Home

BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit

1. For established cell lines e g COS A549 consult original references or the supplier of your cell line for the optimal method of transfection Pay particular attention to media requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen amp Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1989 Felgner amp Ringold 1989 and electroporation Chu et al 1987 Shigekawa amp Dower 1988 Choose the method and reagent that provides the highest efficiency transfection in your mammalian cell line For a recommendation see below For high efficiency transfection in a broad range of mammalian cell lines we recommend using the cationic lipid based Lipofectamine 2000 Reagent Catalog no 11668 027 available from Invitrogen Ciccarone et al 1999 Using Lipofectamine 2000 to transfect plasmid DNA into eukaryotic cells offers the following advantages e Provides the highest transfection efficiency in many mammalian cell types TM e DNA Lipofectamine 2000 complexes can be added directly to cells in culture medium in the presence of serum e Removal of complexes medium change or medium addition following transfection is not required although complexes can be removed after 4 6 hours without loss of activity TM For more i
2. Troubleshooting continued Transient Transfection and RNAi Analysis continued Problem Reason Solution Cytotoxic effects Too much Lipofectamine 2000 Optimize the transfection conditions for your observed after Reagent used cell line by varying the amount of transfection Lipofectamine 2000 Reagent used Plasmid DNA not pure Prepare purified plasmid DNA for transfection We recommend using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 or the S N A P MidiPrep Kit Catalog no K1910 01 to prepare purified plasmid DNA Non specific off target gene knockdown observed Target sequence contains strong homology to other genes Select a new target sequence Use the RNAi Designer at www invitrogen com rnai to help you design your shRNA sequence Generating Stable The table below lists some potential problems and possible solutions that may help you troubleshoot your transfection and selection experiment Cell Lines Problem Reason Solution Few Zeocin resistant colonies obtained Used too much Zeocin for selection e Decrease the concentration of Zeocin used for selection e Perform a kill curve experiment to determine the optimal concentration of Zeocin to use for selection in your mammalian cell line Cells not selected after Zeocin addition i e cells form a monolayer Cells too confluent at the time of Zeocin
3. e pENTR H1 TO Catalog no K4920 00 for regulated expression of shRNA for RNAi analysis e pENTR U6 Catalog no K4945 00 for constitutive expression of shRNA for RNAi analysis Note Other Gateway entry vectors e g PENTR D TOPO do not contain the RNAi cassette required for Pol III dependent expression of shRNA Using the reagents supplied in the BLOCK iT Inducible H1 RNAi Entry Vector Kit you will perform the following steps to generate an entry clone in pENTR H1 TO 1 Design and synthesize two complementary single stranded DNA oligonucleotides with one encoding the shRNA of interest 2 Anneal the single stranded oligonucleotides to generate a double stranded oligo ds oligo Clone the ds oligo into the linearized pENTR H1 TO vector Transform the ligation reaction into One Shot TOP10 chemically competent E coli and select for kanamycin or Zeocin resistant transformants 5 Use the pENTR H1 TO entry construct for the desired RNAi application see below Once you have cloned the ds oligo insert into pENTR H1 TO you may use the resulting entry clone in the following RNAi applications e Transfect the entry clone into a tetracycline repressor TetR expressing mammalian cell line for transient tetracycline regulated RNAi analysis e Transfect the entry clone into a TetR expressing mammalian cell line and select for a stable cell line s expressing the shRNA of interest Use the stable cell line f
4. Generating the Double Stranded Oligo ds oligo Introduction Single Stranded Oligos Amount of DNA Oligo to Anneal Resuspending the Oligos Re annealing LacZ2 1 Control Oligo 20 Once you have synthesized the appropriate complementary single stranded DNA oligos you will anneal equal amounts of each single stranded oligo to generate a double stranded oligo ds oligo Guidelines and instructions are provided in this section Before beginning make sure that you have synthesized the single stranded oligos with the appropriate sequences required for cloning into the pENTR H1 TO vector and for annealing See the figure below for an illustration e Top strand oligo Make sure that this oligo contains the sequence CACC at the 5 end e Bottom strand oligo Make sure that this oligo contains the sequence AAAA at the 5 end and is complementary to the top strand oligo Top strand oligo CACCA 9 4 Bottom strand oligo AAAA 9 4 T Annealing CACCA 4 T ds oligo AAAA You will anneal equal amounts of the top and bottom strand oligos to generate the ds oligos We generally perform the annealing reaction at a final single stranded oligo concentration of 50 uM Annealing at concentrations lower than 50 uM can significantly reduce the efficiency Note that the annealing step is not 100 efficient
5. Introduction Limited Use Label License No 5 Invitrogen Technology 60 Use of the BLOCK iT Inducible H1 RNAi Entry Vector Kit is covered under the licenses detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the
6. The BLOCK iT Inducible H1 RNAi Entry Vector Kit and the BLOCK iT Inducible H1 Lentiviral RNAi System are shipped as described below Upon receipt store each item as detailed below For more detailed information about the BLOCK iT Inducible H1 Lentiviral RNAi reagents supplied with the kit refer to the BLOCK iT Inducible H1 Lentiviral RNAi System manual Box Component Shipping Storage 1 Inducible H1 RNAi Entry Vector Dry ice Tetracycline 20 C protected Reagents and Tetracycline from light All other reagents 20 C 2 One Shot TOP10 Chemically Dry ice 809C Competent E coli 3 9 BLOCK iT Inducible H1 Various Various refer to the BLOCK iT Lentiviral RNAi Reagents Inducible H1 Lentiviral RNAi System manual for details continued on next page vii Kit Contents and Storage continued Inducible H1 RNAi The following reagents are included with the Inducible H1 RNAi Entry Vector Entry Vector and Tetracycline box Box 1 Store the tetracycline at 20 C protected from Reagents and light Store the other reagents at 20 C Tetracycline Reagent Composition Amount pENTR H1 TO vector 0 75 ng ul plasmid DNA in 4x 10 ul linearized 10 mM Tris HCl pH 8 0 1mM EDTA pH 8 0 10X Oligo Annealing Buffer 100 mM Tris HCl pH 8 0 250 ul 10 mM EDTA pH 8 0 1M NaCl DNase RNase Free Water 3x15 ml 5X Ligation Buffer 250 mM Tris HCl pH 7 6 80 ul 50 mM M
7. What to Do Next In some cases you may have difficulty sequencing the ds oligo insert in your pENTR H1 TO construct This is because the hairpin sequence is an inverted repeat that can form secondary structure during sequencing resulting in a drop in the sequencing signal when entering the hairpin If you have difficulty sequencing your entry constructs we suggest trying the following to improve your sequencing results e Use high quality purified plasmid DNA for sequencing We recommend preparing DNA using Invitrogen s PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 or S N A P MidiPrep Kit Catalog no K1910 01 e Add DMSO to the sequencing reaction to a final concentration of 5 e Increase the amount of template used in the reaction up to twice the normal concentration e Standard sequencing kits typically use dITP in place of dGTP to reduce G C compression Other kits containing dGTP are available for sequencing G rich and GT rich templates If you are using a standard commercial sequencing kit containing dITP obtain a sequencing kit containing dGTP e g dGTP BigDye Terminator v3 0 Cycle Sequencing Ready Reaction Kit Applied Biosystems Catalog no 4390229 and use a 7 1 molar ratio of dITP dGTP in your sequencing reaction Once you have identified the correct entry clone be sure to purify the colony and make a glycerol stock for long term storage We recommend that you store a stock of plasm
8. e Gateway LR Clonase II Enzyme Mix Box 8 e 293FT Cell Line Box 9 Refer to the BLOCK iT Inducible H1 Lentiviral RNAi System manual for a detailed description of the lentiviral expression reagents provided with the kit and instructions to produce lentivirus For instructions to grow and maintain the 293FT Cell Line refer to the 293FT Cell Line manual The BLOCK iT Inducible H1 Lentiviral RNAi System and the 293FT Cell Line manuals are supplied with Catalog no K4925 00 but are also available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 59 Accessory Products Introduction Accessory Products TM The products listed in this section may be used with the BLOCK iT Inducible H1 RNAi Entry Vector Kit For more information refer to our Web site www invitrogen com or call Technical Service see page 59 Some of the reagents supplied in the BLOCK iT Inducible H1 RNAi Entry Vector Kit as well as other products suitable for use with the kit are available separately from Invitrogen Ordering information is provided below Product Amount Catalog no T4 DNA Ligase 100 units 15224 017 500 units 15224 025 One Shot TOP10 Chemically Competent 10 reactions C4040 10 Bee 20 reactions C4040 03 40 reactions C4040 06 M13 Reverse Primer 2ug N530 02 PureLink HQ Mini Plasmid Purification Kit 100 purifications
9. Box 1 10 mg ml stock solution e Appropriate tissue culture dishes and supplies continued on next page 41 Generating a Stable Cell Line continued Guidelines for Guidelines are provided below to transfect your pPENTR H1 TO entry construct Transfection and into the TetR expressing mammalian cell line of choice and to select for stable cell Selection lines using Zeocin 1 One day before transfection plate cells at a density recommended by the manufacturer of the transfection reagent you are using On the day of transfection Day 1 transfect your pENTR H1 TO construct into cells following the recommendations of the manufacturer of your transfection reagent Four to six hours after transfection remove the medium and replace with fresh growth medium Incubate the cells overnight at 37 C The following day Day 2 trypsinize and replate cells into a larger sized tissue culture format in fresh complete medium containing the appropriate concentrations of Blasticidin and Zeocin Note Blasticidin is required to maintain the pcDNA 6 TR or pLenti6 TR construct in the TetR expressing cells Example If transfecting cells in a 6 well format trypsinize and replate cells into a 10 cm tissue culture plate in medium containing Blasticidin and Zeocin Replace medium with fresh medium containing Blasticidin and Zeocin every 3 4 days until Blasticidin and Zeocin resistant colonies can be identified generally 10 1
10. K2100 01 S N A P MidiPrep Kit 20 purifications K1910 01 Lipofectamine 2000 Reagent 0 75 ml 11668 027 1 5 ml 11668 019 Lipofectamine LTX Reagent 1 0 ml 15338 100 Opti MEM I Reduced Serum Medium 100 ml 31985 062 500 ml 31985 070 Phosphate Buffered Saline PBS pH 7 4 500 ml 10010 023 Zeocin 1g R250 01 5g 250 05 Kanamycin Sulfate 5g 11815 024 Tetracycline 5g Q100 19 4 E Gel Starter Pak 9 gels and Base G5000 04 10 bp DNA Ladder 50 ug 10821 015 B gal Antiserum 50 ul R901 25 FluoReporter lacZ Galactosidase 1000 reactions F 2905 Quantitation Kit pBLOCK T 3 DEST Gateway Vector 6 ug V486 20 The amount of antibody supplied is sufficient for 25 western blots continued on next page xi Accessory Products continued T REx Products BLOCK iT Inducible Lentiviral RNAi Reagents xii Invitrogen has available a number of cell lines that stably express the Tet TM repressor from pcDNA 6 TR TetR expressing plasmid from the T REx TM System The cell lines should be maintained in medium containing Blasticidin TM In addition the pcDNA 6 TR plasmid is available to facilitate generation of TM TM your own T REx cell lines For more information about the T REx Cell Lines pcDNA 6 TR or the T REx System see our Web site www invitrogen com or contact Technical Service see page 59 Product Amount Catalog no T REx 293 Cell Line 3 x 106 cells fr
11. We have found that adding the complementary C in this situation can result in reduced activity of the shRNA If you plan to express the same shRNA from both the pENTR H1 TO vector and Invitrogen s pENTR U6 vector i e BLOCK iT U6 RNAi Entry Vector Kit Catalog no K4945 00 we recommend initiating the shRNA sequence at a G as this is the preferred initiation site for the U6 promoter Generating shRNA sequence that initiates at a G allows the shRNA to be compatible for cloning and expression from either PENTR H1 TO or pENTR U6 Do not add 5 phosphates to your ss oligos during synthesis The phosphate groups necessary for ligation are present in the linearized pENTR H1 TO vector continued on next page 17 Designing the Single Stranded DNA Oligos continued Example 1 ss This example lists the sequences of top and bottom strand oligos encoding an Oligo Design shRNA targeting the lamin A C gene These particular ss oligos were annealed to generate a lamin ds oligo that was cloned into pENTR H1 TO The resulting lamin H1 TO RNAi cassette was transferred into the pLenti4 BLOCK iT DEST vector in an LR recombination reaction to generate the pLenti4 GW H1 TO lamin construct supplied in the BLOCK iT Inducible H1 Lentiviral RNAi System Catalog no K4925 00 1 sense target sequence loop antisense target sequence T Top strand oligo 57 CACCGCTGGACTTCCAGAAGAACACGAATGTTCTTCTGGAAGTCCAG 3
12. addition Zeocin selection is most effective when cells are less than 5096 confluent at the time of selection After transfection of the pENTR H1 TO construct trypsinize and replate cells such that they are approximately 25 50 confluent before adding medium TM containing Zeocin i Insufficient amount of Zeocin used for selection e Increase the concentration of Zeocin used for selection e Perform a kill curve experiment to determine the optimal concentration of Zeocin to use for selection in your mammalian cell line 50 Recipes LB Luria Bertani Medium Low Salt LB Medium or Plates Containing Zeocin Tetracycline Appendix 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if desired 4 Store at 4 C 1 0 Tryptone 0 5 Yeast Extract 0 5 NaCl pH 7 5 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 5 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 5 with NaOH and bring the volume up to 1 liter If preparing plates add 15 g L agar 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add Zeocin
13. e Zeocin is light sensitive Store the drug and plates or medium containing drug in the dark at 4 C Culture medium containing Zeocin may be stored at 4 C protected from exposure to light for up to 1 month e Wear gloves a laboratory coat and safety glasses or goggles when handling Zeocin containing solutions e Zeocin is toxic Do not ingest or inhale solutions containing the drug Zeocin is supplied in autoclaved deionized water in 1 25 ml aliquots at a concentration of 100 mg ml The stability of Zeocin is guaranteed for six months if stored at 20 C protected from exposure to light 55 Map and Features of pENTR H1 TO pENTR H1 TO Map 56 The figure below shows the features of the pENTR H1 TO vector The vector is supplied linearized between nucleotides 1935 and 1936 with 4 base pair 5 overhangs on each strand as indicated The complete sequence of pENTR H1 TO is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 59 Comments for pENTR H1 TO 3869 nucleotides rrnB T2 transcription terminator bases 268 295 C rrnB T1 transcription terminator bases 427 470 SV40 polyadenylation signal bases 513 642 C Zeocin resistance gene bases 772 1146 C EM7 promoter bases 1147 1213 C SV40 early promoter and origin bases 1268 1576 C M13 forward 20 priming site bases 1648 1663 attL1 bases 1680 1779 C H1 TO p
14. pENTR H1 TO 1631 1711 1791 1871 1941 2021 2101 TTCCCAGTCA We generally order unpurified desalted single stranded oligos using Invitrogen s custom primer synthesis service see www invitrogen com for more information The ss oligos obtained anneal efficiently and provide optimal cloning results Note however that depending on which supplier you use the purity and quality of the ss oligos may vary If you obtain variable annealing and cloning results using unpurified desalted oligos you may want to order oligos that are HPLC or PAGE purified Use the diagram below to help you design suitable DNA oligonucleotides to clone into pENTR H1 TO after annealing Note the following features in the diagram below e The pENTR H1 TO vector is supplied linearized between nucleotides 1935 and 1936 The linearized vector contains 4 nucleotide overhangs on each strand encoding the last 4 nucleotides of the H1 TO promoter and the first 4 nucleotides of the Pol III terminator Note that the annealed double stranded ds oligo must contain specific 4 nucleotide 5 overhangs on each strand as indicated e The shaded region corresponds to those DNA sequences that will be transferred from the entry clone into the Gateway destination vector e g pLenti4 BLOCK iT DEST following recombination Note Following recombination with a Gateway destination vector the resulting expression clone will contain an RNAi cassette cons
