACGA CAACTTGAGA AGATCAAAAA ACAACTAATT ATTCGAAACG ATG AGA TTT CCT TCA ATT TTT ACT GCT GTT TTA TTC GCA Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala GCA Ala TCC ser TCC ser GCA TTA GCT GCT CCA GTC AAC ACT ACA ACA GAA GAT Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp a factor signal sequence GAA Glu ACG Thr GCA Ala CAA Gln ATT CCG GCT GAA GCT GTC ATC GGT TAC TCA GAT TTA Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu GAA Glu GGG Gly GAT Asp TTC Phe GAT GTT GCT GTT TTG CCA TTT TCC AAC AGC ACA AAT Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn a factor priming site AAC Asn GGG Gly TTA Leu TTG
32. Invitrogen PichiaPink Expression System For High level and Large scale Expression and Secretion of Bioactive Recombinant Proteins in Pichia pastoris Catalog nos A11150 A11151 A11152 A11153 and A11154 Revision date 6 August 2010 Manual part no A10984 MANO000717 ii Table of Contents Kit Contents and Storage ocanugetseutuieenedusipereatad tene oO MR eee die iue date iv Accessory Products csiitisiiet aids iss endete titm t ated vii Introduction mo tus coe sate ccenesteerectues cuca cetnadeseeteavessvenaveseedsavesd ecventudecuencuencueneceecuebaeiaesctienens 1 OW OL VIC Wires series bee rte deste seiten d a utei need ee i eb e ed vate dr odes rne ever eee esters ious 1 Using the Pra ik System es ftia das tede atten c Ca o Ea d 6 Exp rimental Outline 4 rn e Ier fere pe e ie ie hee En dete re e etin tie tein ee get 9 MethodS cites ases eee eeu Lese iustus gine ces ses cac lua teas ees quence ds suem duse dus ipis Perdu a dua R OE 11 Pichia PIRE Strasne sdags Shoe e a foeda t cals Deluna dad te bue ef Secu Yotaanbens huge 11 General Cloning Information c cccccscsesccesseseeceeeneneesesesesnenesesesesesnenessseseseeeeceeeesesesesesesnsnenseenenenenesesesnananes 14 Cloning into pPink HC and pPink LC ssssssssssssseeeeeeerennenenert ttt enne 16 Cloning into pEinko EIC sos eo enn Free d eee e ie ee ex dere eg 21 Transforming E colt Cells aee dede needed ie ah niei eed i de pei bere terio 26 Preparin
33. Leu TTT ATA AAT ACT ACT ATT GCC AGC ATT GCT GCT AAA Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys GAA Glu Stu Kpn Nael I GAA Glu GGG Gly GTA Val Swal m TCT CTC GAG AAA AGG CCTCAGGTAC CGGCCGGCCATT TAAATACAGG Ser Leu Glu Lys Arg CYC1 transcription termination region 1228 CCCCTTTTCC TTTGTCGATA TCATGTAATT AGTTATGTCA CGCTTACATT CACGCCCTCC Continued on next page 23 Cloning into pPinka HC continued Restriction Digesting pPinka HC 24 Follow the protocol below to digest pPinka HC with Stu I creates a blunt end and an appropriate restriction enzymes to produce compatible ends to the phosphorylated 5 blunt end i e Mly I and phosphorylated 3 end compatible to RE 2 see below of your gene of interest We recommend dephosphorylating the vector using Calf Intestinal Alkaline Phosphatase CIAP prior to three way ligation to prevent self ligation of the vector Materials needed Stu I 10 units pL Kpn I Nae I Fse I or Swa I 10 units pL Calf Intestinal Alkaline Phosphatase CIAP 1 unit uL TM PureLink Quick Gel Extraction Kit see page vii Procedure 1 Set up a restriction digest as follows pPinka HC 0 5 ug nL 2 uL 10X Restriction Enzyme Buffer 1 uL Sterile water 5 pL Stu I 10 units pL 1 pL RE 2 10 units uL 1 pL 2 Incubate for 2 hours to overnight at 37 C 3 Optional Add 2 units of CIAP at 1 unit yL to the reaction mix a
34. Nett 2008 and is considered a high copy plasmid The backbone of the plasmid is based on pUC19 and contains the Ampicillin bla resistance gene for selection in E coli The map below shows the elements of the pPink HC vector The vector sequence of pPink HC is available at www invitrogen com or by contacting Technical Support page 73 Y Q o Lu Rsr Il Sph Stu Kpn Fsel Nae Swa AM coe EcoN Comments for pPink HC 7667 nucleotides 5 AOX1 promoter region bases 1 940 Multiple cloning site bases 942 988 CYC1 transcription termination region bases 997 1271 ADE2 promoter region bases 1286 1298 ADE2 ORF bases 1299 2984 TRP2 gene bases 3208 5019 pUC ori 5388 6061 c Ampicillin bla resistance gene bases 6206 7066 c c complementary strand Map of pPink LC Map of pPink LC pPink LC 7732 bp is a PichiaPink expression vector containing the full length Pichia pastoris ADE2 gene product driven by the full length 82 bp ADE2 promoter Nett 2008 and is considered a low copy plasmid The backbone of the plasmid is based on pUC19 and contains the Ampicillin bla resistance gene for selection in E coli The map below shows the elements of the pPink LC vector The vector sequence of pPink LC is available at www invitrogen com or by contacting Technical Support page 73 Y Q o Ww Rsr Il Sph Stu Kpn Fse Nae Swa Af Spel EcoN Comments for pPink LC
35. P P and Linder P 1993 Regulation of the ADE2 gene from Saccharomyces cerevisiae Curr Genet 24 472 480 76 References continued Tschopp J F Brust P F Cregg J M Stillman C and Gingeras T R 1987a Expression of the lacZ Gene from Two Methanol Regulated Promoters in Pichia pastoris Nucleic Acids Res 15 3859 3876 Tschopp J F Sverlow G Kosson R Craig W and Grinna L 1987b High Level Secretion of Glycosylated Invertase in the Methylotrophic Yeast Pichia pastoris Bio Technology 5 1305 1308 Wegner G H 1990 Emerging Applications of the Methylotrophic Yeasts FEMS Microbiology Reviews 87 279 284 Zonneveld B J and van der Zanden A L 1995 The red ade mutants of Kluyveromyces lactis and their classification by complementation with cloned ADE1 or ADE2 genes from Saccharomyces cerevisiae Yeast 11 823 827 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 77 invitrogen Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
36. ally during fermentative growth Gleeson et al 1998 When using plates or medium containing methanol as growth medium we recommend that you add methanol every day to compensate for loss because of evaporation or consumption e For plates add 100 uL of 100 methanol to the lid of the inverted plate e For liquid medium add 100 methanol to a final concentration of 0 5 Note Some researchers have had success adding methanol to up to 3 for Mut strains similar to PichiaPink without any negative effect to their liquid culture For long term storage prepare frozen stocks of all four PichiaPink strains included in this kit see next page Continued on next page PichiaPink Strains continued Storing PichiaPink Strains Note To store cells for weeks to months use YPD medium and YPD agar slants see page 60 1 Streak each strain to obtain single colonies on YPD agar plates Grow 3 5 days at 24 30 C 2 Transfer one colony to a YPD stab and grow for 3 5 days at 30 C 3 You can store the cells on YPD for several weeks at 4 C To store cells for months to years store frozen at 80 C Day 1 1 Culture a single colony of each strain in 10 mL of YPD medium for 16 20 hours at 24 30 C shaking at 300 rpm This is your starter culture Note It is important to have adequate aeration for growth Always use 1 5 ratio of media to flask volume Day 2 2 Seed 200 mL of YPD medium with the sta
37. alyze your SDS PAGE gels by Coomassie staining and western blot as expression and secretion are protein dependent and not all proteins express to the level of grams per liter We also suggest checking for protein activity if an assay is available TM Choose the recombinant PichiaPink strain which best expresses your protein and optimize secreted expression based on the suggestions provided in Optimizing PichiaPink Protein Expression on pages 44 45 Once expression is optimized scale up your expression protocol to produce more protein for purification Experimental Outline Experimental Process The overall experimental process is presented below More information about recombination and integration in Pichia is provided in a review by Higgins and Cregg Higgins amp Cregg 1998 secretion PAOX PaAox Signal ADE2 ADE2 ADE2 high copy high copy low copy Secretion Signal Clone GOI into pPINSES linearize DNA Strain 1 Strain 2 Strain 3 Strain 4 Plate transformants en Incubate 3 7 days Select 3 8 white colonies e Small scale expression Select strain for large scale expression Continued on next page Experimental Overview continued Experimental The experimental steps necessary to express your protein of interest using the Steps PichiaPink System are outlined below For more details on each step refer to the indicated pages
38. ant from Step 5 previous page and add 2 volumes of ethanol to the supernatant Incubate at room temperature for 15 minutes Centrifuge at 10 000 x g for 20 minutes at 4 C Resuspend the pellet gently in 0 7 mL of TE buffer pH 7 4 and transfer to a microcentrifuge tube Gently extract with an equal volume of phenol chloroform 1 1 v v followed by an equal volume of chloroform isoamyl alcohol 24 1 Split the aqueous layer into two microcentrifuge tubes Add 1 2 volume of 7 5 M ammonium acetate pH 7 5 and 2 volumes of ethanol to each tube Place on dry ice for 10 minutes or at 20 C for 60 minutes Centrifuge at 10 000 x g for 20 minutes at 4 C and wash the pellets once with 1 mL of 70 ethanol Briefly air dry the pellets and resuspend each one in 50 mL of TE buffer pH 7 5 Determine the concentration of the DNA sample You may store the two samples separately or combined at 20 C until ready for use 69 Genomic DNA Isolation from PichiaPink for PCR Analysis Introduction Materials Needed Procedure 70 The protocol below provides an alternative procedure for you to isolate genomic DNA from untransformed as well as recombinant PichiaPink strains The DNA isolated using this protocol is suitable genomic PCR Smash and Grab Buffer see page 64 for recipe e Sterile water e 0 45 um glass beads acid washed e RNAse A see page viii e Proteinase K see page viii e 10 SDS see page viii e 4MNaCl
39. ase wild type PichiaPink Strain 1 The PichiaPink Strain 2 is a pep4 knockout and the PichiaPink Strain 3 is a prb1 knockout while the PichiaPink Strain 4 is double knock out for both proteases i e prb1 and pep4 Using the PichiaPink System Choosing the Appropriate PichiaPink System for Expressing Secreted Proteins PichiaPink System for Expressing Intracellular Proteins Choosing the Appropriate Vector for Cloning TM The PichiaPink System provides you with two different kits for secreted expression of your recombinant protein of interest The PichiaPink Secreted Protein Expression Kit Cat no A11151 allows you to clone your gene interest in frame with the Saccharomyces cerevisiae a mating factor pre sequence using the pPinka HC plasmid for secreted expression of your recombinant protein pPinka HC is also available separately as the PichiaPink Secreted Protein Vector Kit see page vii for ordering information The PichiaPink Secretion Optimization Kit Cat no A11150 enables you to screen multiple signal sequences with your gene of interest in both low and high copy vectors pPink LC and pPink HC respectively for optimal expression and secretion of your recombinant protein pPink LC and pPink HC vectors are also available separately as the PichiaPink Vector Kit see page vii for ordering information TM Both PichiaPink systems allow the selection of transformants containing your
40. ast Curr Opin Biotechnol 18 387 392 75 References continued Higgins D R and Cregg J M eds 1998 Pichia Protocols Vol 103 Methods in Molecular Biology Edited by Walker J M Humana Press Totowa NJ Johnston M 1987 A Model Fungal Gene Regulatory Mechanism the GAL Genes of Saccharomyces Cerevisiae Microbiol Rev 51 458 476 Jones E W and Fink G R 1982 Regulation of amino acid and nucleotide biosynthesis in yeast The Molecular Biology of the Yeast Saccharomyces Metabolism and Gene Expression N Strathern J Jones E W and Broach J R Eds Cold Spring Harbor Laboratory Press Cold Spring Harbor New York Koutz P J Davis G R Stillman C Barringer K Cregg J M and Thill G 1989 Structural Comparison of the Pichia pastoris Alcohol Oxidase Genes Yeast 5 167 177 Li P Anumanthan A Gao X G langovan K Suzara V V Duzgunes N and Renugopalakrishnan V 2007 Expression of recombinant proteins in Pichia pastoris Appl Biochem Biotechnol 142 105 124 Macauley Patrick S Fazenda M L McNeil B and Harvey L M 2005 Heterologous protein production using the Pichia pastoris expression system Yeast 22 249 270 Nett J 2008 Improved Yeast Strains for Protein Production United states Patent Application PCT US08 13719 Nico Farber K Harder W Ab G and Veenhuis M 1995 Review Methylotrophic Yeasts as Factories for the Production of Foreign Proteins
41. ation Kit Components and PichiaPink Secreted Protein Expression Kits is also available separately from Invitrogen Cat no A11156 It includes the following prepackaged media for your convenience Keep the media dry and store at room temperature Media Amount Yield PAD Agar 2 pouches 1liter pouch of PAD agar medium YP 2 pouches 1liter pouch of YP base medium YPS 2 pouches 0 2 liters pouch of YPS base medium YP Agar 2 pouches 1 liter pouch of YP agar medium Dextrose 1 pouch 1 liter pouch of 20 dextrose vi Accessory Products PichiaPink Kit Reagents Additional Products Many of the reagents supplied in the PichiaPink Kits are available separately from Invitrogen Ordering information is provided below Product Amount Cat no PichiaPink Vector Kit 1 kit A11152 PichiaPink Secreted Protein Vector Kit 1 kit A11153 PichiaPink Expression Strain Kit 1 kit A11154 PichiaPink Secretion Signal Kit 1 kit A11155 PichiaPink Media Kit 1 kit A11156 Many of the reagents supplied with the PichiaPink TM kits as well as other products suitable for use with the kits are available separately from Invitrogen Ordering information is provided below Product Amount Cat no One Shot TOP10 Electrocomp E coli 10 reactions C4040 50 20 reactions C4040 52 One Shot TOP10 Chem
42. ature and use directly for transformation or freeze for future use To freeze cells place tubes in a Styrofoam box or wrap in several layers of paper towels and place in a 80 C freezer It is important that the cells freeze down slowly Do not snap freeze the cells in liquid nitrogen Proceed to the transformation procedure next page Continued on next page EasyComp Transformation continued Note Transformation Materials Needed Before Beginning Transformation Protocol We have observed that higher chemical transformation efficiencies are often obtained with frozen versus freshly prepared cells You may choose to use some of the cells immediately following preparation and freeze the remaining cells in small aliquots You may use the following protocol to transform freshly prepared or frozen competent PichiaPink cells Transformation efficiency may vary with each strain and vector used TM e Chemically competent PichiaPink cells Step 8 previous page e Water baths or heat blocks at 30 C and 42 C e PAD agar plates see Recipes page 61 e The PEG in Solution II may precipitate at temperatures below 27 C If you see a precipitate warm the solution at 37 C swirling occasionally until the precipitate dissolves To prevent formation of a precipitate store Solution II at room temperature e Equilibrate Solution III to room temperature e Equilibrate the appropriate number PAD selection plates
