Home

CLONTECH

1. Expected Recommended Recommended insert size range agarose DNA size markers 0 3 1 5 kb 1 5 oX1 74 Hae III 0 5 10 kb 1 2 1 kb DNA ladder gt 5 kb 0 8 A Hind III Protocol PT3281 1 www clontech com CLONTECH Laboratories Inc Version PR11009 13 Advantage 2 PCR Enzyme System User Manual V Troubleshooting Guide The following general guidelines apply to most PCR reactions However no attempt has been made to address troubleshooting for all of the many applica tions for which the Advantage 2 Polymerase Mix can be used When using the enzyme with one of its CLONTECH companion products additional application specific troubleshooting information can be found in the relevant User Manual A No product observed PCR component missing or degraded Too few cycles Annealing temp too high Suboptimal primer design Not enough template Poor template quality Denaturation temp too high or low Denaturation time too long or too short Extension time too short CLONTECH Laboratories Inc 14 Use a checklist when assembling reactions Always perform a positive control to ensure that each com ponent is functional If the positive control does not work repeat the positive control only If the positive control still does not work repeat again replacing individual components to identify the faulty reagent Increase the number of cycles 3 5 additional cycles at a time Decrease the annealin
2. PR11009 9 Advantage 2 PCR Enzyme System User Manual IV Advantage 2 PCR Protocol continued 5 TaqStart Antibody provides automatic hot start PCR The use of a manual hot start or wax bead based hot start is not required when using Advantage 2 As discussedin the Introduction hot start is automatic because the enzyme mix already contains TagStart Antibody Half life The half life of TITANIUM Taq depends on the specific reaction conditions used but generally ranges from 20 40 min at 95 C Use of additives TagStart Antibody binds TITANIUM Taq DNA Polymerase with high affinity under the conditions described in this protocol The addition of 2 5 DMSO will not interfere with TaqStart function and may improve results in some instances However the addition of formamide or other cosolvents may disrupt TaqStart function Furthermore excessive glycerol solutes e g salts pH extremes or other deviations from the recommended reaction conditions may reduce the effectiveness of the antibody and or DNA polymerases Advantage 2 Polymerase Mix is not intended for certain applications Because of the improved fidelity from long and accurate PCR Advantage 2 is not recommended for mutagenesis protocols involving so called sloppy PCR T A Cloning TITANIUM Taq PCR products are compatible with T A cloning methods For best results please observe the T A cloning tips in Section IV C CLONTECH Laboratories Inc ww
3. Mg proportionately Some targets are inherently difficult to amplify In most cases this is due to unusually high G C content and or secondary structure Use Advantage GC in stead of Advantage 2 Reducing the cycle number may eliminate nonspe cific bands Increase the annealing extension temperature in increments of 2 3 C www clontech com CLONTECH Laboratories Inc 15 Advantage 2 PCR Enzyme System User Manual V Troubleshooting Guide continued Suboptimal primer design Touchdown PCR needed Contamination Redesign your primer s after confirming the accu racy of the sequence information If the original primer s was less than 22 nt long try using a longer primer If the original primer s had a G C content of less than 45 try to design a primer with a G C content of 45 60 Touchdown PCR significantly improves the speci ficity of many PCR reactions in various applications Don et al 1991 Roux 1995 Touchdown PCR involves using an annealing extension temperature that is several degrees higher than the T of the primers during the initial PCR cycles The annealing extension temperature is then reduced to the primer Tm forthe remaining PCR cycles The change can be performed either in a single step or in increments over several cycles See Section D below C Products are smeared on gel Too many cycles Denaturation temp too low Extension time too long Poor template quality Touc