15. C Altschmied L Schollmeier K and Meier I 1983 Control of Expression of the Tn10 encoded Tetracycline Resistance Genes Equilibrium and Kinetic Investigations of the Regulatory Reactions J Mol Biol 169 707 721 Hutvagner G McLachlan J Pasquinelli A E Balint E Tuschl T and Zamore P D 2001 A Cellular Function for the RNA Interference Enzyme Dicer in the Maturation of the let 7 Small Temporal RNA Science 293 811 813 Jones A L Thomas C L and Maule A J 1998 De novo Methylation and Co Suppression Induced by a Cytoplasmically Replicating Plant RNA Virus EMBO J 17 6385 6393 Ketting R F Fischer S E Bernstein E Sijen T Hannon G J and Plasterk R H 2001 Dicer Functions in RNA Interference and in Synthesis of Small RNA Involved in Developmental Timing in C elegans Genes Dev 15 2654 2659 Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Biochem 58 913 949 Lee R C Feinbaum R L and Ambros V 1993 The C elegans Heterochronic Gene lin 4 Encodes Small RNAs with Antisense Complementarity to lin 14 Cell 75 843 854 Li W X and Ding S W 2001 Viral Suppressors of RNA Silencing Curr Opin Biotechnol 12 150 154 McManus M T Petersen C P Haines B B Chen J and Sharp P A 2002 Gene Silencing Using Micro RNA Designed Hairpins RNA 8 842 850 McManus M T and Sharp P A 2002 Gene Silencin
16. Jones et al 1998 Li amp Ding 2001 Voinnet et al 1999 In eukaryotic organisms dsRNA produced in vivo or introduced by pathogens is processed into 21 23 nucleotide double stranded short interfering RNA duplexes siRNA by an enzyme called Dicer a member of the RNase III family of double stranded RNA specific endonucleases Bernstein et al 2001 Ketting et al 2001 Each siRNA then incorporates into an RNA induced silencing complex RISC an enzyme complex that serves to target cellular transcripts complementary to the siRNA for specific cleavage and degradation Hammond et al 2000 Nykanen et al 2001 In addition to dsRNA other endogenous RNA molecules including short temporal RNA stRNA see below and microRNA miRNA Ambros 2001 Carrington amp Ambros 2003 have been identified and shown to be able to trigger gene silencing For more information about the RNAi pathway and the mechanism of gene silencing refer to recent reviews Bosher amp Labouesse 2000 Dykxhoorn et al 2003 Hannon 2002 Plasterk amp Ketting 2000 Zamore 2001 Small temporal RNA stRNA a subclass of micro RNA miRNA were originally identified and shown to be endogenous triggers of gene silencing in C elegans Grishok et al 2001 Lee et al 1993 Short temporal RNA including let 7 Grishok et al 2001 and lin 4 Lee et al 1993 encode hairpin precursors that are processed by the Dicer enzyme into 21 23 nucleotide siRNA duple
17. and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Ciccarone V Chu Y Schifferli K Pichet J P Hawley Nelson P Evans K Roy L and Bennett S 1999 Lipofectamine 2000 Reagent for Rapid Efficient Transfection of Eukaryotic Cells Focus 21 54 55 Cogoni C and Macino G 1997 Isolation of Quelling Defective qde Mutants Impaired in Posttranscriptional Transgene Induced Gene Silencing in Neurospora crassa Proc Natl Acad Sci USA 94 10233 10238 Cogoni C and Macino G 1999 Gene Silencing in Neurospora crassa Requires a Protein Homologous to RNA Dependent RNA Polymerase Nature 399 166 169 Cogoni C Romano N and Macino G 1994 Suppression of Gene Expression by Homologous Transgenes Antonie Van Leeuwenhoek 65 205 209 Cole C N and Stacy T P 1985 Identification of Sequences in the Herpes Simplex Virus Thymidine Kinase Gene Required for Efficient Processing and Polyadenylation Mol Cell Biol 5 2104 2113 Curradi M Izzo A Badaracco G and Landsberger N 2002 Molecular Mechanisms of Gene Silencing Mediated by DNA Methylation Mol Cell Biol 22 3157 3173 Drocourt D Calmels T P G Reynes J P Baron M and Tiraby G 1990 Cassettes of the Streptoalloteichus
18. attL1 and attL2 sites Bacteriophage A derived recombination sequences that allow recombinational cloning of the H1 TO RNAi cassette in the entry construct with a Gateway destination vector Landy 1989 H1 forward priming site Allows sequencing of the insert Human H1 TO promoter Hybrid promoter consisting of the human H1 promoter Hannon et al 1991 Myslinksi et al 2001 and two tetracycline operator tetO sequences for RNA Polymerase III dependent regulated expression of the short hairpin RNA shRNA The tetO sequences serve as binding sites for Tet repressor homodimers Hillen amp Berens 1994 5 overhangs Allows ligase mediated directional cloning of the double stranded oligonucleotide of interest Pol III terminator Allows efficient termination of RNA Polymerase III dependent transcription M13 reverse priming site Allows sequencing of the insert Kanamycin resistance gene Allows selection of the plasmid in E coli pUC origin of replication ori Permits high copy replication and maintenance in E coli 57 Map of pcDNA 1 2 V5 GW lacZ Description 58 pcDNA 1 2 V5 GW lacZ 6498 bp is a control vector expressing a C terminally tagged B galactosidase fusion protein under the control of the human cytomegalovirus CMV promoter Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 and was generated using the MultiSite Gateway Three Fragment Vector Cons
19. e Transfection efficiency see page 34 for more information e Transcription rate of the target gene of interest e Stability of the target protein e Growth characteristics of your mammalian cell line e Efficacy of the shRNA of interest Take these factors into account when designing your RNAi experiments A number of options exist to express your shRNA of interest in the mammalian Options cell line of choice for RNAi analysis Choose the option that best fits your needs Option Procedure Benefit 1 Co transfect the pENTR H1 TO construct anda Perform regulated shRNA expression TetR expressing plasmid e g pcDNA 6 TR or experiments with a single construct pLenti6 TR into mammalian cells for quick screening purposes Note Significant basal expression of the shRNA may be observed with this option 2 Obtain or generate a mammalian cell line that Perform transient or stable regulated stably expresses the Tet repressor Use this cell line shRNA expression experiments with as the host for the pPENTR H1 TO construct multiple shRNA constructs using a Select for a double stable cell line if desired cell line that consistently expresses the same amount of Tet repressor 3 Transfer the H1 TO RNAi cassette from Perform other RNAi applications e g pENTR H1 TO into a suitable Gateway regulated shRNA expression in non destination vector e g pLenti4 BLOCK iT DEST dividing mammalian cells using the by LR recombina
20. from the Pol III terminator G 5 AAAUCGCUGAUUUGUGUAGUCG A 3 ms UUUBGCOBCUAARCACAMEABC n Note The length of the stem and loop may differ depending on how you design the oligonucleotides encoding your target sequence For guidelines to design the oligonucleotides refer to pages 14 19 How Tetracycline Regulation Works Introduction Tetracycline Regulation and tet Operator Sequences Mechanism of Repression Derepression As described previously the H1 promoter in the pENTR H1 TO entry vector has been modified to include two prokaryotic tet operator sequences The presence of the tet operator sequences enables the shRNA of interest to be expressed in a tetracycline dependent manner This section describes the tet operator sequences in the pENTR H1 TO vector and the mechanism of tetracycline regulation in the BLOCK iT Inducible H1 RNAi System The BLOCK iT Inducible H1 RNAi System uses regulatory elements from the E coli Tn10 encoded tetracycline Tet resistance operon Hillen amp Berens 1994 Hillen et al 1983 to allow tetracycline regulated expression of your shRNA of interest from the pENTR H1 TO vector The mechanism of tetracycline regulation in the system is based on the binding of tetracycline to the Tet repressor and derepression of the promoter controlling expression of the shRNA of interest In the system expression of your shRNA of interest is repressed in the absence of tetracycline an
21. ligation reaction into competent TOP10 E coli It is important to have everything you need set up and ready to use to ensure that you obtain the best results We suggest that you read the sections entitled Performing the Ligation Reaction pages 25 27 and Transforming One Shot TOP10 Competent E coli page 28 before beginning You will use T4 DNA Ligase and a 5X Ligation Buffer supplied with the kit to facilitate ligation of your ds oligo with the linearized pENTR H1 TO vector When performing the ligation reaction note the following e The T4 DNA Ligase and the 5X Ligation Buffer supplied with the kit have been optimized to permit ligation of the ds oligo into the pENTR H1 TO vector in 5 minutes at room temperature T4 DNA Ligase preparations and reaction buffers available from other manufacturers may not be appropriate for use in this application Note The T4 DNA Ligase and reaction buffer supplied in the BLOCK iT Inducible H1 RNAi Kits is available separately from Invitrogen Catalog no 15224 017 e Traditional ligation reactions are performed at 16 C overnight This is not recommended for this application Follow the ligation procedure on page 27 For optimal results use a 10 1 to 50 1 molar ratio of ds oligo insert vector in the ligation reaction This ratio is achieved when 1 5 ul of the 5 nM ds oligo stock solution is used for ligation Note the following e If your ss oligos have annealed efficiently i e the inten
22. more information refer to our Web site www invitrogen com or call Technical Service see page 59 continued on next page Transfecting Cells continued Example of Expected Results Transient Regulated Knockdown of a lacZ Reporter Gene In this experiment PENTR H1 TO entry constructs containing ds oligo encoding shRNA targeting the lacZ i e pgNTR GW H1 TO lacZ2 1 NA reporter gene or the endogenous lamin i e PENTR GW H1 TO lamin 4 gene were generated following the recommended protocols and using the reagents supplied in the BLOCK iT Inducible H1 RNAi Entry Vector Kit Note that the lacZ ds oligo used in this experiment is the same as the lacZ2 1 ds control oligo supplied with the kit T REx 293 cells Invitrogen Catalog no R710 07 were grown to 90 confluence Individual wells in a 24 well plate were transfected using Lipofectamine 2000 Reagent with 700 ng of plasmid DNA 100 ng of the pcDNA 1 2 V5 GW lacZ reporter plasmid and 600 ng of non specific plasmid DNA In some wells the reporter plasmid was co transfected with 600 ng of the pENTR GW H1 TO lacZ2 1 N or pENTR GW H1 TO lamin constructs Three hours after transfection the medium was replaced with medium containing 1 ug ml tetracycline Cell lysates were prepared 48 hours after induction and assayed for B galactosidase activity Results Potent and specific inhibition of B galactosidase activity is evident from the lacZ deriv
23. plating Many clones contain inserts with sequence mutations Poor quality single stranded oligos used e Oligo preparation contains mutated sequences e Oligo preparation contains contaminants e Use mass spectrometry to check for peaks of the wrong mass e Order HPLC or polyacrylamide gel PAGE purified oligos e Order oligos from Invitrogen s custom primer synthesis service see our Web site for more information Did not use the competent cells supplied with the kit Use the One Shot TOP10 Chemically Competent E coli supplied with the kit trans formation efficiency is gt 1 x 10 cfu ug DNA Poor sequencing results Loss of sequencing signal in the hairpin region due to secondary structure formation e Use high quality purified plasmid DNA e Add DMSO to the sequencing reaction to a final concentration of 5 e Increase the amount of template used for sequencing up to 2X the normal amount e Usea 7 1 molar ratio of dITP dGTP in your sequencing reaction if using commercial kits No colonies obtained on the selective plate Used the wrong antibiotic for selection Select for transformants on LB agar plates containing 50 ug ml kanamycin continued on next page 47 Troubleshooting continued Transient The table below lists some potential problems and possible solutions that may Transfection and help you troubleshoot your transient transfection and
24. presence and correct orientation of the ds oligo insert b The sequence of the ds oligo insert Note Because of the small size of the ds oligo insert we do not recommend using restriction enzyme analysis to screen transformants We highly recommend sequencing positive transformants to confirm the sequence of the ds oligo insert When screening transformants we find that up to 2076 of the clones may contain mutated inserts generally 1 or 2 bp deletions within the ds oligo The reason for this is not known but may be due to triggering of repair mechanisms within E coli as a result of the inverted repeat sequence within the ds oligo insert Note Entry clones containing mutated ds oligo inserts generally elicit a poor RNAi response in mammalian cells Identify entry clones with the correct ds oligo sequence and use these clones for your RNAi analysis TM To facilitate sequencing of your pENTR H1 TO entry clones use the H1 Forward and M13 Reverse Primers supplied with the kit Box 1 See the diagram on page 19 for the location of the priming sites If you download the sequence for pENTR H1 TO from our Web site note that the overhang sequences will be shown already hybridized to their complementary sequences e g GTGG will be shown hybridized to CACC and TTTT will be shown hybridized to AAAA continued on next page Analyzing Transformants continued v S MENO ZO O E NOU Long Term Storage
25. supplies continued on next page 37 Transfecting Cells continued Guidelines for Transfection and Induction Assaying for p galactosidase Expression 38 TM Guidelines are provided below to transfect your pENTR H1 TO entry construct into the TetR expressing mammalian cell line of choice and to induce expression of the shRNA of interest with tetracycline 1 One day before transfection plate cells at a density recommended by the manufacturer of the transfection reagent you are using 2 On the day of transfection Day 1 transfect your pENTR H1 TO construct into cells following the recommendations of the manufacturer of your transfection reagent If you are co transfecting the pENTR H1 TO construct and a TetR expression plasmid or the pcDNA 1 2 V5 GW lacZ and pENTR GW H1 TO lacZ2 1 N plasmids use the appropriate amounts of each plasmid as recommended on page 36 and 37 respectively 3 Atan appropriate time generally 3 to 24 hours after transfection remove medium and replace with fresh growth medium containing 1 ug ml tetracycline to induce shRNA expression Note the following e If you have transfected your cells using Lipofectamine 2000 you may add tetracycline to induce expression of your shRNA as early as 3 hours following transfection e If you have included the lacZ positive control plasmids in your experiment add tetracycline to cells 3 hours after transfection This induces expression of
26. target sequence does not contain significant homology to other genes as this can increase off target RNAi effects Orientation You may choose a target sequence encoding the sense sequence of the target mRNA or the antisense sequence Thus you can generate an shRNA in two possible orientations sense sequence loop antisense sequence or antisense sequence loop sense sequence siRNA If you have identified a synthetic siRNA that is active in triggering knockdown of your target gene try generating an shRNA using this same target sequence You may use a loop sequence of any length ranging from 4 to 11 nucleotides although short loops i e 4 7 nucleotides are generally preferred Avoid using a loop sequence containing thymidines T s as they may cause early termination This is particularly true if the target sequence see the previous page itself ends in one or more T nucleotides Note We have included the following loop sequences in active shRNA molecules e 5 CGAA 3 e 5 AACG 3 e 5 GAGA 3 continued on next page Designing the Single Stranded DNA Oligos continued Transcription Initiation MMENO 7 ZO QO E Noise Note Transcription of the shRNA initiates at the first base following the end of the H1 TO promoter sequence In the top strand oligo the transcription initiation site corresponds to the first nucleotide following the four base pair CACC sequence added to permit directional cloni
27. tet A A A a A A fetRAtetR TetO TATA TetO ShRNA of interest Experimental Outline Flow Chart The figure below illustrates the major steps necessary to produce a pENTR H1 TO entry clone using the BLOCK iT Inducible H1 RNAi Entry Vector Kit CACCA _ 1 Design and synthesize comple mentary DNA oligos with each containing 4 nucleotide overhangs AAAA T necessary for directional cloning Annealing 2 Anneal DNA oligos to generate a CACCA ds oligo T AAAA Cloning 3 Clone the ds oligo into the PEE H1 TO vector using T4 NA Ligase 4 Transform E coli and analyze colonies for the desired entry clone H1 TO entry clone 5 Transfect the entry clone into a TetR expressing cell line to tran siently express the shRNA OR generate a stable cell line OR recombine with a suitable destination vector to generate an expression clone Transiently transfecta Generate a stable Recombine with a TetR expressing cell line cell line destination vector 13 Methods Designing the Single Stranded DNA Oligos Introduction RECO Nor l Factors to Consider 14 To use the BLOCK iT Inducible H1 RNAi Entry Vector Kit you will first need to design two single stranded DNA oligonucleotides one encoding the target shRNA top strand oligo and the other its complement bottom strand oligo You will then an
