Home

Multi-Copy Pichia Expression Kit

1. sssssssssssseeeeneneneert tette tenerent 81 PCR Analysis of Pichia tegra ntsi nior ensaio ieni aaea eane nter tenentes 83 Direct PCR Screening of Pichia CIONES ronse oaie terae e osasta aaien en eara Teate aroase Aaaa Peine A aT 85 Isolating Total DNA from Pichia essent aeieea eaea o neins aae aE aape kis 86 Determining the Copy Number of Multiple Integrants sssssssseseeeeeneneeeeeneenenenns 88 Procedure for Total RNA Isolation from Pichia sse 91 p Galactosidase Assay ioo s eto mo m sei e A fee p iris f seite ined 92 Technical Supportin tied eo o ve diee bte fi totes asa tiorem ba Eie 94 Purchaser NOUMCAt OM seo oeste nie prebere a EEES ite didis ie died 96 References etsan eene ane PEL Ta Yn C o ee M E DC ee Ee 99 lv Kit Contents and Storage Kit Contents The Multi Copy Pichia Expression Kit is shipped at room temperature and contains the following components Spheroplast Module Box 1 Store at room temperature Reagent Amount Components SOS medium 20 ml 1 M Sorbitol 0 3X YPD 10 mM CaCl Sterile Water 2x 125 ml Autoclaved deionized water SE 2x125ml 1M Sorbitol 25 mM EDTA pH 8 0 SCE 2x125ml 1M Sorbitol 10 mM Sodium citrate buffer pH 5 8 1mM EDTA 1 M Sorbitol 2x125ml CaS 2 x 60 ml 1 M Sorbitol 10 mM Tris HCI pH 7 5 10 mM CaCl 40 PEG 25 ml 40 w v PEG 3350 Reagent grade in water CaT 25 ml 20 mM Tris HCl p
2. Add 1 2 volume of 7 5 M ammonium acetate pH 7 5 and 2 volumes of ethanol to each tube Place on dry ice for 10 minutes or at 20 C for 60 minutes Centrifuge at 10 000 x g for 20 minutes at 4 C and wash the pellets once with 1 ml of 70 ethanol Briefly air dry the pellets and resuspend each one in 50 ul of TE buffer pH 7 5 Determine the concentration of the DNA sample You can store the samples at 20 C separately or combined until ready for use 87 Determining the Copy Number of Multiple Integrants Introduction Quantitative Dot Blot Solutions Quantitative Dot Blot Procedure 88 You may use quantitative dot blots or Southern hybridization to analyze gene copy number i e the actual number of gene copies in your Pichia recombinant Brierley et al 1994 Clare et al 1991a Romanos et al 1991 Scorer et al 1993 Scorer et al 1994 This requires isolating genomic DNA from Pichia recombinants transformed with the parent vector 0 copies of your gene pAO815 or pPIC3 5K containing 1 copy of your gene single copy control and the Pichia recombinants containing multiple copies of your gene Use the protocol detailed on page 86 to isolate genomic DNA You will need the following solutions 10 15 ml of each for each dot blot 50 mM EDTA 2 5 B mercaptoethanol pH 9 1 mg ml Zymolyase 100T in water Seikagaku America Inc 1 800 237 4512 0 1 N NaOH 1 5 M NaCI 2X SSC You will also need 3MM p
3. B Recombinant IJEN c CTAG GATC cL Vector G 1 Expression Bgl ll 4 BamHI Cassette G Insert GATC T RRS ICEREN C CTAG A y Bgl Il BamH I Bg II BamHI ee 5 AOX1 Paox Gene of Interest TT 5 AOX1 Paox Gene ofinterest TT HIS4 2 Expression Cassettes Continued on next page Experimental Outline continued Transformation and Integration Expression and Scale up Two different phenotypic classes of Hist recombinant strains can be generated Mut and Muf see page 2 Transformation of strain GS115 can yield both classes of transformants Hist Mut and His Mut depending on where the plasmid DNA is linearized see below KM71 yields only His Mut since the strain itself is Mut Both Mut and Mut recombinants are useful to have as one phenotype may favor better expression of your protein than the other may Ideally you should test between 6 10 recombinants per phenotype There is no way to predict beforehand which construct or isolate will better express your protein It is strongly recommended that Pichia recombinants be analyzed by PCR to confirm integration of your construct see page 83 Once you have successfully cloned your gene downstream of the AOX1 promoter you will linearize your plasmid to stimulate recombination when the plasmid is transformed into Pichia The table below describes the types of recombinants you will get by selective digestion of your
4. Provided 1 M Sorbitol SE 1M sorbitol 25 mM EDTA pH 8 0 DTT 1M DTT in water SCE 1M sorbitol 1 mM EDTA and 10 mM sodium citrate buffer pH 5 8 CaS 1M sorbitol 10 mM Tris HCl pH 7 5 10 mM CaCl Zymolyase 3 mg ml in water 40 PEG 40 w v PEG 3350 Reagent grade in water CaT 20 mM Tris pH 7 5 and 20 mM CaCl SOS 1M sorbitol 0 3X YPD 10 mM CaClo Prepared fresh for each transformation SED 19 ml of SE and 1 ml of 1 M DTT see page 38 PEG CaT 1 1 mixture of 40 PEG and CaT see page 40 Continued on next page Growth of Pichia for Spheroplasting continued Procedure Streak GS115 or KM71 onto a YPD plate such that isolated single colonies will grow Incubate the plate at 28 30 C for 2 days Inoculate 10 ml of YPD in a 50 ml conical tube or 100 ml shake flask with a single colony of GS115 or KV71 from the YPD plate and grow overnight at 28 30 C with vigorous shaking 250 300 rpm You may store this culture at 4 C for several days Place 200 ml of YPD in each of three 500 ml culture flasks Inoculate the flasks with 5 10 and 20 pl of cells from the culture made in Step 2 and incubate them overnight with vigorous shaking 250 300 rpm at 28 30 C The next morning bring the transformation solutions SE SCE Sterile Water SOS PEG CaS CaT 1 M sorbitol provided in the kit the RDB plates for plating transformants and the RDHB plates for viability control to room temperature Check the
5. 7709 bp vector One unique restriction site EcoR I Intracellular expression of your gene Requires an initiating ATG codon in a Kozak consensus sequence for proper translation initiation of your gene Cavener amp Stuart 1991 Kozak 1987 Kozak 1990 HIS4 selection in Pichia For insertion at HIS4 linearize with Sal I or Stu I generates His Mutt in GS115 and His Mut in KM71 For a gene replacement at AOX1 in GS115 linearize with Bel II generates His Mut See page 34 for alternate restriction sites if your insert DNA has a Bgl II Stu I or Sal I site Comments for pAO815 7709 nucleotides 5 AOX1 promoter fragment bases 1 940 5 AOX7 primer site bases 855 875 EcoR Site bases 943 948 3 AOX7 primer site bases 1024 1044 3 AOX7 transcription termination TT bases 950 1277 HIS4 ORF bases 4199 1665 3 AOX1 fragment bases 4554 5310 pBR322 origin bases 6394 5740 Ampicillin resistance gene bases 7399 6539 The figure below shows the map of pAO815 Details of the multiple cloning site are shown on page 22 The sequence of pAO815 is available on our website www invitrogen com or from Technical Support page 94 a Q LU 3 AOX TT BamH Cloning into the Pichia Multi Copy Expression Vectors Introduction S MENO o m e Nous General Considerations Below are some guidelines to consider when developing a cloning strategy for these vectors The
6. Mut His transformants can be readily and easily screened for their Mut phenotype with Mu serving as a phenotypic indicator of integration via gene replacement at the AOX1 locus The net result of this type of gene replacement is a loss of the AOX1 locus Mut and the gain of an expression cassette containing P4oxi your gene of interest and HIS4 The figure below shows a gene replacement event at the AOX1 locus Gene replacement double crossover event are less likely to happen than insertions single crossover events In general we recommend linearizing your plasmid DNA to create Pichia recombinants by single crossover events By using GS115 or KM71 the Mut phenotype of the recombinant will be the same as the parent strain Linearized plasmid 57 AOX1 TT 3 Pichia genome his4 7 Plasmid integrated L0 7152 Gene of Interest TT HIS4 3 AOX1 into genome TI Electroporation of Pichia Introduction Preparing Cells Transformation 78 This method does not require the generation and maintenance of spheroplasts making it a very convenient method for generating Pichia transformants Efficiencies run about the same as spheroplasting Scorer et al 1994 1 Grow 5 ml of Pichia pastoris in YPD page 66 in a 50 ml conical at 30 C overnight 2 Inoculate 500 ml of fresh medium in a 2 liter flask with 0 1 0 5 ml of the overnight culture Grow overnight again to an ODeo 1 3 1 5 3 Centrifuge the cells at 1
7. 3 or 4 liter baffled flask and grow at 28 30 C with vigorous shaking 250 300 rpm until the culture reaches log phase growth ODeo 2 6 3 Harvest the cells using sterile centrifuge bottles by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature To induce expression decant the supernatant and resuspend cell pellet to an ODeo 1 0 2 6 liters in MMH BMMH or BMMY medium to start induction 4 Aliquot the culture between several 3 or 4 liter baffled flask Cover the flasks with 2 layers of sterile gauze or cheesecloth and return to incubator Continue to grow at 28 30 C with shaking 5 Add 100 methanol to 0 5 every 24 hours until the optimal time of induction is reached as determined from the time course study 6 Harvest cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature 7 Forintracellular expression decant the supernatant and store the cell pellets at 80 C until ready to process For secreted expression save the supernatant chill to 4 C and concentrate it down if desired see page 61 Proceed directly to purification page 62 or store the supernatant at 80 C until ready to process further Continued on next page 59 Scale up of Expression continued Muf Intracellular or Secreted Note 60 1 Using a single colony inoculate 10 ml of MGYH BMGH or BMGY ina 100 ml baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until the culture reaches a
8. 5 6 7 8 9 10 15 20 25 30 35 40 45 and 50 Add 800 ul of 5 SDS to each tube Continued on next page Preparing Spheroplasts continued Adding Zymolyase continued From one tube of cells Step 5 page 38 withdraw 200 pl cells and add to the tube marked 0 This is your zero time point Set the tube aside on ice Add 7 5 ul of Zymolyase to the same tube of cells mix it gently by inversion and incubate the cells at 30 C Do not shake the sample This sample will be used to establish the incubation time for optimal spheroplasting as described below Keep the second tube of cells at room temperature for use in Step 6 below Keep the remainder of the Zymolyase on ice Monitor the formation of the spheroplasts as follows At time 2 minutes withdraw 200 ul of cells from the suspension in Step 2 and add to the tube marked 2 Repeat at time t 4 5 6 7 8 9 10 15 20 25 30 35 40 45 and 50 minutes after adding Zymolyase Read the ODso for all samples Determine the percent of spheroplasting for each time point using the equation 7o Spheroplasting 100 ODso at time t ODso at time 0 x 100 For example At time t 0 the ODso 0 256 At time t 15 the ODs 0 032 Calculation spheroplasting 100 0 032 0 256 x 100 100 0 125 x 100 100 12 5 87 5 Determine the time of incubation that results in approximately 70 spheroplasting This time of incubation is variable due t
9. Continued on next page Pichia Strains continued MOSMSMEN 7 Y Ne o PA E Storage of Pichia Strains Note 10 Make frozen stocks for long term storage of all three Pichia strains included in this kit see below To store cells for weeks to months use YPD medium or YPD agar slants see page 57 1 Streak for single colonies of the desired strain on YPD 2 Transfer one colony to a YPD stab and grow for 2 days at 30 C 3 You can store the cells on YPD for several weeks at 4 C To store cells for months to years store frozen at 80 C 1 Culture a single colony of the desired strain overnight in YPD 2 Harvest the cells and suspend in YPD containing 15 glycerol at a final OD of 50 100 approximately 2 5 x 10 5 0 x 10 cells ml 3 Freeze the cells in liquid nitrogen or a dry ice ethanol bath and store at 80 C After extended storage at 4 C or 80 C we recommend checking the His transformants for correct genotype and viability by streaking on MM MD or MGY plates before using again E coli Strains Genotype of E coli Strain The E coli strain TOP10F is provided in case no suitable E coli strain is available Other strains which may be suitable are TOP10 DH5aF JM109 or any other strain which is recombination deficient recA and deficient in endonuclease A end A F proAB lac lacZAM15 Tn10 Tet mcrA A mrr hsdRMS mcrBC b80lacZAM15 AlacX74 recA1 X araD13
10. al 1989 for a protocol to prepare competent E coli EcoRI BamH I and Bgl II restriction enzymes and appropriate buffers e Low melt agarose e Glass milk e Sterile water e CIP calf intestinal alkaline phosphatase 1 unit pl e 10X CIP Buffer e Phenol chloroform e 3M sodium acetate e 100 ethanol e 80 ethanol e T4 Ligase 2 5 units ul e 10X Ligation Buffer with ATP e LB Amp plates 50 100 ug ml ampicillin e 16 C 37 C and 65 C water baths or temperature block Controls To evaluate your transformants and expression data later on we recommend transforming Pichia with pAO815 the parent vector and pAO815 containing one copy of your expression gene This allows you to compare expression levels to see if multiple copies significantly increase the amount of protein produced Also if you elect to determine how many copies of your gene are in a recombinant by dot or Southern blot the strain with the parent vector will control for background hybridization and the strain with the single copy gene will provide a signal to normalize your data Continued on next page In Vitro Multimerization Protocol continued Digesting Recombinant pAO815 Producing Expression Cassettes for Multimerization Dephosphory lation of Vector 26 Set up two separate digestions of recombinant pAO815 containing one copy of your gene 1 Double digest 1 2 ug recombinant pAOS815 with 10 units each of Bgl II and BamH
11. screen for possible multi copy inserts while the in vitro method produces tandem inserts of your gene by ligation pAO815 and pPIC3 5K are used for intracellular expression while pPIC9K is used for secreted expression All vectors utilize the AOX1 promoter for inducible high level expression For more information on these vectors see pages 12 16 Multiple plasmid integration events occur spontaneously in Pichia at a frequency between 1 and 10 of all Hist transformants The in vivo method allows you to screen for the His transformants that may have multiple inserts of your gene The in vitro method allows you to construct multimers by ligation When Hist transformants are selected they will have a high probability of containing the multimers that you constructed in vitro pPIC3 5K and pPIC9K contain the bacterial kanamycin gene kan from Tn903 that confers resistance to Geneticin in Pichia Note that kan does not confer resistance to kanamycin in Pichia The level of Geneticin resistance roughly depends on the number of kanamycin genes integrated A single copy of pPIC3 5K or pPIC9K integrated into the Pichia genome confers resistance to Geneticin to a level of 0 25 mg ml Multiple integrated copies of either vector can increase the Geneticin resistance level from 0 5 mg ml 1 2 copies up to 4 mg ml 7 12 copies Because of the genetic linkage between the kanamycin gene and the expression cassette Pox and your gene of inte
12. 500 x g for 5 minutes at 4 C Resuspend the pellet with 500 ml of ice cold sterile water 4 Centrifuge the cells as in Step 3 and resuspend the pellet with 250 ml of ice cold sterile water 5 Centrifuge the cells as in Step 3 and resuspend the pellet in 20 ml of ice cold 1 M sorbitol 6 Centrifuge the cells as in Step 3 and resuspend the pellet in 1 ml of ice cold 1 M sorbitol for a final volume of approximately 1 5 ml Note You may freeze the electrocompetent cells in 80 ul aliquots however the transformation efficiencies will decrease significantly 1 Mix80 pl of the cells from Step 6 above with 5 20 pg of linearized DNA in 5 10 pl TE Buffer and transfer them to an ice cold 0 2 cm electroporation cuvette 2 Incubate the cuvette with the cells on ice for 5 minutes 3 Pulse the cells according to the parameters for yeast Saccharomyces cerevisiae suggested by the manufacturer of the specific electroporation device being used 4 Immediately add 1 ml of ice cold 1 M sorbitol to the cuvette Transfer the cuvette contents to a sterile microcentrifuge tube 5 Spread 200 600 pl aliquots on MD or RDB plates 6 Incubate the plates at 30 C until colonies appear Screen for Mut Mut phenotypes as indicated on page 47 PEG 1000 Transformation Method for Pichia Introduction It is thought that a PEG procedure is better than LiCl but not as good as spheroplasting or electroporation for transformation It is conv
13. Cerevisiae Microbiol Rev 51 458 476 Koutz P J Davis G R Stillman C Barringer K Cregg J M and Thill G 1989 Structural Comparison of the Pichia pastoris Alcohol Oxidase Genes Yeast 5 167 177 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Laroche Y Storme V Meutter J D Messens J and Lauwereys M 1994 High Level Secretion and Very Efficient Isotopic Labeling of Tick Anticoagulant Peptide TAP Expressed in the Methylotrophic Yeast Pichia pastoris Bio Technology 12 1119 1124 Linder S Schliwa M and Kube Granderath E 1996 Direct PCR Screening of Pichia pastoris Clones BioTechniques 20 980 982 Nico Farber K Harder W Ab G and Veenhuis M 1995 Review Methylotrophic Yeasts as Factories for the Production of Foreign Proteins Yeast 11 1331 1344 Continued on next page 99 References continued Paifer E Margolles E Cremata J Montesino R Herrera L and Delgado J M 1994 Efficient Expression and Secretion of Recombinant Alpha Amylase in Pichia pastoris Using Two Different Signal Sequences Yeast 10 1415 1419 Ridder R Schmitz R Legay F and Gram H 1995 Generation of Rabbit Monoclonal Antibody Fragments from a Combinato
14. Cregg J M Vedvick T S and Raschke W C 1993 Recent Advances in the Expression of Foreign Genes in Pichia pastoris Bio Technology 11 905 910 Despreaux C W and Manning R F 1993 The dacA Gene of Bacillus stearothermophilus Coding for D Alanine carboxypeptidase Cloning Structure and Expression in Escherichia coli and Pichia pastoris Gene 131 35 41 Continued on next page 98 References continued Deutscher M P ed 1990 Guide to Protein Purification Vol 182 Methods in Enzymology Edited by Abelson J N and Simon M I Academic Press San Diego CA Digan M E Lair S V Brierley R A Siegel R S Williams M E Ellis S B Kellaris P A Provow S A Craig W S Velicelebi G Harpold M M and Thill G P 1989 Continuous Production of a Novel Lysozyme via Secretion from the Yeast Pichia pastoris Bio Technology 7 160 164 Ellis S B Brust P F Koutz P J Waters A F Harpold M M and Gingeras T R 1985 Isolation of Alcohol Oxidase and Two other Methanol Regulatable Genes from the Yeast Pichia pastoris Mol Cell Biol 5 1111 1121 Fryxell K B O Donoghue K Graeff R M Lee H C and Branton W D 1995 Functional Expression of Soluble Forms of Human CD38 in Escherichia coli and Pichia pastoris Protein Expression and Purification 6 329 336 Garcia J N Aguiar J A Gill M Alvarez A Morales J Ferrero J Gonzalez B Padron G