4. Mg range and different reactions may require different concentrations of Mg By eliminating the need to perform experiments for determining the optimal Mg concentration using TITANIUM Taq saves considerable time and effort The Advantage Polymerase Systems Thesimultaneous use of two different DNA polymerases primary and proofread ing in a PCR reaction allows amplification of significantly longer fragments in a process known as long and accurate PCR or long distance PCR LD PCR Barnes 1994 Cheng et al 1994 However the usefulness of two enzyme systems is not limited to LD PCR In fact the efficiency of most PCR reactions can be significantly improved by using the two enzyme combination Advantage 2 offers three primary benefits over conventional single polymerase PCR ncreased range Whereas the upper limit of conventional PCR using a Taq polymerase is 3 kb and much lower in many applications Advantage 2 gives consistent and efficient amplifications of upto 18 kb or more when using two nondegenerate primers of sufficient length to amplify an abundant noncomplex template It can also amplify high complexity i e genomic DNA templates up to 6 kb The absolute upper limit in any particular Protocol PT3281 1 www clontech com CLONTECH Laboratories Inc Version PR11009 3 Advantage 2 PCR Enzyme System User Manual l Introduction continued application will depend on the particular primers the templat
5. the outside of the pipette tip before transfer When adding solution to a tube immerse the tip into the reaction mixture deliver the contents from the pipette tip into the mixture and pipet up and down several times c Use a Master Mix Assembling a Master Mix which contains the appropriate volumes of all reagents required for multiple PCR reactions saves time and greatly reduces tube to tube variation If multiple templates are being tested with the same primers include the primers in the Master Mix If one template is being tested with multiple primer sets include the template in the Master Mix If you are setting up several sets of parallel samples assemble multiple Master Mixes e g each with a different set of primers The Master Mix should be thoroughly mixed before use i e vortexed without bubbling d Always include positive and negative controls i e HO instead of DNA template 4 Touchdown PCR Touchdown PCR can significantly improve the specificity of many PCR reactions in a wide variety of applications Don etal 1991 Roux 1995 Briefly touchdown PCR involves using an annealing extension temperature that is several degrees typically 3 10 C higher than the Tm of the primers during the initial PCR cycles typically 5 10 cycles The annealing extension temperature is then reduced to the primer Tm for the remaining PCR cycles Protocol PT3281 1 www clontech com CLONTECH Laboratories Inc Version
6. CLONTEGH Innovative Tools to Accelerate Discovery Advantage 2 PCR Enzyme System User Manual PT3281 1 PR11009 Published 23 January 2001 Storage conditions 20 C FOR RESEARCH USE ONLY Advantage 2 PCR Enzyme System User Manual Table of Contents l Introduction 3 ll List of Components 6 Ill Additional Materials Required 7 IV Advantage 2 PCR Protocol 8 A General Considerations 8 B Control PCR Reactions 11 C Recommended Cycling Parameters 12 D Recommendations for Electrophoresis 13 V Troubleshooting Guide 14 VI References 18 Vil Related Products 18 Notice to Purchaser This product is intended to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use CLONTECH products may not be resold modified for resale or used to manufacture commercial products without written approval of CLONTECH A license under U S patents 4 683 202 4 683 195 and 4 965 188 or their foreign counterparts owned by Hoffmann La Roche and F Hoffmann La Roche Ltd Roche has an up front fee component and a running royalty component The purchase price of this product includes limited non transferable rights under the running royalty component to use only this amount of the product to practice the Polymerase Chain Reaction PCR and related products described in said patents solely for the research and development activities of the purchaser when this product i