28. to a final concentration of 50 ug ml If preparing plates pour into 10 cm plates 4 Store at 4 C Plates containing Zeocin may be stored at 4 C for up to 2 weeks Use this procedure to prepare a 10 mg ml stock solution from the tetracycline salt available separately from Invitrogen Catalog no Q100 19 Note that the tetracycline provided with the BLOCK iT Inducible H1 RNAi Kits is supplied as a 10 mg ml solution that is ready to use Important If you are using a different form of tetracycline i e free base form prepare the stock solution in 100 ethanol rather than water 1 Weigh out 10 mg of tetracycline and transfer to a sterile microcentrifuge tube 2 Resuspend the tetracycline in 1 ml of sterile water to produce a 10 mg ml stock solution that is yellow in color 3 Wrap the tube in foil and store the stock solution at 20 C protected from exposure to light 51 Generating a TetR Expressing Host Cell Line Introduction Options to Generate Your Own TetR Expressing Cell Lines Note Determining Blasticidin Sensitivity for Your Cell Line Generating a TetR Expressing Cell Line 52 Guidelines are provided in this section to generate your own stable TetR expressing host cell line For detailed instructions refer to the manual for the TetR expression plasmid that you are using Two options exist to generate a stable TetR expressing mammalian cell line using reagents available sepa
29. to use as hosts for your inducible pENTR H1 TO entry construct Those clones that express the highest levels of Tet repressor should exhibit the most complete repression of basal transcription of your shRNA of interest To detect Tet repressor expression we recommend performing Western blot analysis using an Anti Tet repressor antibody MoBiTec G ttingen Germany Catalog no TET01 Once you have generated your stable TetR expressing cell line and have verified that the cells express suitable levels of Tet repressor we recommend the following e Maintain the cell line in medium containing Blasticidin e Remember to freeze and store vials of early passage cells 53 Zeocin Zeocin Molecular Weight Formula and Structure Applications of Zeocin 54 Zeocin belongs to a family of structurally related bleomycin phleomycin type antibiotics isolated from Streptomyces Antibiotics in this family are broad spectrum antibiotics that act as strong antibacterial and antitumor drugs They show strong toxicity against bacteria fungi including yeast plants and mammalian cells Baron et al 1992 Drocourt et al 1990 Mulsant et al 1988 Perez et al 1989 The Zeocin resistance protein has been isolated and characterized Calmels et al 1991 Drocourt et al 1990 This protein the product of the Sh ble gene Streptoalloteichus hindustanus bleomycin gene is a 13 7 kDa protein that binds Zeocin and inhi
30. with the kit into your mammalian cell line and assay for knockdown of p galactosidase expression Reminder When using the 5 nM ds oligo stock solution for cloning thaw the solution on ice Do not thaw the ds oligo by heating or the ds oligo duplexes may melt and form intramolecular hairpin structures After use return the tube to 20 C storage Have the following reagents on hand before beginning e Double stranded oligo of interest 5 nM in 1X Oligo Annealing Buffer thaw on ice before use e pENTR H1 TO linearized 0 75 ng ul supplied with the kit Box 1 thaw on ice before use e lacZ2 1 ds control oligo if desired 5 nM in 1X Oligo Annealing Buffer thaw on ice before use e 5X Ligation Buffer supplied with the kit Box 1 e DNase RNase Free Water supplied with the kit Box 1 e T4 DNA Ligase 1 U ul supplied with the kit Box 1 continued on next page Performing the Ligation Reaction continued Ligation Procedure Follow the procedure below to perform the ligation reaction If you wish to include a negative control set up a separate ligation reaction but omit the ds oligo 1 Setup a 20 ul ligation reaction at room temperature using the following reagents in the order shown Reagent Sample Positive Control 5X Ligation Buffer 4ul 4 ul pENTR H1 TO 0 75 ng ul 2 ul 2 ul ds oligo 5 nM i e 1 10 000 dilution 1 5 ul lacZ2 1 ds control oligo 5 nM i e 5 pl 1 10 000 dilut
31. 4 days after selection Pick at least 10 Blasticidin and Zeocin resistant colonies and expand each clone Induce expression of the shRNA of interest by adding tetracycline to a final concentration of 1 ug ml Wait for the appropriate length of time e g 24 48 hours before assaying for target gene knockdown Compare to uninduced cells 42 Guidelines to Perform the LR Recombination Reaction Introduction Appropriate Destination Vectors Note E coliHost The pENTR H1 TO vector contains attL sites to facilitate transfer of your H1 TO RNAi cassette H1 TO promoter ds oligo of interest Pol III terminator into an appropriate Gateway destination vector to generate an expression clone To transfer your H1 TO RNAi cassette into the destination vector you will perform an LR recombination reaction using Gateway LR Clonase II Enzyme Mix Guidelines are provided in this section We recommend transferring the H1 TO RNAi cassette into a promoterless Gateway destination vector for the following RNAi applications e Perform delivery of the regulated shRNA of interest to hard to transfect or non dividing mammalian cells Use the pLenti4 BLOCK iT DEST vector see Note below e Generate stable cell lines expressing the regulated shRNA using a selection marker other than Zeocin Use the pBLOCK iT 3 DEST vector containing the neomycin selection marker Catalog no V486 20 Important Because the H1 TO RNAi casset
32. Annealing Procedure Step 5 previous page 100 fold into DNase RNase free water to obtain a final concentration of 500 nM Vortex to mix thoroughly 50 uM ds oligo 1 ul DNase RNase free water 99 ul Total volume 100 ul 2 Dilute the 500 nM ds oligo mixture from Step 1 100 fold into 1X Oligo Annealing Buffer as follows to obtain a final concentration of 5 nM Vortex to mix thoroughly Store the remaining 500 nM ds oligo stock at 20 C 500 nM ds oligo lul 10X Oligo Annealing Buffer 10 ul DNase RNase free water 89 ul Total volume 100 pl 3 Aliquot the 5 nM ds oligo stock and store at 20 C The undiluted ds oligos are 10 000 fold more concentrated than the working concentration When performing the dilutions be careful not to cross contaminate the different ds oligo stocks Remember to wear gloves and change pipette tips after every manipulation Once you have diluted your ds oligo you should have three stocks of annealed ds oligo Use each stock as follows e 50 uM ds oligo undiluted Use this stock for long term storage and to prepare new diluted ds oligo stocks if existing stocks become denatured or cross contaminated e 500 nM ds oligo 100 fold dilution Use this stock for gel analysis see Checking the Integrity of the ds Oligo next page e 5nM ds oligo 10 000 fold dilution Use this stock for cloning see Ligation Procedure page 27 This stock is not suitable for long term storage Store the thr
33. Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Baer M Nilsen T W Costigan C and Altman S 1990 Structure and Transcription of a Human Gene for H1 RNA the RNA Component of Human RNase P Nuc Acids Res 18 97 103 Bernstein E Caudy A A Hammond S M and Hannon G J 2001 Role for a Bidentate Ribonuclease in the Initiation Step of RNA Interference Nature 409 363 366 Bogenhagen D F and Brown D D 1981 Nucleotide Sequences in Xenopus 55 DNA Required for Transcription Termination Cell 24 261 270 Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Bosher J M and Labouesse M 2000 RNA Interference Genetic Wand and Genetic Watchdog Nature Cell Biol 2 E31 E36 Brummelkamp T R Bernards R and Agami R 2002 A System for Stable Expression of Short Interfering RNAs in Mammalian Cells Science 296 550 553 Calmels T Parriche M Burand H and Tiraby G 1991 High Efficiency Transformation of Tolypocladium geodes Conidiospores to Phleomycin Resistance Curr Genet 20 309 314 Carrington J C and Ambros V 2003 Role of MicroRNAs in Plant and Animal Development Science 301 336 338 Chen C
34. DNA oligo 200 uM 5 pl Bottom strand DNA oligo 200 uM 5 pl 10X Oligo Annealing Buffer 2 ul DNase RNase Free Water 8 ul Total volume 20 ul If re annealing the lacZ2 1 control oligo centrifuge its tube briefly 5 seconds and transfer contents to a separate 0 5 ml sterile microcentrifuge tube Incubate the reaction at 95 C for 4 minutes Remove the tube containing the annealing reaction from the water bath or the heat block and set on your laboratory bench Allow the reaction mixture to cool to room temperature for 5 10 minutes The single stranded oligos will anneal during this time Place the sample in a microcentrifuge and centrifuge briefly 5 seconds Mix gently Remove 1 ul of the annealing mixture and dilute the ds oligo as directed in Diluting the ds Oligo next page Store the remainder of the 50 uM ds oligo mixture at 20 C continued on next page 21 Generating the Double Stranded Oligo ds oligo continued Diluting the ds Oligo Important Storing the ds Oligo 22 To clone your ds oligo or LacZ2 1 ds Control Oligo into pENTR H1 TO you must dilute the 50 uM stock to a final concentration of 5 nM i e 10 000 fold dilution We generally perform two 100 fold serial dilutions the first into DNase RNase free water and the second into the 1X Oligo Annealing Buffer supplied with the kit Follow the procedure below to dilute the ds oligo 1 Dilute the 50 uM ds oligo mixture from
35. Invitrogen BLOCK iT Inducible H1 RNAi Entry Vector Kit A Gateway adapted entry vector for regulated expression of short hairpin RNA shRNA in mammalian cells Catalog nos K4920 00 and K4925 00 Version F 23 June 2010 25 0721 Table of Contents Table Of Contents si ope ore eedem ondes s a E e a rete aed wate ated eet iii H1 TO Entry Clone Generation Procedure for Experienced Users sssssssseeeseeenee V Kit Contents and Storage tne tenente tenete E E A te tenes vii Accessory Products s er peer ee oem e de Pe PIER EROR Fe PEU eee eee Eee dn ee oen xi Introduction PE 1 OV ELVIS Westen sona ee receta tta dp et eee a ht tt ca tos ed 1 BLOCK iT Inducible H1 RNAi Entry Vector Nits anit tse wee eave Bo tp eo bie e fu Dd 4 Using shRNA for RNAi Analysis h orea a eae EE tnter E ea iata nennen 7 How Tetracycline Regulation WOTKS iesise iroi riii entente ttr 11 Experimental Outline 4 i eet ame di e RR UU eee t i e qe EG fe sete fetis 13 Methods eS 14 Designing the Single Stranded DNA Oligo sssssssssssseeeeeeeeernenenenenrtetrte nennen 14 Generating the Double Stranded Oligo ds oligo sss 20 Performing the Ligation R achoNsssnr isr tat ititi ier EE ETETE in ATE ERE TE ESSEE EEEE E Aari ER Eene TESES EAS 25 Transforming One Shot TOP10 Competent E coli ssss ssssssssissssssrirsssssrssiisrsssnirtsssntsrisesssntinnsnsnrerinessntreenens 28 Analyzing Transfor
36. NA Sequence Oligo Top strand 5 CACCAAATCGCTGATTTGTGTAGTCGGAGACGACTACACAAATCAGCGA 3 Bottom strand 5 AAAATCGCTGATTTGTGTAGTCGTCTCCGACTACACAAATCAGCGATITT 3 One Shot TOP10 The following reagents are included in the One Shot TOP10 Chemically Reagents Competent E coli kit Box 2 Transformation efficiency is 2 1 x 10 cfu pg plasmid DNA Store at 80 C Reagent Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at 4 C or 0 5 Yeast Extract room temperature 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose TOP10 cells 21 x 50 pl pUC19 Control DNA 10 pg ul in 5 mM Tris HCI 0 5 mM 50 ul EDTA pH 8 Genotype of F mcr A A mrr hsdRMS mcrBC o80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 TOP10 Cells galU galK rpsL Str endA1 nupG continued on next page Kit Contents and Storage continued BLOCK iT Inducible H1 Lentiviral RNAi Reagents In addition to the BLOCK iT Inducible H1 RNAi Entry Vector Kit the BLOCK iT Inducible H1 Lentiviral RNAi System Catalog no K4925 00 also includes the following components to facilitate production of a replication incompetent lentivirus that expresses your short hairpin RNA shRNA of interest in a regulated manner e pLenti4 BLOCK iT DEST Gateway Vector Kit Box 3 e pLenti6 TR Vector Kit Box 4 e One Shot StbI3 Chemically Competent E coli Box 5 TM e ViraPower Zeo Lentiviral Support Kit Boxes 6 and 7
37. Paule M R and White R J 2000 Transcription by RNA Polymerases I and III Nuc Acids Res 28 1283 1298 Perez P Tiraby G Kallerhoff J and Perret J 1989 Phleomycin Resistance as a Dominant Selectable Marker for Plant Cell Transformation Plant Mol Biol 13 365 373 Plasterk R H A and Ketting R F 2000 The Silence of the Genes Curr Opin Genet Dev 10 562 567 65 Postle K Nguyen T T and Bertrand K P 1984 Nucleotide Sequence of the Repressor Gene of the Tn10 Tetracycline Resistance Determinant Nuc Acids Res 12 4849 4863 Rietveld L E Caldenhoven E and Stunnenberg H G 2002 In vivo Repression of an Erythroid Specific Gene by Distinct Corepressor Complexes EMBO J 21 1389 1397 Romano N and Macino G 1992 Quelling Transient Inactivation of Gene Expression in Neurospora crassa by Transformation with Homologous Sequences Mol Microbiol 6 3343 3353 Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Smith C J Watson C F Bird C R Ray J Schuch W and Grierson D 1990 Expression of a Truncated Tomato Polygalacturonase Gene Inhibits Expression of the Endogenous Gene in Transgenic Plants Mol Gen Genet 224 477 481 Sui G Soohoo C Affar E B Gay F Shi Y Forrester W C and Shi Y 2002 A DNA Vector Based RNAi Technology
38. able Gateway destination vector to generate an expression clone provides guidelines only For detailed instructions to perform the LR recombination reaction refer to the manual supplied with the destination vector that you are using The BLOCK iT Inducible H1 RNAi Entry Vector Kit is designed to help you generate a construct to express shRNA in a regulated fashion in mammalian cell lines for RNAi analysis Although the kit has been designed to help you express an shRNA in the simplest most direct fashion use of the kit for RNAi analysis assumes that users are familiar with the principles of gene silencing vector based production of shRNA and transfection in mammalian systems We highly recommend that users possess a working knowledge of the RNAi pathway and lipid mediated transfection For more information about the RNAi pathway and expression of shRNA in mammalian cells refer to published references Brummelkamp et al 2002 McManus et al 2002 McManus amp Sharp 2002 Paul et al 2002 Yu et al 2002 BLOCK iT Inducible H1 RNAi Entry Vector Kit Description of the System Features of the pENTR H1 TO Vector The BLOCK iT Inducible H1 RNAi Entry Vector Kit facilitates the generation of an entry construct that permits high level tetracycline regulated expression of an shRNA of interest in mammalian cells for RNAi analysis of a target gene The kit contains the following major components e The pENTR H1 TO
39. at least half of the single stranded oligos remain unannealed even at a concentration of 50 uM If your single stranded oligos are supplied lyophilized resuspend them in water or TE Buffer to a final concentration of 200 uM before use If you plan to use the lacZ2 1 control oligo in the ligation reaction make sure to re anneal it along with the other oligos as described on the next page Since the lacZ2 1 control oligo already comes at a concentration of 50 uM in 1 x Oligo Annealing Buffer re anneal the lacZ2 1 control oligo without further dilution continued on next page Generating the Double Stranded Oligo ds oligo continued Materials Needed Annealing Procedure Have the following materials on hand before beginning Your top strand single stranded oligo 200 uM in water or TE Buffer Your bottom strand single stranded oligo 200 uM in water or TE Buffer 50 uM stock of LacZ2 1 ds Control Oligo if desired thaw on ice 10X Oligo Annealing Buffer supplied with the kit Box 1 DNase RNase Free Water supplied with the kit Box 1 0 5 ml sterile microcentrifuge tubes 95 C water bath or heat block Follow this procedure to anneal your single stranded oligos to generate the ds oligo Note that the final concentration of the oligo mixture is 50 uM 1 Ina 0 5 ml sterile microcentrifuge tube set up the following annealing reaction at room temperature Reagent Amount Top strand
40. bits its DNA strand cleavage activity Expression of this protein TM in eukaryotic and prokaryotic hosts confers resistance to Zeocin The formula for Zeocin is CeoHsoN2102 S3 and the molecular weight is 1 535 The diagram below shows the structure of Zeocin 2 fV A HO CH3 o R HN I H2N re NH OH MW 1 535 Zeocin is used for selection in mammalian cells Mulsant et al 1988 plants Perez et al 1989 yeast Baron et al 1992 and prokaryotes Drocourt et al 1990 Suggested concentrations of Zeocin for selection in mammalian cell lines and E coli are listed below Zeocin Concentration and Selective Medium 25 50 ug ml in Low Salt LB medium see page 51 for recipe 50 1000 ug ml varies with cell line Organism E coli Mammalian Cells Efficient selection requires that the concentration of NaCl be no more than 5 g L lt 90 mM continued on next page Zeocin continued Handling Zeocin Preparing and Storing Zeocin e High salt and acidity or basicity inactivate Zeocin Therefore we recommend that you reduce the salt in bacterial medium and adjust the pH to 7 5 to keep the drug active see the recipe for Low Salt LB Medium page 51 Note that the pH and salt concentration do not need to be adjusted when preparing tissue culture medium containing Zeocin TM e Store Zeocin at 20 C and thaw on ice before use