15. GS115 kb MW 1 2 E OO aUu gt 222 1 0 The Easy DNA Kit available separately from Invitrogen provides a fast and easy method to isolate genomic DNA from Pichia pastoris See page viii for ordering information Direct PCR Screening of Pichia Clones Introduction A simple protocol has been reported in the literature to directly test Pichia clones for insertion of your gene by PCR Linder et al 1996 Briefly the cells are lysed by a combined enzyme freezing and heating treatment You may use the genomic DNA directly as a PCR template Before Starting You will need the following reagents and equipment on hand e A culture or single colony of a Pichia transformant 1 5 ml microcentrifuge tube e 5U ul solution of Lyticase Sigma e 30 C water bath or heat block e Liquid nitrogen e Reagents for PCR Procedure 1 Place 10 pl of a Pichia pastoris culture into a 1 5 ml microcentrifuge tube For relatively dense cultures dilute 1 ul of the culture into 9 ul water Alternatively pick a single colony and resuspend in 10 ul of water 2 Add 5 plofa5 U l solution of lyticase and incubate at 30 C for 10 minutes 3 Freeze the sample at 80 C for 10 minutes or immerse in liquid nitrogen for 1 minute 4 Set up a 50 ul PCR for a hot start 10X Reaction Buffer 5ul 25 mM MgCl2 5 pl 25 mM dNTPs 1ul 5 AOXI primer 10 pmol ul 1 pl 3 AOXI primer 10 pmol ul 1 pl Sterile water 27 ul Cell lysate 5 pl Tot
16. GalNAc Peptide N Glycosidase F Endo Glycoproteins between Asn and GlcNAc removes oligosaccharides Sialidases Exo NeuAc a2 6 Gal Neuraminidases NeuAc a2 6 GIcNAc Vibrio cholerae or NeuAc a2 3 Gal Clostridium perfringens Arthobacter ureafaciens Newcastle disease virus There are a number of commercial vendors who will contract to analyze proteins for glycosylation A number of companies also supply kits and reagents for researchers to do carbohydrate analysis in their own laboratories A partial list is provided below Company Type of Service Contact Glyko Kits for Carbohydrate 1 800 334 5956 Analysis www prozyme com Reagents Contract Services New England BioLabs Reagents 1 800 632 5227 www neb com 63 Appendix E coliMedia Recipes Introduction You select transformants containing pAO815 pPIC3K or pPIC9K on LB agar containing 50 to 100 pg ml ampicillin LB Luria 1 Tryptone Bertani Medium 0 5 Yeast Extract 1 NaCl pH 7 0 1 For 1 liter dissolve the following in 950 ml deionized water 10 g tryptone 5 g yeast extract 10 g NaCl 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave for 20 minutes at 15 Ibs sq in Let cool to 55 C and add desired antibiotics at this point 4 Store at room temperature or at 4 C LB agar plates 1 Make LB Medium above and add 15 g liter agar before autoclaving Autoclave for 20 mi
17. MIEL eae 1 EcoRI Ayr II Not I 922 CAACTAATTA TTCGAAGGAT CCTACGTAGA ATTCCCTAGG GCGGCCGCGA 972 ATTAATTCGC CTTAGACATG ACTGTTCCTC AGTTCAAGTT GGGCACTTAC 3 AOX 1 Primer Site 1055 1075 T 1022 GAGAAGACCG GTCTTGCTAG ATTCTAATCA AGAGGATGTC AGAATGCCAT _iI 1072 TTGCCTGAGA GATGCAGGCT TCATTTTTGA TACTTTTTTA TTTGTAACCT AOXI mRNA 3 end 1146 1122 ATATAGTATA GGATTTTTTT TGTCATTTTG TTTCTTC Special e For pPIC3 5K the fragment containing the gene of interest should have a Considerations Kozak consensus sequence for proper translation initiation although this requirement is not as stringent in yeast For example ACC ATG G is a Kozak consensus sequence where the ATG corresponds to the initiating ATG for your gene of interest Cavener amp Stuart 1991 Kozak 1987 Kozak 1990 e Be sure to analyze the 5 untranslated region of the mRNA for secondary structure formation Secondary structure in the mRNA may have a negative effect on expression of the recombinant protein e If you are digesting with BamH I and SnaB I or SnaB I and EcoR I digest with SnaB I first If you digest with BamH I or EcoR I first the SnaB I site will be too close to the end of the DNA and will not be digested properly Continued on next page 20 Cloning into the Pichia Multi Copy Expression Vectors continued P ox and Multiple Cloning Site of pPIC9K 82 87 92 96 100 105 109 113 117 125
18. Mut phenotype as described below 1 Using a sterile toothpick pick one colony and streak or patch one His transformant in a regular pattern on both an MM plate and an MD plate making sure to patch the MM plate first 2 Use anew toothpick for each transformant continuing until 100 transformants have been patched 2 3 plates 3 To differentiate Mut from Mut make one patch for each of the controls GS115 His Mut Albumin and GS115 His Mut p Gal onto the MD and MM plates Incubate the plates at 30 C for 2 days 5 After 2 days or longer at 30 C score the plates Look for patches that grow normally on the MD plates but show little or no growth on the MM plates Continued on next page 47 Screening for Mut and Mut Transformants continued Note Replica Plating Procedure Easier Selection of Transformants 48 We recommend purifying your Hist transformants to ensure pure clonal isolates You may do this before or after testing for the Mut phenotype This procedure gives a lower rate of misclassifications but it increases the overall Mut Mu screening procedure by 2 days You will need equipment to replica plate 1 Using sterile toothpicks patch 100 Hist transformant on MD plates 2 3 plates For controls make one patch from each of the strains GS115 His Mut Albumin and GS115 His Mutt B Gal onto the MD plates Incubate the plates at 28 30 C for 2 days After 2 days replica p
19. Sal I 2919 BspEI zs B 3580 pAOS15 Note that if more than one expression cassette is created in pAO815 the unique sites in the 5 AOXT region are now duplicated and no longer unique Restriction 5 AOX1 3 AOX1 Vector backbone HIS4 gene Enzyme Bgl II 2 5307 Sal I 2863 StuI 2948 BspEI e lt zs 3580 tRestriction sites are used to generate gene replacements at AOX1 in GS115 only pPIC9K Note that an additional Stu I site was added with the inclusion of the kan gene eliminating the unique Stu I site in HIS4 Restriction 5 AOX1 3 AOX1 Vector backbone HIS4 gene Enzyme SacI 209 Pme lI 414 Bpu 11021 589 Xcm I 699 Bgl TIt 2 6875 Dra It 414 6713 6855 8046 8065 8757 Sal I 3178 BspEI B 3845 tRestriction sites are used to generate gene replacements at AOX1 in GS115 only Continued on next page Preparing Transforming DNA continued Controls We recommend that you include the following controls when transforming Pichia The parent vector linearized in the same manner as your construct Use this as a control to confirm integration via PCR page 83 and as control for background for the expression analysis and the quantitative dot blots or Southern analysis pPIC3 5K pAO815 or pPIC9K containing one copy of your expression cassette
20. at a later date 44 Continued on next page In Vivo Screening of Multiple Inserts continued Method 2 You will need three sets of two microtiter plates 6 total to screen 180 Hist recombinants It is important to grow your clones to approximately the same cell density by successive inoculations to ensure that equivalent numbers of cells are spotted on Geneticin plates If you plated your transformants in top agar it may be necessary to extract them from the agarose and re plate them on minus histidine plates see page 48 in order to pick colonies Remember to include controls for strain background and one copy of your gene For every 180 colonies you can expect to isolate 1 10 Geneticin resistant colonies 1 Using sterile technique add 200 ul YPD to each microtiter well 2 Inoculate each well of the first set of plates with a single His transformant using a sterile toothpick and stirring to resuspend cells 3 Cover the microtiter plate and incubate at 30 C for 2 days shaking not required 4 After 2 days take new microtiter plates and add 190 ul of YPD to each well Inoculate the second set of microtiter plates with 10 ul from the first set of microtiter plates by using a multi channel pipette Make sure the second set of plates is marked and oriented in such a way that you can keep track of wells 6 Cover and incubate the second set of plates overnight at 30 C The next day repeat Steps 5 and 6 creating a thir
21. compensates by generating large amounts of the enzyme The promoter regulating the production of alcohol oxidase is the one used to drive heterologous protein expression in Pichia Continued on next page Overview continued Two Alcohol Oxidase Proteins Expression Phenotype of aox1 mutants Intracellular and Secretory Protein Expression Two genes in Pichia pastoris code for alcohol oxidase AOX1 and AOX2 The AOX1 gene product accounts for the majority of alcohol oxidase activity in the cell Expression of the AOX1 gene is tightly regulated and induced by methanol to very high levels typically gt 30 of the total soluble protein in cells grown on methanol The AOX1 gene has been isolated and a plasmid borne version of the AOX1 promoter is used to drive expression of the gene of interest encoding the desired heterologous protein Ellis et al 1985 Koutz et al 1989 Tschopp et al 1987a While AOX2 is about 97 homologous to AOX1 growth on methanol is much slower than with AOX1 This slow growth on methanol allows isolation of Muf strains aox1 Cregg et al 1989 Koutz et al 1989 Expression of the AOX1 gene is controlled at the level of transcription In methanol grown cells approximately 5 of the polyA RNA is from the AOX1 gene The regulation of the AOX1 gene is a two step process a repression derepression mechanism plus an induction mechanism e g GAL1 gene in Saccharomyces Johnston 1987 Briefly
22. et al 1994 or Chapter 13 in Molecular Cloning A Laboratory Manual Sambrook et al 1989 After you have cloned your gene into pAO815 you are ready to construct in vitro multimers using the protocol on the next page If you cloned your gene into pPIC3 5K or pPIC9K you are ready to prepare plasmid DNA for transformation into Pichia Refer to page 32 for more information 23 In Vitro Multimerization Protocol Introduction Alternative Procedure 24 At this point you have your gene cloned into the EcoR I site of pAO815 recombinant pAO815 To create in vitro multimers you will first generate a Bgl II BamH I expression cassette consisting of the AOX1 promoter and your gene Second you will linearize the vector using BamH I to allow cloning of multiple copies of the Bgl II BamH I expression cassette Note that the linearized vector already contains one copy of your expression cassette To generate multiple copies of your expression cassette follow the general steps below Details are provided on pages 25 31 1 Treat your Bgl II BamH I expression cassette with ligase in vitro Note that Bgl II and BamH I share 4 bases in common between their recognition sites 2 Generate head to tail head to head and tail to tail multimers Head to tail ligation which is the correct orientation for expression will destroy both the BamH I and Bg II sites 3 Treat the ligation mix with BamH I and Bgl II to eliminate head to h
23. help with cloning If your insert has an EcoR I site and you are trying to clone into the EcoR I site of Note pAO815 we recommend the following 1 An enzyme like Bsa I has the following restriction recognition site 5 GGTCTCN 3 CCAGAGNNNNN An EcoR I site may be engineered into the recognition site for Bsa I 5 GGTCTCG AATTC 3 CCAGAGCTTAA G You may add this sequence to your DNA fragment by integrating it into your PCR primer or create in vitro as an adaptor to another restriction site Digest your PCR or adapted ligation product with Bsa I This will generate EcoR I overhangs on both ends of your fragment without digesting with EcoR I Ligate into dephosphorylated pAO815 Other enzymes that may be used are BsmA I or BsmB I 18 Continued on next page Cloning into the Pichia Multi Copy Expression Vectors continued Signal Sequence Processing Optimizing Signal Cleavage Bacterial Transformation The processing of the a factor mating signal sequence in pPIC9K occurs in two steps 1 The preliminary cleavage of the signal sequence by the KEX2 gene product with the final Kex2 cleavage occurring between arginine and glutamine in the sequence Glu Lys Arg Glu Ala Glu Ala where is the site of cleavage 2 The STE13 gene product further cleaves the Glu Ala repeats In Saccharomyces cerevisiae it has been noted that the Glu Ala repeats are not necessary for cleavage by Kex2 but cleav
24. linear DNA can generate stable transformants of Pichia pastoris via homologous recombination between the transforming DNA and regions of homology within the genome Cregg et al 1985 Cregg et al 1989 Such integrants show extreme stability in the absence of selective pressure even when present as multiple copies The most commonly used expression vectors carry the HIS4 gene for selection These vectors are designed to be linearized with a restriction enzyme such that His recombinants are generated by recombination at the AOX1 locus see below or at the his4 locus see next page Note that single crossover events insertions are much more likely to happen than double crossover events replacements Multiple insertion events occur spontaneously at about 1 10 of the single insertion events Gene insertion events at the AOX1 GS115 or aox1 ARG4 KM71 loci arise from a single crossover event between the loci and any of the three AOX1 regions on the vector the AOX1 promoter the AOX1 transcription termination region TT or sequences even further downstream of AOX1 3 AOX1 This results in the insertion of one or more copies of the vector upstream or downstream of the AOX1 or the aox1 ARG4 genes The phenotype of such a transformant is His Mut GS115 or His Mut KM71 By linearizing the recombinant vector at a restriction enzyme site located in the 5 or 3 AOX1 regions Mut or Mut recombinants can be conveniently generated
25. multiple cloning sites for each vector are presented on the following pages for your convenience If you are using pPIC9K it is important to clone your gene in frame with the a factor signal sequence We recommend that you transform the three supercoiled Pichia expression vectors into E coli so that you have a permanent stock e Dilute 1 ul of each plasmid to 10 100 pg ul using sterile water or TE buffer e Transform competent E coli with 1 2 ul of the diluted plasmid and select on LB with 50 100 pg ml ampicillin LB Amp The following are some general considerations applicable to pAO815 pPIC3 5K and pPIC9K e The codon usage in Pichia is believed to be the same as Saccharomyces cerevisiae and many Saccharomyces genes have proven to be cross functional in Pichia e Plasmid constructions should be maintained in a recA endA mutant E coli strain such as TOP10F e The native 5 end of the AOX1 mRNA is noted in each multiple cloning site This is needed to calculate the size of the expressed mRNA of the gene of interest if you need to analyze mRNA for any reason Translation termination is determined by either stop codons in the gene of interest or in the 3 AOX1 sequence The stop codons in the 3 AOX1 sequence are noted in each figure on the following pages The premature termination of transcripts because of AT rich regions has been observed in Pichia and other eukaryotic systems Henikoff amp Cohen 1984 Irniger e
26. number 380 is the constant used to convert the OD reading into units One unit is defined as the amount of enzyme that will hydrolyze 1 nmole of ONPG per minute at 28 C The molar extinction coefficient of ONPG under these conditions is 4 500 For a sample calculation See below Here is a sample calculation Extract concentration 10 mg ml Assay 10 pl of a 1 100 dilution Time 10 minutes OD 0 4 The amount of protein in the reaction 0 01 ml x 0 01 dilution factor x 10 mg ml 0 001 mg protein in the reaction The specific activity 0 400 x 380 15 200 units mg protein 10 x 0 001 mg Pure p galactosidase has an activity of 300 000 units mg protein 93 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato
27. phosphate buffer you may use a wide range of pH values to optimize production of your protein BMGY BMMY contain yeast extract and peptone which may help stabilize secreted proteins and prevent or decrease proteolysis of secreted proteins Inclusion of yeast extract and peptone act as a mixed feed allowing better growth and biomass accumulation There are some proteins specifically susceptible to proteases that have optimal activity at neutral pH If this is the case expression using MGY and MM media may be indicated As Pichia expression progresses in an unbuffered medium such as MM the pH drops to 3 or below inactivating many neutral pH proteases Brierley et al 1994 Pichia is resistant to low pH so the low pH will not affect growth In contrast it has been reported that by including 1 Casamino acids Difco and buffering the medium at pH 6 0 extracellular proteases were inhibited increasing the yield of mouse epidermal growth factor Clare et al 1991b If you know your protein of interest is especially susceptible to neutral pH proteases you may want to do your expressions in an unbuffered medium MM If there is no evidence that your secreted protein of interest is susceptible to proteases at neutral pH we recommend you do your initial expressions in BMMY If the expressed protein is degraded you may then try expression in an unbuffered medium If the above options fail to protect your protein from degradation you may w
28. replication and maintenance in E coli BamHI Unique restriction sites Permits linearization of vector Bel Il Note Stu Lis not unique to for efficient integration into Not I pPIC3 5K or pPIC9K the Pichia nape and Sac I generation of either Mut or Sal I Muf recombinants Stu I kan Kanamycin resistance gene Allows in vivo screening for multicopy inserts by increased resistance to Geneticin Also allows selection for kanamycin resistance in E coli There is no yeast origin of replication in any of the Pichia expression vectors included in this kit His transformants can only be isolated if recombination occurs between the plasmid and the Pichia genome 13 pPIC3 5K Description pPIC3 5K is a plasmid designed to allow you to identify in vivo multiple integrations of your gene in the Pichia genome Other details about pPIC3 5K are provided below 9004 bp vector Five unique restriction sites in the multiple cloning site BamH I SnaB I EcoR I Avr II Not I Intracellular expression of your gene Requires an initiating ATG codon in a Kozak consensus sequence for proper translation initiation of your gene Cavener amp Stuart 1991 Kozak 1987 Kozak 1990 HIS4 selection in Pichia For insertion at AOX1 in GS115 or KM71 linearize with Sac I generates His Mut in GS115 and Hist Mut in KM71 For insertion at HIS4 linearize with Sal I generates His Mut in GS115 and His Mut in KV71 For a gene replaceme
29. screens fewer numbers of clones but is more reliable It involves growing clones in microtiter plates until all clones are at the same density The cultures are then spotted on the YPD Geneticin plates and scored for Geneticin resistance There is a tendency to isolate false positives when screening with Geneticin It is very important to purify your putative Geneticin resistant clones by streaking for single colonies on YPD and then confirming Geneticin resistance on YPD Geneticin plates We do not recommend replica plating as a method to screen for Geneticin resistance If you do elect to replica plate be sure to confirm Geneticin resistance Continued on next page In Vivo Screening of Multiple Inserts continued Before Starting Prepare 4 YPD plates of each of the following concentrations of Geneticin 0 0 25 0 5 0 75 1 0 1 5 1 75 2 0 3 0 and 4 0 mg ml see Appendix page 67 Method 1 Use this procedure if you transformed Pichia spheroplasts Start with plates Spheroplasts containing His transformants 1 Using a sterile spreader remove the top layer of the soft agar containing the His transformants and place into a sterile 50 ml conical centrifuge tube 2 Add 10 to 20 ml of sterile water There should be a 2X volume of water above the settled agar Vortex vigorously for 1 to 2 minutes 3 Set the centrifuge tube upright on the bench and letthe agar pieces settle about 1 minute 4 Det