7. CR amplifications by reducing background DNA synthesis Kellogg et al 1994 CLONTECHniques April 1994 Specifically this antibody reduces or eliminates nonspecific ampli fication products and primer dimer artifacts created prior to the onset of thermal cycling TaqStart is a neutralizing monoclonal antibody that recognizes both native Taq and N terminal deletions such as TITANIUM Taq The antibody inhibits enzy matic activity during PCR reaction setup at ambient temperatures Polymerase activity is restored at the onset of thermal cycling because the antibody is denatured at high temperatures The loss of inhibition is complete and irrevers ible so the polymerase regains its full enzymatic activity for PCR Besides increased specificity and sensitivity the built in hot start in the Advantage 2 Polymerase Mix offers convenience Other methods of hot start require extra steps such as the addition and premelting of wax beads or the addition of a critical component after the initial denaturation These extra steps are inconvenient and introduce a potential source of cross contamination In contrast TaqStart provides automatic hot start PCR with virtually no risk of cross contamination Thus TaqStart provides all the advantages of hot start PCR with none of the disadvantages of other hot start methods The antibody CLONTECH Laboratories Inc www clontech com Protocol PT3281 1 4 Version PR11009 Advantage 2 PCR Enzyme System User Manu
8. Elmer GeneAmp 0 5 ml reaction tubes Cat N801 0737 or N801 0180 Thermal cycler Perkin Elmer GeneAmp 480 or equivalent e Pipettors dedicated for PCR e PCR pipette tips suitable to the above pipettors and preferably equipped with hydrophobic filters DNA size markers See Section IV D 5X Stop loading buffer Sambrook et al 1989 provides several recipes In addition if you have purchased the Advantage 2 Polymerase Mix alone 8430 1 2 you will need the following 50X dNTP mix 10 mM each of dATP dCTP dGTP and dTTP Appropriate control template and primers Protocol PT3281 1 www clontech com CLONTECH Laboratories Inc Version PR11009 7 Advantage 2 PCR Enzyme System User Manual IV Advantage 2 PCR Protocol PLEASE READ ENTIRE PROTOCOL BEFORE STARTING A General Considerations 1 Primer design Primer design is the single largest variable in PCR applications and the single most important factor in determining the success or failure of PCR reactions Always check and recheck your primer design before constructing or ordering primers Visit alces med umn edu VGC html on the web for helpful guidelines on primer design Length and G C content Advantage 2 can be used in a wide variety of PCR applications and the constraints on primer design will vary from one application to the next In general however primers should have a T4 of approximately 70 C to achieve optimal results in a two step cycl
9. Insert Screening Amplimer Sets many RT PCR Amplimer Sets many Advantage RT for PCR Kit K1401 2 MTC Panels many QUICK Clone cDNAs many ApoAlert LM PCR Ladder Assay Kit K2021 1 CLONTECH Laboratories Inc www clontech com Protocol PT3281 1 18 Version PR11009 Advantage 2 PCR Enzyme System User Manual VII Related Products continued Other Related Products TITANIUM Tag DNA Polymerase TITANIUM Taq PCR Kit Advantage Genomic Polymerase Mix Advantage Genomic PCR Kit Advantage GC 2 Polymerase Mix Advantage GC 2 PCR Kit Advantage GC Genomic Polymerase Mix Advantage GC Genomic PCR Kit Advantage HF 2 PCR Kit Advantage UltraPure dNTPs TaqStart Antibody 8434 1 2 K1915 1 y 8418 1 K1906 1 y 8433 1 K1913 1 y 8420 1 K1908 1 y K1914 1 y many 5400 1 2 Advantage ApoAlert and Delta are registered trademarks of CLONTECH Laboratories Inc CLONTECH PCR Select GenomeWalker Marathon Marathon Ready MTC QUICK Clone SMART TagStart and TITANIUM Taq are trademarks of CLONTECH Laboratories Inc GeneAmp is a registered trademark of Roche Molecular Systems Inc licensed to the Perkin Elmer Corporation 2001 CLONTECH Laboratories Inc Protocol PT3281 1 www clontech com Version PR11009 CLONTECH Laboratories Inc 19