41. bleshooting Introduction Use the information in this section to troubleshoot the annealing cloning transformation and transfection procedures Annealing The table below lists some potential problems and possible solutions that may Reaction help you troubleshoot the annealing reaction Problem Reason Solution Weak band Single stranded oligos designed Verify that the sequence of the bottom strand representing ds oligo observed on an agarose gel incorrectly oligo is complementary to the sequence of the top strand oligo If not re synthesize the bottom strand oligo Allowed oligos to cool at 4 C instead of room temperature during annealing procedure After heating to 95 C anneal the oligos by setting the microcentrifuge tube at room temperature for 5 10 minutes see the procedure on page 21 Did not anneal equal amounts of top and bottom strand oligo Anneal equal amounts of the top and bottom strand oligo using the procedure on page 21 Oligos strongly favor formation of intramolecular hairpins Proceed to ligation reaction but increase the amount of ds oligo used from 1 ul up to 5 pl No band representing ds oligo observed on an agarose gel Single stranded oligos designed incorrectly Verify that the sequence of the bottom strand oligo is complementary to the sequence of the top strand oligo If not re synthesize the bottom strand oligo Used the wrong single stranded
42. by assaying for tetracycline regulated knockdown of B galactosidase TM The pENTR H1 TO vector contains the following features e HI TO RNAi cassette containing elements required to allow RNA Polymerase III dependent tetracycline regulated expression of the shRNA of interest in mammalian cells see page 9 for more information e Cloning site containing 4 nucleotide 5 overhangs on each DNA strand for directional cloning of the ds oligo encoding the shRNA of interest Note The 4 nucleotide 5 overhangs on each DNA strand encode the last 4 nucleotides of the H1 TO promoter and the first 4 nucleotides of the Pol III terminator Transcription initiates at the first duplexed nucleotide after the promoter overhang see the diagram on page 19 for more information e Two recombination sites attL1 and attL2 for recombinational cloning of the H1 TO RNAi cassette into a suitable Gateway destination vector Landy 1989 e Kanamycin resistance gene for selection in E coli e Zeocin resistance gene for selection in mammalian cells and E coli e pUC origin for high copy maintenance of the plasmid in E coli continued on next page BLOCK iT Inducible H1 RNAi Entry Vector Kit continued Important Generating shRNA Using the Kit RNAi Applications If you have previously used other Gateway entry vectors note that specific entry vectors are required to generate entry clones for use in RNAi applications Specifically use
43. ck the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C Medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour SY oL dM o9 7 Spread 40 200 ul from each transformation on a pre warmed selective plate and incubate overnight at 37 C We recommend plating two different volumes to ensure that at least one plate will have well spaced colonies If you are transforming the pUC19 control plate 20 100 ul of the transformation reaction on pre warmed LB plates containing 100 ug ml ampicillin 8 An efficient ligation reaction may produce several hundred colonies Pick 5 10 colonies for analysis see Analyzing Transformants next page 29 Analyzing Transformants Analyzing Transformants Important Sequencing Note 30 To analyze positive clones we recommend that you 1 Pick 5 10 kanamycin resistant colonies and culture them overnight in LB or SOB medium containing 50 ug ml kanamycin or Low Salt LB medium TM containing 50 ug ml Zeocin 2 Isolate plasmid DNA using your method of choice To obtain pure plasmid DNA for automated or manual sequencing we recommend using the PureLink HO Mini Plasmid Purification Kit Catalog no K2100 01 or the S N A P MidiPrep Kit Catalog no K1910 01 available from Invitrogen 3 Sequence each pENTR H1 TO entry construct see below to confirm the following a The
44. ckdown experiments with several shRNA expression constructs in the same mammalian cell line e Obtain the lowest levels of basal shRNA expression i e lowest levels of target gene knockdown in the absence of tetracycline To obtain a TetR expressing stable cell line from Invitrogen see the Recommendation below For guidelines to generate your own stable TetR expressing cell line see Generating a TetR Expressing Host Cell Line Appendix page 52 TM Several T REx cell lines that stably express the Tet repressor are available from Invitrogen see page xii for ordering information If you wish to assay for tetracycline regulated expression of your gene of interest in 293 HeLa CHO or Jurkat cells you may want to use one of the T REx cell lines as the host for your pENTR H1 TO entry construct Note The T REx cell lines stably express the Tet repressor from the pcDNA 6 TR expression plasmid This plasmid is used to generate stable TetR expressing cell lines in Invitrogen s T REx System Both pLenti6 TR and pcDNA 6 TR contain the same TetR gene For more information about the T REx cell lines or pcDNA 6 TR see our Web site www invitrogen com or contact Technical Service see page 59 continued on next page 33 General Considerations for Transfection and Regulated Expression continued Methods of Transfection ee by ND a 5 v _ o P E Transient vs Stable Expression of Your shRNA 34
45. containing 100 ug ml ampicillin To perform RNAi analysis using the lacZ control reagents you will co transfect the pcDNA 1 2 V5 GW lacZ reporter plasmid and the pENTR GW H1 TO lacZ2 1 N entry construct that you have generated into your TetR expressing mammalian cell line For optimal results we recommend using 6 fold more entry construct DNA than reporter plasmid DNA in the co transfection For example use 600 ng of pENTR GW H1 TO lacZ2 1 5N DNA and 100 ng of pcDNA 1 2 V5 GW lacZ DNA when transfecting cells plated in a 24 well format For an example of results obtained from such an RNAi experiment see page 39 Have the following materials on hand before beginning e TetR expressing mammalian cell line of interest make sure that cells are healthy and gt 90 viable before beginning TM Note If your cell line expresses TetR from pcDNA 6 TR or pLenti6 TR maintain the cells in medium containing the appropriate concentration of Blasticidin e pENTR H1 TO entry construct TM e pcDNA l 2 V5 GW lacZ plasmid if performing the positive control transfection supplied with the kit Box 1 pENTR GW H1 TO lacZ2 1 plasmid if you have performed the positive control ligation reaction and are performing the positive control transfection e Transfection reagent of choice e g Lipofectamine 2000 e Tetracycline supplied with the kit Box 1 10 mg ml stock solution e Appropriate tissue culture dishes and
46. cycline functions as an inducing agent to regulate transcription of the shRNA of interest from the H1 TO RNAi cassette Tetracycline is supplied with the BLOCK iT Inducible H1 RNAi Kits as a 10 mg ml stock solution that is ready to use but is also available separately from Invitrogen in powdered form Catalog no Q100 19 For a recipe to prepare a 10 mg ml stock solution from the powdered form see page 51 To induce transcription of the shRNA of interest in mammalian cells we generally add tetracycline to a final concentration of 1 ug ml in complete growth medium If desired you may vary the concentration of tetracycline used for induction from 0 001 to 1 ug ml to modulate expression of the shRNA of interest Note The concentrations of tetracycline used for induction in the BLOCK iT Inducible H1 RNAi System are generally not high enough to be toxic to mammalian cells Follow the guidelines below when handling tetracycline e Tetracycline is light sensitive Store the stock solution at 20 C protected from light Prepare medium containing tetracycline immediately before use e Tetracycline is toxic Do not ingest solutions containing the drug If handling the powdered form do not inhale e Wear gloves a laboratory coat and safety glasses or goggles when handling tetracycline and tetracycline containing solutions When culturing cells in medium containing fetal bovine serum FBS note that many lots of FBS contain te
47. d handle the antibiotic refer to the Appendix page 52 Note If you are using the BLOCK iT Inducible H1 Lentiviral RNAi System Zeocin is supplied with the kit Otherwise Zeocin is available separately from Invitrogen see pages xi xii for ordering information TM If you plan to select for stable cell lines expressing the pENTR H1 TO construct you must first determine the minimum concentration of Zeocin that is required to kill your untransfected mammalian cell line i e perform a kill curve experiment Typically concentrations ranging from 50 1000 ug ml Zeocin are sufficient to kill most untransfected mammalian cell lines We recommend testing a range of concentrations to ensure that you determine the minimum concentration necessary for your cell line 1 Plate cells at approximately 25 confluence Prepare a set of 6 7 plates Allow cells to adhere overnight 2 The next day substitute culture medium with medium containing varying concentrations of Zeocin 3 Replenish the selective media every 3 4 days and observe the percentage of surviving cells TM 4 Determine the appropriate concentration of Zeocin that kills the cells within 10 14 days after addition of antibiotic continued on next page Generating a Stable Cell Line continued Effect of Zeocin on Sensitive and Resistant Cells Materials Needed Zeocin s method of killing is quite different from that of other common antibi
48. d induced in its presence In the BLOCK iT Inducible H1 RNAi Entry Vector System expression of the shRNA of interest from the pENTR H1 TO is controlled by a human H1 promoter into which 2 copies of the 19 nt tet operator 2 TetO sequence have been incorporated i e H1 TO promoter Each 19 nt TetO sequence serves as the binding site for 2 molecules of the Tet repressor Refer to the diagram on page 19 for the location and sequences of the TetO sites in the H1 TO promoter In the absence of tetracycline the Tet repressor expressed from the pcDNA 6 TR plasmid or pLenti6 TR lentiviral construct as desired forms a homodimer that binds with extremely high affinity to each TetO sequence Hillen amp Berens 1994 in the H1 TO promoter of the pENTR H1 TO The 2 TetO sites in the H1 TO promoter serve as binding sites for 4 molecules or 2 homodimers of the Tet repressor see figure on the next page Binding of the Tet repressor homodimers to the Tet O sequences represses transcription of your shRNA of interest Upon addition tetracycline binds with high affinity to each Tet repressor homodimer in a 1 1 stoichiometry and causes a conformational change in the repressor that renders it unable to bind the Tet operator The Tet repressor tetracycline complex then dissociates from the Tet operator and allows induction of transcription of the shRNA of interest resulting in target gene knockdown see figure on the next page Note The affin
49. e regulated expression of your gene of interest under the control of a hybrid promoter containing two tetracycline operator 2 TetOz sites e A regulatory expression construct that facilitates high level constitutive expression of the Tet repressor TetR In the T REx System expression of the TetR gene is controlled by the CMV promoter e Tetracycline for inducing expression When the inducible expression construct and the regulatory expression construct are present in the same mammalian cell expression of your gene of interest is repressed in the absence of tetracycline and induced in its presence Yao et al 1998 The Gateway Technology is a universal cloning method that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 to provide a rapid and highly efficient way to move your DNA sequence of interest e g H1 TO RNAi cassette into multiple vector systems To express your shRNA of interest using the pPENTR H1 TO vector simply 1 Clone your ds oligo encoding the shRNA of interest into the TM pENTR H1 TO vector to generate an entry clone 2 Choose one of the following options a Transfect your entry construct into Tet repressor TetR expressing mammalian cells Add tetracycline to transiently assay for target gene knockdown b Transfect the entry construct into TetR expressing mammalian cells and use Zeocin selection to generate a stable cell line Add tetracycl
50. e to use a mammalian cell line in which activity of the CMV promoter is not down regulated TM After transfecting or transducing the pcDNA 6 TR or pLenti6 TR construct into your mammalian cells as appropriate you will use Blasticidin to select for a stable cell line Before beginning remember to determine the minimum concentration of Blasticidin that is required to kill your untransfected or untransduced mammalian cell line as appropriate i e perform a kill curve experiment For detailed instructions to generate a TetR expressing cell line using pcDNA 6 TR or pLenti6 TR refer to the manual for the expression plasmid you are using If you wish to produce a lentiviral stock from pLenti6 TR and transduce mammalian cells to generate your TetR expressing cell line refer to the BLOCK iT Inducible H1 Lentiviral RNAi System or the ViraPower T REx manual All manuals are available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 59 continued on next page Generating a TetR Expressing Host Cell Line continued Important Detecting TetR Expression Maintaining TetR Expressing Cell Lines After you have introduced the TetR expression construct into your mammalian cell line and have performed Blasticidin selection screen individual clones to determine the amount of Tet repressor expressed see below Select for clones that express the highest levels of Tet repressor
51. ed shRNA but not from the lamin derived shRNA after cells have been treated with tetracycline Note In this experiment some basal expression of the lacZ derived shRNA occurs as evidenced by the 15 inhibition of B galactosidase activity in cells cultured in the absence of tetracycline 1 800 1 600 ElUninduced O Tetracycline 1 400 x by o o 1 000 B gal activity m e eo eo Untransfected Reporter only pENTR GW H1 TO pENTR GW H1 TO lacZ2 1shRNA laminshRNA Transfection condition 39 Generating a Stable Cell Line Introduction Zeocin Selection Determining Zeocin Sensitivity for Your Cell Line 40 Once you have established that your shRNA can be inducibly expressed from pENTR H1 TO you may wish to establish a stable cell line that constitutively expresses the Tet repressor and inducibly expresses your shRNA As with transient transfection we recommend using a cell line that stably expresses the Tet repressor as a host for your pENTR H1 TO construct Use a T REx Cell Line available from Invitrogen or your own TetR expressing cell line see page 52 for guidelines to generate the cell line The pENTR H1 TO plasmid contains the Zeocin resistance gene Calmels et al 1991 Drocourt et al 1990 to facilitate generation of cell lines Mulsant et al 1988 that inducibly express the shRNA of interest For a brief description of Zeocin and guidelines to prepare an
52. ee ds oligo stocks at 20 C continued on next page Generating the Double Stranded Oligo ds oligo continued Important Checking the Integrity of the ds Oligo What You Should See NS MENO O O E NOU l When using the diluted ds oligo stock solutions i e 100 fold or 10 000 fold diluted stocks thaw the solutions on ice Do not heat or allow the ds oligo solutions to reach greater than room temperature as this causes the ds oligos to melt The concentration of the oligos in the diluted solutions is not high enough to permit re annealing and instead favors the formation of intramolecular hairpin structures These intramolecular hairpin structures will not clone into pENTR H1 TO If your diluted ds oligo stock solution s is heated discard the ds oligo solution and prepare new diluted stocks using the procedure on the previous page Note If the 50 uM ds oligo solution undiluted stock becomes heated the oligos are sufficiently concentrated and may be re annealed following the annealing procedure on page 21 You may verify the integrity of your annealed ds oligo using agarose gel electrophoresis if desired We suggest running an aliquot of the annealed ds oligo 5 ul of the 500 nM stock and comparing it to an aliquot of each starting single stranded oligo dilute the 200 uM stock 400 fold to 500 nM use 5 ul for gel analysis Be sure to include an appropriate molecular weight standard We ge
53. ently 2 Incubate on ice for 5 to 30 minutes 3 Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tube to ice 4 Add 250 ul of room temperature S O C Medium Incubate at 37 C for 1 hour with shaking 6 Spread 40 200 ul of bacterial culture on a pre warmed LB agar plate containing 50 ug ml kanamycin and incubate overnight at 37 C vi Kit Contents and Storage Types of Kits Kit Components Shipping Storage This manual is supplied with the products listed below Note The BLOCK iT Inducible H1 Lentiviral RNAi System also contains the BLOCK iT Inducible H1 Lentiviral RNAi System components and the BLOCK iT Inducible H1 Lentiviral RNAi System manual Product Catalog no BLOCK iT Inducible H1 RNAi Entry Vector Kit K4920 00 BLOCK iT Inducible H1 Lentiviral RNAi System K4925 00 The BLOCK iT Inducible H1 RNAi Entry Vector Kit and the BLOCK iT Inducible H1 Lentiviral RNAi System include the following components For a detailed description of the contents of the BLOCK iT Inducible H1 RNAi Entry Vector Kit see pages viii ix For a detailed description of the contents of the BLOCK iT Inducible H1 Lentiviral RNAi reagents see the BLOCK iT Inducible H1 Lentiviral RNAi System manual Component Catalog no K4920 00 K4925 00 BLOCK iT Inducible H1 RNAi Entry Vector Kit Y V BLOCK iT Inducible H1 Lentiviral RNAi Reagents Y