30. to directly test for high expressing Pichia recombinant clones without first screening for Mut or Mut phenotypes After testing for high expression be sure to also check the Mut phenotype This will help you optimize expression of your recombinant clone 41 In Vivo Screening of Multiple Inserts Introduction Methods to Screen for Geneticin Resistant Transformants Note 42 You will need as many Hist transformants as you can conveniently generate Recall that statistically 1 10 of the His transformants will have more than one insert This means that if the frequency of multicopy inserts is 1 you will have to screen 1000 His transformants to get 10 Geneticin hyper resistant colonies to test This may require 1 5 plates containing His transformants It is not unusual to screen thousands of colonies Once you have Geneticin resistant colonies you can then test them for expression of your recombinant protein page 50 or characterize them for the Mut phenotype page 47 There are two methods used to screen His transformants for Geneticin resistance Method 1 is technically easier and screens a greater number of clones but is less reliable After initial selection of His transformants they are pooled and plated on YPD Geneticin plates containing increasing concentrations of Geneticin Method 1 is applicable to spheroplast or electroporation transformation methods Method 2 is technically more difficult and
31. total protein concentration should be around 5 10 mg ml 7 Save the pellet and extract with 6 M urea or 1 Triton X 100 to check for insoluble protein Biospec Bartlesville OK makes a Bead Beater that can handle 5 200 ml volumes of cell suspension When expressing and purifying a glycosylated protein in a heterologous expression system it is desirable to quickly determine whether the protein is glycosylated properly Recently some protocols for carbohydrate analysis of proteins have been published to allow the molecular biologist to characterize glycosylated proteins of interest Ausubel et al 1994 Unit 17 Further information about glycosylation in eukaryotes is available in a review Varki amp Freeze 1994 Protein Purification and Glycosylation continued Enzymes for Analyzing Glycoproteins Commercial Carbohydrate Analysis These are just a few of the enzymes available for carbohydrate analysis Abbreviations are as follows Asn Asparagine Gal Galactose GlcNAc N acetylglucosamine GalNAc N acetylgalactosamine and NeuAc N acetylneuraminic acid Enzyme Type of Specificity enzyme Endoglycosidase D Endo Cleaves various high mannose glycans Endoglycosidase F Endo Cleaves various high mannose glycans Endoglycosidase H Endo Cleaves various high mannose glycans B galactosidase Exo Removes terminal galactosides from Gal B1 3 GIcNAc Gal B1 4 GlcNAc or Gal B1 3
32. 135 Special Considerations The sequence below shows the detail of the multiple cloning site and surrounding sequences Potential stop codons are shown underlined AOA RNA 5 end 824 5 AOXI primer site 855 875 r TTATCATCAT TATTAGCTTA CTTTCATAAT TGCGACTGGT TCCAATTGAC 71 AAGCTTTTGA TTTTAACGAC TTTTAACGAC AACTTGAGAA GATCAAAAAA Start 949 a Factor Signal Sequence CAACTAATTA TTCGAAGGAT CCAAACG ATG AGA TTT CCT TCA ATT Met Arg Phe Pro Ser Ile TTT ACT GCA GTT TTA Phe Thr Ala Val Leu CCA GTC AAC ACT ACA Pro Val Asn Thr Thr GCT GAA GCT GTC ATC Ala Glu Ala Val Ile GAT GTT GCT GTT TTG Asp Val Ala Val Leu TTA TTG TTT ATA AAT Leu Leu Ph rl Asn GAA GAA GGG GTA TCT Glu Glu Gly Val Ser Eco RI GIA GAA T Ayr Il rc CCT AGG Val Glu Phe Pro Arg ACATGACTGT GCTAGATTC AGGCTTCAT TTC Phe ACA Thr GGT Gly CCA Pro GCA GCA Ala Ala GAA GAT Glu Asp TAC TCA Tyr Ser TP LEE Phe Ser TOC TCG Ser Ser GAA ACG Glu Thr GAT TTA Asp Leu AAC AGC Asn Ser GCA Ala GCA Ala GAA Glu ACA Thr TTA GCT GCT Leu Ala Ala CAA ATT CCG Gln Ile Pro GGG GAT TTC Gly Asp Phe AAT AAC GGG Asn Asn Gly a Factor primer site 1152 1172 r ACT Thr CTC Leu Not I GCG Ala l TCCTCAGTTC AAG 3 AOX 1 primer site 1327 1347 AATCAAGAGG ATGTCAGAA I TTTGATACTT TTTTATTTG ACT ATT
33. 4 This section provides guidelines to prepare and analyze your samples using SDS polyacrylamide gel electrophoresis Invitrogen offers a wide range of pre cast NuPAGE and Tris Glycine polyacrylamide gels and electrophoresis apparatus The patented NuPAGE Gel System avoids the protein modifications associated with Laemmli type SDS PAGE ensuring optimal separation for protein analysis In addition Invitrogen carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use refer to our website www invitrogen com or contact Technical Support page 94 If you are pouring your own gels note that any standard SDS polyacrylamide gel apparatus and protocol will work for example a 12 polyacrylamide gel with a 5 stacking gel is recommended for proteins ranging in size from 40 100 kDa For other recommendations see standard texts such as Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Biology A Laboratory Manual Sambrook et al 1989 Guide to Protein Purification Deutscher 1990 or Protein Methods Bollag et al 1996 You will need to prepare Breaking Buffer see page 71 and have acid washed 0 5 mm glass beads on hand Preparing of cell pellets Intracellular and Secreted Expression 1 Thaw cell pellets quickly and place on ice 2 For each 1 ml sample add 100 ul Breaking Buffer to the cell pe
34. 6 0 0 1 if the pH needs to be adjusted use phosphoric acid or KOH 2 Sterilize by autoclaving and store at room temperature The shelf life of this solution is greater than one year Yeast Extract Peptone Dextrose Medium 1 liter 176 yeast extract 2 peptone 2 dextrose glucose Note If you are using the YP Base Medium or the YP Base Agar medium pouches included with the Multi Copy Pichia Expression Kit follow the directions on the pouch 1 Dissolve 10 g yeast extract and 20 g of peptone in 900 ml of water Note Add 20 g of agar if making YPD slants or plates 2 Autoclave for 20 minutes on liquid cycle 3 Add 100 ml of 10X D Store the liquid medium at room temperature Store the YPD slants or plates at 4 C The shelf life is several months Continued on next page Pichia Media Recipes continued YPD Geneticin Yeast Extract Peptone Dextrose Medium plates 1 yeast extract 2 peptone 2 dextrose glucose 2 agar Variable amounts of Geneticin see page viii for ordering information Use 50 mg ml Geneticin stock solution to make YPD plates containing Geneticin at final concentrations of 0 25 0 5 0 75 1 0 1 5 1 75 2 0 3 0 and 4 0 mg ml For 250 ml 8 to 10 plates of a single Geneticin concentration 1 Combine 2 5 g yeast extract 5 g peptone and 5 g agar in 225 ml deionized water 2 Autoclave for 20 minutes on liquid cycle Add 25 ml of 10X D and mix well Cool YPD to
35. 815 1 Set up a 20 pl ligation reactions as follows Bgl II BamH I digested expression cassette 15 ul Sterile water 2 pl 10X Ligation Buffer with ATP 2 pl T4 DNA Ligase 2 5 units tl 1nl 2 Incubate at 16 C for 2 5 hours Heat inactivate the ligase by incubating at 65 C for 20 minutes Add the following reagents for restriction enzyme digestion cut back Note that BamH I and Bgl II may be used with the same restriction buffer Sterile water 23 pl 10X restriction enzyme buffer 5 pl Bel II 10 units ml 1 pl BamH I 10 units ml 1 pl 5 Incubate the reaction at 37 C for 2 hours 6 Add 50 pl of phenol chloroform and extract the restriction enzyme digestion to remove the enzymes Transfer the aqueous solution to a new microcentrifuge tube 7 Ethanol precipitate the DNA using 5 ul 3 M sodium acetate and 110 pl 100 ethanol 8 Resuspend pellet in 4 ul sterile water Save on ice if you plan to ligate your insert immediately or you can store at 20 C Proceed to Ligating Multimers into Linearized Vector next page Continued on next page 27 In Vitro Multimerization Protocol continued Note Ligating Multimers into Linearized Vector Transformation into E coli 28 You may wish to combine the ligation reaction with the restriction enzyme digestion T4 ligase will retain most of its activity in all of the four New England BioLabs buffers Remember to add 1 mM ATP to the reaction in order to ensu
36. 9 A ara leu 7697 galU ealK rpsL Str endA1 nupG Note If you do not plan to perform single stranded DNA rescue E coli strains that do not carry the F episome are also suitable for use We recommend that you make a frozen stock of TOP10F to keep on hand 1 Culture TOP10F in 5 ml LB with 10 pg ml tetracycline Grow overnight 2 Mixthoroughly 0 85 ml of culture with 0 15 ml sterile glycerol 3 Transfer to a freezer vial and freeze in liquid nitrogen or a dry ice ethanol bath 4 Store at 80 C 11 Selecting a Pichia Expression Vector Selecting a If your protein is cytosolic and non glycosylated you may elect to express the Vector protein intracellularly If your protein is normally secreted glycosylated or directed to an intracellular organelle you may wish to try secreting your protein We recommend that you try both the native secretion signal using pPIC3 5K or pAO815 and the a factor signal sequence in pPIC9K in order to secrete your protein We recommend trying in vivo and in vitro methods to generate or isolate 2 multicopy inserts of your gene It is difficult to predict beforehand which method will work for your protein A summary of the advantages and disadvantages of each method is presented in the lists below a In am RECO In vitro Method pAO815 Advantages Disadvantages e Quantitative construction of a defined e More work up front to clone defined number of multi
37. AAAAAA TIAGACATGA CTGTTCCTCA TCTTGCTAGA TTCTAATCAA ATGCAGGCTT CATTTTTGAT AOX1 mRNA 3 end 1115 GATTTTTTTT GTCATTTTGT Special Considerations For in vitro multimerization you need to analyze your insert for BamH I and Bgl II restriction sites If your insert has a BamH I or Bgl II site we recommend that you use the in vivo method pPIC3 5K to isolate multiple inserts of your gene For pAOS15 the fragment containing the gene of interest should have a Kozak consensus sequence for proper translation initiation although this requirement is not as stringent in yeast For example ACC ATG G is a Kozak consensus sequence where the ATG corresponds to the initiating ATG for your gene of interest Cavener amp Stuart 1991 Kozak 1987 Kozak 1990 Be sure to analyze the 5 untranslated region of the mRNA for secondary structure formation Secondary structure in the mRNA has a negative effect on expression of the recombinant protein 22 Transformation into E coli Introduction Analysis of Transformants Sequencing Recombinant Clones After Cloning Your Gene At this point you have ligation reactions that you will transform by chemical means or electroporation into competent E coli cells TOP10F or equivalent For procedures to prepare competent cells see Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Biology A Laboratory Manual Sambrook et al 1989 1 After tra
38. Add 40 pl 10 SDS and vortex for 20 seconds 2 Add an equal volume 450 500 ul of buffer saturated phenol and vortex for 20 seconds 3 Incubate at 65 C for 4 minutes Incubate in a dry ice ethanol bath until crystals show 1 minute Centrifuge at maximum speed for 2 minutes at 4 C 5 Transfer aqueous phase to new centrifuge tube and add an equal volume of phenol chloroform and vortex for 20 seconds Centrifuge at maximum speed for 2 minutes at 4 C 6 Remove upper phase to a new tube and add 40 ul of 3 M sodium acetate pH 5 3 and 2 5 volumes of 100 ethanol 20 C Centrifuge at maximum speed for 15 minutes at 4 C Remove ethanol 7 Wash pellet with 80 ethanol and air dry briefly Resuspend total RNA in 20 ul DEPC treated water and store at 80 C Yield is 60 300 ug total RNA mRNA Isolation See Ausubel et al 1994 for a protocol for mRNA isolation and Northern and Northern analysis The FastTrack 2 0 mRNA Kit Cat no K1593 02 6 reactions is Analysis designed to isolate mRNA from 0 2 to 1 mg total RNA The Micro FastTrack 2 0 Kit Cat no K1520 02 20 reactions is designed to isolate mRNA from 100 ug total RNA You will need 1 5 ug mRNA per time point 91 p Galactosidase Assay Introduction Preparing Solutions Z Buffer ONPG Solution 1 M Sodium Carbonate 92 The GS115 B Gal strain is provided as a Hist Mut intracellular expression control Growth of the strain during Mu
39. Be sure to linearize pAO815 in the same manner as your multimer Most of the His transformants created by transforming with recombinant pPIC3 5K or pPIC9K will only have one copy Make sure that the transformant you pick is only resistant to 0 25 mg ml Geneticin The single copy controls created using pPIC3 5K pAO815 and pPIC9K should have the same Mut phenotype as the putative multimeric recombinants you are testing Use these recombinants as a control to compare expression levels with multiple copies of your expression cassette and as a single copy control for quantitative dot blot or Southern analysis This is a very important control as increasing the copy number of the desired gene does not always lead to increased expression of recombinant protein 35 Growth of Pichia for Spheroplasting Introduction Explanation of Spheroplasting Preparing Media Solutions 36 In general spheroplasting and electroporation page 78 provide the highest efficiency of transformation for most researchers 10 to 10 transformants per ug DNA Pichia can also be transformed using PEG 1000 page 79 or lithium chloride page 81 These two protocols particularly lithium chloride do not perform as well as spheroplasting or electroporation If you do not have an electroporation device we recommend spheroplasting or using the PEG 1000 method Transformation in Pichia is less efficient than for Saccharomyces For references on general yeast tra
40. Buffered Minimal Methanol 1 liter 100 mM potassium phosphate pH 6 0 1 34 YNB 4 x 105 biotin 1 glycerol or 0 5 methanol 1 Autoclave 700 ml water for 20 minutes on liquid cycle 2 Cool to room temperature then add the following and mix well 100 ml 1 M potassium phosphate buffer pH 6 0 100 ml 10X YNB 2 ml 500X B 100 ml 10X GY 4 For BMM add 100 ml 10X M instead of glycerol Store media at 4 C The shelf life of this solution is approximately two months Buffered Glycerol complex Medium Buffered Methanol complex Medium 1 liter 1 yeast extract 2 peptone 100 mM potassium phosphate pH 6 0 1 34 YNB 4 x 105 biotin 1 glycerol or 0 5 methanol 1 Dissolve 10 g of yeast extract 20 g peptone in 700 ml water 2 Autoclave 20 minutes on liquid cycle 3 Cool to room temperature then add the following and mix well 100 ml 1 M potassium phosphate buffer pH 6 0 100 ml 10X YNB 2 ml 500X B 100 ml 10X GY 4 For BMMY add 100 ml 10X M instead of glycerol Store media at 4 C The shelf life of this solution is approximately two months Continued on next page Pichia Media Recipes continued Breaking Buffer Vendors for Baffled Flasks 50 mM sodium phosphate pH 7 4 1 mM PMSF phenylmethylsulfonyl fluoride or other protease inhibitors 1mM EDTA 5 glycerol 1 Prepare a stock solution of your desired protease inhibitors and store appropriately Follow manufacturer s recommendations 2 For 1 liter dissolve i
41. GCC AGC ATT Thr Ile GAG AAA Glu Lys GCC GCG Ala Ala 4 4OX1 mRNA 3 end 1418 TTTTTTGTCA l TGGGCA C1 Ala Ser Ile 1 GCT GCT AAA Ala Ala Lys Kex2 signal cleavage Sna BI aca cac Arg Glu AAT TAA Asn m GCT Ala que l TACGAGAA GCCATTTGCC AACCTATATA l GAA GCT TAC j x us Ste13 signal cleavage GCCTTAG GACCGGTCTT TGAGAGATGC GTATAGGATT e The fragment containing the gene of interest must be cloned in frame with the secretion signal open reading frame e An initiating ATG is provided by the signal sequence Translation will initiate at the ATG closest to the 5 end of the mRNA e If your insert has a Bg II site see page 34 for alternate restriction sites to linearize your plasmid for Pichia transformation Continued on next page 21 Cloning into the Pichia Multi Copy Expression Vectors continued Prox and Multiple Cloning Site of pAO815 82 87 92 97 102 107 AOX1 mRNA 5 end 824 I TTATCATCAT TATTAGCTTA CTTTCATAAT 031 AAGCTTTTGA TTTTAACGAC TTTTAACGAC EcoRI CAACTAATTA TTCGAAACGA GGAATTCGCC GTTCAAGTTG GGCACTTACG AGAAGACCGG 3 AOX 1 primer site 1024 1044 GAGGATGTCA GAATGCCATT TGCCTGAGAG ACTTTTTTAT TTGTAACCTA TATAGTATAG The sequence below shows the detail of the multiple cloning site and surrounding sequences 5 AOX 1 primer site 855 875 Pai asa ee TGCGACTGGT TCCAATTGAC AACTTGAGAA GATC
42. H 7 5 20 mM CaCl Spheroplast Module Box 2 Store at 20 C Reagent Amount Components Zymolyase 10x20 pl 3 mg ml Zymolyase in water 100 000 units g lytic activity 1MDTT 10 x 1 ml 1 M dithiothreitol in water Stab Vials Pichia and E coli stabs Store at 4 C Strain Amount Genotype Phenotype Pichia only GS115 1 stab his4 Mut KM71 1 stab arg4 his4 aox1 ARG4 Mut Arg GS115 1 stab HIS4 Mut Albumin GS115 B Gal 1 stab HIS4 Mutt TOP10F 1 stab F proAB lac lacZAM15 Tn10 Tet mcrA A mrr hsdRMS mcrBC 80lacZAMT15 AlacX74 deoR recA1 X araD139 A ara leu 7697 galU galK rpsL Str5 end A1 nupG Continued on next page Materials continued Kit Contents continued Media vi Vectors Store at 20 C Reagent Description pAO815 Vector for creation of multi copy genes in vitro 20 ug lyophilized and intracellular expression in Pichia pPIC3 5K Vector for in vivo isolation of multi copy genes 20 ug 40 ul at 0 5 ug ul in and intracellular expression in Pichia TE buffer pH 8 0 pPIC9K Vector for in vivo isolation of multi copy genes 20 ug 40 ul at 0 5 pg pl in and secreted expression in Pichia TE buffer pH 8 0 Uses the a factor signal sequence Primers Store at 20 C 5 AOXI sequencing primer 2 ug 312 pmoles lyophilized 5 GACTGGTICCAATTGACAAGC 3 3 AOXI sequencing primer 2
43. His transformants on each plate Use all the plates that have His transformants Resuspend the His transformants into the water by using a sterile spreader and running it across the top of the agar Be careful not to tear the agar Transfer and pool the cell suspension into a sterile 50 ml conical centrifuge tube and vortex briefly 5 to 10 seconds Determine cell density using a spectrophotometer 1 OD 5 x 10 cells ml Note any agar present will interfere with a spectrophotometer reading Plate 105 cells on YPD plates containing Geneticin at a final concentration of 0 25 0 5 0 75 1 0 1 5 1 75 2 0 3 0 and 4 0 mg ml You may want to confirm the titer of the cells on the YPD plates without Geneticin in order to calculate the percent of Geneticin resistant colonies you obtain for each Geneticin concentration and determine whether you are getting multimers at 1 10 of the transformants plated Prepare 10 10 and 107 dilutions of the pooled transformants using sterile water Plate 100 to 200 ul per plate Incubate plates at 30 C and check daily Geneticin resistant colonies will take 2 to 5 days to appear while cells plated on YPD will take 2 3 days Proceed to Analysis of Results page 45 If you do not plate all of the cell suspension from either method above add Note sterile glycerol to 15 and freeze in convenient aliquots at 80 C You may thaw the aliquots and analyze for Geneticin resistant colonies