10. Marathon Ready cDNAs or Delta Differential Display use the param eters recommended in the protocol for that kit If you intend to capture your PCR product by T A cloning we recommend that you add an additional 10 min extension at 70 C and then immedi ately clone of freeze the PCR product Do not store the reaction at 4 C These steps will help ensure the incorporation and preservation of 3 A overhangs Target Size 1 kb 1 5 kb 5 9 kb 10 20 kb Cycle Parameters 95 C for 1 min 25 35 cycles 95 C for 30 sec8 68 C for 1 mine 68 C for 1 min 95 C for 1 min 25 35 cycles 95 C for 30 sec 68 C for 3 mint 68 C for 3 min 95 C for 1 min 25 35 cycles 95 C for 30 sec8 68 C for 6 mine 68 C for 6 min 95 C for 1 min 25 35 cycles 95 C for 30 sec 68 C for 12 min 68 C for 12 min www clontech com Protocol PT3281 1 Advantage 2 PCR Enzyme System User Manual IV Advantage 2 PCR Protocol continued 25 cycles for multiple copy genes or medium to high abundance cDNAs 30 35 cycles for single or low copy number genes or rare cDNAs For most applications we prefer two step cycles denaturation at T followed by annealing and extension at Tz instead of three step cycles denaturation at T followed by annealing at T followed by extension at T4 Three step cycles will be necessary when the Tm of the primers is less than 60 65 C and in certain special protoc
11. Mix is comprised of TITANIUM Tag DNA Polymerase a nuclease deficient N terminal deletion of Tag DNA polymerase plus TaqStart Antibody to provide automatic hot start PCR Kellogg et al 1994 and a minor amount of a proofreading polymerase TITANIUM Tag provides the most sensitive and robust capabilities of any Taq derived polymerase Its increased sensitivity and robust nature are especially useful for amplifying a wide size range of DNA fragments cDNAs of rare transcripts or products from complex templates The higher yields and increased sensitivity that TITANIUM Taq provides trans late into two major advantages over conventional polymerases First targets can be amplified using fewer PCR cycles saving time and lowering background in any given experiment Second in situations where the amplification target is present at extremely low levels e g amplifying a rare cDNA in an RT PCR experiment or detecting viral nucleic acid the high sensitivity obtained with TITANIUM Taq allows successful amplification of your target where other polymerases fail TITANIUM Taq allows you to perform PCR without tedious buffer optimization In any given reaction TITANIUM Tag tolerates a wide range of Mg concentra tions Mg is already included at a set concentration in the Advantage 2 PCR Buffer eliminating the need to add Mg as a separate component during reaction setup In contrast native Taq polymerase only functions well over a narrow
12. al Il Introduction continued comes already included in the Advantage 2 Polymerase Mix there is no need to add it as a separate reagent during PCR setup What can I use with Advantage 2 The Advantage 2 Mix and Kit are the recommended polymerase systems for use in applications involving RACE RT PCR cDNA synthesis and library construc tion cDNA subtraction and differential display high performance cloning and RNA fingerprinting Advantage 2 has been optimized for use with all of CLONTECH s PCR based application kits including SMART cDNA Library Construction SMART PCR cDNA Synthesis SMART RACE cDNA Amplification CLONTECH PCR Select Subtraction Kits Marathon cDNA Amplification and Delta Differential Display For genomic applications includ ing CLONTECH s GenomeWalker Kits we recommend Advantage Genomic Kits See Related Products Section VII for ordering information Protocol PT3281 1 www clontech com CLONTECH Laboratories Inc Version PR11009 5 Advantage 2 PCR Enzyme System User Manual Il List of Co mponents Advantage 2 PCR Kit K1910 y 1 Store all components at 20 C Enough reagents are supplied for 30 or 100 PCR reactions of 50 ul each 30 rxns 100 rxns e 30ul 100ul 50X Advantage 2 Polymerase Mix Includes TITANIUM Taq DNA Polymerase a small amount of proofreading polymerase and TaqStart Antibody 1 1 ug ul in the following storage buffer Concentration Final
13. cles with a 3 min annealing extension time is sufficient for amplification of the positive control template provided in the kit Other templates may require more or less cycles and different annealing extension times See Section IV C 6 Transfer a 5 ul sample of your PCR reaction to a fresh tube and add 1 ul of 5X stop loading buffer Analyze your sample s along with suitable DNA size markers by electrophoresis on a 1 296 agarose EtBr gel Expected results If you are using the positive control reagents provided in the kit the reaction should produce a single major fragment of 3 5 kb derived from the gene for the bovine pancreatic trypsin inhibitor No bands should be generated in the negative i e no DNA template control Protocol