43. ave an advantage in the glycosylation of secreted proteins because it is not as prone to hyperglycosylation Both Saccharomyces cerevisiae and Pichia pastoris have a majority of N linked glycosylation of the high mannose type however the length of the oligosaccharide chains added posttranslationally to proteins in Pichia average 8 14 mannose residues per side chain is much shorter than those in Saccharomyces cerevisiae 50 150 mannose residues Grinna amp Tschopp 1989 Tschopp et al 1987b Very little O linked glycosylation has been observed in Pichia In addition Saccharomyces cerevisiae core oligosaccharides have terminal 1 3 glycan linkages whereas Pichia pastoris does not It is believed that the a1 3 glycan linkages in glycosylated proteins produced from Saccharomyces cerevisiae are primarily responsible for the hyper antigenic nature of these proteins making them particularly unsuitable for therapeutic use This is less of a problem for glycoproteins generated in Pichia pastoris because they resemble the glycoprotein structure of higher eukaryotes Cregg et al 1993 Gerngross 2004 Hamilton et al 2003 Hamilton amp Gerngross 2007 Heterologous expression in Pichia pastoris can be intracellular or secreted Secretion requires the presence of a signal sequence on the expressed protein to target it to the secretory pathway While several different secretion signal sequences have been used successfully including the nati
44. chiaPink Strain 2 ade2 pep4 1mL 80 C PichiaPink Strain 3 ade2 prb1 1mL 80 C PichiaPink Strain 4 ade2 prb1 pep4 1mL 80 C Continued on next page Kit Contents and Storage continued PichiaPink The PichiaPink Secretion Signal Kit included in the PichiaPink Secretion Secretion Signal Optimization Kit is also available separately from Invitrogen Cat no A11155 Kit Components The PichiaPink Secretion Signal Kit consists of eight secretion signal sequences supplied as phosphorylated duplexes in 40 pmol lyophilized aliquots The secretion signals and their sources are listed below Upon receipt store the secretion signal duplexes at 20 C TM For the list of PichiaPink secretion signals their sources and sequences see PichiaPink Secretion Signal Sequences on pages 54 55in the Appendix Item Source Amount a amylase signal sequence Aspergillus niger 40 pmol Glucoamylase signal sequence Aspergillus awamori 40 pmol Serum albumin signal sequence Homo sapiens 40 pmol Inulinase presequence Kluyveromyces maxianus 40 pmol Invertase signal sequence Saccharomyces cerevisiae 40 pmol Killer Protein signal sequence Saccharomyces cerevisiae 40 pmol Lysozyme signal sequence Gallus gallus 40 pmol a mating factor pre sequence Saccharomyces cerevisiae 40 pmol PichiaPink Media The PichiaPink Media Kit included in the PichiaPink Secretion Optimiz
45. ds on the copy number of the plasmid which in turn is determined by the promoter strengths of the markers The pink colonies express very little ADE2 gene product while the white colonies express higher amounts of the ADE2 gene product suggesting that those colonies have more copies of the integrated construct Strains transformed with the low copy plasmid pPink LC grows faster on medium lacking adenine generating white colonies due to the stronger promoter on this vector Since the promoter is stronger less ADE2 expression is required to allow the strains to grow on medium lacking adenine As a result fewer copies of the ADE2 gene expression construct are required in the strain Continued on next page Using the PichiaPink System continued Note Growth in a Fermentor or Bioreactor Expression and Scale up When using the pPink HC vector the transformation efficiency of the host strain may appear low because colonies with only a few copies of the marker will not produce enough ADE2 gene product to grow and will be selected against on medium lacking adenine i e adenine dropout medium or minimal medium Only colonies that have integrated multiple copies of the ADE2 marker will able to grow without adenine Since the gene of interest is linked to the selection marker the white colonies could also result in higher expression of the gene of interest TM The ADE2 selection system provided by the PichiaPink vectors can
46. e restriction enzyme used to linearize your vector Note If your gene of interest contains internal sequences recognized by Mly I and the restriction enzyme used to linearize your vector you can use gene synthesis to generate your insert with appropriate ends compatible with this ligation scheme e Refer to the diagram depicting the multiple cloning site of pPinka HC on page 23 to develop a cloning strategy Continued on next page 21 Cloning into pPinka HC continued Cloning into The figure below schematically depicts the pPinka HC cloning reaction Prior to pPinka HC performing ligation reaction to clone your insert you must digest the pPinka HC vector with Stu I creates a blunt end and an appropriate restriction enzyme in the multiple cloning site downstream of the Stu I site that does not cut within your gene of interest e g one of Kpn I Nae I Fse I or Swa I This double restriction digest will create compatible ends to the phosphorylated 5 blunt end most easily created by adding an Mly I site and the phosphorylated 3 end of your gene of interest see diagram below Refer to the diagram depicting the multiple cloning site of into pPinka HC on the next page to develop a cloning strategy P blunt E n5srop GOI Stu blunt RE 2 aMF SigSeq ADE2 pPinka HC P Aox RE 2 Kpn Nae Fse or Swa plunt Mly DNA 5 end 3 end pPinka HC Stu I blunt Kpn I Nae I Fse I or Swa
47. ectorin 10 pg 20 C TE buffer pH 8 0 3 CYC1 primer 20 uL of 0 5 pg pL vector in 10 ug 20 C TE buffer pH 8 0 TE buffer pH 8 0 10 mM Tris HCl 1 mM EDTA pH 8 0 P P PichiaPink The PichiaPink Secreted Protein Vector Kit included in the PichiaPink Secreted Secreted Protein Protein Expression Kit is also available separately from Invitrogen Cat no Vector Kit A11153 Upon receipt store the components as listed below Components Note pPinka HC vector is high copy number vector containing the Saccharomyces cerevisiae a mating factor pre sequence for secreted protein expression Item Composition Amount Storage One Shot TOP10 Electrocomp E coli 21 x 50 pL 80 C pPinka HC vector 40 uL of 0 5 ug uL vector 20 ug 20 C in TE buffer pH 8 0 5 a factor primer 20 uL of 0 5 pg pL vector 10 ug 20 C in TE buffer pH 8 0 3 CYC1 primer 20 uL of 0 5 pg pL vector 10 ug 20 C in TE buffer pH 8 0 PichiaPink The PichiaPink Expression Strain Kit included in the PichiaPink Secretion Expression Strain Kit Components TM Optimization and PichiaPink Secreted Protein Expression Kits is also available separately from Invitrogen Cat no A11154 Upon receipt store the strains at 80 C Note The ade2 deletion is a full deletion of the ADE2 gene and part of its promoter Item Relevant Genotype Amount Storage PichiaPink Strain 1 ade2 1mL 80 C Pi
48. ed using the EasyComp protocol for electroporation TM Pichia EasyComp Kit see page vii for ordering information 30 C rotary shaking incubator PichiaPink YPD medium see Recipes page 60 50 mL sterile conical tubes Centrifuge suitable for 50 mL conical tubes floor or table top 1 5 mL sterile screw cap microcentrifuge tubes Styrofoam box or paper towels TM Inoculate 10 mL of YPD with a single colony of your PichiaPink strain Grow for 1 2 days at 24 30 C in a shaking incubator 250 300 rpm Dilute cells from the overnight culture to an ODe of 0 1 0 2 in 10 mL of YPD Grow the cells at 24 30 C in a shaking incubator until the OD reaches 0 6 1 0 This will take approximately 18 to 24 hours Pellet the cells by centrifugation at 500 x g for 5 minutes at room temperature Discard the supernatant Resuspend the cell pellet in 10 mL of Solution I from the EasyComp kit equilibrated to room temperature No incubation time is required Pellet the cells by centrifugation at 500 x g for 5 minutes at room temperature Discard the supernatant Resuspend the cell pellet in 1 mL of Solution I The cells are now competent Aliquot 50 to 200 ul of competent cells into labeled 1 5 mL sterile screw cap microcentrifuge tubes Note 50 ul of cells are used for each transformation Cells can be thawed and refrozen several times without significant loss in transformation efficiency You may keep the cells at room temper
49. ee way Ligation Protocol 20 Follow the protocol below to clone your gene of interest in frame with the secretion signal sequence into pPink HC and pPink LC vectors Materials needed T4 DNA Ligase pPink HC or pPink LC vector linearized see previous page Insert with gene of interest Secretion signal sequence see pages 54 55 Procedure 1 Resuspend the secretion signal sequence you want to use in 40 uL of TE buffer to prepare 10X stock solution at 1 pmol wL Dilute 1 uL of this solution 10 fold to prepare 0 1 pmol uL working solution for three way ligation 2 Set up a three way ligation reaction in a 0 5 mL microcentrifuge tube as follows Component Amount 5X ligase buffer 2 pL T4 DNA ligase 0 5 uL pPink HC or pPink LC 4 fmol 1 pL at 20 ng pL Insert with gene of interest 12 20 fmol 1 pL at 10 20 ng uL Secretion signal sequence 1X 0 1 pmol 1 pL at 10 20 ng pL Sterile water to 10 pL 3 Mix gently centrifuge briefly and incubate at 25 C for 1 2 hours or at 16 C overnight 4 Proceed to Transforming E coli Cells page 26 Cloning into pPinka HC Introduction Considerations for pPinka HC Cloning of the secretion signal sequences and the gene of interest into pPinka HC This section provides detailed protocols for preparing the pPinka HC vector and the insert containing your gene of interest The following considerations apply
50. elow and centrifuging at maximum speed in a microcentrifuge for 2 3 minutes at room temperature You will use these samples to analyze expression levels and determine the optimal time post induction to harvest Time points hours 0 6 12 24 1 day 36 48 2 days 60 72 3 days 84 and 96 4 days Analyzing Protein Expression by SDS PAGE Introduction Polyacrylamide Gel Electrophoresis Preparing Cell Pellets Intracellular and Secreted Expression This section provides guidelines to prepare and analyze your samples using SDS polyacrylamide gel electrophoresis Invitrogen offers a wide range of pre cast NuPAGE and Tris Glycine polyacrylamide gels and electrophoresis apparatus The patented NuPAGE Gel System avoids the protein modifications associated with Laemmli type SDS PAGE ensuring optimal separation for protein analysis In addition Invitrogen carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use refer to our website www invitrogen com or contact Technical Support see page 73 If you are pouring your own gels note that any standard SDS PAGE apparatus and protocol will work For example a 12 polyacrylamide gel with a 5 stacking gel is recommended for proteins ranging in size from 40 100 kDa Refer to standard texts such as Molecular Cloning A Laboratory Manual Sambrook et al 1989 Curr
51. ent Protocols in Molecular Biology Ausubel et al 1994 Guide to Protein Purification Deutscher 1990 or Protein Methods Bollag and Edelstein 1991 for further recommendations You will need to prepare Breaking Buffer see page 64 and have acid washed 0 5 mm glass beads on hand 1 Thaw cell pellets quickly and place on ice 2 For each 1 mL sample add 100 uL Breaking Buffer to the cell pellet and resuspend 3 Addan equal volume of acid washed glass beads size 0 5 um Estimate equal volume by displacement 4 Vortex 30 seconds then incubate on ice for 30 seconds Repeat for a total of 8 cycles 5 Centrifuge at maximum speed for 10 minutes at 4 C Transfer the clear supernatant to a fresh microcentrifuge tube 6 Mix50 ul of the supernatant with 12 5 ul of NuPAGE LDS Sample Preparation Buffer and 7 5 ul of NuPAGE Sample Reducing Agent see page viii 7 Boil for 10 minutes and load 10 20 uL per well Thickness of the gel and number of wells will determine loading volume You may store the remaining sample at 20 C for western blots if necessary You may store the cell lysates at 80 C for further analysis Continued on next page 41 Analyzing Protein Expression by SDS PAGE continued Preparing Supernatant Secreted Expression only Protein Concentration Controls 42 1 Thaw supernatants and place on ice Mix 50 ul of the supernatant with 12 5 ul of NuPAGE LDS Sample Preparation
52. entary strand Recipes Introduction Using Pichia Media The expression of recombinant proteins in Pichia pastoris requires the preparation of several different media However the PichiaPink System uses ade2 complementation as a selection marker for transformants and eliminates special media requirements for antibiotic selection or for determining the Mut phenotype PichiaPink strains are Mut In addition the protease knockout strains help reduce the need for heavy protease inhibitor use This section includes information on the media requirements of the PichiaPink System instructions for reconstituting the media in the PichiaPink Media Kit as well as recipes for additional media used when expressing recombinant proteins in PichiaPink strains For your convenience the PichiaPink Media Kit is included in the PichiaPink Secretion Optimization and PichiaPink Secreted Protein Expression Kits and is also available separately from Invitrogen see page vii for ordering information It contains the following prepackaged media that can easily be reconstituted Medium Description Application YPD Rich complex broth General growth and storage YPDS YPD with sorbitol Recovery of cells after transformation BMGY Buffered complex medium Generating biomass for containing glycerol secreted expression controlling the pH of the medium and decreasing protease activity BMMY Buffered comple