44. I Use a 20 ul reaction volume and digest for 1 2 hours at 37 C to release your expression cassette Proceed to Producing of Expression Cassettes for Multimerization below Digest 2 ug recombinant pAO815 with 10 units of BamH I only Use a 20 ul reaction volume and digest for 1 2 hours at 37 C to linearize recombinant pAO815 Proceed to Dephosphorylation of Vector below Load all of the Bgl II BamH I digestion on a 1 low melt agarose gel and electrophorese to separate fragments Stain the gel with ethidium bromide Cut out the band containing the expression cassette and place into a microcentrifuge tube Note that the size of the fragment depends on the size of your gene The vector backbone will be digested into 2 fragments e 4 0 kb BamH I Bgl II fragment contains HIS4 and 3 AOX1 sequences e 24 Bgl II fragment contains the pBR322 origin and ampicillin resistance marker Isolate DNA from the agarose using the method of choice Ethanol precipitate the DNA with 1 10 volume 3 M sodium acetate and 2 volumes 100 ethanol Resuspend the Bgl II BamH I digested expression cassette in 15 pl sterile water Store on ice if proceeding immediately to Ligation and Digestion of Expression Cassette next page Store at 20 C for long term storage Dephosphorylation is necessary to prevent self ligation of the vector 1 Take your digest from Digestion of Recombinant pAOS15 Step 2 above and phenol extract then ethanol precipi
45. Invitrogen Multi Copy Pichia Expression Kit For the Isolation and Expression of Recombinant Proteins from Pichia pastoris Strains Containing Multiple Copies of a Particular Gene Cat no K1750 01 Revision date 07 September 2010 Manual part no 25 0170 MANDO000041 ii Table of Contents Kit Contents and Storage vs s iiioase te eed eee eet deinen te ee diri tenete i Matias v ACCESSOFY Products nie itu eet eee ei i me Hn etu E viii DI 1 OVERVIEW Aso dae tette taret aee ER s tee D ete abesse iege 1 Experimental Outlirie 5d teet ete ante ni etude teneri ret aidera toes 4 MethodsS gue 8 Pichia Strainissotsisesi heme dodisaiudamed tieni dede up eiii udis atqtie bai id 8 E colrStrams cederet BRE eR NH e nhe 11 Selecting a Pichia Expression Vector siisi rn nE Ei E EA E EE EEA EEE EE NEE 12 PPIGIS Ne EU 14 pier dope cm PM 15 pACISID doutes t dS POPE UIT o Eo CIES Lad a Dorm Ma SQ Da DER STUDI MI ue Devan 16 Cloning into the Pichia Multi Copy Expression Vectors sse 17 Transformation inte E coli ue ote eo d um eei endis diei t ens did irre dette ies 23 In Vitro Multimerization Protocol eese eet rendered ioi cii ed tease EIU 24 Preparing Transforming DIN Asis steer leere iei dee dit reiner eise eise tun ipee 32 Growth of Pichia for Spheroplasting ssssssssesseneneneetenetennnntete tnter nennen 36 Preparing Spheroplasts 5 cie hedge ele re aedi e bien er nere ERR rea ie
46. ODs of each of the three culture flasks Harvest the cells from the culture that has an ODeo between 0 2 and 0 3 Centrifuge the cells at room temperature for 5 10 minutes at 1 500 x g Decant the supernatant and discard the other cultures Proceed to Preparing Spheroplasts page 38 Note If the cultures are all over 0 3 choose one of the cultures and dilute 1 4 with fresh medium and incubate at 28 30 C until the OD is between 0 2 and 0 3 2 4 hours Harvest the cells and proceed as in Step 6 above 37 Preparing Spheroplasts Before Starting Note Washing the Cells Adding Zymolyase 38 You should have a cell pellet from Step 6 page 37 e Prepare 100 ml of molten RD agarose and keep at 45 C see Appendix page 69 e Thaw one tube of 1 M DTT provided in the kit e Prepare fresh SED for one batch of spheroplasts as follows Using sterile technique transfer 19 ml of SE provided to an appropriate sterile container e g 50 ml conical tube Add 1 ml of 1 M DTT and mix well For best results this solution of SED should be made and used immediately The quality and freshness of DTT is critical for a successful spheroplast preparation The 1 M DTT provided is analytical reagent grade and must be stored at 20 C 1 Wash the cells from Step 6 page 37 by resuspending the pellet in 20 ml of sterile water provided Resuspend the pellet by swirling the tube Transfer to a sterile 50 ml conical tube 2 Pe
47. PG solution and sodium carbonate solution to 28 C Add 10 50 ul of your crude assay to 1 ml of Z buffer and equilibrate at 28 C As a control for spontaneous hydrolysis of ONPG add an aliquot of your lysis buffer to 1 ml of Z buffer 4 Toinitiate the reaction add 0 2 ml 4 mg ml ONPG to each of the tubes in Step 3 5 Incubate the samples and the control at 28 C until a faint yellow color develops This should occur at least 10 minutes after the start of the assay to ensure accurate data Note that the tube with no lysate may not change color 6 Stop the reaction by adding 0 5 ml of 1 M sodium carbonate to each tube Record the length of incubation for each sample 7 Read the OD against the control containing buffer alone Determine the protein concentration of your lysate in mg ml If the reaction turns yellow too quickly you need to dilute your lysate Try successive 10 fold dilutions of the lysate using your lysis buffer until the reaction starts turning yellow after 10 minutes This is to ensure that you are measuring a true initial rate Use the following formula to determine the specific activity of the p galactosidase in units mg total protein OD x 380 minutes at 28 C x mg protein in reaction P galactosidase units mg total protein Remember to take into account the volume of lysate added to the reaction and any dilutions made to the lysate when calculating the amount of protein in the reaction The
48. Stu I linearized constructs favor recombination at the HIS4 locus Most of the transformants should be Mut however with the presence of AOX1 sequences in the plasmid there is a chance that recombination will occur at the AOX1 locus disrupting the wild type AOX1 gene and creating His Mut transformants page 74 Again testing on MD and MM plates will allow you to confirm His Mut transformants see next page All His transformants in KM71 will be Muf because of the disruption of the AOXI1 gene aox1 ARGA4 There is no need to test recombinants for the Mut phenotype all recombinants will be Mut Transformation of KM71 with Sal I or Stu I linearized plasmid constructions favor recombination at the HIS4 locus while Sac I linearized plasmid constructions favor recombination at the 5 region of the AOXI1 gene His transformants need to be purified on minimal plates without histidine to ensure pure clonal isolates before testing for expression see page 50 The following can be prepared several days in advance and stored at 4 C Minimal Dextrose MD agar plates 1 liter see page 69 Minimal Methanol MM agar plates 1 liter see page 69 Sterile toothpicks and Scoring Templates see page 49 Streak out the strains GS115 Albumin His Mut and GS115 f Gal His Mut on an MD or MGY plate as controls for Mut and Mut growth on MD and MM plates Use the plates containing the His transformants and screen for the Mut and
49. You should have the following e Your construct linearized with Sal I Stu I or Sac I to favor isolation of His Mut recombinants in GS115 e Your construct linearized with Sal I Stu I or Sac I to favor isolation of Hist Muf recombinants in KM71 e Parent plasmid linearized with same restriction enzyme Controls should include no DNA or linearized pBR322 DNA and plasmid only no cells to check for contamination 1 For each transformation dispense 100 ul of the spheroplast preparation from Step 9 previous page into a sterile 15 ml snap top Falcon 2059 tube or equivalent 2 Add 10 pg of DNA and incubate the tube at room temperature for 10 minutes 3 During the 10 minute incubation make a fresh PEG CaT solution Since each transformation requires 1 0 ml of the PEG CaT solution calculate the amount you need and prepare this volume by adding together equal volumes of 40 PEG and CaT a 1 1 solution 4 Add 1 0 ml of fresh PEG CaT solution to the cells and DNA mix gently and incubate at room temperature for 10 minutes 5 Centrifuge the tube at 750 x g for 10 minutes at room temperature and carefully aspirate the PEG CaT solution Invert the tube and tap it gently to drain the excess PEG CaT solution 6 Resuspend the pellet of transformed cells in 150 ul of SOS medium and incubate it at room temperature for 20 minutes 7 Add 850 ul of 1 M sorbitol Proceed to Plating below Pichia spheroplasts need to be pla
50. Zaret K S and Sherman F 1984 Mutationally Altered 3 Ends of Yeast CYC1 mRNA Affect Transcript Stability and Translational Efficiency J Mol Biol 177 107 136 2009 Life Technologies Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 101 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
51. a L 1987b High Level Secretion of Glycosylated Invertase in the Methylotrophic Yeast Pichia pastoris Bio Technology 5 1305 1308 Continued on next page 100 References continued Varki A and Freeze H H 1994 The Major Glycosylation Pathways of Mammalian Membranes A Summary Subcell Biochem 22 71 100 Vedvick T Buckholz R G Engel M Urcan M Kinney J Provow S Siegel R S and Thill G P 1991 High level Secretion of Biologically Active Aprotonin from the Yeast Pichia pastoris J Ind Microbiol 7 197 201 Vozza L A Wittwer L Higgins D R Purcell T J Bergseid M Collins Racie L A LaVallie E R and Hoeffler J P 1996 Production of a Recombinant Bovine Enterokinase Catalytic Subunit in the Methylotrophic Yeast Pichia pastoris Bio Technology 14 77 81 Wagner S L Siegel R S Vedvick T S Raschke W C and VanNostrand W E 1992 High level Expression Purification and Characterization of the Kunitz type Protease Inhibitor Domain of Protease Nixin 2 amyloid b Protein Precursor Biochem Biophys Res Commun 186 1138 1145 Wegner G H 1990 Emerging Applications of the Methylotrophic Yeasts FEMS Microbiology Reviews 87 279 284 Weiss H M Haase W Michel H and Reilander H 1995 Expression of Functional Mouse 5 HTsA Serotonin Receptor in the Methylotrophic Yeast Pichia pastoris Pharmacological Characterization and Localization FEBS 377 451 456
52. a 45 C water bath Es LN Prepare a prewarmed 45 C mixture of the following stock solutions 100 ml of 10X D 100 ml of 10X YNB 2 ml of 500X B 10 ml of 100X AA 88 ml of sterile water Add to sorbitol solution 5 For growth of his4 strains you must add histidine to the media Add 10 ml of 100X H histidine to the prewarmed mixture in Step 4 Store liquid medium at 4 C Media should last for several months 1 Dissolve 186 g of sorbitol in 700 ml of water and add 20 g of agar Autoclave 20 minutes on liquid cycle 3 Place the autoclaved solution in a 60 C water bath prior to addition of prewarmed mixture of stock solutions This will keep the medium from becoming too thick to mix reagents 4 Prepare the prewarmed 45 C mixture from RD and RDH Liquid Media Step 4 above Add to sorbitol agar solution If you are selecting for His transformants do not add histidine 5 Pour the plates immediately after mixing the solutions in Step 4 Store the plates at 4 C Shelf life is several months Continued on next page Pichia Media Recipes continued RD and RDH Top Agar MD and MDH MM and MMH 1 Dissolve 186 g of sorbitol in 700 ml of water and add 10 g of agar or agarose Autoclave 20 minutes on liquid cycle Place the autoclaved solution in a 60 C water bath prior to addition of prewarmed mixture of stock solutions This will keep the medium from becoming too thick to mix reagents Prepare the prewar
53. age after Glu Lys Arg may be more efficient when followed by Glu Ala repeats A number of amino acids are tolerated at site X instead of Glu in the sequence Glu Lys Arg X These amino acids include the aromatic amino acids small amino acids and histidine Proline however will inhibit Kex2 cleavage For more information on Kex2 cleavage see Brake et al 1984 There are some cases where Ste13 cleavage of Glu Ala repeats is not efficient and Glu Ala repeats are left on the N terminus of the expressed protein of interest This is generally dependent on the protein of interest Once you have decided on a cloning strategy you will need to prepare competent E coli cells for transformation before setting up your ligation reactions See Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Biology A Laboratory Manual Sambrook et al 1989 for preparation of electrocompetent or chemically competent E coli or use your laboratory s procedure Continued on next page 19 Cloning into the Pichia Multi Copy Expression Vectors continued Prox and The sequence below shows the detail of the multiple cloning site and Multiple Cloning surrounding sequences Potential stop codons are underlined Site of pPIC3 5K ee LORNA Send 824 5 AOX Primer Site 855 875 822 TTATCATCAT TATTAGCTTA CTTTCATAAT TGCGACTGGT TCCAATTGAC D M 872 AAGCTTTTGA TTTTAACGAC TTTTAACGAC AACTTGAGAA GATCAAAAAA
54. al Volume 45 ul 5 Place the solution in the thermocycler and incubate at 95 C for 5 minutes 6 Add5plofa0 16 U pl solution of Taq polymerase 0 8 units Cycle 30 times using the following parameters Step Temperature Time Denaturation 95 C 1 minute Annealing 54 C 1 minute Extension 72 C 1 minute Include a final extension of 7 minutes at 72 C 8 Analyze a 10 pl aliquot by agarose gel electrophoresis 85 Isolating Total DNA from Pichia Introduction Solutions Preparing Cells Spheroplasting and Lysis 86 The protocol below allows you to isolate DNA from the desired Hist recombinant and the untransformed GS115 or KM71 which is suitable for Southern blot analysis dot slot blot analysis or genomic PCR See Current Protocols in Molecular Biology pages 13 11 1 to 13 11 4 Ausubel et al 1994 Guide to Yeast Genetics and Molecular Biology pages 322 323 Strathern and Higgins 1991 or Holm et al 1986 You will need to make the following solutions There is not enough of some of these reagents in the kit to perform this experiment Minimal Medium MD MGYH Sterile water SCED 1 M sorbitol 10 mM sodium citrate pH 7 5 10 mM EDTA 10 mM DTT Zymolyase 3 mg ml stock solution in water Seikagaku America Inc 1 800 237 4512 1 SDS in water 5 M potassium acetate pH 8 9 TE buffer pH 7 4 10 mM Tris HCl pH 7 4 1 mM EDTA pH 8 0 7 5 M ammonium acetate pH 7 5 P
55. and Menendez A 1995 High Level Expression of Human IEN a2b in Pichia pastoris Biotecnologia Aplicada 12 152 155 Gietz R D and Schiestl R H 1996 in Methods in Molecular Biology Evans I H ed Humana Press Totowa NJ Guo W Gonzalez Candelas L and Kolattukudy P E 1995 Cloning of a New Pectate Lyase Gene pelC from Fusarium solani f sp pisi Nectria haematococca Mating Type VI and Characterization of the Gene Product Expressed in Pichia pastoris Arch Biochem Biophys 323 352 360 Guthrie C and Fink G R eds 1991 Guide to Yeast Genetics and Molecular Biology Vol 194 Methods in Enzymology Edited by Abelson J N and Simon M L Academic Press San Diego CA Hagenson M J Holden K A Parker K A Wood P J Cruze J A Fuke M Hopkins T R and Stroman D W 1989 Expression of Streptokinase in Pichia pastoris Yeast Enzyme Microbiol Technol 11 650 656 Henikoff S and Cohen E H 1984 Sequences Responsible for Transcription Termination on a Gene Segment in Saccharomyces cerevisiae Mol Cell Biol 4 1515 1520 Hinnen A Hicks J B and Fink G R 1978 Transformation of Yeast Cells Proc Natl Acad Sci USA 75 1292 1293 Irniger S Egli C M and Braus G H 1991 Different Classes of Polyadenylation Sites in the Yeast Saccharomyces cerevisiae Mol Cell Bio 11 3060 3069 Johnston M 1987 A Model Fungal Gene Regulatory Mechanism the GAL Genes of Saccharomyces
56. aper The following protocol is a summary of a rapid DNA dot blot technique to detect multiple integrants Romanos et al 1991 It is very important to spot equivalent numbers of cells onto filters in order to quantify copy number Alternatively genomic DNA may be isolated and spotted directly onto nitrocellulose or nylon fixed and analyzed 1 Grow Mut or Mu transformants in individual wells of a 96 well microtiter plate in 200 ul of YPD broth at 30 C until all wells have approximately the same density This may necessitate several passages Alternatively you may grow individual transformants in culture tubes and normalize the absorbance at 600 nm by adding medium 2 Filter 50 ul of each sample onto a nitrocellulose or nylon filter placed into a dot slot blot apparatus using multi channel pipettor Air dry filters 3 Tolyse the cells on the filter treat the filter with four solutions as follows place two sheets of 3 MM paper in a tray and soak with 10 15 ml of 50 mM EDTA 2 5 B mercaptoethanol pH 9 Make sure that the paper is uniformly soaked and that there are no puddles Place the nitrocellulose filter face down on the treated 3MM paper Incubate for 15 minutes at room temperature 4 Remove the nitrocellulose filter from the 3MM paper and replace the 3MM paper with two new sheets Soak with 10 15 ml of 1 mg ml Zymolyase 100T as described in Step 3 Place the nitrocellulose filter face down on the 3MM paper and incubat
57. approximately 55 60 C and add appropriate volume of Geneticin stock see chart below Remember to also make several YPD plates without Geneticin 5 Mix well by swirling but be careful to minimize bubble formation 6 Pour agar solution into 10 cm petri plates Let plates harden invert and store bagged at 4 C Plates are stable for at least 6 months Final Geneticin ml Geneticin stock mg ml per250 ml YPD 0 25 1 25 0 50 2 5 0 75 3 75 1 00 5 0 1 50 7 5 1 75 8 75 2 00 10 0 3 00 15 0 4 00 20 0 Continued on next page 67 Pichia Media Recipes continued MGY and MGYH RD and RDH Liquid Media RDB and RDHB Agar Plates 68 Minimal Glycerol Medium Histidine 1 liter 1 34 YNB 1 glycerol 4 x 105 biotin 0 004 histidine 1 Combine aseptically 800 ml autoclaved water with 100 ml of 10X YNB 2 ml of 500X B and 100 ml of 10X GY 2 For growth of his4 strains in this medium a version can be made that contains histidine called MGYH by adding 10 ml of 100X H stock solution Store at 4 C The shelf life of this solution is approximately two months Regeneration Dextrose Medium Histidine 1 liter 1 M sorbitol 2 dextrose 1 34 YNB 4 x 10 biotin 0 005 amino acids 0 004 histidine Dissolve 186 g of sorbitol in 700 ml of water and proceed to Step 2 Autoclave 20 minutes on liquid cycle Cool and maintain the liquid medium in
58. ay only transfer modified altered or original material from the Expression Kit or Vector to a third party following written notification of and written approval from Life Technologies so that the recipient can be licensed You may not assign sub license rent lease or otherwise transfer this license agreement or any of the rights or obligation there under except as expressly permitted by Life Technolo gies and RCT Continued on next page Purchaser Notification continued Limited Use Label This license agreement is effective until terminated You may terminate it at any License time by destroying all Pichia Expression products in your control It will also No 74 Pichia terminate automatically if you fail to comply with the terms and conditions of Pastoris the license agreement You shall upon termination of the license agreement Expression Sys destroy all Pichia Expression products in your control and so notify Life Techno tem continued logies in writing You may contact Research Corporation Technologies at the following address Bennett Cohen Ph D Research Corporation Technologies 101 North Wilmot Road Suite 600 Tucson Arizona 85711 3335 Tel 520 748 4443 Fax 520 748 0025 97 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Bar