PT3281 1 www clontech com CLONTECH Laboratories Inc Version PR11009 11 Advantage 2 PCR Enzyme System User Manual IV Advantage 2 PCR Protocol continued C CLONTECH Laboratories Inc 12 Recommended Cycling Parameters Use the following guidelines when setting up your initial experiments with Advantage 2 These are general guidelines the optimal parameters may vary with different thermal cyclers and will depend on your particular primers template and other experimental variables Notes When using the Advantage 2 Polymerase Mix with CLONTECH s PCR based application kits such as SMART cDNA Synthesis or Library Construction PCR Select Subtraction Marathon cDNA Amplification
14. e used and other experimental variables Increased fidelity The inclusion of a minor amount of a proofreading polymerase results in an error rate that is 3 fold lower than that of conventional PCR with Taq alone Barnes 1994 Frey etal 1995 Nelson et al 1995 In our studies Advantage 2 exhibits an error rate of 25 errors per 100 000 bp after 25 PCR cycles Note that the presence of organic solvents or salts in the reaction can decrease fidelity High fidelity a particularly important feature when the amplification products will be used in subsequent experiments e g cloning sequencing functional assays expression systems etc Increased efficiency and greater yields While range and fidelity are the most commonly noted aspects of long and accurate PCR the use of atwo polymerase system also increases the efficiency and yield and therefore the sensitivity of all PCR assays even for templates that are well within the range of conventional PCR While DNA polymerases with proofreading activity offer better accuracy than LD PCR methods when used alone they lack the increased efficiency and size range flexibility possible with Advantage 2 for long and accurate PCR Automatic hot start with TaqStart Antibody Advantage 2 contains built in hot start PCR from TaqStart Antibody included in the polymerase mix Antibody mediated hot start with TaqStart has been shown to significantly improve the efficiency and specificity of P
15. g temperature in increments of 2 4 C Redesign your primer s after confirming the accu racy of the sequence information If the original primer s was less than 22 nt long try using a longer primer If the original primer s had a G C content of less than 45 try to design a primer with a G C content of 45 60 Repeat PCR using a higher concentration of DNA after trying more cycles Check template integrity by electrophoresis on a standard TBE agarose gel If necessary repurify your template using methods that minimize shearing and nicking Optimize denaturation temperature by decreasing or increasing it in 1 C increments A denaturation temperature that is too high can lead to degradation ofthe template especially forlong target sequences Optimize denaturation time by decreasing or increas ing it in 10 sec increments A denaturation time that is too long can lead to degradation of the template especially for long target sequences Especially for longer templates increase the extension time in 1 min increments Protocol PT3281 1 Version PR11009 www clontech com Advantage 2 PCR Enzyme System User Manual V Troubleshooting Guide continued Too little enzyme Mg is too low dNTPs is too low Difficult target B Multiple products Too many cycles Annealing temp too low Protocol PT3281 1 Version PR11009 The Advantage 2 Polymerase Mix is 50X for most applications Therefore tr
16. gher yields with a acl based PCR fidelity assay Biochemica 2 8 9 Kellogg D E Rybalkin I Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hotstart PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase BioTechniques 16 1134 1137 Longo M C Berninger M S amp Hartley J L 1990 Use of uracil DNA glycosylase to control carry over contamination in polymerase chain reactions Gene 93 3749 Nelson K Brannan J amp Kretz K 1995 The fidelity of TaqPlus DNA Polymerase in PCR Strategies Mol Biol 8 24 25 Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods Appl 4 5185 5194 Sambrook J Fritsch E F amp Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Cold Spring Harbor Laboratory Cold Spring Harbor NY VII Related Products For the latest and most complete listing of all CLONTECH products please visit www clontech com The following CLONTECH products are compatible with Advantage 2 SMART cDNA Library Construction Kit K1051 1 SMART PCR cDNA Synthesis Kit K1052 1 SMART RACE cDNA Amplification Kit K1811 1 Marathon cDNA Amplification Kit K1802 1 Marathon Ready cDNAs many Delta Differential Display Kit K1810 1 CLONTECH PCR Select cDNA Subtraction Kit K1804 1 e CLONTECH PCR Select Bacterial Genome Subtraction Kit K1809 1 LD