54. entry vector into which a ds oligo encoding the shRNA of interest will be cloned to generate an entry clone that contains the elements required for tetracycline inducible expression of the shRNA in mammalian cells The pENTR H1 TO vector is supplied linearized with 4 nucleotide 5 overhangs on each strand to facilitate directional cloning of the ds oligo insert The resulting entry clone containing the H1 TO RNAi cassette i e H1 TO promoter ds oligo Pol III terminator may be used in a number of RNAi applications see the next page For more information about the features of the pENTR H1 TO vector see below and page 56 For more information about the H1 TO RNAi cassette see page 9 For more information about how tetracycline regulation works see page 11 e T4DNA Ligase and an optimized ligation buffer to allow 5 minute room TM temperature ligation of the ds oligo insert into pmENTR H1 TO e OneShot TOP10 Chemically Competent E coli for high efficiency transformation of the ligation reaction e Tetracycline the inducing agent for regulated expression of the shRNA of interest Note The kit also includes a lacZ2 1 ds control oligo that may be cloned into pENTR H1 TO to generate an entry construct expressing an shRNA targeting the lacZ gene Co transfecting the entry clone and the peDNA 1 2 V5 GW lacZ reporter plasmid supplied with the kit into mammalian cells provide a means to assess the RNAi response in your cell line
55. es Notwithstanding the preceding any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party who has a license from Invitrogen under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon t
56. g in Mammals by Small Interfering RNAs Nature Rev Genet 3 737 747 Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor Laboratory Cold Spring Harbor New York Mulsant P Tiraby G Kallerhoff J and Perret J 1988 Phleomycin Resistance as a Dominant Selectable Marker in CHO Cells Somat Cell Mol Genet 14 243 252 Myslinksi E Ame J C Krol A and Carbon P 2001 An Unusually Compact External Promoter for RNA Polymerase III Transcription of the Human H1RNA Gene Nuc Acids Res 29 2502 2509 Napoli C Lemieux C and Jorgensen R 1990 Introduction of a Chalcone Synthase Gene into Petunia Results in Reversible Co Suppression of Homologous Genes in trans Plant Cell 2 279 289 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 Nykanen A Haley B and Zamore P D 2001 ATP Requirements and Small Interfering RNA Structure in the RNA Interference Pathway Cell 107 309 321 Paddison P J Caudy A A Bernstein E Hannon G J and Conklin D S 2002 Short Hairpin RNAs shRNAs Induce Sequence Specific Silencing in Mammalian Cells Genes Dev 16 948 958 Paul C P Good P D Winer I and Engelke D R 2002 Effective Expression of Small Interfering RNA in Human Cells Nat Biotechnol 20 505 508
57. gCl 5mM ATP 5 mM DIT 25 w v polyethylene glycol 8000 T4 DNA Ligase 1 Weiss U l in 20 ul 10 mM Tris HCl pH 7 5 50 mM KCl 1mM DTT 50 v v glycerol H1 Forward Sequencing 100 ng ul in TE Buffer pH 8 0 20 ul Primer M13 Reverse Primer 100 ng ul in TE Buffer pH 8 0 20 ul LacZ2 1 double stranded 50 uM in 1X Oligo Annealing Buffer 4 ul ds Control Oligo peDNA 1 2 V5 GW lacZ 500 ng ul in TE Buffer pH 8 0 20 ul control plasmid Tetracycline 10 mg ml in water 1 ml Unit Definition of One Weiss unit of T4 DNA Ligase catalyzes the exchange of 1 nmol P abeled T4 DNA Ligase pyrophosphate into y B P ATP in 20 minutes at 37 C Weiss et al 1968 One unit is equal to approximately 300 cohesive end ligation units viii continued on next page Kit Contents and Storage continued Primer Sequences The table below provides the sequence and the amount supplied of the primers included in the kit Primer Sequence Amount H1 Forward 5 TGITCTGGGAAATCACCATA 3 328 pmoles M13 Reverse 5 CAGGAAACAGCTATGAC 3 385 pmoles LacZ2 1 Control The sequences of the lacZ2 1 control oligos are listed below The lacZ2 1 control Oligo Sequences DNA oligos are annealed and are supplied in the kit as a 50 uM double stranded oligo The LacZ2 1 ds Control Oligo needs to be re annealed and diluted 10 000 fold to 5 nM see page 21 before use in the ligation reaction see page 25 LacZ2 1 D
58. he 50 uM stock 100 fold into DNase RNase free water to generate a 500 nM stock 2 Dilute the 500 nM stock 100 fold into 1X Oligo Annealing Buffer to generate a 5 nM stock Use the 5 nM stock for cloning 5 nM ds oligo stock solution heated above room temperature prior to use Thaw ds oligo stock solution on ice or at 4 C prior to use Important Dilute ds oligos will melt and form intramolecular hairpins if heated above room temperature These hairpins will not clone into pENTR H1 TO Incorrect vector insert ratio used in ligation reaction e Forgot to dilute annealed target ds oligo or LacZ2 1 ds Control Oligo 1 10 000 before use e Annealed ds oligo diluted incorrectly Dilute the 50 uM ds oligo mixture as instructed on page 22 to generate a 5 nM stock Use the 5 nM ds oligo stock for cloning ds oligo mixture had a lower percentage of annealed ds oligo Increase the amount of ds oligo used in the ligation reaction e g from 1 ul to 5 ul Ligation reaction not adequately mixed or incorrectly mixed prior to incubation e Mix the ligation reaction well by pipetting up and down Note Flicking the tube is not adequate to mix the reagents e Do not vortex the ligation reaction Did not use the 5X Ligation Buffer supplied with the kit Use the T4 DNA Ligase and 5X Ligation Buffer supplied with the kit for ligation These reagents are optimized to facilitate 5 minute ligation at room tempera
59. he use of this product to manufacture a protein for sale provided that no method claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 For additional information about Invitrogen s policy for the use and distribution of Gateway clones see the section entitled Gateway Clone Distribution Policy page 63 continued on next page 61 Purchaser Notification continued Limited Use Label License No 173 Inhibition of Gene Expression by dsRNA Limited Use Label License No 177 In vivo Oligonuc leotide Generator 62 This product may be covered by one or more of U S Patent No 6 506 559 and or for eign equivalents and is sold under license to Invitrogen Corporation by the Carnegie Institution of Washington A separate license from the Carnegie Institute of Washing ton may be required to use this product This product is for non clinical research use only It is not to be used for commercial purposes Use of this product to produce products for sale or for diagnostic therapeutic or high throughput drug discovery pu
60. hindustanus ble Gene for Transformation of Lower and Higher Eukaryotes to Phleomycin Resistance Nucleic Acids Res 18 4009 Dykxhoorn D M Novina C D and Sharp P A 2003 Killing the Messenger Short RNAs that Silence Gene Expression Nat Rev Mol Cell Biol 4 457 467 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 64 Felgner P L a and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Grishok A Pasquinelli A E Conte D Li N Parrish S Ha I Baillie D L Fire A Ruvkun G and Mello C C 2001 Genes and Mechanisms Related to RNA Interference Regulate Expression of the Small Temporal RNAs That Control C elegans Developmental Timing Cell 106 23 34 Hammond S M Bernstein E Beach D and Hannon G J 2000 An RNA Directed Nuclease Mediates Genetic Interference in Caenorhabditis elegans Nature 404 293 296 Hannon G J 2002 RNA Interference Nature 418 244 251 Hannon G J Chubb A Maroney P A Hannon G Altman S and Nilsen T W 1991 Multiple cis acting Elements are Required for RNA Polymerase III Transcription of the Gene Encoding H1 RNA the RNA Component of Human RNase P J Biol Chem 266 22796 22799 Hillen W and Berens C 1994 Mechanisms Underlying Expression of Tn10 Encoded Tetracycline Resistance Annu Rev Microbiol 48 345 369 Hillen W Gatz
61. id DNA at 20 C 1 Streak the original colony out for a single colony on an LB plate containing 50 ug ml kanamycin or a Low Salt LB plate containing 50 ug ml Zeocin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 ug ml kanamycin or Low Salt LB containing 50 pg ml Zeocin Grow until the culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store the glycerol stock at 80 C Once you have obtained your pPENTR H1 TO entry clone you have a number of options to express your shRNA of interest to perform RNAi analysis See General Considerations for Transfection and Regulated Expression next section for a discussion of your expression options BigDye is a registered trademark of Applied Biosystems 31 General Considerations for Transfection and Regulated Expression Introduction Factors Affecting Gene Knockdown Levels shRNA Expression TM Once you have generated your pENTR H1 TO entry construct you are ready to express your shRNA of interest and to perform RNAi analysis of your target gene This section provides general guidelines to help you design your transfection and RNAi experiment We recommend that you read through this section before beginning A number of factors can influence the degree to which expression of your gene of interest is reduced i e gene knockdown in an RNAi experiment including
62. ine to assay for target gene knockdown c Perform an LR recombination reaction between the entry construct and a suitable Gateway destination vector to generate an expression clone for use in other RNAi applications For more information about the Gateway Technology refer to the Gateway Technology with Clonase II manual which is available for downloading from our Web site www invitrogen com or by calling Technical Service see page 59 continued on next page Overview continued Purpose of this Manual Important This manual provides an overview of the BLOCK iT Inducible H1 RNAi Entry Vector Kit and provides instructions and guidelines to e Design the appropriate single stranded oligonucleotides representing the target gene e Anneal the single stranded oligonucleotides to generate a double stranded oligonucleotide ds oligo e Clone the ds oligo into the pENTR H1 TO vector and transform the ligation reaction into competent E coli e Generate stable mammalian TetR expressing cell lines provides guidelines only TM e Transfect your PENTR H1 TO construct into a mammalian TetR expressing cell line to perform transient tetracycline regulated RNAi analysis e Transfect your pENTR H1 TO construct into a mammalian TetR expressing cell line and perform Zeocin selection to generate a stable cell line for tetracycline regulated RNAi analysis e Perform an LR recombination reaction with a suit
63. ion DNase RNase Free Water to a final volume of 19 ul 8 ul T4 DNA Ligase 1 U ul 1 pl 11d Total volume 20 ul 20 ul 2 Mix reaction well by pipetting up and down Note The presence of PEG and glycerol supplied by the Ligation Buffer and the T4 DNA Ligase will make the reaction mixture viscous Be sure to mix the reaction thoroughly by pipetting up and down Do not vortex 3 Incubate for 5 minutes at room temperature Note The incubation time may be extended up to 2 hours and may result in a higher yield of colonies 4 Place the reaction on ice and proceed to Transforming One Shot TOP10 Competent E coli next page Note You may store the ligation reaction at 20 C overnight 27 Transforming One Shot TOP10 Competent E coli Introduction Materials to Have on Hand 28 Once you have performed the ligation reaction you will transform your ligation mixture into competent E coli One Shot TOP10 Chemically Competent E coli Box 2 are included with the kit to facilitate transformation One Shot TOP10 E coli have a transformation efficiency of 1 x 10 cfu ug plasmid DNA You will need to have the following materials on hand before beginning Ligation reaction from Step 3 previous page One Shot TOP10 Chemically Competent E coli supplied with the kit Box 2 one vial per transformation thaw on ice immediately before use S O C Medium supplied with the kit Box 2 warm to room
64. ion of shRNA sequence Verify that the shRNA sequence does not contain gt 3 tandem T s which can cause premature transcription termination Select a different target region Vary the length of the shRNA sequence e g if the target sequence is 19 bp try increasing the stem length 3 nucleotides Select a different loop sequence Vary the length of the loop Reverse the orientation of the shRNA hairpin sequence e g change oligo sequence from sense loop antisense to antisense loop sense orientation 48 continued on next page Troubleshooting continued Transient Transfection and RNAi Analysis continued Problem Reason Solution Low levels of tetracycline regulated gene knockdown observed continued Did not add enough tetracycline Increase the amount of tetracycline used for induction Targeted an essential gene Generate a stable cell line then add tetracycline to induce shRNA expression Gene knockdown observed but not tetracycline regulated Did not transfect the pENTR H1 TO entry construct into a cell line expressing Tet repressor Transfect the entry construct into a cell line that expresses Tet repressor TM e Use one of Invitrogen s T REx Cell Lines OR e Generate your own stable TetR expressing cell line using pcDNA 6 TR or pLenti6 TR as desired Significant target gene knockdown observed in uninduced cells Insufficient amount of Tet re
65. isting of the H1 TO promoter shRNA sequence and the Pol III terminator The sequence of pENTR H1 TO is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 59 For a map of pENTR H1 TO see the Appendix page 51 M13 forward 20 priming site r 1 CGACGTTGTA AAACGACGGC CAGTCTTAAG CTCGGGCCCC AAATAATGAT TTTATTTTGA CTGATAGTGA attL1 CCTGTTCGTT AATTCAGTCG TTAAGTCAGC GCAACAAATT GATGAGCAAT GCTTTTTTAT AATGCCAACT TTGTACAAAA AAGCAGGCTT TAAAGGAACC AACATGT T TSG SCCr re tee ee H1 TO promoter H1 forward priming site ACTGCAT CEG GTACCGGGCC CCCCCTCGAA CATCTAATAT TTGCATGTCG CTATGTGTTC TGGGAAATCA TGACCTAGGC CATGGCCCGG GGGGGAGCTT CTAGATTATA AACGTACAGC GATACACAAG ACCCTTTAGT Transcriptional start TetO sequence TATA box TetO sequence Pol IIl terminator CCATAAACGT GGTATTTGCA I LC GAG GCITST ACAGCTCGAA GAAATCCCTA TCAGTGATAG AGACTTATAA GTTCCCTATC AGTGATAGAG A N oligo eiia al RY h CTTTAGGGAT AGTCACTATC TCTGAATATT CAAGGGATAG TCACTATCTC TGTGGH AAAAE attL2 r CCTTCGGGAA GCTCTCCATA TTTTTTGGAT CCACTAGTTC TAGACCCAGC TTITTCTTGTAC AAAGTTGGCA GGAAGCCCTT CGAGAGGTAT AAAAAACCTA GGTGATCAAG ATCTGGGTCG AAAGAACATG TTTCAACCGT TTATAAGAAA GCTGATATCC l GCATTGCTTA TCAATTTGTT GCAACGAACA GGTCACTATC AGTCAAAATA AAATCATTAT TTGCCATCCA M13 reverse priming site r 1 CCTATAGTGA GTCGTATTAC ATGGTCATAG CTGTTTCCTG GCAGCTCTGG 19
66. ity of the Tet repressor for the tet operator is Ks 2 x 10 M as measured under physiological conditions where Ks is the binding constant Hillen amp Berens 1994 The association constant Ka of tetracycline for the Tet repressor is 3 x 10 M Takahashi et al 1991 continued on next page 11 How Tetracycline Regulation Works continued Diagram of Tetracycline Regulation 12 Entry Vector System 1 Introduce the pcDNA 6 TR plasmid or the Lenti6 TR lentiviral construct into the mammalian cells of interest Add Blasticidin to select for a stable Tet repressor TetR expressing cell line Transfect the pENTR H1 TO entry construct into Sre EE cells Upon transfection Tet homodimers bind to Tet operator 2 TetO sequences in the pENTR H1 TO construct repressing transcription of the shRNA of interest Added tetracycline tet binds to tetR homodimers Binding of tet to tetR homodimers causes a conformational change in tetR release from the Tet M sequences and induction of shRNA transcription A fetRAtetR The figure below illustrates the mechanism of tetracycline regulated expression and derepression of the shRNA of interest in the BLOCK iT Inducible H1 RNAi gt i 4 tetR AtetR tetR AtetR tetRAtetR TetO 2 tetR Expression Derepressed TetO TATA TetO shRNA of interest Expression Repressed tetRAtetR TetO shRNA of interest
67. kit into PENTR H1 TO we recommend using the resulting pENTR GW H1 TO lacZ2 1 4 entry construct as a positive control to assess the RNAi response in your cell line Simply co transfect the pENTR GW H1 TO lacZ2 1 entry construct and the pcDNA 1 2 V5 GW lacZ reporter plasmid supplied with the kit into your TetR expressing mammalian cells and assay for knockdown of galactosidase expression 48 hours post transfection using Western blot analysis or activity assay For more information about the TM pcDNA 1 2 V5 GW lacZ reporter plasmid recommendations for transfection and methods to assay for B galactosidase activity see the next page continued on next page Transfecting Cells continued pcDNA 1 2 V5 GW lacZ Reporter Plasmid Transfecting the LacZ Containing Reagents Materials Needed The pcDNA 1 2 V5 GW lacZ reporter plasmid is supplied with the kit for use as a positive control to assay for the RNAi response in your mammalian cell line In this vector B galactosidase is expressed as a C terminally tagged fusion protein under the control of the human cytomegalovirus CMV promoter The pcDNA 1 2 V5 GW lacZ vector is supplied as 500 ng ul of plasmid DNA in TE Buffer pH 8 0 Dilute the stock as necessary for use in transfection see the next page If you wish to propagate the plasmid transform a recA end A E coli strain such as TOP10 Use 10 ng of plasmid for transformation and select on LB agar plates