53. entrifuge to separate cells from the supernatant The optimal method will depend on whether you need the supernatant secreted expression or the cells intracellular expression as the source of your protein and what you have available You can load the supernatants directly onto purification columns or concentrate using ultrafiltration Note The methods and equipment listed above are by no means complete The amount of cells or the volume of supernatant will determine what sort of equipment you need We recommend disrupting the cells using glass beads as described in Current Protocols in Molecular Biology Ausubel et al 1994 or Guide to Protein Purification Deutscher 1990 This method may be tedious for large amounts of cells For larger amounts we have found that a microfluidizer works very well French pressing the cells does not seem to work as well as the glass beads or the microfluidizer 53 Appendix PichiaPink Secretion Signal Sequences Introduction a mating factor pre sequence a amylase signal sequence Glucoamylase signal sequence Serum albumin signal sequence 54 TM The secretion signal sequences included in the PichiaPink Secretion Signal Kit are provided as phosphorylated duplex oligomers in 40 pmol aliquots lyophilized in TE Buffer pH 8 The sequence underlined in each signal sequence corresponds to the Kozak sequence taken from the native AOX1 gene Resuspend the duplexes in 40 pL TE
54. es are labeled to indicate the cleavage site The multiple cloning site has been confirmed by sequencing and functional testing The vector sequence of pPink LC is available for downloading at www invitrogen com or from Technical Support see page 73 For a map of pPink LC see page 57 5 end of AOX1 mRNA 801 CCCTGTCTTA AACCTTTTTT TTTATCATCA TTATTAGCTT ACTTTCATAA TTGCGACTGG 5 AOX1 priming site l 861 TTCCAATTGA CAAGCTTTTG ATTTTAACGA CTTTTAACGA CAACTTGAGA AGATCAAAAA EcoR Rsr ll Sphi Stul Kpn Nael Fsel I I I I I I 921 ACAACTAATT ATTCGAAACG GAATTCCGGA CCGGCATGCA GGCCTGGTAC CGGCCGGCCA Swal CYC1 transcription termination region l 981 TTTAAATACA GGCCCCTTTT CCTTTGTCGA TATCATGTAA TTAGTTATGT CACGCTTACA The MCSs of pPink HC and pPink LC differ at the Stu I restriction site When Important propagated in E coli cells that are wild type for Dcm methylation the pPink LC vector cannot be digested with Stu I due to the methylation of residues adjacent to the Stu I recognition sequence However pPink HC vector contains two additional nucleotides on each side of the Stu I recognition sequence in the MCS thus rendering it susceptible to Stu I digestion Continued on next page 18 Cloning into pPink HC and pPink LC continued Restriction Digesting pPink HC and pPink LC Follow the protocol below to digest the pPink HC and pPink LC vectors with EcoR I and an appropriate restriction enzyme i e Rsr IL Sph I Stu I
55. ess poorly from high copy number plasmids and benefit from low copy number expression Always pick white colonies for expression even if you desire low copy number expression e Try intracellular expression The protein may not be processed correctly and fail to secrete Be sure you check your cell pellets for evidence of expression e Scale up to fermentation page 48 Pichia is a yeast and is particularly well suited for growth in fermentors Further fermentation guidelines which provide recommendations for growing Pichia in fermentors are available on our website at www invitrogen com Be sure to try some of the easier things listed on the previous page as no expression can be the same thing as very low expression If none of these things improve protein expression use PCR to check for insertion of your gene into the PichiaPink genome page 64 If your gene is present perform a northern blot analysis to check for transcription of your gene There is a protocol in the Appendix for RNA isolation from PichiaPink see page 71 If you see premature transcriptional termination check the AT content of your gene In Saccharomyces there are a few consensus sequences which promote premature termination One of these TTTTTATA resembles a sequence in HIV 1 gp120 ATTATTTTAT AAA which when expressed in Pichia gave premature termination of the mRNA When this sequence was changed longer transcripts were found Scorer et al 1993
56. etween 24 30 C 1 Initiate a 50 w v glycerol feed containing 12 mL PTM trace salts per liter of glycerol feed see page 64 for recipe Set the feed rate to 5 to 15 mL hr liter initial fermentation volume Carry out glycerol feeding for approximately four hours or longer see note below A cellular yield of 150 to 220 g liter wet cells is typical at the end of this stage while no appreciable recombinant protein is produced Note The level of expressed protein depends on the cell mass generated during the glycerol fed batch phase The length of this feed can be varied to optimize protein yield We recommend a range of 50 to 300 g liter wet cells for study Do not exceed 4 glycerol in the batch phase due to toxicity problems with higher levels of glycerol Continued on next page 51 PichiaPink Fermentation continued Important Guidelines for Methanol Fed Batch Phase Methanol Fed Batch Phase 52 If dissolved oxygen falls below 2076 you should stop the glycerol or methanol feed and wait until the dissolved oxygen spikes before increasing the oxygen rate Once you observe a DO spike you may make adjustments to agitation aeration pressure or oxygen feeding e Do not start the methanol feed until all of the glycerol is consumed to fully induce the AOX1 promoter on methanol However it has been reported that a mixed feed of glycerol and methanol has been successful for expressing recombinant proteins Br
57. f insert with PichiaPink vectors After obtaining the desired recombinant plasmid TM you are ready to transform into PichiaPink Expression Strains One Shot TOP10 Electrocomp E coli Note You may also perform chemical transformation using chemically competent E coli cells Do not use One Shot TOP10 Electrocomp E coli for chemical transformation e Electroporator and cuvettes e g E Shot Standard Electroporation Cuvettes 0 1 cm see page vii e O C medium at room temperature see page vii e 15 mL snap cap tube e g Falcon e LB plates containing 50 100 pg mL ampicillin two for each transformation e 37 C shaking and non shaking incubator Remember to include the vector only and cells only controls to evaluate your experiment The vector only control will indicate whether your vector was adequately cut and or dephosphorylated Since the CIAP reaction is not 100 efficient and because there is often some degradation of the ends there might be a few colonies on this plate The cells only plate should have no colonies at all Use ONLY electrocompetent cells for electroporation to avoid arcing Do not use the One Shot TOP10 chemically competent cells for electroporation 1 Add 4 pL of the ligation reaction from Step 2 page 20 or 25 into a 0 1 cm cuvette see page vii containing 50 ul of One Shot TOP10 Electrocomp E coli and mix gently Do not mix by pipetting up and down Avoid f
58. g Transforming DIN nuin n REDI REESE RA EHE UR Rea PRERA a TIR ERE ERER SRE 29 Preparing PichiaPmk Strains for ElecttOporatiOB eiie ndi aset Ub do a HA M dir eR Pob cte cite 31 Transforming PichiaPink Strains by Electroporation esc as ioannis pides b ael Soin a EE 32 EasyComp Ltanistottdtlott ou usce pute bi pn siepe unius M Das m qM decipi S idee peti aes 34 Expressing Recombinant PichiaPink Strains oss on odo Dea deno ra rate fa uta en eiae 38 Analyzing Protein Expression by SDS PAGE tenete tenente tenente 41 Optimizing PichiaPink Protein Expressioluss s euni qe gene etel en el teste in ome Adin dO sre b cert 44 Proteity Glycosylationa us diesen ettet ap heedtunmo detener tud eer eaae v fesses indus 46 Scaling Up EXptessiOn rete on iim en iet iii eri eie Pese aee teet ri edens tet D lagen 47 Pichi Pink Fermentation e i tede bomo ica aura cu b emt tod e iaaii MN IER NaRa 48 ADDOPODCOaudispadses teat niea del vL EET RYDER FEBR EX LEEVENRY FERMER VN BY GUN BYLNR NES aana da ambra ELENA 54 PichiaPink Secretion Signal Sequences eee petiere reed tete pleex ooi Pied e ddnde dd 54 Map of pPink El canto eet diete thou eie n in d ER HER Eee rb er akt Sth 56 Map oEpPink EC soni eestestibn ad mtenteutboer eost arde tnt 57 Map ot pPinko HG cuisse Red e ttes te em og d hv e dente tbi tf Nae iilii 58 Ca A 59 PCR Analysis of PichiaPink Integrate nob en osse ui b oo UO bare AU capa OD Pu E 65
59. g to grow and manipulate any microorganism Some general references to consult are Guide to Yeast Genetics and Molecular Biology Guthrie amp Fink 1991 Current Protocols in Molecular Biology Ausubel et al 1994 Molecular Cloning A Laboratory Manual Sambrook et al 1989 Protein Methods Bollag and Edelstein 1991 Guide to Protein Purification Deutscher 1990 Recombinant Protein Expression in Pichia pastoris Cregg et al 2000 and Pichia Protocols Methods in Molecular Biology Higgins amp Cregg 1998 PichiaPink Strain 1 is the wild type ade2 knockout Pichia strain The ade2 knockout renders the PichiaPink strain an adenine auxotroph i e it requires an external adenine source for growth These cells are unable to grow on minimal medium or adenine dropout medium and display a slow growth phenotype on rich medium PichiaPink Strain 1 is the parental strain from which the rest of the PichiaPink strains are derived therefore all PichiaPink strains carry the ade2 deletion TM The PichiaPink Strain 2 is a pep4 knockout which prevents it from synthesizing proteinase A a vacuolar aspartyl protease capable of self activation Since proteinase A also plays a role in the subsequent activation of additional vacuolar proteases pep4 knockout strains have a diminished proteinase B activity and lack carboxypeptidase Y activity altogether TM PichiaPink Strain 3 is a prb1 knockout which prevents it from
60. ge Store the YPDS medium at room temperature The shelf life is several months PAD Pichia Adenine Dropout agar lacks adenine and is used for selecting transformants in the PichiaPink system To prepare 1 liter of PAD agar use only one pouch of PAD agar pouch from the PichiaPink Media Kit 1 Dissolve the contents of the PAD agar pouch from the PichiaPink Media Kit in 900 mL of distilled water 2 Autoclave for 20 minutes on liquid cycle 3 Add 100 mL of sterile 20 Dextrose see previous page Store the PAD agar plates at 4 C The shelf life is several months 10X YNB 13 4 Yeast Nitrogen Base with Ammonium Sulfate without amino acids Dissolve 134 g of yeast nitrogen base YNB with ammonium sulfate and without amino acids in 1000 mL of water and filter sterilize Heat the solution to dissolve YNB completely in water Store at 4 C Alternatively use 34 g of YNB without ammonium sulfate and amino acids and 100 g of ammonium sulfate The shelf life of this solution is approximately one year If you are using the YNB pouch included in the kit follow the directions on the pouch Note Pichia cells exhibit optimal growth with higher YNB concentrations therefore the amount of YNB used in this kit is twice as concentrated as YNB formulations for Saccharomyces 50X B 0 02 Biotin Dissolve 20 mg biotin in 100 mL of water and filter sterilize Store at 4 C The shelf life of this solution is approximately one yea
61. gene of interest without using antibiotics by exploiting the adenine auxotrophy of the TM untransformed PichiaPink strains If you prefer to express your gene of interest intracellularly but still wish to utilize the easy selection scheme of the PichiaPink System you may clone your gene in either the pPink LC or the pPink HC vector without the secretion signal provided that you include the yeast consensus sequence and the ATG start codon in your gene of interest These vectors are available in the PichiaPink Secretion Optimization Kit or the PichiaPink Vector Kit see above TM For any PichiaPink strain to grow on minimal media lacking adenine sufficient ADE2 gene product must be expressed from the marker gene on the PichiaPink vector upon transformation and integration into the Pichia genome TM TM All PichiaPink vectors contain the ADE2 marker for selecting PichiaPink transformants without using antibiotics However they express the ADE2 gene product from promoters of different lengths which dictate the copy number of the integrated plasmids see Transformation and Integration next page The pPink LC vector has an 82 bp promoter for the ADE2 marker and is considered to bealow copy plasmid LC while the pPink HC vector has a 13 bp promoter for the ADE2 marker and is considered a high copy plasmid HC In addition the pPink LC and pPink HC vectors also allow you to optimize the secretion of your pro
62. h approximately 1 10 of the initial fermentation volume from the culture generated in the inoculum shake flasks Note that the DO will be close to 10076 before the culture starts to grow As the culture grows it will consume oxygen causing the DO to decrease Be sure to keep the DO above 20 by adding oxygen as needed Grow the batch culture until the glycerol is completely consumed duration of batch depends on inoculum volume and OD This is indicated by a sharp increase in the DO to 10076 Perform sampling at the end of each fermentation stage and at least twice daily Note We take 10 mL samples for each time point then take 1 mL aliquots from this 10 mL sample Analyze samples for cell growth ODeo and wet cell weight pH microscopic purity and protein concentrations or activity Proceed to Glycerol Fed Batch Phase below or freeze the cell pellets and supernatants at 80 C for later analysis A cellular yield of 90 to 150 g liter wet cells is expected for this stage Recombinant protein will not yet be produced due to the absence of methanol Once all the glycerol is consumed from the batch growth phase a glycerol feed is initiated to increase the cell biomass under limiting conditions When you are ready to induce with methanol you can use DO spikes to make sure the glycerol is limited Although we recommend that you carry out the methanol feed at 24 C you may carry out the glycerol fed batch phase at any temperature b