17. hdown PCR needed Too much enzyme Too much template Contamination CLONTECH Laboratories Inc 16 Reduce the cycle number by 3 5 to see if non specific bands go away Try increasing the denaturation temperature in incre ments of 1 C Decrease the extension time in 1 2 min increments Check template integrity by electrophoresis on a de denaturing agarose gel Repurify your template if necessary See Touchdown PCR needed under previous section The Advantage 2 Polymerase Mix is 50X for most applications however a 1X final concentration of the enzyme mix may be too high for some applications If smearing is observed first try optimizing the cycle parameters as described above then try reducing the enzyme concentration to 0 5 0 2X Try a lower concentration of DNA template in the PCR reaction See Section D below www clontech com Protocol PT3281 1 Version PR11009 Advantage 2 PCR Enzyme System User Manual V Troubleshooting Guide continued D Dealing with contamination Contamination most often results in extra bands or smearing It is important to include a negative control a control that replaces the DNA template with PCR grade HO but still includes the primers in every PCR experiment to determine if the PCR reagents pipettors or PCR reaction tubes are contaminated with previously amplified targets If possible set up the PCR reaction and perform the post PCR analysis in separate laborato
18. ing program with a 68 C annealing extension step Therefore whenever possible primers should be at least 22 nucleotides nt long 25 30 mers are preferred and should have a G C content of 45 60 Furthermore the 3 terminal ends of each primer should notbe comple mentary to each other and should contain a low G C content 2 Template quality Because PCR amplification proceeds exponentially many conven tional PCR applications work well with templates of average or even low quality In many applications such as screening cDNA inserts with CLONTECH s LD Insert Screening Amplimers long and accurate PCR with Advantage 2 will also tolerate a wide range of template quality However the longer or more complex the target the more important template quality becomes This is because the number of unnicked full length targets decreases as the target length increases so poor quality DNA will have very few large unnicked targets Furthermore some depurination occurs when DNA is denatured during thermal cycling and this can lead to truncated products Therefore it is particularly important to prepare high quality high molecular weight DNA when amplifying large targets Template quality is also important when the highest possible sensitivity is needed In cDNA applications such as RACE and RT PCR protocols incomplete reverse transcription can lead to an absence of product truncated products or a mix of truncated and full length product
19. ols 8 Use the minimal possible denaturation time In some cases better results may be obtained by modifying the denaturation step 15 sec 94 C Exposure of DNA to high temperatures causes some depurination of single stranded DNA during denatur ation which eventually leads to strand scission High temperature also leads to gradual loss of enzyme activity Minimizing denaturation time is particularly important in experiments with very large templates where total cycling time can exceed 12 hr Use the maximum possible annealing extension temperature See Note A Some researchers prefer to use an annealing extension time equal to the expected target size in kb plus two minutes We recommend using 1 min per kb of expected target D Optional This final extension may reduce background in some cases D Recommendations for Electrophoresis We recommend that you transfer a 5 ul sample of your PCR reaction to a fresh tube and add 1 ul of 5X stop loading buffer Place the remaining 45 ul of the reaction mixture on ice it can be subjected to further cycling if you do not see a product Analyze your sample s along with suitable DNA size markers by electrophoresis on a suitable agarose gel containing 0 1 ug ml EtBr The percentage agarose and the DNA size markers you choose will depend on the expected range of insert sizes You may wish to refer to the following general guidelines before assembling your gel Recommendations for agarose gels