68. knockdown experiment RNAi Analysis Problem Reason Solution Low levels of tetracycline regulated gene knockdown observed Low transfection efficiency if TM using Lipofectamine 2000 Reagent Antibiotics added to the media during transfection Cells too sparse at the time of transfection Not enough plasmid DNA transfected Not enough Lipofectamine 2000 used Do not add antibiotics to the media during transfection Plate cells such that they will be 90 95 confluent at the time of transfection Increase the amount of plasmid DNA transfected Optimize the transfection conditions for your cell line by varying the amount of TM Lipofectamine 2000 used Select for a stable cell line Did not wait long enough after induction before assaying for gene knockdown Repeat the transfection and wait for a longer period of time after induction before assaying for gene knockdown Perform a time course of expression to determine the point at which the highest degree of gene knockdown occurs ds oligo insert in your pENTR H1 TO construct contains mutations When analyzing kanamycin resistant transformants sequence the ds oligo insert to verify its sequence Select constructs containing the correct ds oligo insert for use in RNAi analysis shRNA sequence not optimal due to Target region selected Length of the shRNA sequence i e stem length Loop sequence Orientat
69. lian and invertebrate systems The BLOCK iT Inducible H1 RNAi Entry Vector Kit and the BLOCK iT U6 RNAi Entry Vector Kit Catalog nos K4920 00 and K4945 00 respectively use a vector based approach to allow efficient generation of RNAi cassettes for constitutive or regulated expression of shRNA molecules in mammalian cells Other BLOCK iT RNAi products are available to facilitate production and delivery of synthetic short interfering RNA siRNA diced siRNA d siRNA or double stranded RNA dsRNA for RNAi analysis in mammalian cells or invertebrate organisms as appropriate For more information about any of the BLOCK iT RNAi products see the RNAi Central application portal at www invitrogen com rnai or contact Technical Service see page 59 TM continued on next page Overview continued The T REx Technology Gateway Technology TM The T REx Technology facilitates tetracycline regulated expression of a gene of interest in mammalian cells through the use of regulatory elements from the E coli Tn10 encoded tetracycline Tet resistance operon Hillen amp Berens 1994 Hillen et al 1983 Tetracycline regulation in the T REx System is based on the binding of tetracycline to the Tet repressor and derepression of the promoter controlling expression of the gene of interest Yao et al 1998 The main TM components of the T REx System include e An inducible expression construct to facilitate tetracyclin
70. line Catalog Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail E mail tech_service invitrogen com jpinfo invitrogen com eurotech invitrogen com Certificate of Analysis Material Data Safety Sheets MSDSs Limited Warranty Product qualification is described in the Certificate of Analysis CofA available on our website by product lot number at www invitrogen com cofa MSDSs are available on our Web site at www invitrogen com On the home page click on Technical Resources and follow instructions on the page to download the MSDS for your product Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concern
71. mants sih aE E e e a SEAE e E EN E a E REE 30 General Considerations for Transfection and Regulated Expression sse 32 Trarnstecuneg Cells z tcs A A EEE fac R A E E A edes e metis 36 Gen rating a Stable Cel Dine desee meteo E A ERE BEE erat eei tists 40 Guidelines to Perform the LR Recombination Reaction sss 43 Troubleshooting obses has edet ind Heid nih Ghia va eda fe plora be even adf earn iad ee 45 Appendix iscrio eeen aaae a reee Aaaa aa eaaa oraa eaa Oaa aaa e PUO ER OCDE UOI ARA 51 Recipes a E E EAE ERAT E E ARETE ER E AE EST TEES 51 Generating a TetR Expressing Host Cell Line seen nennen 52 Vidi pm ETT E P soda gales adc EERE 54 Map anid Features of pENTR ET TQ necat e tete epp et ae poa lh ere bee 56 Map of pcIDDNAT 2 V5 GW NACL ssc teet ete e Pte Petre ts Eee dep Pts 58 Technical Services suse enema enenatis nent den 59 Purchaser Notificatiori assis aene Coe D AR O D OU OUR ORI ERO I RRR ARARE e iie 60 Gateway Clone Distribution Polly ei tet sede UE bebe cte Mute ftii Cu abaci ictu do tei fedele 63 References ueniet ee t et be ve te evi ve ere dem d a Po ec te eem tied 64 H1 TO Entry Clone Generation Procedure for Experienced Users Introduction This quick reference sheet is provided for experienced users of the H1 TO entry clone generation procedure If you are performing the annealing cloning or transformation procedures for the first time follow the detailed
72. nces required to facilitate directional cloning e Transcription initiation site e Sequences encoding the shRNA of interest i e stem and loop sequences Bottom strand oligo e Sequences required to facilitate directional cloning e Sequences complementary to the top strand oligo For more information about the sequence requirements for directional cloning see below For guidelines to choose the target loop and transcription initiation sequences see pages 16 16 For an example of ss oligo design see page 18 continued on next page Designing the Single Stranded DNA Oligos continued Sequences Required for Directional Cloning Structural Features of the shRNA To enable directional cloning of the ds oligo into pENTR H1 TO you must add the following 4 nucleotides to the 5 end of the corresponding ss oligo Top strand oligo Add CACC to the 5 end of the oligo The CACC is complementary to the overhang sequence GTGG in the pENTR H1 TO vector and constitutes the last 4 bases of the H1 TO promoter Bottom strand oligo Add AAAA to the 5 end of the oligo The AAAA is complementary to the overhang sequence TTTT in the pENTR H1 TO vector and constitutes the first 4 bases of the Pol III terminator Refer to page 19 for a diagram of the cloning site for pgENTR H1 TO Reminder When designing the top strand oligo encoding the shRNA remember that an shRNA generally contains the following structural features A sh
73. neal the top and bottom strand oligos to generate a double stranded oligonucleotide ds oligo suitable for cloning into the pENTR H1 TO vector The design of the single stranded oligonucleotides ss oligos is critical to the success of both the cloning procedure and ultimately the RNAi analysis General guidelines are provided in this section to help you choose the target sequence and to design the ss oligos Note however that simply following these guidelines does not guarantee that the shRNA will be effective in knocking down the target gene For a given target gene you may need to generate and screen multiple shRNA sequences to identify one that is active in gene knockdown studies We recommend using Invitrogen s RNAi Designer an online tool to help you design and order shRNA sequences for any target gene of interest The RNAi Designer incorporates the guidelines provided in this manual as well as other design rules into a proprietary algorithm to design shRNA sequences from a target sequence that are compatible for use in cloning into the pENTR H1 TO or pENTR U6 vectors Alternatively if you have identified a synthetic siRNA that is active in triggering knockdown of your target gene the RNAi Designer will convert the siRNA into a suitable shRNA To use the RNAi Designer see www invitrogen com rnai When designing the top and bottom strand single stranded oligos consider the following factors Top strand oligo e Seque
74. nerally use the following gel and molecular weight standard e Agarose gel 4 E Gel Invitrogen Catalog no G5000 04 e Molecular weight standard 10 bp DNA Ladder Invitrogen Catalog no 10821 015 When analyzing an aliquot of the annealed ds oligo reaction by agarose gel electrophoresis we generally see the following e A detectable higher molecular weight band representing annealed ds oligo e lt A detectable lower molecular weight band representing unannealed single stranded oligos Note that this band is detected since a significant amount of the single stranded oligo remains unannealed For an example of expected results obtained from agarose gel analysis see the next page If the band representing ds oligo is weak or if you do not see a band see Troubleshooting page 45 for tips to troubleshoot your annealing reaction The efficiency at which ss oligos anneal may vary depending on their sequence and length When analyzing the annealed ds oligo reaction by agarose gel electrophoresis evaluate the annealing efficiency and roughly estimate the percentage of annealed ds oligo produced by comparing the intensity of the higher molecular weight band annealed ds oligo to the lower molecular band unannealed ss oligos You will use this information when setting up your ligation reaction see Amount of ds Oligo to Use page 25 for details continued on next page 23 Generating the Double Stranded Oligo ds oligo c
75. nformation on Lipofectamine 2000 Reagent refer to our Web site www invitrogen com or call Technical Service see page 59 When designing your RNAi experiment you should consider how to assay for knockdown of the target gene After you have transfected your pENTR H1 TO construct into TetR expressing mammalian cells you may e Pool a heterogeneous population of cells and test for target gene knockdown after induction with tetracycline i e transient knockdown We recommend waiting for a minimum of 24 48 hours after induction before assaying for target gene knockdown to allow time for the shRNA to be expressed and processed e Select for stably transfected cells using Zeocin Selection requires a minimum of 10 14 days after transfection but allows generation of clonal cell lines that stably express the shRNA of interest shRNA expression will be tetracycline regulated expression Options 2 page 32 or constitutive expression Option 4 page 32 For more information about Zeocin selection see Generating a Stable Cell Line page 40 continued on next page General Considerations for Transfection and Regulated Expression continued Tetracycline Using Tetracycline Tetracycline in Fetal Bovine Serum Tetracycline MW 444 4 is commonly used as a broad spectrum antibiotic and acts to inhibit translation by blocking polypeptide chain elongation in bacteria In the BLOCK iT Inducible H1 RNAi System tetra
76. ng We recommend initiating the shRNA sequence at an adenosine A or a guanosine G Note that transcription of the native H1 RNA initiates at an A Initiating transcription at a C or T is generally not recommended as this may affect initiation efficiency and position When choosing the transcription initiation site you should also keep the following in mind Initiation at an A e If Ais the first base of the target sequence you do not need to add the complementary T to the 3 end of the top strand oligo because the T will be supplied by the first base of the Pol III terminator Similarly if the first 2 or 3 bases of the target sequence are A s you may omit adding the complementary T s to the 3 end of the top strand oligo For an example see Example 2 on the next page e If Ais not the first base of the target sequence add an A to the 5 end of the top strand oligo You may omit adding a complementary T to the 3 end of the top strand oligo as the T will be supplied by the first base of the Pol III terminator Initiation at a G e If Gis the first base of the target sequence then add a complementary C to the 3 end of the top strand oligo e IfGis not the first base of the target sequence we recommend adding a G to the 5 end of the top strand oligo directly following the CACC overhang sequence In this case do not add the complementary C to the 3 end of the top strand oligo For an example see Example 1 on the next page Note
77. nts using the pENTR H1 TO construct only Use the pLenti6 TR lentiviral construct available from Invitrogen to generate a TetR expressing cell line pLenti6 TR is a lentiviral based vector that expresses the Tet repressor and is the regulatory vector available with Invitrogen s BLOCK iT Inducible H1 Lentiviral RNAi System Catalog no K4925 00 or the ViraPower T REx System Catalog no K4965 00 If you plan to perform RNAi analysis using both the pENTR H1 TO construct and the pLenti4 BLOCK T DEST construct we recommend using pLenti6 TR to generate your TetR expressing cell Line Note pLenti6 TR is also available separately from Invitrogen Catalog no V480 20 For guidelines to generate your own TetR expressing cell line see pages 52 53 Using shRNA for RNAi Analysis The RNAi Pathway RNAi describes the phenomenon by which dsRNA induces potent and specific stRNA and shRNA inhibition of eukaryotic gene expression via the degradation of complementary messenger RNA mRNA and is functionally similar to the processes of post transcriptional gene silencing PTGS or cosuppression in plants Cogoni et al 1994 Napoli et al 1990 Smith et al 1990 van der Krol et al 1990 and quelling in fungi Cogoni amp Macino 1997 Cogoni amp Macino 1999 Romano amp Macino 1992 In plants the PTGS response is thought to occur as a natural defense against viral infection or transposon insertion Anandalakshmi et al 1998
78. oligos Make sure that you mix single stranded oligos with complementary sequence Ligation and The table below lists some potential problems and possible solutions that may Transformation help you troubleshoot the ligation and transformation procedures Reactions Problem Reason Solution Few kanamycin resistant colonies obtained on the selective plate Single stranded oligos designed incorrectly Make sure that each single stranded oligo contains the 4 nucleotides on the 5 end required for cloning into pENTR H1 TO e Top strand oligo include CACC on the 5 end e Bottom strand oligo include AAAA on the 5 end ds oligos stored incorrectly Store the ds oligo stocks at 20 C Ligation reaction not incubated for long enough Extend the incubation time of the ligation reaction up to 2 hours at room temperature continued on next page 45 Troubleshooting continued Ligation and Transformation Reactions continued Problem Reason Solution Few kanamycin resistant colonies obtained on the selective plate continued ds oligos were degraded e Store the 5 nM ds oligo stock in 1X Oligo Annealing Buffer e Avoid repeated freeze thaw cycles Aliquot the 5 nM ds oligo stock and store at 20 C 500 nM ds oligo stock solution diluted into water instead of 1X Oligo Annealing Buffer To dilute the 50 uM ds oligo reaction 1 Dilute t
79. ontinued Example of Expected Results 24 bp 100 50 40 30 20 In this experiment two 47 bp oligos top and bottom strand were annealed 50 uM final concentration using the reagents supplied in the kit and following the procedure on page 21 to generate a ds control oligo The annealing reaction was diluted 100 fold in water to a concentration of 500 nM Aliquots of the diluted ds oligo 5 ul and each corresponding single stranded oligo 5 ul of a 500 nM stock were analyzed on a 4 E Gel Results The ds oligo annealing reaction shows a clearly detectable higher molecular weight band that differs in size from each component single stranded oligo Remaining unannealed ss oligo is also detectable In this reaction we estimate that the efficiency of the annealing reaction was greater than 50 Note The agarose gel is non denaturing therefore the single stranded oligos do not resolve at the expected size due to formation of secondary structure Lane 1 10 bp DNA Ladder Lane 2 Top strand oligo ZH 1 7 Lane 3 Bottom strand oligo lt ds oligo Lane 4 ds oligo annealing reaction Lane 5 10 bp DNA Ladder i 7 ss oligo Lid End Performing the Ligation Reaction Introduction Important Amount of ds Oligo to Use Once you have generated your ds oligo and have diluted it to the appropriate concentration you will clone the ds oligo into the pENTR H1 TO vector and transform your
80. or tetracycline regulated RNAi analysis e Transfect the entry clone into a non TetR expressing mammalian cell line for transient non tetracycline regulated RNAi analysis Select for a stable cell line to constitutively express the shRNA of interest if desired e Transfer the H1 TO RNAi cassette into a suitable destination vector using Gateway Technology e g pLenti4 BLOCK T DEST For more information about TetR expressing mammalian cell lines available from Invitrogen i e T REx Cell Lines or how to generate your own TetR expressing cell line see the next page continued on next page BLOCK iT Inducible H1 RNAi Entry Vector Kit continued Tet Repressor Expressing Cell Lines To express your shRNA of interest in a tetracycline regulated manner you will need a mammalian host cell line that stably expresses the tetracycline repressor TetR to prevent basal target gene knockdown You may obtain or generate this TetR expressing cell line in the following ways Use one of the T REx Cell Lines available from Invitrogen These cell lines express the Tet repressor from the pcDNA 6 TR plasmid the regulatory vector available with Invitrogen s T REx System For more information TM about the T REx Cell Lines see page xii Use the pcDNA 6 TR plasmid available from Invitrogen Catalog no V1025 20 to generate your own TetR expressing cell line This is recommended if you plan to perform your RNAi experime