59. corer et al 1993 Mut Tick Anticoagulant 1 7 Secreted Laroche et al 1994 protein Mut Bm86 Tick Gut 1 5 Secreted Rodriguez et al Glycoprotein 1994 Regulatory Proteins Tumor Necrosis 10 0 Intracellular Sreekrishna et al Factor TNF Muts 1989 Mouse Epidermal 0 45 Secreted Clare et al 1991b Growth Factor Muts EGF 2b Human 0 4 Intracellular Garcia et al 1995 Interferon IFN Mut Continued on next page Proteins Expressed in Pichia continued Table continued Protein Expression Where Expressed Reference Levels How Expressed grams liter Membrane Proteins Human CD38 0 05 Secreted Fryxell et al 1995 soluble portion Mut Mouse Serotonin 0 001 Secreted Weiss et al 1995 Receptor Mutt Proteases and Inhibitors Protease Carboxypeptidase B 0 8 Secreted Despreaux amp Mut Muf Manning 1993 Enterokinase 0 021 Secreted Vozza et al 1996 Mut Ghilanten 0 01 Secreted Brankamp et al Mut 1995 Kunitz protease 1 0 Secreted Wagner et al 1992 inhibitor Human Proteinase 0 05 Intracellular Sun et al 1995 Inhibitor 6 Mut Antibodies Rabbit Single Chain gt 0 1 Secreted Ridder et al 1995 Mut phenotype was not described in the paper 73 Recombination and Integration in Pichia Introduction Gene Insertion at AOX1 or aox1 ARG4 Like Saccharomyces cerevisiae
60. d set of microtiter plates Note Successive growth and passage of the clones will bring them all to the same cell density 8 After incubation take the third set of plates and resuspend the cells in each well by pipetting up and down with a multi channel pipette set on 100 pl volume 9 Spot 10 ul from each well on YPD plates containing Geneticin at a final concentration of 0 0 25 0 5 0 75 1 0 1 5 1 75 2 0 3 0 and 4 0 mg ml Spot in a regular pattern using the multi channel pipette or a grid underneath the plate 10 Let the liquid soak in then incubate plates at 30 C and check after 2 3 4 or 5 days for Geneticin resistant clones Proceed to Analyzing Results below Analyzing There may be only a few Geneticin resistant colonies and they may be of Results different sizes but the colony morphology should be the same Pick all Geneticin resistant colonies and purify by streaking for single colonies Be sure to confirm the observed level of Geneticin resistance You may not find colonies resistant to 2 0 3 0 or 4 0 mg ml Geneticin Jackpot clones resistant to these high levels of Geneticin are very rare You may have to screen thousands of His transformants in order to isolate colonies resistant to 2 4 mg ml Geneticin Since there is no guarantee that multiple copies will actually increase the amount of protein expressed most people elect to proceed directly to expression to see if any of these colonies ove
61. depending on the host strain used The figure below shows the result of an insertion of the plasmid 3 to the intact AOXI1 locus Mut and the gain of P4ox your gene of interest and HIS4 expression cassette This event could also happen at the 5 AOXI regions of the plasmid and genome with the resulting insertion positioned 5 to an intact AOX1 locus This also occurs with non linearized plasmid and plasmid that religates although at a lower frequency AOX1 or aox1 ARG4 Pichia Genome his4 5 AOX1 or aox1 ARG4 TT H Gene of Interest TT 74 Expression Cassette Continued on next page Recombination and Integration in Pichia continued Gene Insertion Events at his4 In either GS115 Mutt or KM71 Mut gene insertion events at the his4 locus arise from a single crossover event between the his4 locus in the chromosome and the HIS4 gene on the vector This results in the insertion of one or more copies of the vector at the his4 locus Since the genomic AOX1 or a0x1 ARG4 loci are not involved in this recombination event the phenotype of such a His transformant has the same Mut phenotype as the parent strain By linearizing the recombinant vector at a restriction enzyme site located in HIS4 gene Mut or Mut recombinants can be conveniently generated depending on the host strain used The figure below shows the result of an insertion of the plasmid between duplicated copies of the HIS4 his4 genes one still mutant t
62. dium acetate 100 ethanol 80 ethanol T4 Ligase 2 5 units yl 10X Ligation Buffer with ATD LB medium LB ampicillin plates 50 100 pg ml ampicillin Geneticin antibiotic see page viii YPD Geneticin plates see Appendix page 67 Hemacytometer Microtiter plates optional Breaking Buffer see Appendix page 71 Acid washed glass beads available from Sigma Replica plating equipment optional TM Bead Beater optional available from Biospec vil Accessory Products Introduction Accessory Products viii The products listed in this section are intended for use with the Multi Copy Pichia Expression Kit For more information refer to our website www invitrogen com or call Technical Support see page 94 Many of the reagents supplied in the Multi Copy Pichia Expression Kit as well as other reagents and kits used in Pichia expression experiments are available separately from Invitrogen Ordering information is provided below Product Amount Cat no Pichia Spheroplast Module 10 preparations K1720 01 Box 1 and Box 2 50 transformations Geneticin powder 1g 11811 023 5g 11811 031 25g 11811 098 Geneticin liquid 50mg ml 20 ml 10131 035 100 ml 10131 027 Ampicillin Sodium Salt irradiated 200 mg 11593 027 TA Cloning Kit with pCR 2 1 vector 20 reactions K2000 01 PureLink HiPure Plasmid Miniprep Kit 25 preparations K2100 02 100 preparation
63. e for 4 hours at 37 C Continued on next page Determining the Copy Number of Multiple Integrants continued Quantitative Dot 5 Blot Procedure continued Remove the nitrocellulose filter from the paper and replace the paper with two new sheets Soak with 10 15 ml of 0 1 N NaOH 1 5 M NaCl Place the nitrocellulose filter face down on the paper and incubate for 5 minutes at room temperature Remove the nitrocellulose filter and replace with two new 3MM sheets Soak with 10 15 ml of 2X SSC Place the nitrocellulose filter face down on the 3MM paper and incubate for 5 minutes at room temperature Repeat Bake nitrocellulose filters at 80 C or UV crosslink DNA to nylon The filters may be probed with a nonradioactive labeled or random primed P labeled probe complementary to your gene You can identify multi copy integrants by a strong hybridization signal relative to the single copy control You can then quantify dot blots for copy number by densitometry of the film or blot or by using a B scanner if radiolabeled Southern Blot For a detailed description of this technique as applied to Pichia pastoris see Clare Analysis et al 1991a It is very important to digest your DNA with the right restriction enzyme s to generate a blot of digested and gel separated genomic DNA It is also important to understand that your strategy will be different if you use pPIC3 5K versus pAO815 to generate your multiple copies Digesti
64. e isolated and analyzed for the Mut phenotype Genetic analysis of Arg transformants showed that the wild type AOX1 gene was replaced by the aox1 ARG4 construct The advantage of using KM71 is that there is no need to screen for the Mut Important phenotype on methanol minimal medium All transformants will be Mut Secondly since the AOX1 locus was not completely deleted it is theoretically possible to replace aox1 ARG4 with your construct by gene replacement The phenotype of this strain would be His Mut Arg This means the recombinant strain would require arginine in the medium to grow Unfortunately simple inclusion of arginine does not totally alleviate the effects of the arg4 mutation and arg4 strains do not grow well on minimal medium supplemented with arginine Therefore we do not recommend that you generate His transformants in KM71 by replacing the aox1 ARG4 construct Continued on next page Pichia Strains continued Control Expression Strains Growth of Pichia Strains Growth on Methanol GS115 His Mut Albumin This strain is a control for secreted expression and the Mut phenotype when screening Pichia transformants page 47 The gene for serum albumin was cloned with its native secretion signal then integrated into Pichia at the AOX1 locus This strain secretes albumin 67 kDa into the medium at levels gt 1 gram liter GS115 His Mut B galactosidase This strain is a control for intracellular
65. ead and tail to tail multimers Ligate into BamH I linearized recombinant pAO815 Transform into E coli and analyze recombinant plasmids for copy number by digesting with Bel II and BamH I You may wish to build each desired multimer in increments by ligating each additional expression cassette one or two at a time into pAO815 For example 1 Digest pAO815 with one copy of your gene using BamH I 2 Ligatea single copy of the Bg II BamH I expression cassette into the vector 3 Transform E coli and analyze the transformants for the vector with 2 copies of your insert 4 Isolate and digest this vector with 2 copies of your gene with BamH I and Bgl II to isolate a cassette with 2 copies of your gene optional 5 Digest the vector with 2 copies of your gene with BamH I and ligate 1 or 2 copies see Step 4 of the expression cassette into the vector 6 Transform E coli and analyze the transformants for the vector with 3 or 4 copies of your insert 7 Repeat until the desired multimer is reached Continued on next page In Vitro Multimerization Protocol continued Before Starting You will need the following materials e Electrocompetent or chemically competent E coli must be recA endA for transformation You will need 3 4 tubes of competent cells per experiment Use your favorite protocol or refer Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Biology A Laboratory Manual Sambrook et
66. ecommend performing a western blot or another more sensitive assay to detect your protein Visualization of the expressed protein will depend on several factors including its expression level its solubility its molecular weight and whether an abundant cellular protein of the same size will mask it Western blot analysis enzymatic activities or a defined purification profile if available may help to identify the expressed protein among the native Pichia cellular proteins Inspection of your Coomassie stained SDS PAGE should reveal the induction over time of your protein co migrating with your standard If there is no recombinant protein visible then perform either a western blot or a functional assay if you have one If you detect low expression of your recombinant protein see Optimizing Pichia Protein Expression page 57 for guidelines to optimize expression Test your expression conditions with the one of the two control strains included in the kit GS115 B Gal or Albumin If there is no indication of expression at all perform a northern analysis to see if and how much full length mRNA is induced See page 91 for an RNA isolation protocol Optimizing Pichia Protein Expression Introduction Proteolysis or Degradation Low Secreted Expression Levels Low Expression Levels Based on available data there is approximately a 75 chance of expressing your protein of interest in Pichia pastoris at reasonable levels T
67. ells and may result in the isolation of false positives Continued on next page 12 Selecting a Pichia Expression Vector continued Features Note The table below describes the general and optional features of the Pichia multi copy expression vectors from Tn903 which confers resistance to Geneticin in Pichia and kanamycin resistance in E coli for pPIC3 5K and pPIC9K Feature Description Benefit 5 AOX1 A 1000 bp fragment Allows methanol inducible containing the AOX1 promoter high level expression in Pichia Targets plasmid integration to the AOX1 locus a factor 269 bp fragment encoding the Allows secretion of desired signal a factor signal sequence for protein into the medium sequence secretion in Pichia pPIC9K only MCS Multiple Cloning Site Allows insertion of your gene into the expression vector TT Native transcription Permits efficient transcription termination and termination and polyadenylation signal from polyadenylation of the mRNA AOXI gene 260 bp HIS4 Pichia wild type gene coding Provides a selectable marker for histidinol dehydrogenase to isolate Pichia recombinant 2 4 kb and used to strains complement Pichia his4 strains 3 AOX1 Sequences from the AOX1 gene Targets plasmid integration at that are further 3 to the TT the AOXI gene sequences 650 bp Amp Ampicillin resistance gene Allows selection replication pBR322 origin E coli origin of
68. em are owned by Research Corporation Technologies RCT Inc Tucson Arizona Life Technologies has an exclusive license to sell Pichia expression kits and vectors to scientists for research purposes only under the terms described below Use of Pichia pastoris by commercial entities for any commercial purpose requires the user to obtain a commercial license as detailed below Before using any Pichia expression product please read the following license agreement If you do not agree to be bound by its terms contact Life Technologies within 10 days for authorization to return the unused Pichia expression products and to receive a full refund If you do agree to the terms of this license agreement please complete the User Regis tration Card and return it to Life Technologies before using the product Life Technologies Corporation Life Technologies grants you a non exclusive license to use the enclosed Pichia expression vectors Expression Vector for academic research or for evaluation purposes only The Expression Vectors are being transferred to you in furtherance of and reliance on such license You may not use the Expression Vectors for any commercial purpose without a license for such purpose from Research Corporation Technologies Inc Tucson Arizona Commercial purposes include any use of Expression Products or Expression Vectors in a Commercial Product any use of Expression Products or Expression Vectors in the manufacture of a Comm
69. enient for people who do not have an electroporation device The efficiency is 10 to 10 transformants per pg of DNA Required e Buffer A 1 0 M Sorbitol Fisher 10 mM Bicine pH 8 35 Sigma 3 v v Solutions ethylene glycol Merck e Buffer B 40 w v Polyethylene glycol 1000 Sigma 0 2 M Bicine pH 8 35 e Buffer C 0 15 M NaCl 10 mM Bicine pH 8 35 e Filter sterilize and store at 20 C e Fresh reagent grade DMSO that is from an unopened bottle or made fresh and stored at 70 C until use Cell competence decreases very rapidly after the cells thaw even when held on important ice It is critical to add DNA to frozen cell samples To perform multiple transformations it is recommended to process them in groups of six at a time Preparing 1 Streak Pichia pastoris strain for single colonies on a YPD plate and incubate Competent Cells the plate at 30 C for two days 2 Inoculate a 10 ml YPD culture with a single colony from the plate and grow the culture overnight at 30 C with shaking 3 Inthe morning use an aliquot of the overnight culture to inoculate a 100 ml YPD culture to a starting ODe of 0 1 and grow at 30 C to an ODs of 0 5 to 0 8 4 Harvest the culture by centrifugation at 3 000 x g at room temperature and wash cells once in 50 ml of Buffer A 5 Resuspend cells in 4 ml of Buffer A and distribute in 0 2 ml aliquots to sterile 1 5 ml microcentrifuge tubes Add 11 ul of DMSO to each tube mix and
70. entary fragment to HIS4 Procedure for Total RNA Isolation from Pichia Introduction This protocol is designed to isolate 60 300 ug total RNA Schmitt et al 1990 from Pichia which is suitable for mRNA isolation using Invitrogen s FastTrack 2 0 or Micro FastTrack 2 0 mRNA Isolation Kit If you wish to use another protocol you should scale up the reaction to yield about 2 mg of total RNA per time point The mRNA is for Northern blot analysis of Pichia recombinants to determine if the gene of interest is being induced and transcribed RNA isolation should be done from induced cultures using an uninduced culture as a negative control Solutions You will need the following solutions Remember to use DEPC treated water and to use equipment free of RNase MGYH or BMGY medium DEPC treated water 3M sodium acetate pH 5 3 Buffered phenol 10 SDS in DEPC treated water Phenol chloroform 1 1 Chloroform isoamyl alcohol 24 1 65 C water bath AE buffer 50 mM sodium acetate pH 5 3 1 mM EDTA Growing Cells 1 Grow up two cultures 100 200 ml in MGY or BMGY but induce only one of them Use the same protocol for induction that you used in the Expression section 2 Take 10 ml time points at 1 2 3 4 and 6 days 3 Harvest the cells from each time point by centrifugation at 1500 x g for 10 minutes at room temperature 4 Resuspend cell pellet in 400 ul AE buffer and transfer to a microcentrifuge tube Lysing Cells 1
71. ercial Product any sale of Expression Products any use of Expression Products or the Expression Kit to facilitate or advance research or development directed to a Commercial Product and any use of Expression Products or the Expression Kit to facilitate or advance any research or development program the results of which will be directly applied to the development or manufacture of a Commercial Product Expression Products means products expressed with the Expression Kit or with the use of any Pichia expression vectors including the Expression Vector or host strains Commercial Product means any product intended for sale or commercial use Commercial entities may conduct their evaluation for one year at which time this license automatically terminates Commercial entities will be contacted by Research Corporation Technologies during the evaluation period regarding their desire for a commercial license Access to the Expression Kit and Vector must be limited solely to those officers employees and students of your institution who need access to perform the above described research or evaluation You must inform each such officer employee and student of the provisions of this license agreement and require them to agree in writing to be bound by the provisions of this license agreement You may not distribute any Expression Vector or host strain contained herein or in the Expression Kit to others even those within your own institution You m
72. ermine the cell density of the supernatant by using a hemacytometer You need at least 5 x 10 cells ml so you can plate 10 cells in 200 pl or less If the cells are too dilute transfer the liquid to a fresh tube and centrifuge the cells Resuspend the cell pellet in sterile water in a volume sufficient to give 5 x 10 cells ml 5 Plate 10 cells YPD Geneticin plates containing Geneticin at a final concentration of 0 25 0 5 0 75 1 0 1 5 1 75 2 0 3 0 and 4 0 mg ml Use four plates for each concentration You may want to confirm the titer of the cells on the YPD plates without Geneticin in order to calculate the percent of Geneticin resistant colonies you obtain for each Geneticin concentration and determine whether you are getting multimers at 1 10 of the transformants plated Prepare 10 10 and 107 dilutions of the pooled transformants using sterile water Plate 100 to 200 pl per plate 6 Incubate plates at 30 C and check daily Geneticin resistant colonies will take 2 to 5 days to appear while cells plated on YPD without Geneticin will take 2 3 days Proceed to Analysis of Results page 45 Continued on next page 43 In Vivo Screening of Multiple Inserts continued Method 1 Use this procedure if electroporation was used to transform Pichia Transformants Electroporation will not be plated in top agar Start with plates containing His transformants 1 Pipette 1 to 2 ml sterile water over the