20. resulting in a smeared band on a gel This problem can be minimized by ensuring that your starting material is of the highest quality For 5 and 3 RACE and general PCR from cDNA you can ensure the quality of your cDNA by using Marathon Ready cDNA from CLONTECH CLONTECH Laboratories Inc www clontech com Protocol PT3281 1 8 Version PR11009 Advantage 2 PCR Enzyme System User Manual IV Advantage 2 PCR Protocol continued 3 Good PCR practices a Prepare reactions with dedicated pipettors in a dedicated work space Due to the tremendous amplification power of PCR minute amounts of contaminating DNA can produce nonspecific amplification in some instances contaminants can cause DNA bands even in the absence of added template DNA We recommend that you use small aliquots of starting material to avoid contaminating your stocks When performing PCR you should wear gloves and set up your reactions in a dedicated lab area or noncirculating containment hood using dedicated pipettors PCR pipette tips with hydrophobic filters and dedicated solutions We also recommend setting up a negative control reaction that does not contain any template Finally perform post PCR analysis in a separate area using a separate set of pipettors b Pipetting Because of the small volumes used in PCR experiments and the potential for tube to tube variation careful pipetting technique is extremely important Always be sure that no extra solution is on
21. rxn in 50X mix Component concentration 50 96 Glycerol 1 0 96 15 mM Tris HCI pH 8 0 0 3 mM 75 mM KCI 1 5 mM 0 05 mM EDTA 1 0 uM e 200 ul 60041 10X Advantage 2 PCR Buffer Concentration Final rxn in 10X mix Component concentration 400 mM Tricine KOH pH 8 7 at 25 C 40 mM 150 mM KOAc 15 mM 35 mM Mg OAC 3 5 mM 37 5 ug ml BSA 3 75 ug ml 0 05 96 Tween 20 0 005 96 0 05 96 Nonidet P40 0 005 96 e 50ul 12041 50X dNTP Mix 10 mM each of dATP dCTP dGTP and dTTP final rxn concentration 0 2 mM each e 30ul 100ul Control DNA Template 100 ng ul Calf Thymus DNA e 30ul 100ul Control Primer Mix 10 uM each 5 primer 5 GCAACTGCAGGAAGAGCAAGAAATGCA 3 3 primer 5 TGGCACGGCCATAAGAGGTAGATGTCA 3 2 55ml 5 0mlI PCR Grade Water CLONTECH Laboratories Inc www clontech com Protocol PT3281 1 6 Version PR11009 Advantage 2 PCR Enzyme System User Manual ll List of Components continued Advantage 2 Polymerase Mix 8430 1 2 Store all components at 20 C Enough reagents are supplied for 100 or 500 PCR reactions of 50 wl each 100 rxns 500 rxns e 10040 25x 100 ul 50X Advantage 2 Polymerase Mix See page 5 for component concentrations e 600ul 5x 600uI 10X Advantage 2 PCR Buffer See page 5 for component concentrations lll Additional Materials Required The following reagents are not supplied optional Mineral oil We recommend Sigma Cat M 3516 0 5 ml PCR reaction tubes We recommend Perkin
22. ry areas with separate sets of pipettors Laboratory benches and pipettor shafts can be decontaminated by depurination Wipe surfaces with 1N HCI followed by 1N NaOH Then neutralize with a neutral buffer e g Tris or PBS and rinse with ddH O We advise using commercially available aerosol free pipette tips An enzymatic method has been published for destroying PCR product carryover Longo et al 1990 It involves incorporation of dUTP into the PCR products and subsequenthydrolysis with uracil N glycosylase UNG When performing PCR directly on phage plaques or bacterial colonies failure to isolate single plaques or colonies will also produce multiple bands Protocol PT3281 1 www clontech com CLONTECH Laboratories Inc Version PR11009 17 Advantage 2 PCR Enzyme System User Manual VI References Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Cheng S Fockler C Barnes W M amp Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 5695 5699 Don R H Cox P T Wainwright B J Baker K amp Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Frey B amp Suppmann B 1995 Demonstration of the Expand PCR system s greater fidelity and hi