63. he pellet with 80 ethanol air dry and resuspend in 10 ul sterile deionized water Use immediately or store at 20 C TM You may also linearize your PichiaPink vector by cutting it at a unique site within the AOX1 promoter region to promote integration into the PichiaPink genome We recommend using the Pme I restriction enzyme provided that your gene of interest does not contain the Pme I recognition site You can not linearize your PichiaPink vector within the ADE2 gene and use the ADE2 locus for integration because the full ADE2 ORF has been knocked out in the PichiaPink strains as it is used as a nutritional selection marker Preparing PichiaPink Strains for Electroporation TM Introduction This section provides the protocols for generating electrocompetent PichiaPink Strains Use the electrocompetent cells on the same day that you have prepared them Do not store electrocompetent cells as the transformation efficiency decreases dramatically upon storage at 80 C TM Materials Needed Working glycerol stock of PichiaPink Strains see page 13 e YPD media and YPD agar plates see Recipes page 60 e Sterile water ice cold place on ice the day of the experiment e 1M sorbitol sterile and ice cold place on ice the day of the experiment e 125 mL and 1 liter baffled culture flasks sterile e 300 mL centrifuge bottles sterile Protocol Day 1 1 Streak each strain from a working glycero
64. iate PCR parameters For the final extension incubate at 72 C for 10 minutes Store at 4 C DoT Ie e Visualize by agarose gel electrophoresis We strongly recommend that you sequence your construct before transforming into PichiaPink to confirm that gene is in frame with secretion signal sequence Use the sequencing primers included in the kit to sequence your construct e To sequence your construct in pPink HC and pPink LC use the 5 AOX1 and the 3 CYC1 Sequencing Primers e To sequence your construct in pPinka HC use the 5 a factor or the 5 AOX1 and the 3 CYC1 Sequencing Primers Once you have identified the correct clone be sure to purify the colony and make a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colony on LB plates containing 50 100 ug mL ampicillin 2 Isolate a single colony and inoculate into 1 2 mL of LB containing 50 100 ug mL ampicillin Grow until culture reaches stationary phase Mix 0 85 mL of culture with 0 15 mL of sterile glycerol and transfer to a cryovial Store at 80 C Preparing Transforming DNA Introduction Plasmid Preparation Method of Transformation TM At this point you should have your gene cloned into the appropriate PichiaPink vectors Your construct should be correctly fused to the secretion signal sequence and the yeast consensus Kozak sequence Fo
65. ically Competent 10 reactions C4040 10 E coli 20 reactions C4040 03 Platinum PCR SuperMix 100 reactions 11306 016 Platinum Tag DNA Polymerase High Fidelity 100 reactions 11304 011 PureLink PCR Purification Kit 50 preps K3100 01 PureLink Quick Gel Extraction Kit 1 kit K2100 12 PureLink Quick Plasmid Miniprep Kit 50 preps K2100 10 250 preps K2100 11 FastTrack 2 0 mRNA Isolation Kit 1 kit K1593 02 Micro FastTrack 2 0 mRNA Isolation Kit 1 kit K1520 02 T4 DNA Ligase 5 U uL 250 units 15224 041 Ampicillin Sodium Salt irradiated 200 mg 11593 027 Miller s LB Broth Base Luria Broth Base 500g 12795 027 powder Yeast Nitrogen Base 1 pouch 67 g Q300 07 500 g bulk Q300 09 E Shot Standard Electroporation Cuvettes 50 bag P510 50 0 1 cm E Shot Standard Electroporation Cuvettes 50 bag P520 50 0 2 cm S O C Medium 10 x 10 mL 15544 034 Continued on next page vii Accessory Products continued Additional Products continued viii TM Many of the reagents supplied with the PichiaPink kits as well as other products suitable for use with the kits are available separately from Invitrogen Ordering information is provided below Product Amount Cat no UltraPure 20X SSC 1000 mL 15557 044 Pichia EasyComp Kit 20 transformations 1 kit K1730 01 UltraPure Phenol chloroform Isoamyl 100 mL 15593 031 Alcohol 25 24 1 v v PureLink Air Porou
66. ierley et al 1990 Sreekrishna et al 1989 e introduce methanol slowly to adapt the culture to growth on methanol If you add methanol too fast you will kill the cells e Once the culture is adapted to methanol it is very important to use DO spikes to analyze the state of the culture and to take time points over the course of methanol induction to optimize protein expression e Growth on methanol also generates a lot of heat so temperature control at this stage is very important Once the culture is fully adapted to methanol the final feed rate will be limited by the heat and oxygen transfer capacity of the fermentor The feed rates on the next page are suggested values but it is critical that you maintain the DO level above 20 and monitor the methanol limitation by observing DO spikes in response to a brief 10 to 30 seconds shut off of the methanol feed 1 Terminate glycerol feed and initiate induction by starting a 100 methanol feed containing 12 mL PTM trace salts per liter of methanol Set the feed rate to 3 6 mL hr per liter initial fermentation volume Reduce the temperature set point to 24 C 2 During the first 2 3 hours methanol will accumulate in the fermentor and the dissolved oxygen values will be erratic while the culture adapts to methanol Eventually the DO reading will stabilize and remain constant If you cannot maintain the DO level above 20 stop the methanol feed wait for the DO to spike and continue on w
67. ing of these ingredients Filter sterilize as above and use Smash and Grab Mix together the following ingredients to prepare Smash and Grab Buffer for easy Buffer isolation of PichiaPink genomic DNA 10 SDS 5 mL 20 Triton X 100 5mL 4M NaCl 1 25 mL 500 mM EDTA 100 uL 1M Tris pH 8 0 500 pL Water to a final volume of 50 mL Filter sterilize and store at room temperature 64 PCR Analysis of PichiaPink Integrants Introduction PCR Procedure The following protocol is designed to allow you to analyze PichiaPink integrants to determine if the gene of interest has integrated into the genome of your PichiaPink strain Isolate genomic DNA from 6 10 PichiaPink clones using the protocol on page 68 or page 70 After isolating your DNA use the procedure below to identify the integrants Amplification of the gene of interest is carried out either with the 5 AOX1 forward primer pPink HC pPink LC and pPinka HC or the a factor forward primer pPinka HC only paired with the 3 CYC1 reverse primer included in the kit This protocol is useful for confirming integration of the gene of interest but will not provide information on the site of integration A more direct procedure is provided on the next page 1 Setup PCR reactions as follows For amplification controls use 5 10 ng of recombinant plasmid positive control and 5 10 ng of the appropriate plasmid without insert negative control 10X
68. ink Secreted y V Protein Vector Kit PichiaPink Expression 4 y 4 Strain Kit PichiaPink Secretion y y Signal Kit PichiaPink Media Kit 4 y 4 PichiaPink Expression y 4 4 Ni y System Manual Shipping Storage Components of the various PichiaPink Kits are shipped as described below Upon receipt store the components as detailed Item Shipping Storage One Shot TOP10 Electrocomp E coli Dry ice 80 C PichiaPink Expression Strains Dry ice 80 C PichiaPink Vectors Gel ice 20 C Sequencing primers Gel ice 20 C PichiaPink Secretion Signal Sequences Gel ice 20 C PichiaPink Media Pouches Room Room Temperature Temperature iv Continued on next page Kit Contents and Storage continued PichiaPink Vector Kit Components The PichiaPink Vector Kit included in the PichiaPink Secretion Optimization Kit is also available separately from Invitrogen Cat no A11152 Upon receipt store the components as listed below Note pPink LC vector is a low copy number vector LC low copy number whereas pPink HC is a high copy number vector HC high copy number Item Composition Amount Storage One Shot TOP10 Electrocomp E coli 21 x 50 pL 80 C pPink LC vector 40 uL of 0 5 ug uL vector in 20 ug 20 C TE buffer pH 8 0 pPink HC vector 40 uL of 0 5 ug uL vector in 20 ug 20 C TE buffer pH 8 0 5 AOX1 primer 20 pL of 0 5 pg pL v
69. inka HC or the a factor forward primer pPinka HC only paired with the 3 CYCT reverse primer pPink HC pPink LC and pPinka HC included in the kit perform the following PCR procedure 1 Set up a master mix enough for 96 colonies as follows 10X PCR Buffer 275 uL dNTPs 2 5 mM 220 uL 5 forward primer 100 uM 4 5 uL 3 reverse primer 100 uM 4 5 uL Sterile water 1685 uL Taq Polymerase 5 U ul 5uL 2 Mixthe solution and aliquot 20 uL of the master mix into the 96 wells of a PCR plate 3 Using an eight channel pipette add 5 uL of the PichiaPink DNA supernatant to the plate containing the PCR master mix and pipette up and down several times Close the PCR plate with Microplate Adhesive Film 4 Load the thermocycler and run the following program Step Temperature Time Cycle Initial Denaturation 95 C 2 minutes 1X Denaturation 95 C 1 minute Annealing 54 C 1 minute 30X Extension 72 C 1 minute Final Extension 72 C 7 minutes 1X 5 Analyze a 10 pl aliquot by agarose gel electrophoresis 67 Total DNA Isolation from PichiaPink Introduction Solutions Preparation Spheroplasting and Lysis 68 The protocol below allows you to isolate DNA from untransformed as well as recombinant PichiaPink strains The DNA isolated using this protocol is suitable for Southern blot analysis dot slot blot analysis or genomic PCR See Current Protocols in Molecular Biology page
70. ith the same methanol feed rate Increase agitation aeration pressure or oxygen feeding to maintain the DO above 20 only after the accumulated methanol has been consumed as indicated by the DO spike after the feed shut off 3 When the culture is fully adapted to methanol utilization 2 4 hours and is limited on methanol it will have a steady DO reading and a fast DO spike time generally under 30 seconds Maintain the lower methanol feed rate under limited conditions for at least 1 hour after adaptation before doubling the feed Double the feed rate to 7 3 mL hr liter initial fermentation volume 4 After 2 hours at the 7 3 mL hr liter feed rate increase the methanol feed rate to 10 9 mL hr liter initial fermentation volume Maintain this feed rate throughout the remainder of the fermentation Note The supernatant may appear greenish This is normal Continued on next page PichiaPink Fermentation continued Yield Harvesting Cells and Supernatant Cell Lysis The entire methanol fed batch phase lasts approximately 40 70 hours with up to a total of approximately 700 mL methanol fed per liter of initial volume However this may vary for different proteins For small fermentations 1 10 liters you can collect the culture into centrifuge bottles 500 1000 mL and centrifuge to separate the cells from the supernatant For large fermentations you can use large membrane filtration units Millipore or a Sharples c
71. ized plasmid DNA ODoo of PichiaPink cells not in the optimum range Grow cells to ODeoo 1 3 1 6 Incubation time is too short or temperature is too low TM PichiaPink transformations may be incubated for longer periods of time up to 3 hours and at higher temperature 35 37 C before plating This may in some instances result in higher transformation efficiencies Plate incubation time too short ade2 strains grow slowly Transformants can take up to seven days to appear Plasmid linearized in the wrong region TM Linearize the PichiaPink vector containing your gene of interest in either the TRP2 gene or the AOX1 promoter region for integration in PichiaPink strains You cannot use ADE2 locus for integration as the PichiaPink are ade2 knockouts 33 EasyComp Transformation Introduction Materials Needed Preparing Competent Cells 34 TM The Pichia EasyComp Kit produces chemically competent Pichia cells and is included to provide an alternative to electroporation and a rapid convenient method for TM transforming your PichiaPink Strains However the low transformation efficiency of chemically competent Pichia 3 ug plasmid DNA yields about 50 colonies makes it more difficult to screen a large number of integrants for the highest secreted expression levels Note that the cells are prepared differently for electroporation Do not use cells prepar
72. l et al 1994 TM We recommend that you propagate and maintain the PichiaPink vectors and expression constructs in E coli strains that are recombination recA and endonuclease A deficient end A such as TOP10 DH10B DH5a or JM109 For your convenience One Shot TOP10 Electrocomp E coli are included in PichiaPink vector kits For more information on electrocompetent and chemically competent E coli cells available from Invitrogen refer to our website at www invitrogen com or contact Technical Support see page 73 The PichiaPink vectors contain the ampicillin resistance bla gene to allow selection of the plasmid using ampicillin To propagate and maintain the TM PichiaPink vectors we recommend using the following procedure 1 Use the vector in the 0 5 pg pL stock solution supplied with the kit to transform a recA endA E coli strain like TOP10 DH5a JM109 or equivalent 2 Select transformants on LB plates containing 100 ug mL ampicillin Prepare a glycerol stock from each transformant containing plasmid for long term storage see page 28 Continued on next page General Cloning Information continued General Considerations TM The following are some general considerations applicable to all PichiaPink vectors The codon usage in Pichia is believed to be similar to Saccharomyces cerevisiae We highly recommend that you codon optimize your gene of interest during synthesi
73. l stock or stab for single colonies on YPD agar plates Grow at 24 30 C for 3 5 days until colonies form Day 2 2 Inoculate 10 mL of YPD media in a sterile 125 mL baffled flask with a single colony from the YPD agar plate 3 Incubate shaking at 300 rpm at 24 30 C for 1 2 days This is your starter culture Note It is important to have adequate aeration for growth Always use at least a 1 5 ratio of media to flask volume 4 Usethe starter culture to inoculate 100 mL of YPD media in a sterile 1 liter flask to an ODe of 0 2 Grow the culture for 1 2 days at 24 30 C Day 3 or 4 5 Monitor the OD o of the culture until it reaches between 1 3 1 5 log phase growth Transfer cells to a 300 mL centrifuge bottle centrifuge at 1 500 x g at 4 C for 5 minutes Resuspend the pellet with 250 mL of ice cold sterile water 6 Centrifuge the cells as in previous step then resuspend the pellet with 50 mL of ice cold sterile water 7 Centrifuge the cells as in previous step then resuspend the pellet in 10 mL of ice cold 1 M sorbitol 8 Centrifuge the cells as in previous step then resuspend the pellet in 300 uL of ice cold 1 M sorbitol for a final volume of approximately 500 uL Keep the cells on ice and use that day Do not store cells 31 Transforming PichiaPink Strains by Electroporation Introduction Materials Needed Electroporation Protocol Note 32 We recommend electroporation as the method of choice for