81. ort nucleotide sequence derived from the target gene i e target sequence followed by A short loop and A short nucleotide sequence that is the reverse complement of the initial target sequence Note that upon transcription the target sequence and its complement base pair to form the stem of the shRNA For guidelines to choose the target and loop sequences see the next page continued on next page 15 Designing the Single Stranded DNA Oligos continued Choosing the Target Sequence Loop Sequence 16 When performing RNAi analysis on a particular gene your choice of target sequence can significantly affect the degree of gene knockdown observed We recommend following the guidelines below when choosing your target sequence Note that these are general recommendations only and that exceptions may occur Length We recommend choosing a target sequence ranging from 19 to 29 nucleotides in length Longer sequences may induce non specific responses in mammalian cells Complexity e Make sure that the target sequence does not contain runs of more than three of the same nucleotide In particular avoid choosing a target sequence that contains runs of four thymidines T s as this will result in early transcription termination e Choose a sequence with low GC content 30 50 GC content is recommended e Avoid choosing a target sequence that is a known site for RNA protein interaction Homology Make sure that the
82. otics such as Blasticidin Geneticin and hygromycin Zeocin sensitive cells do not round up and detach from the plate but may exhibit the following morphological changes e Vast increase in size similar to the effects of cytomegalovirus infecting permissive cells e Abnormal cell shape e Presence of large empty vesicles in the cytoplasm breakdown of the endoplasmic reticulum and Golgi apparatus or scaffolding proteins e Breakdown of plasma and nuclear membrane appearance of many holes in these membranes Eventually these cells will completely break down and only strings of protein will remain Zeocin resistant cells should continue to divide at regular intervals to form distinct colonies There should not be any distinct morphological changes in TM Zeocin resistant cells when compared to non selected cells Have the following materials on hand before beginning e TetR expressing mammalian cell line of interest make sure that cells are healthy and gt 90 viable before beginning Note If your cell line expresses TetR from pcDNA 6 TR or pLenti6 TR maintain the cells in medium containing the appropriate concentration of Blasticidin e pENTR H1 TO entry construct e Transfection reagent of choice e g Lipofectamine 2000 e Zeocin 100 mg ml in sterile water e Blasticidin to maintain the pcDNA 6 TR or pLenti6 TR construct in the TetR expressing cell line e Tetracycline supplied with the kit
83. ozen R710 07 T REx HeLa Cell Line 3 x 106 cells frozen R714 07 T REx CHO Cell Line 3 x 106 cells frozen R718 07 T REx Jurkat Cell Line 3 x 106 cells frozen R722 07 Flp In T REx 293 Cell Line 3 x 106 cells frozen R780 07 pcDNA 6 TR 20 ug V1025 20 The reagents supplied in the BLOCK iT Inducible H1 Lentiviral RNAi System are available separately from Invitrogen Ordering information is provided below Product Amount Catalog no BLOCK iT Lentiviral RNAi Zeo 20 constructions V488 20 Gateway Vector Kit pLenti6 TR Vector Kit 20 ug 480 20 Gateway LR Clonase II Enzyme Mix 20 reactions 11791 020 100 reactions 11791 100 One Shot Stbl3 Chemically Competent 20 x 50 ul C7373 03 E coli ViraPower Zeo Lentiviral Support Kit 20 reactions K4985 00 293FT Cell Line 3 x 106 cells frozen R700 07 Blasticidin 50mg R210 01 Overview Introduction Advantages of the BLOCK iT Inducible H1 RNAi Entry Vector Kit BLOCK iT RNAi Technology Introduction The BLOCK iT Inducible H1 RNAi Entry Vector Kit combines Invitrogen s BLOCK iT RNAi and T REx technologies to facilitate tetracycline regulated expression of a short hairpin RNA shRNA of interest from an H1 TO RNAi cassette for use in RNA interference RNAi analysis in mammalian cells The kit provides a Gateway adapted entry vector designed to allow efficient transient or stable regulated ex
84. pression of shRNA in dividing mammalian cells or easy transfer of the H1 TO RNAi cassette into other suitable Gateway destination vectors for other RNAi applications For more information about the BLOCK iT RNAi T REx and Gateway technologies see below and the next page TM Using the BLOCK iT Inducible H1 RNAi Entry Vector Kit for vector based expression of shRNA provides the following advantages e Provides a rapid and efficient way to clone double stranded oligonucleotide ds oligo duplexes encoding a desired shRNA target sequence into an entry vector containing an RNA Polymerase III Pol IIT driven expression cassette i e H1 TO RNAi cassette for use in RNAi analysis e The entry construct containing the H1 TO RNAi expression cassette may be directly transfected into mammalian cells expressing the Tet repressor to enable rapid tetracycline regulated screening of shRNA target sequences e The entry construct contains a Zeocin resistance marker to allow generation of stable cell lines that express the shRNA of interest upon tetracycline addition e The vector is Gateway adapted to allow easy transfer of the H1 TO RNAi cassette into any appropriate expression system for other RNAi applications e g lentiviral system for stable delivery of regulated shRNA in hard to transfect or non dividing mammalian cells TM A variety of BLOCK iT RNAi products are available from Invitrogen to facilitate RNAi analysis in mamma
85. pressor expressed when transfecting a stable TetR expressing cell line Screen other TetR expressing clones Choose the clone that exhibit the highest level of TetR expression for use as the host for your pENTR H1 TO construct Co transfected a TetR expression plasmid and the pENTR H1 TO construct e Use 6 fold more TetR expression plasmid DNA than pENTR H1 TO plasmid DNA in the co transfection e Transfect the pENTR H1 TO construct into a cell line that stably expresses TetR When generating the TetR expressing cell line pcDNA 6 TR or pLenti6 TR construct introduced into a mammalian cell line in which the CMV promoter is down regulated Use a mammalian cell line in which the CMV promoter is not down regulated as the host for the pcDNA 6 TR or pLenti6 TR construct No gene knockdown observed even after tetracycline induction shRNA with no activity chosen e Verify that the shRNA sequence does not contain gt 3 tandem T s which can cause premature transcription termination e Select a different target region Hairpin designed incorrectly Follow the guidelines on pages 14 19 to select the target sequence and design the single stranded oligos Forgot to add tetracycline Treat cells 3 to 24 hours after transfection with tetracycline to induce shRNA expression Assay for target gene knockdown 24 96 hours following induction as appropriate continued on next page 49
86. product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com continued on next page Purchaser Notification continued Limited Use Label License No 19 Gateway Cloning Products Gateway Clone Distribution Policy This product and its use is the subject of one or more of U S Patent Nos 5 888 732 6 143 557 6 171 861 6 270 969 and 6 277 608 and or other pending U S and foreign patent applications owned by Invitrogen Corporation The purchase of this product conveys to the buyer the non transferable righ
87. protocols provided in the manual Step Action Design single stranded DNA oligos Follow the guidelines on pages 14 19 to design single stranded DNA oligos encoding the shRNA of interest Anneal the single stranded 1 Set up the following annealing reaction oligos to generate a ds oligo 200 uM top strand oligo 5 ul 200 uM bottom strand oligo 5 ul 10X Oligo Annealing Buffer 2 ul DNase RNase free water 8 ul Total volume 20 ul 2 Heat the reaction mixture to 95 C for 4 minutes 3 Remove the sample and set on the laboratory bench Allow the reaction to cool to room temperature for 5 10 minutes Spin down the sample in a microcentrifuge for 5 seconds Mix gently Dilute the ds oligo mixture 10 000 fold by performing two serial 100 fold dilutions the first into DNase RNase free water and the second into 1X Oligo Annealing Buffer Final concentration is 5 nM Clone the ds oligo into 1 Set up the following ligation reaction pENTR H1 TO 5X Ligation Buffer 4 ul pENTR H1 TO 0 75 ng pl 2 ul ds oligo 5 nM 1 10 000 dilution 1 5 ul DNase RNase Free water to a final volume of 19 ul T4 DNA Ligase 1 U ul lul Total volume 20 ul Mix reaction well and incubate for 5 minutes at room temperature Place reaction on ice and proceed to transform E coli below Transform One Shot TOP10 1 Add 2 pl of the ligation reaction into a vial of One Shot TOP10 Chemically Competent E coli chemically competent E coli and mix g
88. rRNA tRNA 7SL RNA U6 snRNA H1 RNA and a number of other small stable RNAs that are involved in RNA processing Paule amp White 2000 Some of the hallmarks of RNA Polymerase III based transcription are that e Transcription initiates and terminates at fairly precise points e There is little addition of unwanted 5 and 3 sequences to the RNA molecule For more information about RNA Polymerase III transcription refer to published reviews or reference sources Paule amp White 2000 White 1998 Use of siRNA diced siRNA or synthetic siRNA for RNAi analysis in mammalian cells is limited by their transient nature To address this limitation a number of groups have developed vector based systems to facilitate expression of siRNA and shRNA in mammalian cells Brummelkamp et al 2002 McManus et al 2002 Paddison et al 2002 Paul et al 2002 Sui et al 2002 Yu et al 2002 At Invitrogen we have developed the Gateway adapted pENTR H1 TO vector to facilitate generation of an entry clone containing a ds oligo encoding an shRNA of interest within the context of an RNA Polymerase III driven expression cassette i e H1 TO RNAi cassette see the next page The resulting pENTR H1 TO entry construct may be introduced into dividing mammalian cells for transient or stable tetracycline regulated expression of the shRNA of interest and initial RNAi screening if desired Once initial screening is complete the H1 TO RNAi casse
89. rately from Invitrogen Choose the option that best fits your needs TM e Transfect the pceDNA 6 TR plasmid i e TetR expression plasmid from the T REx System into your mammalian cells of interest Use Blasticidin to select for a stable cell line e Transfect the pLenti6 TR plasmid i e TetR expression plasmid from the ViraPower T REx and BLOCK iT Inducible H1 Lentiviral RNAi System into your mammalian cells of interest Alternatively produce a Lenti6 TR lentiviral stock and use this stock to transduce the mammalian cells of interest Use Blasticidin to select for a stable cell line For more information about pcDNA 6 TR pLenti6 TR and Blasticidin see the manual for each product All manuals are available for downloading from our Web site www invitrogen com or by calling Technical Service see page 59 To TM obtain the pcDNA 6 TR or pLenti6 TR plasmids or Blasticidin see page xii Both pcDNA 6 TR and pLenti6 TR contain the same TetR gene Postle et al 1984 Similarly expression of TetR from both plasmids is controlled by the human cytomegalovirus CMV promoter Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 Although highly active in most mammalian cell lines activity of the viral CMV promoter can be down regulated in some cell lines due to methylation Curradi et al 2002 histone deacetylation Rietveld et al 2002 or both When generating your own TetR expressing cell line be sur
90. romoter bases 1836 1935 tetO site bases 1885 1903 TATA box bases 1906 1910 tetO site bases 1913 1931 H1 forward priming site bases 1856 1875 5 overhang bases 1932 1935 C 5 overhang bases 1936 1939 Pol Ill transcription terminator bases 1936 1941 attL2 bases 1994 2093 M13 reverse priming site bases 2134 2150 Kanamycin resistance gene bases 2263 3072 pUC origin bases 3193 3866 C complementary strand ET ggg Po term continued on next page Map and Features of pENTR H1 TO continued Features of pENTR H1 TO 3869 bp contains the following elements All features have pENTR H1 TO been functionally tested and the vector fully sequenced Feature Benefit rrnB T1 and T2 transcription terminators Reduces potential toxicity in E coli by preventing basal expression of the double stranded oligonucleotide of interest SV40 polyadenylation signal Allows transcription termination and polyadenylation of mRNA Zeocin resistance Sh ble gene Allows stable selection in mammalian cells and prokaryotes Drocourt et al 1990 Mulsant et al 1988 EM7 promoter Synthetic prokaryotic promoter for expression of TM the Zeocin resistance marker in E coli SV40 early promoter and origin Allows high level expression of the selection marker and episomal replication in cells expressing the SV40 large T antigen M13 forward 20 priming site Allows sequencing of the insert
91. rposes the screening of more than 10 000 com pounds per day is prohibited In order to obtain a license to use this product for these commercial purposes contact The Regents of the University of California This product or the use of this product is covered by U S Patent No 5 624 803 owned by The Regents of the University of California Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invi
92. s about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 59 Purchaser Notification
93. sequence required for cloning reverse complement of top strand oligo sequence Bottom strand oligo 5 AAAACTGGACTTCCAGAAGAACATTCGTGTTCTTCTGGAAGTCCAGC 3 sequence required for cloning Annealing ds oligo 5 CACCGCTGGACTTCCAGAAGAACACGAATGTTCTTCTGGAAGTCCAG 3 3 CGACCTGAAGGTCTTCTTGTGCT TACAAGAAGACCTTCAGGTCAAAA 5 Example 2 ss This example lists the sequences of top and bottom strand oligos encoding an Oligo Design shRNA targeting the lacZ gene These particular ss oligos were annealed to generate the lacZ2 1 ds control oligo supplied in the kit Note that in this shRNA sequence the first 3 bases of the target sequence are A s Thus the 3 corresponding T s were omitted from the 3 end of the top strand oligo 1 antisense target sequence loop sense target sequence Top strand oligo 5 CACCAAATCGCTGATTTGTGTAGTCGGAGACGACTACACAAATCAGCGA 3 l sequence required for cloning reverse complement of top strand oligo sequence r 1 Bottom strand oligo 5 AAAATCGCTGATTTGTGTAGTCGTCTCCGACTACACAAATCAGCGATTT 3 ees sequence required for cloning Annealing ds oligo 5 CACCAAATCGCTGATTTGTGTAGTCGGAGACGACTACACAAATCAGCGA 3 3 TTTAGCGACTAAACACATCAGCCTCTGCTGATGTGTTTAGTCGCTAAAA 5 continued on next page 18 Designing the Single Stranded DNA Oligos continued NI 4 ECO Cloning Site and EN Nous l Recombination Region of
94. sity of the higher molecular weight band is greater than the intensity of the lower molecular weight band on an agarose gel then use 1 2 ul of the 5 nM ds oligo stock in the ligation reaction e If your ss oligos anneal less efficiently i e the intensity of the higher molecular is equivalent to or less than the intensity of the lower molecular weight band on an agarose gel then increase the amount of the 5 nM ds oligo stock used in the ligation reaction from 1 pl up to 5 ul continued on next page 25 Performing the Ligation Reaction continued Positive Control Important Materials Needed 26 We recommend including the lacZ2 1 ds control oligo supplied with the kit as a positive control in your ligation experiment The lacZ2 1 ds control oligo is supplied as a 50 uM stock in 1X Oligo Annealing Buffer and needs to be re annealed and diluted 10 000 fold before use in a ligation reaction see page 21 See page ix for the sequence of each strand of the lacZ2 1 ds control oligo Note that the lacZ2 1 ss control oligos anneal less efficiently than other ss oligos therefore we recommend using 5 pl of the 5 nM ds oligo stock in the ligation reaction Tip Once you have cloned the lacZ2 1 ds control oligo into PENTR H1 TO you may use the resulting entry clone as a positive control for the RNAi response in your mammalian cell line Simply co transfect the entry clone and the pcDNA 1 2 V5 GW lacZ reporter plasmid supplied
95. t into a mammalian cell line that stably expresses high levels of the Tet repressor i e use one of Invitrogen s T REx Cell Lines or a cell line that you have generated If you have not generated a stable TetR expressing cell line you may co transfect the pPENTR H1 TO plasmid with a suitable TetR expressing plasmid i e pcDNA 6 TR or pLenti6 TR into your mammalian cell line If you wish to use this method we recommend using 6 fold more TetR expression plasmid DNA than pENTR H1 TO plasmid DNA in the co transfection For example use 600 ng of pcDNA 6 TR plasmid and 100 ng of pENTR H1 TO entry construct DNA when transfecting cells plated in a 24 well format Note that you may need to optimize repression and inducibility by varying TM the ratio of TetR expression plasmid pENTR H1 TO used for transfection Once you have obtained your entry clone you must isolate plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic cells must be very clean and free from contamination with phenol or sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 S N A P MidiPrep Kit Catalog no K1910 01 or CsCl gradient centrifugation If you have performed the positive control reaction and have cloned the lacZ2 1 ds oligo supplied with the
96. t to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Invitrogen Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of Clonase purchased from Invitrogen Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purpos