73. expression and the Mut phenotype when screening Pichia transformants page 47 The gene for B galactosidase lacZ was integrated into Pichia at the his4 locus This strain expresses B galactosidase 117 kDa at levels that can be detected by visualization on Coomassie stained SDS PAGE see pages 54 56 or assay using ONPG see page 92 93 The growth temperature of Pichia pastoris is 28 30 C for liquid cultures plates and slants Growth above 32 C during induction can be detrimental to protein expression and can even lead to cell death Other important facts e Doubling time of log phase Mut or Mut Pichia in YPD is 2 hours e Mut and Mut strains do not differ in growth rates unless grown on methanol e Doubling time of log phase Mut Pichia in methanol medium MM is 4 6 hours e Doubling time of log phase Mut Pichia in MM is 18 hours One ODop 5 x 10 cells ml Note that growth characteristics may vary depending on the recombinant strain When plates or medium containing methanol are used as growth medium it is advisable to add methanol every day to compensate for loss due to evaporation or consumption e For plates add 100 ul of 100 methanol to the lid of the inverted plate e For liquid medium add 100 methanol to a final concentration of 0 5 Some researchers have had success adding methanol to 1 every day for Mut strains and up to 3 for Mut without any negative effect to their liquid culture
74. expression plasmid Restriction Integration Event GS115 Phenotype KM71 Phenotype Enzyme Sal I or Stu I Insertion at his4 Hist Mutt His Mut Sac I cannot be Insertion at 5 Hist Mutt Hist Mut used with AOX1 region multi copy constructs in pAO815 Bgl II Replacement at His Mut His Mut not AOX1 locus recommended see page 8 After confirming your Pichia recombinants by PCR you will test expression of both His Mut and His Mut recombinants This involves growing a small culture of each recombinant inducing with methanol and taking time points If looking for intracellular expression analyze the cell pellet from each time point by SDS polyacrylamide gel electrophoresis SDS PAGE If looking for secreted expression analyze both the cell pellet and supernatant from each time point We recommend that you analyze your SDS PAGE gels by both Coomassie staining and western blot if you have an antibody to your protein We also suggest checking for protein activity by assay if one is available Not all proteins express to the level of grams per liter so it is advisable to check by western blot or activity assay and not just by Coomassie staining of SDS PAGE gels for production of your protein Choose the Pichia recombinant strain that best expresses your protein and optimize induction based on the suggestions on pages 57 58 Once expression is optimized scale up your expression protocol to p
75. f High Copy Number Transformants of Pichia pastoris for High level Foreign Gene Expression Bio Technology 12 181 184 Sreekrishna K Nelles L Potenz R Cruse J Mazzaferro P Fish W Fuke M Holden K Phelps D Wood P and Parker K 1989 High Level Expression Purification and Characterization of Recombinant Human Tumor Necrosis Factor Synthesized in the Methylotrophic Yeast Pichia pastoris Biochemistry 28 4117 4125 Sreekrishna K Potenz R H B Cruze J A McCombie W R Parker K A Nelles L Mazzaferro P K Holden K A Harrison R G Wood P J Phelps D A Hubbard C E and Fuke M 1988 High Level Expression of Heterologous Proteins in Methylotrophic Yeast Pichia pastoris J Basic Microbiol 28 265 278 Sun J Coughlin P Salem H H and Bird P 1995 Production and Characterization of Recombinant Human Proteinase Inhibitor 6 Expressed in Pichia pastoris Biochim Biophys ACTA 1252 28 34 Thill G P Davis G R Stillman C Holtz G Brierley R Engel M Buckholz R Kinney J Provow S Vedvick T and Siegel R S 1990 in International Symposium on the Genetics of Microorganisms Vol 2 pp 477 490 Tschopp J F Brust P F Cregg J M Stillman C and Gingeras T R 1987a Expression of the lacZ Gene from Two Methanol Regulated Promoters in Pichia pastoris Nucleic Acids Res 15 3859 3876 Tschopp J F Sverlow G Kosson R Craig W and Grinn
76. growth on glucose represses transcription even in the presence of the inducer methanol For this reason growth on glycerol is recommended for optimal induction with methanol Note that growth on glycerol only derepression is not sufficient to generate even minute levels of expression from the AOX1 gene The inducer methanol is necessary for even detectable levels of AOX1 expression Ellis et al 1985 Koutz et al 1989 Tschopp et al 19872 Loss of the AOX1 gene and thus a loss of most of the cell s alcohol oxidase activity results in a strain that is phenotypically Mut Methanol utilization slow This has in the past been referred to as Mut The Mu designation has been chosen to accurately describe the phenotype of these mutants This results in a reduction in the cells ability to metabolize methanol The cells therefore exhibit poor growth on methanol medium Mut Methanol utilization plus refers to the wild type ability of strains to metabolize methanol as the sole carbon source These two phenotypes are used when evaluating Pichia transformants for integration of your gene Experimental Outline page 6 Heterologous expression in Pichia pastoris can be intracellular or secreted Secretion requires the presence of a signal sequence on the expressed protein to target it to the secretory pathway While several different secretion signal sequences have been used successfully including the native secretion signal present on so
77. he biggest hurdle seems to be generating initial success i e expression of your protein at any level While there are relatively few examples of expression of 210 grams liter there are many examples of expression in the 21 gram liter range making the Pichia pastoris expression system one of the most productive eukaryotic expression systems available Likewise there are several examples of proteins that have been successfully expressed in Pichia pastoris that were completely unsuccessful in baculovirus or Saccharomyces cerevisiae suggesting that the Pichia pastoris system is an important alternative to have available If you obtain no or low protein expression in your initial expression experiment use the following guidelines to optimize expression Doa time course study of expression Check to see if there is a time point that yields a larger percentage of full length protein e Ifsecreting your protein check to see if your protein is susceptible to neutral pH proteases by expressing in unbuffered medium MM In addition try 1 Casamino acids with buffered medium to inhibit extracellular proteases e Try using SMD1168 proteinase A deficient for expression see Proteases page 50 e Check cell pellet to see if overall expression is low or if the protein did not secrete If it did not secrete try a different signal sequence e g a native or a factor signal sequence e Concentrate your supernatant by ammonium sulfate precip
78. he other wild type Pichia Genome his4 his4 mutation sw TT Gene of interest 5 Prox g 3 AOX1 OS His His Continued on next page 75 Recombination and Integration in Pichia continued Multiple Gene Multiple gene insertion events at a single locus in a cell do occur spontaneously Insertion Events with a low but detectable frequency between 1 and 10 of all selected His transformants Multi copy events can occur as gene insertions either at the AOXI aox1 ARGA or his4 loci This results in a Mut phenotype in GS115 and a Mu phenotype in KM71 Quantitative dot blot analysis Southern blot analysis and differential hybridization can detect multiple gene insertion events See page 88 for a protocol to screen for multiple inserts 5 AOX1 or aox1 ARG4 TT 3 5 Paox g Cene of Interest TT Kan HIS4 Expression Cassette 1 2nd Insertion Event Expression 5 AOX1 or aox1 ARG4 TT 3 p 5 Paox g Gene of Interest TT Kan HIS4 Cassette 1 Expression Cassette 2 3rd Insertion Event etc Continued on next page 76 Recombination and Integration in Pichia continued Gene Replacement at AOX7 in GS115 Ina his4 strain such as GS115 a gene replacement omega insertion event arises from a double crossover event between the AOX1 promoter and 3 AOX1 regions of the vector and genome This results in the complete removal of the AOXI coding region i e gene replacement The resulting phenotype is His
79. henol chloroform 1 1 v v 1 Grow at 30 C the recombinant strain and the parent strain to an ODsoo of 5 10 in 10 ml of minimal media such as MD or MGY recombinant or MDH or MGYH GS115 or KM71 2 Collect the cells by centrifugation at 1500 x g for 5 10 minutes at room temperature 3 Wash the cells with 10 ml sterile water by centrifugation as in Step 2 1 Resuspend the cells in 2 ml of SCED buffer pH 7 5 Make this solution fresh 2 Add 0 1 0 3 mg of Zymolyase mix well before adding to the cells Incubate at 37 C for 50 minutes to achieve lt 80 spheroplasting monitor the percent spheroplasting using the procedure on pages 38 39 3 Add2mlof197o SDS mix gently and set on ice 0 to 4 C for 5 minutes Add 1 5 ml of 5 M potassium acetate pH 8 9 and mix gently Centrifuge at 10 000 x g for 5 10 minutes at 4 C and save the supernatant Continued on next page Isolating Total DNA from Pichia continued DNA Precipitation Transfer the supernatant from Step 5 the previous page and add 2 volumes of ethanol to the supernatant Incubate at room temperature for 15 minutes Centrifuge at 10 000 x g for 20 minutes at 4 C Resuspend the pellet gently in 0 7 ml of TE buffer pH 7 4 and transfer to a microcentrifuge tube Gently extract with an equal volume of phenol chloroform 1 1 v v followed by an equal volume of chloroform isoamyl alcohol 24 1 Split the aqueous layer into two microcentrifuge tubes
80. i a ess 38 Transformation of Pichia esses eene tenente nennen tenete tenente nenenetererertr tenentes 40 In Vivo Screening of Multiple Inserts cccccccsccssesescsesssssesceceeesenesesesesesnsnsnesesssesesceeenenesesesesesnenenesesessseeees 42 Screening for Mutt and Mut Transformants uc eee depo op OD ete i uude e 47 Expression of Recombinant Pichia Strains sse tenentes 50 Analysis by SDS Polyacrylamide Gel Electrophoresis c cccscssscssesesssteessseseececeeeseneesesesesnsnsenesesesesnans 54 Optimizing Pichia Protein Expressions iee keere antee aao ie ER aeo eaaa ei aE Sea EE AA ae naat 57 Scal up Of Expression sepsi ipere e baee re EH mee EUR eU ee fte a tiit 59 Protein Purification and Glycosylation c cccccsesessssssseseececenenesesesesesesnenenesesssnsnsnsnssesessseseeceeesesanenesesssesees 62 Table of Contents continued PDD GIOIX qe X MS 64 Ecol Media Recipes ssoi E Pe died etch ceti sse ea af tein cere Mentos 64 Pichia Media Recipes siishi s a bti lo en ed edite ten eid de aie er i eet 65 Proteins Expressed ini Picftia ua ede dede teda ee ende ferens inten 72 Recombination and Integration in Pichia sse ener nenne 74 blectroporatiomof Pichiac ete e tee ee te eem tein e ei i ec arse ainen ehd 78 PEG 1000 Transformation Method for Pichtia essent 79 Lithium Chloride Transformation Method
81. incubator shake at 250 300 rpm You should have verified recombinants in GS115 or KM71 as well as a control recombinant of GS115 or KM71 Vector no insert and 1 copy When performing your expression it is important to run the proper controls so that you will be able to interpret your expression results You should use the following expression controls G5115 His Mu albumin Muts Secretion control GS115 His Mut B Gal Mutt Intracellular control GS115 or KM71 Vector no insert Background control GS115 or KM71 Vector 1 copy Expression level due to one copy of gene Recombination can occur in many different ways that can affect expression We recommend that you screen 6 10 verified recombinant clones for expression levels Start with colonies from the freshest plates available Colony viability drops over time so if you have any doubts it is better to streak out your strain You may also start the cultures with a small sample from a frozen glycerol stock that was generated from a single colony The following information is designed to get you started with expression You may have to change the conditions to optimize expression for your particular protein Use bottom or side baffled flasks whenever possible see page 71 If you are analyzing a number of recombinants you can try 50 ml conical tubes Be sure that the medium is well aerated by increasing the rate of shaking or placing the tubes at an angle in the shaker Co
82. ing DNA Introduction Preparing Plasmid DNA 32 You should have a Pichia multi copy expression vector with your gene of interest cloned in the correct orientation for expression The table below describes what you will be doing in the next few sections Step Action Pages 1 Prepare your DNA for transformation 32 35 2 Grow either GS115 or KM71 and prepare spheroplasts 36 39 3 Transform GS115 or KM71 with your DNA 40 41 4 Select His transformants 41 5 If you cloned your gene of interest into pPIC3 5K or 42 46 pPIC9K you will screen your His transformants for Geneticin resistance 6 Confirm the Mut Mut phenotype of your recombinant 47 49 strain 7 Confirm that your gene is present using PCR optional 83 84 8 Test for expression of your gene 50 56 We recommend isolating both Hist Mut and Hist Mut Pichia transformants as it is difficult to predict beforehand what construct will best express your protein see pages 72 and 73 for a partial list of proteins expressed in Pichia By linearizing your construct DNA in the 5 AOX1 region or in the HIS4 gene and using GS115 Mut and KM71 Mut you can easily isolate Mutt and Mut recombinants Plan on using 10 ug digested DNA for each transformation Plasmid DNA for Pichia transformation should be at least pure enough for restriction digestion however the cleaner the DNA the more efficient the transformation We rec
83. integrants Amplification of the gene of interest is carried out either with the a factor primer for pPIC9 only or 5 AOXI primer paired with the 3 AOX1 primer included in the kit This protocol is useful for confirming integration of the gene of interest but will not provide information on the site of integration A more direct method for PCR screening is available on the page 85 1 Setup PCR reactions as follows 10X PCR Buffer 5ul Genomic DNA 1 ug 5 pl 100 mM dNTPs 25 mM each 1ygl 5 AOXI Primer 0 1 ug ul 5 pl 3 AOXI Primer 0 1 ug ul 5 pl Sterile water to 50 pl Taq Polymerase 5 U yl 0 25 pl Resuspend the primers in 20 pl sterile water to prepare a 0 1 pg pl solution The amount of primer may be decreased if desired For 20 pmoles primer use 2 ul of each primer For amplification controls use 100 ng of recombinant plasmid positive control and 100 ng of the appropriate plasmid without insert negative control 2 Load thermocycler and run the following program Step Temperature Time Cycle Hot Start 94 C 2 minutes 1X Denaturation 94 C 1 minute Annealing 55 C 1 minute 25 35X Extension 72 C 1 minute Final Extension 72 C 7 minutes 1X 3 Analyze 10 ul on a 1X TAE 0 8 agarose gel Continued on next page 83 PCR Analysis of Pichia Integrants continued Interpreting PCR Important Note Example of PCR Analysis Note 84 If screening Mutt i
84. ion in the his4 gene in the host strain will not interfere with hybridization if you make the probe complementary to the wild type gene If you used pPIC3 5K to generate multimers use Bgl II to digest your DNA Clare et al 1991a Note that if you used pPIC3 5K that all multimers are NOT necessarily in a head to tail configuration Some multimers may be head to head and others tail to tail We recommend that you think about what products may be produced An expression cassette in the opposite orientation may produce a different band The number of multiple copies will cause one or two bands depending on orientation in the Southern blot to increase in intensity once you are gt 2 copies If you used pAO815 to generate multimers use Bgl II and BamH I to digest the genomic DNA and release the multimer The molecular weight of the band should allow you to determine the number of multimers If this multimer is too large you may wish to digest with an enzyme like Sac I This will collapse the multimer into single fragments containing your gene These will produce a band that will be quite intense The relative intensity of this band versus a band containing a single copy of your gene will allow you to determine the copy number Bel II digested DNA from GS115 and GS115 transformed with pPIC3 5K or pAO815 will produce a bands of 2 8 kb the genomic copy of HIS4 and 6 7 kb the vector derived copy of HIS4 respectively when probed with a complem
85. ish to transform your gene into SMD1168 This strain genotype is his4 pep4 and is deficient in proteinase A activity You can use the same procedures for transforming and expressing GS115 with SMD1168 You can also use this strain in large scale fermentation The most important parameter for efficient expression in Pichia is adequate aeration during methanol induction As a general rule when inducing expression never allow cultures to be more than 10 30 of your total flask volume We strongly recommend that you use baffled flasks See Appendix page 71 for suppliers of baffled flasks Cover the flasks with cheesecloth 2 3 layers or another loose fitting cover Never use tight fitting covers Aeration is not as critical when generating biomass before induction Continued on next page Expression of Recombinant Pichia Strains continued Kinetics of Growth Temperature and Shaking Before Starting Guidelines for Expression Note that while Mut and Muf strains will grow at essentially the same rate in YPD or glycerol media Mut will grow faster than Mut when both are grown on methanol because of the presence of the AOX1 gene product Perform expression at 30 C in a shaking incubator It is critical that the temperature does not exceed 30 C If your incubator temperature fluctuates set the temperature at 28 C If using a floor shaking incubator shake at 225 250 rpm If using a table top shaker that sits inside an
86. it shares the advantages of molecular and genetic manipulations with Saccharomyces and it has the added advantage of 10 to 100 fold higher heterologous protein expression levels These features make Pichia very useful as a protein expression system Many of the techniques developed for Saccharomyces may be applied to Pichia These include e Transformation by complementation e Gene disruption e Gene replacement In addition the genetic nomenclature used for Saccharomyces has been applied to Pichia For example the HIS4 gene in both Saccharomyces and Pichia encodes histidinol dehydrogenase There is also cross complementation between gene products in both Saccharomyces and Pichia Several wild type genes from Saccharomyces complement comparable mutant genes in Pichia Genes such as HIS4 LEU2 ARG4 TRP1 and URA3 all complement their respective mutant genes in Pichia Pichia pastoris is a methylotrophic yeast capable of metabolizing methanol as its sole carbon source The first step in the metabolism of methanol is the oxidation of methanol to formaldehyde using molecular oxygen by the enzyme alcohol oxidase In addition to formaldehyde this reaction generates hydrogen peroxide To avoid hydrogen peroxide toxicity methanol metabolism takes place within a specialized cell organelle called the peroxisome which sequesters toxic by products away from the rest of the cell Alcohol oxidase has a poor affinity for O and Pichia pastoris