74. mL water 2 Autoclave 20 minutes on liquid cycle 3 Cool to room temperature then add the following and mix well 100 mL 1 M potassium phosphate buffer pH 6 0 100 mL 10X YNB 20 mL 50X B 100 mL 10X GY 4 For BMMY add 100 mL 10X M instead of glycerol Store media at 4 C The shelf life of this solution is approximately two months Minimal Glycerol Medium Adenine 1 liter 1 34 YNB 1 glycerol 0 0004 biotin 0 002 Adenine 1 Combine aseptically 800 mL autoclaved water with 100 mL of 10X YNB 20 mL of 50X B and 100 mL of 10X GY 2 For growth of ade2 strains in this medium a version can be made that contains adenine called MGYA by adding 10 mL of 100X A stock solution Store at 4 C The shelf life of this solution is approximately two months Continued on next page Recipes continued MD and MDA MM and MMA Minimal Dextrose Medium Adenine 1 liter 1 34 YNB 0 0004 biotin 2 dextrose 0 002 Adenine 1 2 For medium autoclave 800 mL of water for 20 minutes on liquid cycle Cool to about 60 C and then add 100 mL of 10X YNB 20 mL of 50X B 100 mL of 10X D To make MDA add 10 mL of 100X A stock solution Mix and store at 4 C For plates add 15 g agar to the water in Step 1 and proceed If preparing plates pour the plates immediately MD stores well for several months at 4 C Minimal Methanol Adenine 1 liter 1 34 YNB 0 0004 biotin 0 5 methanol 0 002 Adeni
75. n Optimization Kit allows you to screen multiple signal sequences with your gene of interest in both the low copy vector pPink LC and the high copy vector pPink HC For a list of the PichiaPink secretion signals their sources and sequences see PichiaPink Secretion Signal Sequences on pages 54 55 in the Appendix TM The PichiaPink System offers four ade2 strains for easy selection of transformants containing your gene of interest using adenine auxotrophy These strains differ in their protease knock out genotypes to help reduce the impact of proteases and the need for heavy use of protease inhibitors during protein expression see page 5 for more information We recommend that you perform pilot experiments using all four PichiaPink strains to determine which strain produces the desired amount of your recombinant protein before scaling up expression see Expression and Scale Up page 8 Since the host PichiaPink strain is an ade2 knockout i e full deletion of ADE2 gene only cells that express sufficient ADE2 gene product from the marker gene on the plasmid will grow on minimal medium lacking adenine Regardless of the host PichiaPink strain you will observe both white and slightly pink colonies on your selection plates upon transformation with the pPink HC or the pPinka HC vector The color of the colonies indirectly indicates the relative expression levels of your protein of interest as the color of the colony depen
76. n Expression next page for guidelines to optimize expression If there is no indication of expression at all use PCR to analyze your recombinants for the correctly sized PCR product page 64 If you find that you have recombinants perform a northern analysis to see if and how much full length mRNA is induced See page 71 for an RNA isolation protocol 43 Optimizing PichiaPink Protein Expression Introduction Proteolysis or Degradation Low Secreted Expression Levels 44 Based on available data there is approximately a 50 to 75 chance of expressing your protein of interest in PichiaPink at reasonable levels The biggest hurdle seems to be generating initial success i e expressing your protein at any level While there are a few examples of expression of gt 10 grams liter there are many examples of expression in the gt 1 gram liter range making the Pichia pastoris expression system one of the most productive eukaryotic expression systems available Likewise there are several examples of proteins that have been successfully expressed in Pichia pastoris that were completely unsuccessful in baculovirus or Saccharomyces cerevisiae suggesting that the Pichia pastoris system is an important alternative to have available If you obtain no or low protein expression in your initial expression experiment use the following guidelines to optimize expression TM Although three of the PichiaPink strains have protea
77. ncluding manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way Invitrogen Japan Invitrogen Ltd Carlsbad CA 92008 USA LOOP X Bldg 6F Inchinnan Business Park Tel 1 760 603 7200 3 9 15 Kaigan 3 Fountain Drive Tel Toll Free 1 800 955 6288 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Fax 1 760 602 6500 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 E mail techsupport invitrogen com Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 MSDS Certificate of Analysis Limited Warranty E mail jpinfo invitrogen com E mail eurotech invitrogen com Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds The Certificate of Analysis CofA provides detailed quality control information for each product and is searchable by product lot number which is printed on each box CofAs are available on our website at www invitrogen com support Invitrogen is committed to providing our customers with high quality goods and services Our goal is
78. nd incubate for 1 hour at 37 C 4 Gel purify the digested vectors using the PureLink Quick Gel Extraction Kit see page vii and continue to Ligation Procedure next page RE 2 Kpn I Nae I Fse I or Swa I Continued on next page Cloning into pPinka HC continued Ligation Procedure Follow the protocol below to clone your gene of interest in frame with a mating factor pre sequence into pPinka HC Materials needed T4 DNA Ligase pPinka HC linearized see previous page Insert with gene of interest Procedure 1 Set up a ligation reaction in a 0 5 mL microcentrifuge tube as follows Component Amount 5X ligase buffer 2 pL T4 DNA ligase 0 5 uL pPink HC or pPink LC 4 fmol 1 pL at 20 ng uL Gene of interest 12 20 fmol 1 pL at 10 20 ng uL Sterile water to 10 pL 2 Mix gently centrifuge briefly and incubate at 25 C for 1 2 hours or at 16 C overnight 3 Proceed to Transforming E coli Cells next page 25 Transforming E coli Cells Introduction Materials Needed Transformation protocol 26 TM After you have ligated your insert and the PichiaPink Secretion Signal duplex into the appropriate PichiaPink vector you need to transform electrocompetent E coli with your ligation reaction and analyze the transformants for the presence and orientation of your insert There is no blue white screening for the presence o
79. nd the ATG start codon in your gene of interest The following considerations apply only to pPink HC and pPink LC For a detailed protocol to clone your gene of interest and the secretion signal sequence into pPink HC or pPink LC see page 19 e Cloning of the secretion signal sequences and the insert i e the gene of interest into pPink HC and pPink LC vectors is a three way ligation To achieve a high efficiency of cloning you must closely follow the instructions for preparing the vector and the insert see next page for more information e For the three way ligation the pPink LC and pPink HC vectors must be digested with EcoR I and an appropriate restriction enzyme that cuts within the multiple cloning site MCS downstream of EcoR I e g Rsr IL Sph I Stu I Kpn 1 Nae I Fse Lor Swa I This double digestion creates compatible ends to the 5 EcoR I end of the signal sequence and the 3 end of the insert containing your gene of interest e The insert containing your gene of interest must have a phosphorylated 5 blunt end most easily accomplished by adding an Mly I site After the stop codon your insert must have 3 end that is compatible to the restriction enzyme used to cut the vector downstream of the EcoR I site Make sure that your gene of interest does not contain internal restriction sites for this enzyme and Mly I Note If your gene of interest contains internal sequences recognized by Mly I and the enzyme used
80. ne 1 2 For medium autoclave 800 mL of water for 20 minutes on liquid cycle Cool autoclaved water to 60 C and add 100 mL of 10X YNB 20 mL of 50X B 100 mL of 10X M To make MMA add 10 mL of 100X A stock solution Mix and store at 4 C For plates add 15 g agar to the water in Step 1 and proceed After mixing pour the plates immediately MM and MMA stores well for several months at 4 C Continued on next page 63 Recipes continued Breaking Buffer 50 mM sodium phosphate pH 7 4 1 mM PMSF phenylmethylsulfonyl fluoride or other protease inhibitors 1mM EDTA 5 glycerol 1 Prepare a stock solution of your desired protease inhibitors and store appropriately Follow manufacturer s recommendations 2 For 1 liter dissolve the following in 900 mL deionized water 6 g sodium phosphate monobasic 372 mg EDTA 50 mL glycerol Use NaOH to adjust pH and bring up the volume to 1 liter Store at 4 C Right before use add the protease inhibitors PTM Trace Salts Mix together the following ingredients to prepare PTM Trace Salts for PichiaPink fermentation Cupric sulfate 5H O 6 0g Sodium iodide 0 08 g Manganese sulfate H O 3 0g Sodium molybdate 2H O 0 2g Boric Acid 0 02 g Cobalt chloride 0 5g Zinc chloride 20 0 g Ferrous sulfate 7H O 65 0 g Biotin 0 2 g Sulfuric Acid 5 0 mL Water to a final volume of 1 liter Filter sterilize and store at room temperature Note There may be a cloudy precipitate upon mix
81. not experimentally shown for Pichia pastoris ADE2 expression is thought to be regulated in a similar manner In Saccharomyces cerevisiae Pichia pastoris and other yeast strains mutations in ADE2 lead to the accumulation of purine precursors in the vacuole which causes the colony to be red in color The pigmentation phenotype can be used as a tool for selection and screening Jones amp Fink 1982 Zonneveld amp van der Zanden 1995 In addition ade2 mutants are adenine auxotrophs that are unable to grow on medium lacking adenine and have a slow growth phenotype on rich medium TM The strains in the PichiaPink kits are ade2 auxotrophs that are unable to grow in the absence of adenine due to the full deletion of the ADE2 gene and part of its promoter The expression plasmids included in the kit contain the ADE2 gene under its own promoter as the selection marker Transformation of the PichiaPink strains with the expression plasmids enable the strain to grow again on medium lacking adenine Ade dropout medium or minimal medium Jones amp Fink 1982 Zonneveld amp van der Zanden 1995 Further the color of the transformant colonies indirectly indicates the relative expression levels of your protein of interest see Transformation and Integration page 7 Continued on next page Overview continued Posttranslational Modifications Secretory Protein Expression In comparison to Saccharomyces cerevisiae Pichia may h
82. nt genes in Pichia Pichia pastoris is a methylotrophic yeast capable of metabolizing methanol as its sole carbon source The first step in the metabolism of methanol is the oxidation of methanol to formaldehyde using molecular oxygen by the enzyme alcohol oxidase In addition to formaldehyde this reaction generates hydrogen peroxide To avoid hydrogen peroxide toxicity methanol metabolism takes place within a specialized cell organelle called the peroxisome which sequesters toxic by products away from the rest of the cell Alcohol oxidase has a poor affinity for O2 and Pichia pastoris compensates by generating large amounts of the enzyme The promoter regulating the production of alcohol oxidase is the one used to drive the expression of your TM heterologous protein of interest in the PichiaPink System AOX1 is one of the two genes in Pichia pastoris that code for alcohol oxidase the other being AOX2 The majority of alcohol oxidase activity in the cell is attributable to the product of the AOX1 gene Expression of the AOX1 gene is tightly regulated and induced by methanol to very high levels typically gt 30 of the total soluble protein in cells grown with methanol The AOX1 gene has been isolated and a plasmid borne version of the AOX1 promoter is used to drive expression of the gene of interest encoding the desired heterologous protein in the PichiaPink System Ellis et al 1985 Koutz et al 1989 Tschopp et al 19872
83. ntiate your protein from background especially if you express your protein intracellularly In addition to Coomassie stained SDS PAGE we strongly recommend that you perform a western blot or another more sensitive assay to detect your protein Visualization of the expressed protein will depend on several factors including its expression level its solubility its molecular weight and whether it will be masked by an abundant cellular protein of the same size Western blot analysis enzymatic activities or a defined purification profile if available may help to identify the expressed protein among the native PichiaPink cellular proteins Continued on next page Analyzing Protein Expression by SDS PAGE continued Analysis of Protein Expression Inspection of your Coomassie stained SDS PAGE should reveal the secreted expression level of your protein of interest co migrating with your standard If you have performed time course experiments you will also know the induction of your protein over time If you are satisfied with the level of expression try a test purification using your method of choice or proceed to scale up expression page 47 If there is no recombinant protein visible silver stain your gel or perform a western blot We also recommend that you perform a functional assay if one is available for your protein of interest If you detect low expression of your recombinant protein see Optimizing PichiaPink Protei
84. nued General Characteristics of Pichia pastoris Similarity to Saccharomyces Pichia pastoris as a Methylotrophic Yeast AOX1 gene As a eukaryote Pichia pastoris has many of the advantages of higher eukaryotic expression systems such as protein processing protein folding and the availability of posttranslational modifications while being as easy to manipulate as E coli or Saccharomyces cerevisiae It is faster easier and less expensive to use than other eukaryotic expression systems and generally gives higher expression levels As a yeast Pichia shares the advantages of molecular and genetic manipulations with Saccharomyces and it has the added advantage of 10 to 100 fold higher heterologous protein expression levels These features make Pichia very useful as a protein expression system Many of the techniques developed for Saccharomyces may be applied to Pichia pastoris These include e transformation by complementation e gene disruption e gene replacement In addition the genetic nomenclature used for Saccharomyces has been applied to Pichia For example histidinol dehydrogenase is encoded by the HIS4 gene in both Saccharomyces and Pichia There is also cross complementation between gene products in both Saccharomyces and Pichia Several wild type genes from Saccharomyces complement comparable mutant genes in Pichia pastoris Genes such as ADE2 HIS4 LEU2 ARG4 TRP1 and URA3 all complement their respective muta