97. te contains its own promoter i e H1 TO promoter we do not recommend transferring the H1 TO RNAi cassette into destination vectors that contain a promoter e g pCDNA 3 2 V5 DEST If you plan to perform regulated RNAi analysis in a lentiviral based system transfer your H1 TO RNAi cassette into Invitrogen s pLenti4 BLOCK T DEST destination vector Catalog nos V488 20 or K4925 00 Do not transfer the H1 TO RNAi cassette into the pLenti BLOCK iT DEST vector The pLenti6 BLOCK iT DEST vector contains the Blasticidin resistance marker for selection making it incompatible for use with Blasticidin resistant T REx cell lines both TM commercially available and those generated using the pcDNA 6 TR or pLenti6 TR constructs Once you have performed the LR recombination reaction you will transform the recombination reaction into competent E coli and select for the appropriate transformants You may use any recA endA E coli strain including TOP10 DH5a or equivalent for transformation Do not transform the LR recombination reaction into E coli strains that contain the F episome e g TOP10F These strains contain the ccd A gene and will prevent negative selection with the ccdB gene TM Important When performing the LR recombination reaction with the pLenti4 BLOCK T DEST vector use the Stbl3 E coli strain for transformation to obtain optimal results see ordering information below Product Amo
98. temperature pUC19 positive control supplied with the kit Box 2 if desired 42 C water bath LB plates containing 50 ug ml kanamycin two for each transformation warm at 37 C for 30 minutes before use Alternative You may use Low Salt LB plates containing 50 ug ml Zeocin to select for transformants if desired Note that for Zeocin to be active the salt concentration of the bacterial medium must be 90 mM and the pH must be 7 5 For a recipe to prepare Low Salt LB agar plates containing Zeocin see page 51 For more information about Zeocin see page 54 LB plates containing 100 ug ml ampicillin if transforming the pUC19 control 37 C shaking and non shaking incubator continued on next page Transforming One Shot TOP10 Competent E coli continued One Shot TOP10 Use this procedure to transform your ligation reaction into One Shot TOP10 Transformation Chemically Competent E coli To include a positive control for transformation Procedure transform 10 pg 1 ul of pUC19 plasmid into a separate vial of One Shot TOP10 competent E coli 1 Add 2 ul of the ligation reaction from Step 3 previous page into a vial of One Shot TOP10 chemically competent E coli and mix gently Do not mix by pipetting up and down 2 Incubate on ice for 5 to 30 minutes Note Longer incubations seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion Heat sho
99. terized Hannon et al 1991 Myslinksi et al 2001 We and other groups have chosen this particular promoter to control vector based expression of shRNA molecules in mammalian cells Brummelkamp et al 2002 McManus et al 2002 for the following reasons e The promoter is recognized by RNA Polymerase III and controls high level constitutive expression of shRNA e The promoter is active in most mammalian cell types e The promoter is a type III Pol III promoter in that all elements required to control expression of the shRNA are located upstream of the transcription start site Paule amp White 2000 For more information about the tet operator sequences and how tetracycline regulation works see pages 11 continued on next page Using shRNA for RNAi Analysis continued Structure of the shRNA 10 The shRNA molecule expressed from the H1 TO RNAi cassette in pENTR H1 TO or in a suitable destination vector forms an intramolecular stem loop structure similar to the structure of miRNA The endogenous Dicer enzyme then processes this hairpin into a 21 23 nt siRNA duplex Example The figure below illustrates the structure of the shRNA generated from the pENTR GW H1 TO lacZ2 1 construct You may generate this construct by cloning the lacZ2 1 ds control oligo supplied with the kit into pENTR H1 TO following the protocols in this manual The 22 nt lacZ target sequence is indicated in bold The underlined bases are derived
100. than the tetR Mammalian Cell Transcription Factor Fusion Derivatives Regulates Inducible Gene Expression in Mammalian Cells Hum Gene Ther 9 1939 1950 Yu J Y DeRuiter S L and Turner D L 2002 RNA Interference by Expression of Short interfering RNAs and Hairpin RNAs in Mammalian Cells Proc Natl Acad Sci USA 99 6047 6052 Zamore P D 2001 RNA Interference Listening to the Sound of Silence Nat Struct Biol 8 746 750 2004 2007 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 66 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
101. the lacZ2 1 shRNA and prevents accumulation of B galactosidase enabling detectable measurement of lacZ knockdown that might otherwise be masked by the long half life of B galactosidase e Ifyou have transfected your cells using another transfection reagent you may need to replace the medium and allow cells to recover for 24 hours before induction 4 Incubate cells in medium containing tetracycline for 24 to 96 hours as appropriate before assaying for target gene knockdown If you perform RNAi analysis using the control entry clone containing the lacZ2 1 ds oligo i e pPENTR GW H1 TO lacZ2 1 4 you may assay for B galacto sidase expression and knockdown by Western blot analysis or activity assay using cell free lysates Miller 1972 Invitrogen offers the B gal Antiserum Catalog no R901 25 the B Gal Assay Kit Catalog no K1455 01 and the FluoReporter lacZ Galactosidase Quantitation Kit Catalog no F 2905 for detection of B galactosidase expression For an example of results obtained from a B galacto sidase knockdown experiment see the next page Note The f galactosidase protein expressed from the pcDNA 1 2 V5 GW lacZ control plasmid is fused to a V5 epitope and is approximately 119 kDa in size If you are performing Western blot analysis you may also use the Anti V5 Antibodies available from Invitrogen e g Anti V5 HRP Antibody Catalog no R961 25 or Anti V5 AP Antibody Catalog no R962 25 for detection For
102. tion to generate an expression pLenti4 BLOCK iT DEST construct clone 4 Transfect the pENTR H1 TO construct into any Constitutively express the shRNA of 32 non TetR expressing dividing mammalian cell line Select for a stable cell line if desired interest continued on next page General Considerations for Transfection and Regulated Expression continued Expression of Tet Repressor TetR Because tetracycline regulated shRNA expression in the BLOCK iT Inducible H1 RNAi System is based on a repression derepression mechanism the amount of Tet repressor that is expressed in the host cell line will determine the level of transcriptional repression of the Tet operator sequences in your pENTR H1 TO construct Tet repressor levels need to be sufficiently high to suitably repress basal level transcription of the shRNA thus suppressing target gene knockdown in uninduced cells In addition the most effective repression of basal shRNA expression is achieved when Tet repressor is present in mammalian cells prior to introduction of the pPENTR H1 TO construct For these reasons we recommend first generating a stable cell line expressing the Tet repressor then using this cell line as the host for your pENTR H1 TO entry construct Option 2 previous page or other suitable inducible expression construct Option 3 previous page This option is particularly recommended if you want to e Perform regulated RNAi kno
103. to Suppress Gene Expression in Mammalian Cells Proc Natl Acad Sci USA 99 5515 5520 Takahashi M Degenkolb J and Hillen W 1991 Determination of the Equilibrium Association Constant Between Tet Repressor and Tetracycline at Limiting Mg Concentrations A Generally Applicable Method for Effector Dependent High Affinity Complexes Anal Biochem 199 197 202 van der Krol A R Mur L A Beld M Mol J N and Stuitje A R 1990 Flavonoid Genes in Petunia Addition of a Limited Number of Gene Copies May Lead to a Suppression of Gene Expression Plant Cell 2 291 299 Voinnet O Pinto Y M and Baulcombe D C 1999 Suppression of Gene Silencing A General Strategy Used by Diverse DNA and RNA Viruses of Plants Proc Natl Acad Sci USA 96 14147 14152 Weiss B Jacquemin Sablon A Live T R Fareed G C and Richardson C C 1968 Enzymatic Breakage and Joining of Deoxyribonucleic Acid VI Further Purification and Properties of Polynucleotide Ligase from Escherichia coli Infected with Bacteriophage T4 J Biol Chem 243 4543 4555 White R J 1998 RNA Polymerase III Transcription Springer Verlag New York NY Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 Yao F Svensjo T Winkler T Lu M Eriksson C and Eriksson E 1998 Tetracycline Repressor tetR Rather
104. tracycline as FBS is often isolated from cows that have been fed a diet containing tetracycline If you culture your mammalian cells in medium containing FBS that is not reduced in tetracycline you may observe some basal expression of your shRNA of interest in the absence of tetracycline We generally culture our mammalian cells in medium containing FBS that may not be reduced in tetracycline and have observed low basal expression of shRNA as assayed by target gene knockdown in the absence of tetracycline Depending on your application e g if targeting a protein involved in cell viability you may wish to culture your cells in tetracycline tested FBS You may obtain tetracycline tested GIBCO FBS from Invitrogen Contact Technical Service see page 59 for more information 35 Transfecting Cells Introduction Important Plasmid Preparation Positive Control 36 TM This section provides general guidelines to transfect your pENTR H1 TO construct into a TetR expressing mammalian cell line of interest to perform transient regulated RNAi analysis Performing transient RNAi analysis is useful to e Quickly test multiple shRNA sequences to a particular target gene e Quickly screen for an RNAi response in your mammalian cell line If you want to generate a stable cell line expressing the shRNA of interest see the next section Reminder For optimal results we recommend that you transfect your pENTR H1 TO construc
105. trogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 63 References Ambros V 2001 MicroRNAs Tiny Regulators with Great Potential Cell 107 823 826 Anandalakshmi R Pruss G J Ge X Marathe R Mallory A C Smith T H and Vance V B 1998 A Viral Suppressor of Gene Silencing in Plants Proc Natl Acad Sci USA 95 13079 13084 Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M
106. truction Kit available from Invitrogen Catalog no 12537 023 Briefly a MultiSite Gateway LR recombination reaction was performed with pDEST R4 R3 and entry clones containing the CMV promoter lacZ gene and V5 epitope and TK polyadenylation signal Cole amp Stacy 1985 to generate the pcDNA 1 2 V5 GW lacZ vector B galactosidase is expressed as a C terminal V5 fusion protein with a molecular weight of approximately 119 kDa The complete sequence of pcDNA 1 2 V5 GW lacZ is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 59 pcDNA 1 2 V5 GW lacZ Comments for pcDNA 1 2 V5 GW lacZ 6498 nucleotides attB4 bases 5 25 CMV promoter bases 137 724 attB1 bases 614 637 LacZ fusion protein bases 643 3798 LacZ ORF bases 643 3714 attB2 bases 3716 3739 V5 epitope bases 3739 3780 lacZ forward 2 priming site 840 859 lacZ reverse 2 priming site 1820 1839 C TK polyadenylation signal bases 3807 4078 attB3 bases 4079 4099 bla promoter bases 4603 4701 Ampicillin b a resistance gene bases 4702 5562 pUC origin bases 5707 6380 C complementary strand Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc Complete technical service contact information Access to the Invitrogen On
107. tte may then be easily and efficiently transferred into a suitable destination vector by LR recombination for use in other RNAi applications e g expression of shRNA in hard to transfect or non dividing cells continued on next page Using shRNA for RNAi Analysis continued Features of the H1 TO RNAi Cassette Human H1 Promoter The H1 TO RNAi cassette in PENTR H1 TO contains all of the elements required to facilitate RNA Polymerase III controlled expression of your shRNA of interest including a e Modified human H1 promoter see below for more information e Double stranded oligo encoding an shRNA to your target gene of interest e Polymerase III Pol III terminator consisting of a cluster of six thymidine T residues Bogenhagen amp Brown 1981 See the diagram below for an illustration of the H1 TO RNAi cassette attL1 PL ZITHd attL2 Note The H1 TO RNAi cassette in PENTR H1 TO is flanked by attL sites to allow easy transfer of the cassette into other suitable Gateway destination vectors Expression of the shRNA of interest from pENTR H1 TO or a suitable destination vector following LR recombination is controlled by the human H1 promoter which has been modified to include two prokaryotic tet operator 2 TetO2 sequences The endogenous human H1 promoter normally controls expression of H1 RNA the RNA component of human RNase P involved in tRNA processing Baer et al 1990 and has been well charac
108. ture Important Other T4 DNA Ligase preparations may not support 5 minute room temperature ligation Not enough transformation mixture plated Increase the amount of the transformation mixture plated 46 continued on next page Troubleshooting continued Ligation and Transformation Reactions continued Problem Reason Solution Few kanamycin resistant colonies obtained on the selective plate continued Ligation reaction incubated overnight at 16 C The ligation conditions used to clone the ds oligo into pENTR H1 TO differ from traditional ligation conditions Incubate the ligation reaction at room temperature for 5 minutes Selective plates contained too much kanamycin Use LB agar plates containing 50 ug ml kanamycin for selection Used LB agar to make selective plates containing Zeocin Use Low Salt LB agar to make selective plates containing Zeocin Did not use the competent cells supplied with the kit Use the One Shot TOP10 Chemically Competent E coli supplied with the kit trans formation efficiency is gt 1 x 10 cfu ug DNA Not enough of the ligation reaction transformed Increase the amount of ligation reaction transformed Did not perform the 1 hour grow out period before plating the transformation mixture After the heat shock step add S O C Medium and incubate the bacterial culture for 1 hour at 37 C with shaking before
109. unt Catalog no One Shot TOP10 Chemically Competent E coli 20 x 50 ul C4040 03 40 x 50 ul C4040 06 One Shot Stbl3 Chemically Competent E coli 20 x 50 ul C7373 03 continued on next page 43 Guidelines to Perform the LR Recombination Reaction continued Important Materials Needed Performing the LR Recombination Reaction 44 We recommend performing the LR recombination reaction using a TM e Supercoiled attL containing pENTR H1 TO entry clone e Supercoiled attR containing destination vector You will need the following reagents to perform the LR recombination reaction e Purified plasmid DNA of your pENTR H1 TO entry clone 50 150 ng ul in TE Buffer pH 8 0 e Destination vector of choice 150 ng l in TE Buffer pH 8 0 e LRClonase II enzyme mix Invitrogen Catalog no 11791 020 e TE Buffer pH 8 0 10 mM Tris HCl pH 8 0 1 mM EDTA e 2ug yul Proteinase K solution supplied with the LR Clonase II enzyme mix e Appropriate chemically competent E coli host and growth media for expression e S O C Medium e Appropriate selective plates For detailed guidelines and instructions to perform the LR recombination reaction with pLenti4 BLOCK iT DEST and transform competent E coli refer to the BLOCK iT Inducible H1 Lentiviral RNAi System manual If you are using another destination vector refer to the manual for the destination vector you are using Trou
110. xes Hutvagner et al 2001 Ketting et al 2001 that then enter the RNAi pathway and result in gene silencing by blocking translation Short hairpin RNA shRNA are an artificially designed class of RNA molecules that can trigger gene silencing through interaction with cellular components common to the RNAi and miRNA pathways Although shRNA are a structurally simplified form of miRNA these RNA molecules behave similarly to siRNA in that they trigger the RNAi response by inducing cleavage and degradation of target transcripts Brummelkamp et al 2002 Paddison et al 2002 Paul et al 2002 Sui et al 2002 Yu et al 2002 continued on next page Using shRNA for RNAi Analysis continued Structural Features of ShRNA Hallmarks of RNA Polymerase Ill Based Expression Using a Vector Based System to Express shRNA Exogenous short hairpin RNA can be transcribed by RNA Polymerase III Paule amp White 2000 and generally contain the following structural features e A short nucleotide sequence ranging from 19 29 nucleotides derived from the target gene followed by e A short spacer of 4 15 nucleotides i e loop and e A 19 29 nucleotide sequence that is the reverse complement of the initial target sequence The resulting RNA molecule forms an intramolecular stem loop structure that is then processed into an siRNA duplex by the Dicer enzyme RNA Polymerase III transcribes a limited number of genes including 5S

BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit

Contents

Download Pdf Manuals

Related Search

Related Contents

BLOCK-iT&trade; Inducible H1 RNAi Entry Vector Kit

Contents

Download Pdf Manuals

Related Search

Related Contents

BLOCK-iT™ Inducible H1 RNAi Entry Vector Kit