87. itation or ultrafiltration see page 61 e For Mutt induce expression with a higher density culture e Check both Mut and Mu recombinants for increased expression Some proteins express better in one type of genetic background than another e Ifsecreting your protein try intracellular expression The protein may not be processed correctly and fail to secrete Be sure you check your cell pellets for evidence of expression If you are having problems with intracellular expression try secreting your protein It probably will glycosylate which may be desirable or not If glycosylation is undesirable oligosaccharides can be removed with Peptide N Glycosidase F New England Biolabs page 63 e Scale up to fermentation page 61 Pichia is a yeast and is particularly well suited to fermentation Continued on next page 57 Optimizing Pichia Protein Expression continued No Expression Be sure to try some of the easier things listed on the previous page as no expression can be the same thing as very low expression If none of these things improve protein expression perform a northern blot analysis to check for transcription of your gene There is a protocol in the Appendix for RNA isolation from Pichia see page 91 Analyze for the presence of your insert by PCR see page 83 You can reasonably analyze 12 20 transformants by PCR Remember to include the vector only and original one copy construct controls in order to ana
88. karyotic Start and Stop Translation Sites Nucleic Acids Res 19 3185 3192 Clare J J Rayment F B Ballantine S P Sreekrishna K and Romanos M A 1991a High level Expression of Tetanus Toxin Fragment c in Pichia pastoris Strains Containing Multiple Tandem Integrations of the Gene Bio Technology 9 455 460 Clare J J Romanos M A Rayment F B Rowedder J E Smith M A Payne M M Sreekrishna K and Henwood C A 1991b Production of Epidermal Growth Factor in Yeast High Level Secretion Using Pichia pastoris Strains Containing Multiple Gene Copies Gene 105 205 212 Cregg J M Barringer K J and Hessler A Y 1985 Pichia pastoris as a Host System for Transformations Mol Cell Biol 5 3376 3385 Cregg J M and Higgins D R 1995 Production of Foreign Proteins in the Yeast Pichia pastoris Canadian J Botany Supp 73 5981 5987 Cregg J M Madden K R Barringer K J Thill G and Stillman C A 1989 Functional Characterization of the Two Alcohol Oxidase Genes from the Yeast Pichia pastoris Mol Cell Biol 9 1316 1323 Cregg J M Tschopp J F Stillman C Siegel R Akong M Craig W S Buckholz R G Madden K R Kellaris P A Davis G R Smiley B L Cruze J Torregrossa R Velicelebi G and Thill G P 1987 High Level Expression and Efficient Assembly of Hepatitis B Surface Antigen in the Methylotrophic Yeast Pichia pastoris Bio Technology 5 479 485
89. ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail jpinfo invitrogen com E mail tech_support invitrogen com eurotech invitrogen com MSDS MSDSs Material Safety Data Sheets are available on our website at www invitrogen com msds Certificate of The Certificate of Analysis CofA provides detailed quality control information Analysis for each product The CofA for each product is available on our website at www invitrogen com cofa and is searchable by product lot number which is printed on each box Continued on next page 94 Technical Support continued Limited Warranty Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expirati
90. late the patches from the MD plates onto fresh MM and MD plates to screen for Mu transformants Incubate the replica plates at 28 30 C for 2 days After 2 days at 28 30 C score the replica plates Look for patches that grow normally on the MD replica plates but show little or no growth on the MM replica plates Including Hist Mut and His Mu control patches on each plate will provide examples of Mut and Muf phenotypes Because of plating in top agarose transformants can be on top or imbedded in the top agarose making it difficult to pick and patch colonies in the next section The following protocol allows you to collect the transformants and re plate them directly onto plates without top agarose 1 Scrape the agarose containing the His transformants with a sterile spreader into a sterile 50 ml conical centrifuge tube and mix with 20 ml sterile deionized water Vortex the suspension vigorously to separate the cells from the agarose Filter the suspension through 4 folds of sterile cheesecloth Centrifuge the filtrate at 1 500 x g for 5 minutes at room temperature This will pellet the cells on the bottom of the tube and any remaining agarose will pellet on top of the cells Remove the agarose pellet carefully from the top of the cells by gently shaking the tube to disperse only the agarose pellet into the water Decant the supernatant with the agarose pellet Resuspend the cell pellet in 5 ml of sterile deionized water and
91. llet and resuspend 3 Add an equal volume of acid washed glass beads size 0 5 mm Estimate equal volume by displacement 4 Vortex 30 seconds then incubate on ice for 30 seconds Repeat for a total of 8 cycles 5 Centrifuge at maximum speed for 10 minutes at 4 C Transfer the clear supernatant to a fresh microcentrifuge tube 6 Take 50 ul of supernatant cell lysate and mix with an appropriate volume of denaturing PAGE Gel Loading buffer Sample Buffer 7 Heat the sample as recommended and load 10 20 pl per well Thickness of the gel and number of wells will determine volume loaded You may store the remaining sample at 20 C for western blots if necessary You may store the cell lysates at 80 C for further analysis Continued on next page Analysis by SDS Polyacrylamide Gel Electrophoresis continued Preparing Preparing of supernatant Secreted Expression only Samples 1 Thaw supernatants and place on ice continued 2 Mix 50 pl of the supernatant with an appropriate volume of denaturing PAGE Gel Loading buffer 3 Heat the sample as recommended then load 10 30 pl onto the gel Remaining sample may be stored at 20 C for western blots if necessary Supernatants may be stored at 80 C for further analysis 4 Analyze Coomassie stained gel and western blot if necessary for your protein 5 If no protein is seen by Coomassie or by western blot then concentrate the supernatant 5 10 fold and analyze
92. llet in MM BMM or BMMY medium using 1 5 to 1 10 of the original culture volume approximately 10 20 ml Place in a 100 ml baffled flask Cover the flask with 2 layers of sterile gauze or cheesecloth and return to incubator to continue to grow Add 100 methanol to a final concentration of 0 5 every 24 hours to maintain induction At each of the times indicated below transfer 1 ml of the expression culture to a 1 5 ml microcentrifuge tube These samples will be used to analyze expression levels and determine the optimal time post induction to harvest Centrifuge at maximum speed in a tabletop microcentrifuge for 2 3 minutes at room temperature Time points hours 0 24 1 day 48 2 days 72 3 days 96 4 days 120 5 days and 144 6 days For secreted expression transfer the supernatant to a separate tube Store the supernatant and the cell pellets at 80 C until ready to assay Freeze quickly in liquid N or a dry ice alcohol bath For intracellular expression decant the supernatant and store just the cell pellets at 80 C until ready to assay Freeze quickly in liquid N or a dry ice alcohol bath Analyze the cell pellets for protein expression by Coomassie stained SDS PAGE and western blot or functional assay see Analysis by SDS Polyacrylamide Gel Electrophoresis next page 53 Analysis by SDS Polyacrylamide Gel Electrophoresis Introduction Polyacrylamide Gel Electrophoresis Preparing Samples 5
93. llet the cells by centrifugation at 1 500 x g for 5 minutes at room temperature Decant and discard the supernatant The cell pellet will be used to prepare spheroplasts 3 Wash the cell pellet once by resuspending in 20 ml of fresh SED prepared above and centrifuge at 1 500 x g for 5 minutes at room temperature 4 Wash the cells once with 20 ml of 1 M sorbitol and centrifuge as described in Step 2 5 Resuspend the cells by swirling in 20 ml of SCE buffer and divide the suspension into two 50 ml conical tubes 10 ml each 6 Remove one tube of Zymolyase from 20 C and place it on ice Mix well by flicking the tube several times Zymolyase is provided as a slurry and does not go into solution It is important to mix the slurry thoroughly before each use to ensure addition of a consistent amount of Zymolyase You will use one tube of cells prepared above to determine the optimal time of digestion with Zymolyase to make spheroplasts Once the optimal time is determined the other tube of cells will be used to make spheroplasts Zymolyase digests the cell wall and makes the cells extremely fragile Handle the sample gently The moment after addition of Zymolyase the digestion of the cell wall begins e Prepare at least 20 ml of a 5 SDS solution not provided for use below e Set your UV Vis spectrophotometer to 800 nm and blank with 800 pl 5 SDS and 200 pl SCE e Set up 17 sterile microcentrifuge tubes and label them 0 2 4
94. lyze your PCR experiment If you see premature transcriptional termination check the AT content of your gene In Saccharomyces there are a few consensus sequences that promote premature termination One of these TTTTTATA resembles a sequence in HIV 1 gp120 ATTATTTTAT AAA which when expressed in Pichia gave premature termination of the mRNA When this sequence was changed longer transcripts were found Scorer et al 1993 Hyper If your protein is hyperglycosylated glycosylation e Try intracellular expression as your protein will not go through the secretion pathway and therefore not be modified e Try deglycosylating the protein with Peptide N Glycosidase F or other enzymes see page 62 e Engineer gene to remove N linked glycosylation sites 58 Scale up of Expression Guidelines for Expression Mut Intracellular or Secreted Once expression is optimized scale up your expression protocol to produce more protein by increasing the culture volume using larger baffled flasks below or by fermentation Use the guidelines below to scale up your expression protocol To purify your protein see the references listed on page 62 1 Using a single colony inoculate 25 ml of MGYH BMGH or BMGY in a 250 ml baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until culture reaches an ODs 2 6 approximately 16 18 hours 2 Use this 25 ml culture to inoculate 1 liter of MGYH BMGH or BMGY ina
95. me heterologous proteins success has been variable The secretion signal sequence from the Saccharomyces cerevisiae factor prepro peptide has been used with the most success Cregg et al 1993 Scorer et al 1993 The major advantage of expressing heterologous proteins as secreted proteins is that Pichia pastoris secretes very low levels of native proteins Since there is very low amount of protein in the minimal Pichia growth medium this means that the secreted heterologous protein comprises the vast majority of the total protein in the medium and serves as the first step in purification of the protein Barr et al 1992 However that if there are recognized glycosylation sites Asn X Ser Thr in your protein s primary sequence glycosylation may occur at these sites Continued on next page Overview continued Posttranslational Modifications In comparison to Saccharomyces cerevisiae Pichia may have an advantage in the glycosylation of secreted proteins because it may not hyperglycosylate Both Saccharomyces cerevisiae and Pichia pastoris have a majority of N linked glycosylation of the high mannose type however the length of the oligosaccharide chains added posttranslationally to proteins in Pichia average 8 14 mannose residues per side chain is much shorter than those in Saccharomyces cerevisiae 50 150 mannose residues Grinna and Tschopp 1989 Tschopp et al 1987b Very little O linked glycosylation has been observed i
96. med 45 C mixture from RD and RDH Liquid Media Step 4 previous page Add to sorbitol agar solution If you are selecting for His transformants do not add histidine Place the solution to 45 C after adding the solutions in Step 4 During transformation use as a molten solution at 45 C Store top agar at 4 C Shelf life is several months Minimal Dextrose Medium Histidine 1 liter 1 34 YNB 4 x 10 biotin 2 dextrose 1 For medium autoclave 800 ml of water for 20 minutes on liquid cycle 2 Cool to about 60 C and then add 100 ml of 10X YNB 2 ml of 500X B 100 ml of 10X D 3 Tomake MDH add 10 ml of 100X H stock solution Mix and store at 4 C For plates add 15 g agar to the water in Step 1 and proceed 5 If preparing plates pour the plates immediately MD stores well for several months at 4 C Minimal Methanol Histidine 1 liter 1 3496 YNB 4 x 105 biotin 0 596 methanol 1 2 For medium autoclave 800 ml of water for 20 minutes on liquid cycle Cool autoclaved water to 60 C and add 100 ml of 10X YNB 2 ml of 500X B 100 ml of 10X M To make MMH add 10 ml of 100X H stock solution Mix and store at 4 C For plates add 15 g agar to the water in Step 1 and proceed After mixing pour the plates immediately MM and MMH stores well for several months at 4 C Continued on next page 69 Pichia Media Recipes continued BMG and BMM BMGY and BMMY 70 Buffered Minimal Glycerol
97. mers number of multimers e Most of the His transformants will contain the e Size of the vector may become quite large proper defined number of inserts depending on the size of your gene and the number of copies you create e Isolation of recombinants with multiple inserts e Rearrangements in E coli may occur is easy because most of the His transformants will contain multiple copies of your gene e In vitro construction allows step wise analysis of copy number effects on protein expression e Multiple inserts are located at a single locus e No need for a second drug resistance marker in the vector In vivo Method pPIC3 5K and pPIC9K Advantages Disadvantages e Easy to initiate experiment because only one e Qualitative screen Geneticin resistance copy of your gene is cloned into the vector may not necessarily correlate with the before transforming into Pichia number of copies of your gene e Identifies the 1 10 of spontaneous His e Screening Hist transformants may transformants that have multiple inserts involve more work because you will need thousands of His transformants to generate enough Geneticin resistant colonies to test e Average size of vector is similar to other Pichia e The number of multiple inserts is expression vectors unknown although this can be determined through Southern or dot blot analysis e Multiple inserts are located at a single locus e Screening on Geneticin is sensitive to the density of the c
98. n 1 Dissolve 20 mg biotin in 100 ml of water and filter sterilize 2 Store at 4 C The shelf life of this solution is approximately one year 100X H 0 4 Histidine 1 Dissolve 400 mg of L histidine in 100 ml of water Heat the solution if necessary to no greater than 50 C in order to dissolve 2 Filter sterilize and store at 4 C The shelf life of this solution is approximately one year 10X D 20 Dextrose 1 Dissolve 200 g of D glucose in 1 000 ml of water 2 Autoclave for 15 minutes or filter sterilize The shelf life of this solution is approximately one year Continued on next page 65 Pichia Media Recipes continued Stock Solutions continued YPD or YEPD 66 10X M 5 Methanol 1 Mix 5 ml of methanol with 95 ml of water 2 Filter sterilize and store at 4 C The shelf life of this solution is approximately two months 10X GY 10 Glycerol 1 Mix 100 ml of glycerol with 900 ml of water 2 Sterilize either by filtering or autoclaving Store at room temperature The shelf life of this solution is greater than one year 100X AA 0 5 of each Amino Acid 1 Dissolve 500 mg each of L glutamic acid L methionine L lysine L leucine and L isoleucine in 100 ml of water 2 Filter sterilize and store at 4 C The shelf life of this solution is approximately one year 1M potassium phosphate buffer pH 6 0 1 Combine 132 ml of 1 M K HPO 868 ml of 1 M KH PO and confirm that the pH
99. n Pichia In addition Saccharomyces cerevisiae core oligosaccharides have terminal a1 3 glycan linkages whereas Pichia pastoris does not It is believed that the 01 3 glycan linkages in glycosylated proteins produced from Saccharomyces cerevisiae are primarily responsible for the hyper antigenic nature of these proteins making them particularly unsuitable for therapeutic use Although not yet proven this is predicted to be less of a problem for glycoproteins generated in Pichia pastoris because it may resemble the glycoprotein structure of higher eukaryotes Cregg et al 1993 Experimental Outline Selecting Vector to Generate Multi Copy Integrants Frequency of Multicopy Inserts Generating Multicopy Inserts in vivo 5 AOX1 or aox1 ARG4 TT 3 5 Paoxig CENE of Interest TT LEW Multiple copy integration of recombinant genes in Pichia has been demonstrated to increase expression of the desired protein in some cases Brierley et al 1994 Clare et al 1991a Cregg et al 1993 Romanos et al 1991 Scorer et al 1993 Scorer et al 1994 Thill et al 1990 Vedvick et al 1991 The three vectors included in this kit allow isolation and generation of multicopy inserts by in vivo pPIC3 5K pPIC9K or in vitro methods pAO815 and to test whether increasing the copy number of your recombinant gene will lead to a subsequent increase in protein expression The in vivo method utilizes hyper resistance to Geneticin G 418 to
100. n 900 ml deionized water 6 g sodium phosphate monobasic 372 mg EDTA and 50 ml glycerol 3 Use NaOH to adjust pH and bring up the volume to 1 liter Store at 4 C Right before use add the protease inhibitors Bellco 1 800 257 7043 has a wide variety of baffled flasks from 50 to 2 000 ml Wheaton 1 609 825 1100 only sells side baffle flasks 71 Proteins Expressed in Pichia Table 72 The table below provides a partial list of references documenting successful expression of heterologous proteins in Pichia pastoris Note that both Mut and Muf phenotypes were used successfully as well as secreted and intracellular expression Protein Expression Where Expressed Reference Levels How Expressed grams liter Enzymes Invertase 23 Secreted Tschopp et al Mut 1987b Bovine Lysozyme c2 0 55 Secreted Digan et al 1989 Mut Streptokinase 0 08 Intracellular Hagenson et al active 1989 Alpha amylase 2 5 Secreted Paifer et al 1994 Mut Pectate Lyase 0 004 Secreted Guo et al 1995 Mut Spinach Phospho 0 1 Intracellular Brandes et al 1996 ribulokinase Muts Antigens Hepatitis B surface 0 4 Intracellular Cregg et al 1987 antigen Mut Pertussis Antigen 3 0 Intracellular Romanos et al 1991 P69 Mut Tetanus Toxin 12 0 Intracellular Clare et al 1991a Fragment C Mut Mut HIV 1 gp120 1 25 Intracellular S