23. s used in conjunction with a thermal cycler whose use is covered by the up front fee component Rights to the up front fee component must be obtained by the end user in order to have a complete license These rights under the up front fee component may be purchased from Perkin Elmer or obtained by purchasing an authorized thermal cycler No right to perform or offer commercial services of any kind using PCR including without limitation reporting the results of purchaser s activity for a fee or other commercial consideration is hereby granted by implication or estoppel Further information on purchasing licensesto practice the PCR process may be obtained by contacting the Director of Licensing atthe Perkin Elmer Corporation 850 Lincoln Centre Drive Foster City CA 94404 or at Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda CA 94501 TaqStart Antibody is licensed under U S Patent No 5 338 671 and corresponding patents in other countries This product is sold under licensing arrangements with F Hoffmann La Roche Ltd Roche Molecular Systems Inc and the Perkin Elmer Corporation CLONTECH Laboratories Inc www clontech com Protocol PT3281 1 2 Version PR11009 Advantage 2 PCR Enzyme System User Manual Il Introduction The Advantage 2 Polymerase Mix and Advantage 2 PCR Kit which includes the Polymerase Mix allow efficient accurate and convenient amplification of DNA from any template The Advantage 2 Polymerase
24. w clontech com Protocol PT3281 1 10 Version PR11009 Advantage 2 PCR Enzyme System User Manual IV Advantage 2 PCR Protocol continued B Control PCR Reactions The following PCR reactions should be performed in parallel with your experiments as controls to ensure that the Advantage 2 Polymerase Mix is working properly A positive control template and primers are provided in the Advantage 2 PCR Kit When using the Advantage 2 Polymerase Mix with CLONTECH s PCR based applications kits use the positive controls provided with those kits 1 Place all components on ice and allow to thaw completely Mix each component thoroughly before use 2 Combine the following reagents in a 0 5 ml PCR tube Positive Negative Control Control 40 ul 41 ul PCR Grade Water 5 ul 5 ul 10X Advantage 2 PCR Buffer 1 ul Control DNA Template 100 ng Ll 2 ul 2 ul Control Primer Mix 10 uM ea 1 yul 1 yul 50X dNTP Mix 10 mM ea 1 ul 1 ul 50X Advantage 2 Polymerase Mix 50 ul 50 ul Total volume 3 Mix well and spin tube briefly to collect all the liquid in bottom of tube 4 If your thermal cycler does not have a hot lid add 1 2 drops of mineral oil to prevent evaporation during cycling A good seal of mineral oil should have a well defined meniscus between the two phases Cap the PCR tubes firmly 5 Commence thermal cycling using the following parameters 95 C for 1min 90 cycles 95 C for 15 sec 68 C for 3 min 80 cy
25. y to optimize the cycle parameters as described above before increasing the enzyme concentration In rare cases the yields can be improved by increasing the concentration of the enzyme mix However increasing the concentra tion gt 2X is likely to lead to higher background levels The Advantage 2 Polymerase Mix performs well at a broad range of Mg concentration Therefore as long as you use the buffer included with the mix and a final concentration of 0 2 mM of each dNTP it is unlikely that a lack of product is due to problems with the Mg concentration However high concentrations of EDTA or other metal chelators in the template stock solution can reduce the effective concentration of Mg to below a minimum level When used as recommended the 50X dNTP mix provided with the kit gives a final concentration of 0 2 mM of each dNTP In our experience this con centration of dNTPs is suitable for a wide range of applications If you are preparing your own dNTPs be sure that your final concentration of each dNTP in the reaction is 0 2 mM Some manufacturers recommend using concentra tions higher than 0 2 mM of each dNTP when ampli fying large templates However we have had no trouble amplifying large templates using 0 2 mM for each dNTP We have gone up to 35 kb with the Advantage Genomic PCR Kit so it is unlikely that dNTPs are limiting Note that if you increase the concentration of dNTPs you will also need to in crease the

CLONTECH

Contents

Download Pdf Manuals

Related Search

Related Contents