85. of your protein of interest you are ready to scale up your expression protocol to produce more protein Pichia pastoris like Saccharomyces cerevisiae is particularly well suited for growth in fermentors Pichia has the ability to reach very high cell densities during fermentation which may improve overall protein yields Use the guidelines below for growing your TM transformed PichiaPink strains in fermentors We recommend that only those with fermentation experience or those who have access to people with experience attempt fermentation Since there are a wide variety of fermentors available it is difficult to provide exact procedures for your particular case Read the operator s manual for your particular fermentor before beginning It is important to monitor and control the following parameters throughout the fermentation process The following table describes the parameters and the reasons for monitoring them Parameter Reason Temperature 24 30 C Growth above 32 C is detrimental to protein expression Dissolved oxygen gt 20 Pichia needs oxygen to metabolize glycerol and methanol pH 5 0 6 0 Important when secreting protein into the medium and for optimal growth Agitation 500 to 1 500 rpm Maximizes oxygen concentration in the medium Aeration 0 1 to 1 0 vvm for Maximizes oxygen concentration in the medium glass fermentors which depends on the vessel Antifoam the minimum
86. olic rate indicates how healthy the culture is For example changes in the DO concentrations allow you to determine whether all the glycerol is consumed from the culture before adding methanol Secondly inducing DO spikes ensures that your methanol feed does not exceed the rate of consumption Excess methanol may be toxic If carbon is limiting shutting off the carbon source should cause the culture to decrease its metabolic rate and the DO to rise spike Terminate the carbon feed and time how long it takes for the DO to rise 10 after which turn the carbon feed back on If the lag time is short 1 minute the carbon source is limiting Continued on next page 49 PichiaPink Fermentation continued Proteases Recommended Equipment Inoculum Seed Flask Preparation 50 Proteases are known to be secreted into the medium during Pichia fermentations which can result in the degradation of the desired protein product Although protease inhibitors can be added to the medium during fermentation the cost to do so can be significant To help reduce the impact of proteases and the need for heavy protease inhibitor use PichiaPink System offers three protease knockout strains along with a protease wild type strain Below is a checklist for equipment recommendations e A jacketed vessel is needed for cooling the yeast during fermentation especially during methanol induction You will need a constant source of cold
87. optimized secreted expression of your protein of interest you are ready to scale up your expression protocol to produce more protein You may do this by increasing the culture volume using larger baffled flasks below or fermentation See PichiaPink Fermentation next page for recommendations for growing Pichia in fermentors Use the guidelines below to scale up your expression protocol To purify your protein use your method of choice p Using a single colony inoculate 25 mL of BMGY in a 250 mL baffled flask Grow at 24 30 C in a shaking incubator 250 300 rpm until culture reaches an OD600 of 2 6 approximately 2 3 days 2 Use this 25 mL culture to inoculate 1 liter of BMGY in a 3 or 4 liter baffled flask and grow at 24 30 C with vigorous shaking 250 300 rpm until the culture reaches log phase growth ODs 2 6 3 Harvest the cells by centrifuging in sterile centrifuge bottles at 1 500 3 000 x g for 5 minutes at room temperature To induce expression decant the supernatant and resuspend the cell pellet in 200 mL of BMMY medium Note The resuspension step above concentrates the culture 5 fold thereby reducing the need for concentrating the secreted proteins if the expression level is not particularly high see below 4 Aliquot the culture between two 1 liter baffled flasks Cover the flasks with PureLink Air Porous Tape see page vii 2 layers of sterile gauze or cheesecloth and return to incubator Continue to gro
88. ormants on the other hand are selected using nutritional markers Continued on next page 29 Preparing Transforming DNA continued Restriction Digest Note 30 Follow the protocol below to digest your PichiaPink construct with the appropriate restriction enzyme The restriction enzymes listed below are unique cutters within the TRP2 region of PichiaPink vectors and as such integration of the linearized TM vector can only occur at the TRP2 locus of the PichiaPink strain Materials needed Restriction enzyme that does not cut within your gene e g one of Mam I EcoN I Spe I or Afl TI 100 and 80 ethanol 3M sodium acetate Optional Phenol chloroform isoamyl alcohol 25 24 1 v v v Procedure 1 Digest 5 10 ug of plasmid DNA with one of the restriction enzymes listed below Each enzyme cuts one time in the TRP2 region to linearize the PichiaPink vectors Choose an enzyme that does not cut within your gene e g one of Mam I EcoN I Spe I or Afl II 2 We recommend that you check a small aliquot of your digest by agarose gel electrophoresis for complete linearization 3 Ifthe vector is completely linearized heat inactivate or add EDTA to stop the reaction Optional You may also phenol chloroform extract your linearized vector once 4 Ethanol precipitate the digest using 1 10 volume of 3 M sodium acetate and 2 5 volumes of 100 ethanol 5 Centrifuge the solution to pellet the DNA wash t
89. ormation of bubbles Note Other electrocompetent recA endA E coli strains are also suitable 2 Blectroporate your samples using your own protocol and your electroporator Note If you have problems with arcing see below Immediately add 250 ul of room temperature S O C medium 4 Transfer the solution to a 15 mL snap cap tube and shake for at least 1 hour at 37 C to allow expression of the antibiotic resistance gene Procedure continued on next page Continued on next page Transforming E coli Cells continued Transformation protocol continued High throughput E coli Transformation Analyzing Positive Clones Procedure continued from previous page 5 Spread 50 100 uL from each transformation on a prewarmed LB plate containing 50 100 pg mL ampicillin and incubate overnight at 37 C We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies Note You may save the remainder of your transformation mix at 4 C If you do not get transformants or very few transformants you may then plate out the remainder of the transformation mix onto LB ampicillin plates 6 Pick 8 10 colonies for analysis see Analyzing Positive Clones or Analyzing Transformants by PCR next page To prevent arcing of your samples during electroporation the volume of cells should be between 50 and 80 ul 0 1 cm cuvettes or 100 to 200 ul 0 2 cm cuvettes If you experience arcing du
90. otein of interest in an unbuffered medium MMA If there is no evidence that your secreted protein of interest is susceptible to proteases at neutral pH we recommend you do your initial expressions in BMMY If the expressed protein is degraded expression in an unbuffered medium may then be tried TM The most important parameter for efficient expression in a PichiaPink strain is adequate aeration during methanol induction As a general rule never allow cultures to be more than 10 30 of your total flask volume when inducing expression We strongly recommend that you use baffled flasks Cover the flasks with porous tape such as PureLink Air Porous Tape see page vii or another loose fitting cover Never use tight fitting covers Aeration is not as critical when generating biomass before induction TM While recombinant PichiaPink strains expressing ADE2 gene product grow unhindered in rich and minimal media untransformed strains i e ade2 knockouts grow slowly in rich and minimal medium This slow growth phenotype ensures that virtually all PichiaPink cells in the medium express the protein interest because revertants cannot compete with and outgrow the desired production strain All expression is done at 30 C in a shaking incubator It is critical that the temperature does not exceed 30 C If your incubator temperature fluctuates set the temperature at 28 C Shake at 225 250 rpm if using a floor shaking incubator
91. out centrifuge insert Continued on next page EasyComp Transformation continued Troubleshooting The table below provides solutions to possible problems you may encounter when preparing and transforming competent PichiaPink cells using the Pichia TM EasyComp Kit Problem Probable Cause Possible Solution Low efficiency of transformation The pH of Solution I or Solution III may have drifted The pH of both solutions Check the pH of Solutions I and III If the pH is low increase it by adding NaOH If the pH is high decrease it by adding HCI Store should be 8 0 solutions at 4 C in order to minimize drift in pH Transformation Be sure to mix the transformation reaction not mixed during incubation reaction every 15 minutes throughout the 1 hour incubation at 30 C Vortexing works best Incubation time is too short or temperature is too low TM PichiaPink transformations may be incubated for longer periods of time up to 3 hours and at higher temperature 35 37 C This may in some instances result in higher transformation efficiencies Cell density is too low OD600 lt 0 6 Resuspend cells from Preparing Competent Cells Step 6 page 34 in a smaller volume i e 500 uL 37 Expressing Recombinant PichiaPink Strains Introduction Pilot Expression Detecting Recombinant Proteins in PichiaPink TM You should now have several
92. r 100X A 0 2 Adenine Dissolve 200 mg of L adenine in 100 mL of water Heat the solution if necessary to no greater than 50 C in order to dissolve Filter sterilize and store at 4 C The shelf life of this solution is approximately one year 10X D 20 Dextrose Dissolve 200 g of D glucose in 1000 mL of water Autoclave for 15 minutes or filter sterilize The shelf life of this solution is approximately one year Continued on next page 61 Recipes continued Stock Solutions continued BMGY and BMMY MGY and MGYA 62 10X M 5 Methanol Mix 5 mL of methanol with 95 mL of water Filter sterilize and store at 4 C The shelf life of this solution is approximately two months 10X GY 10 Glycerol Mix 100 mL of glycerol with 900 mL of water Filter sterilize or autoclave Store at room temperature The shelf life of this solution is greater than one year 1M potassium phosphate buffer pH 6 0 Combine 132 mL of 1 M K HPO 868 mL of 1 M KH PO and confirm that the pH is 6 0 0 1 if the pH needs to be adjusted use phosphoric acid or KOH Sterilize by autoclaving and store at room temperature The shelf life of this solution is greater than one year Buffered Glycerol complex Medium and Buffered Methanol complex Medium 1 liter 1 yeast extract 2 peptone 100 mM potassium phosphate pH 6 0 1 34 YNB 0 0004 biotin 1 glycerol or 0 5 methanol 1 Dissolve 10 g of yeast extract 20 g peptone in 700
93. r the next step in your PichiaPink experiments you will purify plasmid DNA and linearize the plasmid DNA prior to transformation and selection in PichiaPink Strains We recommend that you prepare enough plasmid DNA to transform all four PichiaPink Strains to enable you choose the best strain for your large scale secreted expression Once you have cloned and sequenced your insert generate enough plasmid DNA to transform PichiaPink Strains 5 10 ug of each plasmid per each transformation We recommend the PureLink Quick Plasmid Miniprep Kit for quick purification of pure plasmid DNA see page vii Once you have purified plasmid DNA proceed to Preparing PichiaPink Strains for Electroporation page 30 We recommend electroporation or chemical methods for transforming PichiaPink Strains with PichiaPink vectors Electroporation yields 10 to 10 transformants per ug of linearized DNA and does not destroy the cell wall of Pichia If you do not have access to an electroporation device use the EasyComp procedure on page 33 In contrast with Pichia systems that rely on antibiotic resistance markers for selection you may also use spheroplasting for transforming PichiaPink Strains Spheroplasting involves removal of the cell wall to allow DNA to enter the cell When antibiotic resistance markers are used cells must first regenerate the cell wall before they are able to express the resistance gene PichiaPink transf
94. ring transformation try one of the following suggestions e Reduce the voltage normally used to charge your electroporator by 10 e Reduce the pulse length by reducing the load resistance to 100 ohms e Ethanol precipitate the ligation reaction and resuspend in water prior to electroporation We recommend using chemical transformation for high throughput applications such as cloning multiple secretion signal sequences You can use 96 well plates and multi channel pipettors to perform your ligation reactions and then directly transfer ligation mixtures into a new 96 well plate containing chemically competent cells You can perform the heat shock step and subsequent incubation in a water bath heat block or thermocycler set to the appropriate temperature gt Pick 8 10 colonies from each transformation and culture them overnight in LB medium containing 50 100 pg mL ampicillin 2 Isolate plasmid DNA using your method of choice We recommend using the PureLink Quick Plasmid Miniprep Kit see page vii 3 Analyze the plasmids by restriction analysis to confirm the presence and correct orientation of the insert Use a restriction enzyme or a combination of enzymes that cut once in the vector and once in the insert 4 Alternatively you may colony PCR 8 10 colonies directly from the selection plate for the presence of the insert see next page 5 You should isolate plasmid DNA from positive colonies and sequence to confirm p
95. ris Mol Cell Biol 5 1111 1121 Gedvilaite A and Sasnauskas K 1994 Control of the expression of the ADE2 gene of the yeast Saccharomyces cerevisiae Curr Genet 25 475 479 Gerngross T U 2004 Advances in the production of human therapeutic proteins in yeasts and filamentous fungi Nat Biotechnol 22 1409 1414 Gleeson M A White C E Meininger D P and Komives E A 1998 Generation of protease deficient strains and their use in heterologous protein expression Methods Mol Biol 103 81 94 Grinna L S and Tschopp J F 1989 Size Distribution and General Structural Features of N Linked Oligosaccharides from the Methylotrophic Yeast Pichia pastoris Yeast 5 107 115 Guthrie C and Fink G R eds 1991 Guide to Yeast Genetics and Molecular Biology Vol 194 Methods in Enzymology Edited by Abelson J N and Simon M I Academic Press San Diego CA Hamilton R Watanabe C K and de Boer H A 1987 Compilation and comparison of the sequence context around the AUG startcodons in Saccharomyces cerevisiae mRNAs Nucleic Acids Res 15 3581 3593 Hamilton S R Bobrowicz P Bobrowicz B Davidson R C Li H Mitchell T Nett J H Rausch S Stadheim T A Wischnewski H Wildt S and Gerngross T U 2003 Production of complex human glycoproteins in yeast Science 301 1244 1246 Hamilton S R and Gerngross T U 2007 Glycosylation engineering in yeast the advent of fully humanized ye
96. roper insertion of the signal sequence and gene of interest Continued on next page 27 Transforming E coli Cells continued Analyzing Transformants by PCR Sequencing Recombinant Clones Long Term Storage 28 Alternatively you may analyze positive transformants for the presence of your insert using colony PCR For pPink HC and pPink LC use a combination of the 5 AOXI or the 3 CYCT primer and a primer that hybridizes within your insert For pPinka HC use a combination of the 5 a factor or the 3 CYC1 primer and a primer that hybridizes within your insert You will need to determine the amplification conditions If you are using this technique for the first time we recommend performing restriction analysis in parallel Artifacts may be obtained because of mispriming or contaminating template The protocol below is provided for your convenience Other protocols are also suitable e g high throughput 96 well Materials Needed Platinum PCR SuperMix see page vii Appropriate forward and reverse PCR primers 20 uM each Procedure 1 For each sample aliquot 48 ul of Platinum PCR SuperMix into a 0 5 mL microcentrifuge tube Add 1 ul each of the forward and reverse PCR primer 2 Pick 8 10 colonies and resuspend them individually in 50 ul of the PCR cocktail from Step 1 above Incubate reaction for 10 minutes at 94 C to lyse cells and inactivate nucleases Amplify for 20 to 30 cycles using the appropr
97. roteases and the need for heavy protease inhibitor use during expression as well as a protease wild type strain e ADE2 complementation ensures higher stability of transformants during scale up of protein expression e Choice between the pPinka HC vector containing Saccharomyces cerevisiae a mating factor pre sequence for high copy number secreted protein expression or the pPink HC and pPink LC vectors for high and low copy number expression respectively and eight secretion signal sequences for optimization of secreted protein expression e Optional intracellular protein expression using the pPink HC and pPink LC vectors by omitting the secretion signal sequences at the cloning step TM e Simpler media growth conditions for screening and convenient PichiaPink media pouches The information presented here is designed to give you a concise overview of the Pichia pastoris expression system It is by no means exhaustive For further information read the articles cited in the text along with the following review articles Buckholz amp Gleeson 1991 Cregg et al 2000 Cregg amp Higgins 1995 Cregg et al 1993 Daly amp Hearn 2005 Higgins amp Cregg 1998 Li et al 2007 Macauley Patrick et al 2005 Nico Farber et al 1995 Sreekrishna et al 1988 Wegner 1990 General reviews of foreign gene expression in yeast is also available Romanos 1995 Romanos et al 1992 Continued on next page Overview conti
98. rovided as lyophilized duplex oligomers in 40 pmol aliquots with the PichiaPink Secretion Optimization Kit They are also available separately as a stand alone set from Invitrogen see page vii for ordering information For the list of the PichiaPink secretion signals their sources and sequences see PichiaPink Secretion Signal Sequences on pages 54 55 in the Appendix Continued on next page Overview continued Protease Knock outs prb1 and pep4 Proteases are known to be secreted into the medium during Pichia fermentations which can result in the degradation of the desired protein product Although protease inhibitors can be added to the medium during fermentation the cost to do so can be significant Some of the proteolytic activities of Pichia have been characterized Proteinase A encoded by the PEP4 gene is a vacuolar self activating aspartyl protease involved in the subsequent activation of additional vacuolar proteases such as proteinase B and carboxypeptidase Y Although the precursor to proteinase B encoded by the PRB1 gene displays approximately 50 activity compared to its proteinase A processed mature form carboxypeptidase Y shows an absolute requirement for proteinase A mediated proteolytic processing for activity Gleeson et al 1998 To help reduce the impact of proteases and the need for heavy protease inhibitor use PichiaPink System offers three protease knockout strains along with the prote
99. rter culture to an OD6eo0 of 0 2 Grow shaking for 1 2 days at 24 30 C to an OD of 2 3 Day 3 or 4 3 Harvest the cells by centrifuging at 1 500 x g for 5 minutes Remove the supernatant and resuspend the cells in YPD medium containing 2576 glycerol to a final OD of 50 100 approximately 2 5 5 0 x 10 cells mL 4 Aliquot the cells in cryovials 1 mL aliquots and freeze in liquid nitrogen or a dry ice ethanol bath and store at 80 C Cells will be pink in color TM Although transformed PichiaPink strains are very stable we recommend that you check your cells for correct phenotype and protein expression after extended storage at 4 C or 80 C 13 General Cloning Information Introduction General Molecular Biology Techniques E coli Strain Maintaining Plasmids 14 TM Before cloning your gene into one of the PichiaPink vectors review the information and guidelines presented below If you are cloning into pPinka HC you must clone your gene of interest in frame with the a mating factor pre sequence The multiple cloning sites of PichiaPink vectors are presented on page 18 pPink HC and pPink LC and on page 23 pPinka HC to help you develop a cloning strategy For assistance with E coli transformations restriction enzyme analysis DNA biochemistry and plasmid preparation refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausube
100. s and choose the best PichiaPink strain secretion signal and vector combination 1 Using a single colony inoculate 10 mL of BMGY medium in a 125 mL baffled flask Grow the cells for 1 2 days at 24 30 C in a shaking incubator set to 250 300 rpm 2 Transfer the cells to 50 mL conical tubes and centrifuge at 1 500x g for 5 minutes at room temperature Decant the BMGY supernatant and resuspend the cell pellet in 1 mL of BMMY medium to induce expression Note Make sure to replace the caps of the tubes with porous tape to maximize aeration 3 Return the cells in BMMY medium to the 30 C shaking incubator to continue growth overnight 4 The next day remove 100 uL from the sample for gel analysis and add 100 uL of 40 methanol Continue to grow the cells overnight in the 30 C shaking incubator set to 300 rpm 5 Harvest the cells by centrifuging for 10 minutes at 1 500 x g 6 Transfer the supernatant to a separate tube and store both the supernatant and the cell pellet at 80 C until ready to assay Freeze quickly in liquid N or a dry ice alcohol bath 7 Analyze the supernatants and cell pellets for protein expression by Coomassie or Silver stained SDS PAGE and western blot or functional assay see Analysis by SDS Polyacrylamide Gel Electrophoresis next page If you wish to determine the induction profile of you protein over time you may collect 100 uL samples of the expression culture at each of the times indicated b
101. s Length 16 aa MW 1647 0 Da Nucleotide sequence of oligo 1 AATTCGAAACGATGAAGTTAGCATACTCCTTGTTGC Complement nucleotide sequence of oligo 2 TCCATTGGCAGGAGTCAGTGCT AGCACTGACTCCTGCCAATGGAAGCAACAAGGAGTATGCTAACTTCATCGT TCG Source Saccharomyces cerevisiae Length 19 aa MW 2025 5 Da Nucleotide sequence of oligo 1 AATTCGAAACGATGCTTTTGCAAGCTTTCCTTTTCCTTTTGGCTGG Complement nucleotide sequence of oligo 2 TGCAGATATTTTGGC TTTGCAGCCAAAATATCTGCA GCAAAACCAGCCAAAAGGAAAAGGAAAGCTTGCAAAAGCATCGTTTCG Source Saccharomyces cerevisiae Length 26 aa MW 2926 6 Da Nucleotide sequence of oligo 1 AATTCGAAACGATGACTAAGCCAACCCAAGTATTAGTTAGATCCGTCAGTATATTATTTTTCATCACA TTACTACATCTAGTCGTAGCT Complement nucleotide sequence of oligo 2 AGCTACGACTAGA GCTTAGTCATCGT TCG GTAGTAATGTGATGAAAAATAATATACTGACGGATCTAACTAATACTTGGGTTG Source Gallus gallus Length 26 aa MW 2686 4 Da Nucleotide sequence of oligo 1 AATTCGAAACGATGCTGGGTAAGAACGACCCAATGTGTCTTGTTTTGGTCTTGTTGGGATTGACTGCT TIGTTGGGTATCTGTCAAGGT Complement nucleotide sequence of oligo 2 ACC TACCCAGCATCGTTTCG GACAGATACCCAACAAAGCAGT CAAT CCCAACAAGACCAAAACAAGACACATTGGGTCGTTCT 55 Map of pPink HC Map of pPink HC 56 pPink HC 7667 bp is a PichiaPink expression vector containing the full length Pichia pastoris ADE2 gene product driven by a truncated 13 bp ADE2 promoter
102. s 13 11 1 to 13 11 4 Ausubel et al 1994 Guide to Yeast Genetics and Molecular Biology pages 322 323 Strathern and Higgins 1991 or Holm et al 1986 You will need to make the following solutions e YPD medium see Recipes page 60 e Sterile water e SCED 1M sorbitol 10 mM sodium citrate pH 7 5 10 mM EDTA 10 mM DTT e Zymolyase 3 mg mL stock solution in water Seikagaku America Inc 1 800 237 4512 e 1 SDS see page vii e 5M potassium acetate pH 8 9 e TE buffer pH 7 4 10 mM Tris HCl pH 7 4 1 mM EDTA pH 8 0 e 7 5 M ammonium acetate pH 7 5 e Phenol chloroform 1 1 v v 1 Grow at 30 C the recombinant strain and the parent strain to an ODeo of 5 10 in 10 mL of YPD medium 2 Collect the cells by centrifugation at 1 500 x g for 5 10 minutes at room temperature 3 Wash the cells with 10 mL sterile water by centrifugation as in Step 2 1 Resuspend the cells in 2 mL of SCED buffer pH 7 5 Make this solution fresh 2 Add0 1 0 3 mg of Zymolyase mix well before adding to the cells Incubate at 37 C for 50 minutes to achieve 8076 spheroplasting Add 2 mL of 1 SDS mix gently and set on ice 0 to 4 C for 5 minutes 4 Add 1 5 mL of 5 M potassium acetate pH 8 9 and mix gently Centrifuge at 10 000 x g for 5 10 minutes at 4 C and save the supernatant Continued on next page Total DNA Isolation from PichiaPink continued DNA Precipitation 1 Transfer the supernat
103. s Tape 50 pieces 12262 010 NuPAGE LDS Sample Preparation Buffer 10 mL NP0007 4X 250 mL NP0008 NuPAGE Sample Reducing Agent 10X 250 pL NP0004 10 mL NP0009 NuPAGE Novex 4 12 Bis Tris Gels 1 box 10 gels NP0321BOX SimplyBlue Safe Stain 1000 mL LC6060 SilverXpress Silver Staining Kit 1 kit LC6100 UltraPure 10 SDS Solution 4 x 100 mL 15553 027 RNAse A 20 mg mL 10 mL 12091 021 25 mL 12091 039 Proteinase K 5mL 25530 049 TE Buffer 20X RNAse free 100 mL T11493 Water distilled 500 mL 15230 162 Pichia Protocols Methods in Molecular 1 book G100 01 Biology Overview Introduction PichiaPink System Review Articles Introduction TM The PichiaPink System is a eukaryotic protein expression system based on the eukaryote Pichia pastoris which can be used for high level g liter and large scale 1000 liter production of secreted recombinant proteins This section provides general information on Pichia pastoris and the PichiaPink System TM The PichiaPink System offers the following advantages over existing Pichia pastoris based protein expression systems e Easy selection of expression clones using ADE2 complementation i e complementation of adenine auxotrophy rather than antibiotic resistance TM e Essentially all transformants in the PichiaPink system express the protein of interest TM e Three protease knockout PichiaPink strains to help reduce the impact of p
104. s or filter sterilize Store at room temperature The shelf life of this solution is approximately one year YPD medium is used for growing PichiaPink strains prior to transformation To prepare 1 liter of YPD use only one pouch of YP from the PichiaPink Media Kit 1 Dissolve the contents of the YP pouch from the PichiaPink Media Kit in 900 mL of distilled water 2 Autoclave for 20 minutes on liquid cycle 3 Add 100 mL of sterile 20 Dextrose see above Store the YPD medium at room temperature The shelf life is several months YPD agar is used for streaking glycerol stocks of PichiaPink strains To prepare 1 liter use only one pouch of YP agar from the PichiaPink Media Kit 1 Dissolve the contents of the YP agar pouch from the PichiaPink Media Kit in 900 mL of distilled water 2 Autoclave for 20 minutes on liquid cycle 3 Add 100 mL of sterile 20 Dextrose see above Store the YPD agar slants or plates at 4 C The shelf life is several months Continued on next page Recipes continued YPDS Medium PAD Agar Stock Solutions YPDS medium is used for the recovery of cells after electroporation To prepare 0 2 liters of YPDS use only one pouch of YPS from the PichiaPink Media Kit 1 Dissolve the contents of the YPS pouch from the PichiaPink Media Kit in 180 mL of distilled water 2 Autoclave for 20 minutes on liquid cycle 3 Add 20 mL of sterile 20 Dextrose see previous pa
105. s to match the codon usage in Pichia for optimal expression in PichiaPink strains Many Saccharomyces genes have proven to be functional in Pichia Propagate and maintain plasmid constructs in a recA end A E coli strain such as TOP10 DH10B DH5o or JM109 AT rich regions may cause the premature termination of transcripts in Pichia and other eukaryotic systems Henikoff and Cohen 1984 Irniger et al 1991 Scorer et al 1993 Zaret and Sherman 1984 If you have problems expressing your gene check for premature termination by northern analysis and check your sequence for AT rich regions It may be necessary to change the sequence in order to express your gene Scorer et al 1993 TM The PichiaPink Secretion Signal duplexes and the pPinka HC vector contain the ATG start codon immediately upstream of secretion signal sequences therefore it is not necessary to include the initiation codon when designing inserts containing your gene of interest However your insert may include an ATCG Since the ribosome generally recognizes the first ATG unless the internal ATG is in a particularly good context the ATG in front of the secretion signal will be used for initiation Your insert must contain a stop codon TM The PichiaPink Secretion Signal duplexes and the pPinka HC vector contain the following yeast consensus sequence at the translation initiation site where the ATG translation initiation codon is shown underlined
106. se knockouts and have been shown to exhibit reduced levels of proteolytic degradation of secreted proteins we recommend that you follow the guidelines below to further increase your chances of achieving high secreted expression levels e Doa time course study of expression Check to see if there is a time point that yields a larger percentage of full length protein e Check to see if your protein is susceptible to neutral pH proteases by expressing in unbuffered medium In addition try 1 Casamino acids with buffered medium to inhibit extracellular proteases e Induce expression with a higher density culture e Check cell pellet to see if overall expression is low or if the protein did not secrete If it did not secrete try a different signal sequence The PichiaPink Secretion Optimization Kit includes the PichiaPink Secretion Signal Kit also available separately see page vii which contains eight separate secretion signal duplexes ready to be cloned with your gene of interest into the PichiaPink vectors for optimal secretion TM e Concentrate your supernatant by ammonium sulfate precipitation or ultrafiltration see page 47 e Induce expression with a higher density culture Continued on next page Optimizing PichiaPink Protein Expression continued Low Expression Levels No Expression Hyperglycosy lation e If you have only used pPink HC or pPinka HC for expression try pPink LC Some proteins expr
107. sed to compare relative amounts of protein Continued on next page Expressing Recombinant PichiaPink Strains continued Media Proteases Aeration Kinetics of Growth Temperature and Shaking You will need BMGY and BMMY buffered complex glycerol or methanol medium for expression of your protein of interest see Recipes page 62 BMGY and BMMY are usually used for the expression of secreted proteins particularly if pH is important for the activity of your protein Because these media are buffered with phosphate buffer a wide range of pH values may be used to optimize production of your protein BMGY and BMMY contain yeast extract and peptone to stabilize secreted proteins and prevent or decrease proteolysis of secreted proteins Inclusion of yeast extract and peptone allow better growth and biomass accumulation There are some proteins specifically susceptible to proteases that have optimal activity at neutral pH If this is the case expression using MGYA and MMA media may be indicated even if you are using one of the protease knock out PichiaPink strains As PichiaPink expression progresses in an unbuffered medium such as MMA the pH drops to 3 or below inactivating many neutral pH proteases Brierley et al 1994 PichiaPink is resistant to low pH so the low pH will not affect growth If you know your protein of interest is especially susceptible to neutral pH proteases you may want to express your pr
108. sity formats such as 96 well plates can greatly simplify the testing of multiple strain vector and secretion signal combinations when using the PichiaPink Secretion Optimization Kit Growth in 96 well plates is best done with a 3 mm throw shaker at a high agitation speed We suggest that you analyze your SDS PAGE gels by both Coomassie staining and western blot as the expression and secretion is protein dependent and not all proteins express to the level of grams per liter We also suggest checking for protein activity if an assay is available Small scale expression conditions may not be optimal for your protein For this reason the method you choose for detection i e SDS PAGE western or functional assay may be an important factor in determining the success of expression If your method of detection does not reveal any expression you may want to consider using a more sensitive method Technique Method of Detection Sensitivity SDS PAGE Coomassie stained Visualization by eye Can detect as little as 100 ng in a single band SDS PAGE Silver stained Visualization by eye Can detect as little as 2 ng in a single band Western Analysis Antibody to your particular protein Can detect as little as 1 10 pg depending on detection method alkaline phosphatase horseradish peroxidase radiolabeled antibody Functional assay Varies depending on assay Varies depending on assay It is u
109. ssolved oxygen above 20 may be difficult depending on the oxygen transfer rates OTR of the fermentor especially in small scale glass vessels In a glass vessel oxygen supplementation is needed to keep the DO above 20 usually 0 1 0 3 vvm liters of O per liter of fermentation culture per minute Oxygen consumption varies and depends on the amount of methanol added and the protein being expressed 2 Youcan use oxygen at 0 1 to 0 3 vvm to achieve adequate levels You can accomplish this in any glass fermentor by mixing with the air feed For stainless steel vessels you can use pressure to increase the OTR Be sure to read the operator s manual for your particular fermentor 3 Ifa fermentor cannot supply the necessary levels of oxygen then you should scale back the methanol feed accordingly Note that decreasing the amount of methanol may reduce the level of protein expression 4 Toreach maximum expression levels you may increase the fermentation time to deliver similar levels of methanol at the lower feed rate For many recombinant proteins there is a direct correlation between the amount of methanol consumed and the amount of protein produced During growth the culture consumes oxygen keeping the DO concentration low Oxygen is consumed regardless whether you grow the on glycerol or methanol You can manipulate the DO concentration to evaluate the metabolic rate of the culture and whether the carbon source is limiting The metab
110. tein of interest by testing multiple secretion signal sequences see Choosing the Appropriate Secretion Signal next page The pPinka HC vector has the same high copy ADE2 marker as pPink HC but it also contains the Saccharomyces cerevisiae a mating factor pre sequence for secreted expression of your recombinant protein TM For maps and features of the PichiaPink vectors see pages 56 58 Continued on next page Using the PichiaPink System continued Choosing the Appropriate Secretion Signal Transformation and Integration Heterologous expression in Pichia pastoris can be either intracellular or secreted Secretion requires the presence of a signal sequence on the expressed protein to target it to the secretory pathway While several different secretion signal sequences have been used successfully including the native secretion signal present on some heterologous proteins success has been variable The secretion signal sequence from the Saccharomyces cerevisiae a mating factor pre sequence has been used with the most success Cereghino et al 2002 Cregg et al 1993 Scorer et al 1993 You may readily clone your gene of interest in frame with this signal sequence using the pPinka HC plasmid However in some cases it may be more advantageous to try to express your protein of interest using different signal sequences The signal sequence can have a significant impact on the yield of your protein The PichiaPink Secretio
111. to ensure that every customer is 10076 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed
112. transforming PichiaPink Strains as it yields some of the highest transformation frequencies in Pichia This section provides protocols and guidelines for transforming each of your TM PichiaPink strains by electroporation TM Electrocompetent PichiaPink Strains previous page TM e 5 10 ug pure PichiaPink plasmid construct i e pPink HC pPink or pPinka HC containing your insert for each transformation TM e PichiaPink YPDS media see Recipes page 61 TM e PichiaPink PAD selection plates see Recipes page 61 TM e Electroporation device and 0 2 cm cuvettes e g E Shot Standard Electroporation Cuvettes 0 2 cm see page vii For each transformation i e each strain and plasmid construct 1 Mix80 ul of the electrocompetent PichiaPink cells from Step 8 previous page with 5 10 ug of linearized plasmid DNA Step 4 page 30 and transfer to an ice cold 0 2 cm electroporation cuvette Incubate the cuvette with the cells on ice for 5 minutes Pulse the cells in the electroporator according to the instrument manufacturer s instructions for yeast The time constant should be 5 milliseconds 4 Immediately after pulsing the cells add 1 mL of ice cold YPDS media to the cuvette and mix by pipetting up and down 5 Incubate the cells at 24 30 C for at least 2 hours without shaking You do not need to remove the cells from the cuvettes Note You may incubate the cells for up to 12 hours
113. ve secretion signal present on some heterologous proteins success has been variable The secretion signal sequence from the Saccharomyces cerevisiae a mating factor pre sequence has been used with the most success Cereghino et al 2002 Cregg et al 1993 Scorer et al 1993 The major advantage of expressing heterologous proteins as secreted proteins is that Pichia pastoris secretes very low levels of native proteins That combined with the very low amount of protein in the minimal Pichia growth medium means that the secreted heterologous protein comprises the vast majority of the total protein in the medium and serves as the first step in purification of the protein Barr et al 1992 Note that if there are recognized glycosylation sites Asn X Ser Thr in your protein s primary sequence glycosylation may occur at these sites TM The PichiaPink System offers multiple options for targeting your protein of interest to the secretory pathway The PichiaPink Secreted Protein Expression Kit allows you to clone your gene of interest in frame with the Saccharomyces cerevisiae a mating factor pre sequence using the pPinka HC plasmid for secreted expression The PichiaPink Secretion Optimization Kit enables you to screen multiple signal sequences with your gene of interest in low and high copy vectors pPink LC and pPink HC respectively for optimal expression and secretion of your recombinant protein The secretion signal sequences are p
114. w at 24 30 C with shaking 5 Add 10076 methanol to 0 576 every 24 hours until the optimal time of induction is reached as determined from the time course study 6 Harvest cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature 7 Forintracellular expression decant the supernatant You can process the cells immediately or store at 80 C until ready for use 8 Forsecreted expression save the supernatant chill to 4 C and concentrate if desired see below Proceed directly to purification using your method of choice or store the supernatant at 80 C until ready to process further Proteins secreted into the media are usually gt 50 homogeneous and require some additional purification If the expression level is not particularly high we recommend that you concentrate the protein There are several general methods to concentrate proteins secreted from Pichia These general methods include e Ammonium sulfate precipitation e Dialysis e Centrifuge concentrator for small volumes e g Centricon or Centriprep devices available from Amicon e Pressurized cell concentrators for large volumes Amicon ultrafiltration devices e Lyophilization A general guide to protein techniques is Protein Methods Bollag and Edelstein 1991 47 PichiaPink Fermentation Introduction Important Fermentation Parameters Monitoring the Growth of PichiaPink 48 Once you have optimized secreted expression
115. water 5 10 C This requirement may mean that you need a refrigeration unit to keep the water cold e A foam probe is highly recommended as antifoam is required e A source of O either air stainless steel fermentors at 1 2 vvm or pure O 0 1 0 3 vvm for glass fermentors e Calibrated peristaltic pumps to feed the glycerol and methanol e Automatic control of pH TM Follow the instructions below to prepare PichiaPink starter cultures to inoculate the fermentor Be sure not to put too much medium in the baffled flasks The volume of the medium should be 10 30 of the total flask volume 1 Inoculate baffled flasks containing a total of 1 10 of the initial fermentation volume of BMGY with a colony from an MGY plate or from a frozen glycerol stock 2 Grow the cells at 30 C 250 300 rpm 2 3 days until OD 2 20 To accurately measure OD gt 1 0 dilute a sample of your culture 10 to 100 fold before reading Continued on next page PichiaPink Fermentation continued Glycerol Batch Phase Note Glycerol Fed Batch Phase TM Follow the instructions below to prepare your PichiaPink strains for glycerol fed batch phase page 51 1 2 Sterilize the fermentor containing BMGY medium After sterilization and cooling set the temperature to 30 C agitation and aeration to operating conditions usually maximum rpm and 0 1 1 0 vvm air and adjust the pH of the medium to 6 0 Inoculate the fermentor wit
116. x medium Inducing secreted expression containing methanol controlling the pH of the medium and decreasing protease activity MGY or MGYA Minimal medium Generating biomass prior to optional containing glycerol with or methanol induction for without adenine intracellular expression MM or MMA Minimal medium Intracellular expression of optional containing methanol with or desired protein without adenine Continued on next page 59 Recipes continued PichiaPink Media For your convenience the PichiaPink Media Kit is included in the PichiaPink Kit 2096 Dextrose 10X YPD Medium YPD Agar 60 TM Secretion Optimization and PichiaPink Secreted Protein Expression Kits and is also available separately from Invitrogen see page vii for ordering information It contains the following prepackaged media Media Amount Yield PAD Agar 2 pouches 1liter pouch of PAD agar medium YP 2 pouches 1liter pouch of YP base medium YPS 2 pouches 0 2 liters pouch of YPS base medium YP Agar 2 pouches 1liter pouch of YP agar medium Dextrose 1 pouch 1 liter pouch of 20 dextrose TM Follow the instructions below to prepare the media for your PichiaPink experiments To prepare 1 liter of 20 Dextrose 10X stock solution 1 Dissolve the contents of the Dextrose pouch from the PichiaPink Media Kit in 1000 mL of distilled water 2 Autoclave for 15 minute

PichiaPink Expression System

Contents

Download Pdf Manuals

Related Search

Related Contents