101. n ODeo 2 6 approximately 16 18 hours Use this 10 ml culture to inoculate 1 liter of MGYH BMGH or BMGY in a 3 or 4 liter baffled flask and grow at 28 30 C with vigorous shaking 250 300 rpm until the culture reaches log phase growth OD 2 6 Harvest the cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature To induce expression decant the supernatant and resuspend cell pellet in 1 5 to 1 10 of the original culture volume of MMH BMMH or BMMY medium approximately 100 200 ml Place the culture in a 1 liter baffled flask Cover the flask with 2 layers of sterile gauze or cheesecloth and return to incubator Continue to grow at 28 30 C with shaking Add 100 methanol to 0 5 every 24 hours until the optimal time of induction is reached Harvest cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature For intracellular expression decant the supernatant and store the cell pellets at 80 C until ready to process For secreted expression save the supernatant chill to 4 C and concentrate it down if desired see next page Proceed directly to purification page 62 or store the supernatant at 80 C until ready to process further To increase the amount of cells for Mu recombinants increase the number of flasks put 200 300 ml in a 3 liter flask or try fermentation Continued on next page Scale up of Expression continued Concentration of Proteins Cell Lysis Fermenta
102. nd Guide to Protein Purification Deutscher 1990 Genotype of The Pichia host strains G5115 and KM71 have a mutation in the histidinol Pichia Strain dehydrogenase gene his4 that prevents them from synthesizing histidine All expression plasmids carry the HIS4 gene that complements his4 in the host so transformants are selected for their ability to grow on histidine deficient medium Spontaneous reversion of GS115 and KM71 to His prototrophy is less than 1 out of 10 The parent strain of KM71 has a mutation in the argininosuccinate lyase gene arg4 that prevents the strain from growing in the absence of arginine The wild type ARG4 gene was used to disrupt AOX1 creating KM71 a Mut Arg His strain Both G 115 and KM71 will grow on complex medium such as YPD also known as YEPD and on minimal media supplemented with histidine Until transformed neither GS115 nor KM71 will grow on minimal medium alone as they are His Note Mut Methanol utilization slow phenotype has in the past been referred to as Mut The Mu designation has been chosen to accurately describe the phenotype of these mutants Construction of The ARG4 gene 2 kb was inserted into the cloned wild type AOX1 gene KM71 between the BamH I site codons 15 16 of AOX1 and the Sal I site codons 227 228 of AOX1 ARG4 replaces codons 16 through 227 of AOX1 This construct was transformed into the parent strain of KM71 arg4 his4 and Arg transformants wer
103. ng DNA from Pichia recombinants containing multiple copies will produce a band that will vary in intensity depending on the number of copies of your gene It is very important to include a control to show the intensity of a single copy gene You can quantify the band intensities using densitometry to estimate relative gene dosage Controls It is very important to include DNA from the host strain alone GS115 or KM71 the host strain transformed with the parent vector pPIC3 5K or pAO815 and the host strain transformed with a vector containing one copy of your gene It is also a very good idea to make a probe to the HIS4 gene as an internal control for single copy in addition to a probe to your gene Note that if your gene inserts into his4 two copies of the HIS4 gene are created one mutant and the other wild type see Recombination and Integration in Pichia Pichia Expression Kit manual Continued on next page 89 Determining the Copy Number of Multiple Integrants continued General Guidelines 90 Use standard procedures and solutions for Southern blotting as outlined in Molecular Cloning A Laboratory Manual Sambrook et al 1989 pages 9 31 9 58 Isolate genomic DNA and quantify using fluorometry Be sure to eliminate RNA It is very important to load the same amount of DNA into each lane to accurately determine copy number Probe your Southern blot with probes to both HIS4 and your gene Note that the point mutat
104. ns that more His transformants need to be screened Remember that you are isolating spontaneous multiple integration events These occur at a frequency of 1 10 that may mean that you need to screen thousands of His transformants as opposed to hundreds In addition to isolate recombinants with the most copies of your gene inserted you may have to screen additional His transformants Successive multiple insertions are simply more rare If you find that your transformation efficiency is low try electroporation instead of spheroplasting This may increase the transformation efficiency and help you isolate more His transformants 46 Screening for Mut and Mut Transformants Introduction Screening for His Mut in GS115 His Mu in KM71 Preparation His Mut or His Mut in GS115 At this point you may wish to score your His transformants for Mut and Mut phenotype Included in the kit are two strains that will provide examples of Mut and Mut phenotypes GS115 Albumin is Mut and GS115 B Gal is Mut Hist KM71 recombinants do not need to be screened for their Mut phenotype as they all will be Mut Remember also to isolate two control strains for background protein expression in Pichia One control is the parent plasmid linearized in such a way to generate His Muf transformants The other control is the parent plasmid linearized to generate His Mut transformants Transformation of GS115 with Sal I or
105. nsert into pPIC9K linearize with e Sac I for insertion at AOX1 GS115 Mut or KM71 Mut e SalI for insertion at HIS4 GS115 Mut or KM71 Mut 1 Digest both your construct and the parent vector You will transform GS115 and or KM71 with the parent vector as a background control for expression 2 Analyze a small portion of your digest by agarose gel electrophoresis to confirm complete digestion of your fragment The number of transformants and frequency of targeting will be reduced if digestion is not complete 3 Extract the digest with phenol chloroform isoamyl alcohol 25 24 1 and ethanol precipitate the digested DNA Resuspend DNA pellet in 10 20 pl of TE buffer It is not necessary to purify the fragment containing your gene away from the rest of the plasmid 4 Store at 20 C until ready to transform Continued on next page 33 Preparing Transforming DNA continued Alternate Restriction Sites 34 The table below describes alternate restriction sites for linearizing your construct before transformation into Pichia pPIC3 5K Note that an additional Stu I site was added with the inclusion of the kan gene so that the Stu I site in HIS4 is no longer unique Restriction 5 AOX1 3 AOX1 Vector backbone HIS4 gene Enzyme SacI 209 Pmel 414 SE Bpu 1102 I 589 Xcm I 699 B Bgl II 2 6616 Dra It 414 6454 6596 7787 7806
106. nsformation plate the transformation mix onto LB plates with 50 100 ug ml ampicillin see Appendix page 64 and select ampicillin resistant colonies 2 Pick 10 ampicillin resistant transformants and inoculate into LB medium with 50 100 pg ml ampicillin Grow overnight at 37 C with shaking 3 Isolate plasmid DNA by miniprep for restriction analysis and sequencing see below To sequence pAO815 or pPIC3 5K use the 5 AOX1 and the 3 AOXI Sequencing primers To sequence pPIC9K use the a Factor primer and the 3 AOXI Sequencing primers Resuspend the primers in 20 pl sterile water to prepare a 0 1 ug ul solution 4 Make a glycerol stock of your desired clone for safekeeping by combining 0 85 ml of an overnight bacterial culture with 0 15 ml of sterile glycerol Mix by vortexing and transfer to a labeled storage tube Freeze the tube in liquid nitrogen or a dry ice ethanol bath and store at 70 C 5 Once your construct is confirmed by sequencing proceed to Preparing Transforming DNA page 32 We strongly recommend that you sequence your construct before transforming into Pichia to confirm the following e The correct reading frame for secretion e An ATG in the proper context for eukaryotic translation initiation Use the primers mentioned above to sequence your constructs For the location of the priming sites see pages 20 22 For sequencing protocols refer to Unit 7 in Current Protocols in Molecular Biology Ausubel
107. nsformation see Cregg et al 1985 Hinnen et al 1978 The cell wall of yeast prevents uptake of DNA To enable yeast to take up DNA it is necessary to partially remove the cell wall Zymolyase is a B glucanase that hydrolyzes the glucose polymers with 1 3 linkages in the cell wall Addition of Zymolyase partially digests the cell wall It is critical not to overdigest the cell wall as doing so will cause the cells to die Zymolyase digestion is monitored by the sensitivity of the cells to SDS Aliquots of cells are added to SDS lysing the spheroplasts This causes a clearing of the solution that is monitored by the absorbance light scattering at 800 nm It has been empirically determined that when 70 spheroplasting has been achieved digestion is optimal Cells are then washed with an isotonic solution to remove the enzyme and incubated with DNA The cells are resuspended in sorbitol to facilitate cell wall regeneration and plated Prepare the following media several days in advance and store at 4 C see Appendix pages 66 69 for details YPD Yeast extract Peptone Dextrose medium 1 liter YPD plates 1 liter RDB Regeneration Dextrose Base plates 1 liter RDHB Regeneration Dextrose Histidine Base plates 1 liter Prepare the following solution on the day of transformation and maintain at 45 C 5 SDS solution in water RD Regeneration Dextrose molten agarose 100 ml Spheroplasting and Transformation Reagents
108. nt at AOX1 in GS115 linearize with Bel II generates His Mut See page 34 for alternate restriction sites if your insert DNA has a Bgl II Sac I or Sal I site Map of pPIC3 5K The figure below shows the map of pPIC3 5K Details of the multiple cloning site are shown on page 20 The sequence of pPIC3 5K is available from our website www invitrogen com or from Technical Support page 94 Comments for pPIC3 5K 9004 nucleotides 5 AOX1 promoter fragment bases 1 937 5 AOX1 primer site bases 855 875 Multiple Cloning Site bases 938 968 3 AOX1 primer site bases 1055 1075 3 AOX1 transcription termination TT bases 981 1314 HIS4 ORF bases 4242 1708 Kanamycin resistance gene bases 5471 4656 3 AOX1 fragment bases 5850 6607 pBR322 origin bases 7689 7016 Ampicillin resistance gene bases 8694 7834 BamH SnaB EcoR Avr Il Not 3 AOX1 TT BspE 14 pPIC9K Description The vector pPIC9K contains the kanamycin resistance gene for in vivo screening of multiple copy inserts and secretes recombinant proteins to the medium pPIC9K is functional in Pichia strains GS115 and KM71 Other details are e 9276 bp fusion vector e Four unique restriction sites for cloning in frame with the a factor secretion signal SnaB I EcoR I Avr IL Not I e Secreted expression of your gene using the a factor secretion signal e For expression your gene must be cloned in frame with the initiation codon of
109. ntegrants you should see two bands One will correspond to the size of your gene of interest the other to the AOX1 gene approximately 2 2 kb If screening Mut integrants in GS115 you should see only the band that corresponds to the gene of interest In KM71 because of the ARG4 insert in AOX1 the PCR product is 3 6 kb Parent plasmids will produce the following sized PCR products Add these fragments to the size of your insert to interpret your PCR results Vector PCR Product pPIC3 5K 220 bp pAOS815 189 bp pPIC9K using the 5 AOX1 primer 492 bp pPIC9K using the a Factor primer 195 bp If you use the a factor primer as a PCR primer you will not see a band with GS115 or KM71 This is because there is no a factor signal associated with the chromosomal AOX1 gene Sometimes there will be ghost bands appearing in your PCR These do not seem to be significant as they have not been shown to be a problem The figure below shows the results of a typical PCR analysis using the procedure on page 83 Genomic DNA was isolated from Pichia recombinants and from appropriate controls Ten microliter samples from each PCR were run on a 0 8 agarose gel Lane 1 contains a 1 kb 100 bp ladder Lane 2 shows the wild type AOX1 gene 2 2 kb and a 2 4 kb product containing the gene of interest GOI 1 9 kb and 492 bp of flanking AOX1 sequence from GS115 pPIC9K GOI Lane 3 shows the wild type AOX1 gene alone from
110. ntinued on next page 51 Expression of Recombinant Pichia Strains continued Mut Intracellular or Secreted 52 You can test the effectiveness of your expression conditions by growing GS115 B Gal Mutt which expresses B Galactosidase intracellularly Include GS115 or KM71 transformed with the parent vector as a control for background intracellular expression 1 Using a single colony inoculate 25 ml of MGY BMG or BMGY in a 250 ml baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until culture reaches an ODs 2 6 log phase growth approximately 16 18 hours Harvest the cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature Decant supernatant and resuspend cell pellet to an ODs of 1 0 in MM BMM or BMMY medium to induce expression approximately 100 200 ml Place culture in a 1 liter baffled flask Cover the flask with 2 layers of sterile gauze or cheesecloth and return to incubator to continue growth Add 100 methanol to a final concentration of 0 5 methanol every 24 hours to maintain induction Be sure to check the volume of the culture and add methanol accordingly Evaporation may reduce culture volume At each of the times indicated below transfer 1 ml of the expression culture to a 1 5 ml microcentrifuge tube These samples will be used to analyze expression levels and determine the optimal time post induction to harvest Centrifuge at maximum speed in a tabletop microcent
111. nued on next page 29 In Vitro Multimerization Protocol continued Trouble shooting 30 The table below will help you optimize formation and isolation of multimers in Pichia Problem Possible Reason Solution No multimers or low number of multimers in your vector after transformation into E coli CIP defective Use fresh CIP Add more CIP Add 1 unit of CIP and incubate 15 more minutes at 37 C This is somewhat risky as CIP can degrade the ends of your DNA Not enough insert DNA to ligate Digest more pAO815 containing 1 copy of your expression cassette Construct is unstable in E coli Use the in vivo method to isolate multimers see page 4 Multimers are too long to ligate efficiently Try ligating each expression cassette separately Recombinant vector rearranges and deletions are detected Construct is unstable in E coli Use the in vivo method to isolate multimers see page 4 Pichia Hist transformants do not have multimers Vector was linearized with the wrong enzyme Restriction enzymes in the 5 AOXI region are duplicated when multimers are created Linearize your construct with Sal I or Stu I to insert the construct into his4 Analyze your construct for other unique restriction sites in the vector backbone that are near the 5 AOXT region or the 3 AOX1 region These sites will preserve your multimers and allo
112. nutes at 15 Ibs sq in Let cool to 55 C and add desired antibiotics at this point Pour into 10 cm petri plates Let the plates harden invert and store at 4 C 64 Pichia Media Recipes Introduction Stock Solutions The expression of recombinant proteins in Pichia pastoris requires the preparation of several different media Recipes for these media are included in this section In addition Yeast Nitrogen Base is available from Invitrogen see below for ordering information Item Amount Cat no Yeast Nitrogen Base 67 g pouch Q300 07 with ammonium sulfate Each pouch contains reagents Shout amino acids to prepare 500 ml of a 10X YNB solution 500g Q300 09 10X YNB 13 4 Yeast Nitrogen Base with Ammonium Sulfate without amino acids 1 Dissolve 134 g of yeast nitrogen base YNB with ammonium sulfate and without amino acids in 1 000 ml of water Heat the solution to dissolve YNB completely in water 2 Alternatively use 34 g of YNB without ammonium sulfate and amino acids and 100 g of ammonium sulfate 3 Filter sterilize and store at 4 C The shelf life of this solution is approximately one year If you are using the YNB pouch included in the kit follow the directions on the pouch Note Pichia cells exhibit optimal growth with higher YNB concentrations therefore the amount of YNB used in this kit is twice as concentrated as YNB formulations for Saccharomyces 500X B 0 02 Bioti
113. o differences in lots of Zymolyase In Invitrogen labs it takes approximately 15 40 minutes of Zymolyase treatment to achieve optimal spheroplasting Note It is important to establish the minimum time required for the desired amount of spheroplasting Prolonged incubation with Zymolyase is deleterious to spheroplasts and will result in lower transformation efficiency Add 7 5 pl Zymolyase to the remaining tube of cells as described in Step 1 above Incubate the tube at 30 C for the time that was established in Step 5 to obtain the optimal level 70 of spheroplasting Harvest the spheroplasts by centrifugation at 750 x g for 10 minutes at room temperature Decant and discard the supernatant Wash the spheroplasts once with 10 ml of 1 M sorbitol gently disperse the pellet by tapping the tube do not vortex Collect the spheroplasts by centrifugation at 750 x g for 10 minutes at room temperature Wash the spheroplasts once with 10 ml of CaS and centrifuge as in Step 7 Gently resuspend the spheroplasts in 0 6 ml of CaS The spheroplasts must be used immediately up to 30 minutes for transformation page 40 They cannot be stored for much longer This preparation yields enough spheroplasts for six transformations 39 Transformation of Pichia Before Starting Procedure Plating 40 Make sure your RDB plates are at room temperature and that you have molten RD top agarose available Thaw your linearized DNA and keep on ice
114. ommend the PureLink HiPure Plasmid Miniprep Kit see page viii to prepare plasmid DNA for routine Pichia transformations Refer to our website www invitrogen com or contact Technical Support for more information on a large selection of plasmid purification columns You may prepare plasmid DNA using alkaline lysis phenol chloroform extraction and ethanol precipitation Continued on next page Preparing Transforming DNA continued Linearizing Plasmid DNA Procedure We recommend that you linearize your vector in such a manner to generate both Mut and Mut recombinants It is possible that one phenotype will express your multicopy integrant better than the other will Use strain KM71 if you only want Muf recombinants It is much easier and more efficient to generate Mu recombinant strains using single crossover events than double crossover events e g insertions at AOX1 or his4 as opposed to gene replacement at AOX1 If your insert contains any of the restriction sites listed below see page 34 for alternate sites 1 If you cloned your insert into pPIC3 5K linearize with e Sac I for insertion at AOX1 GS115 Mut or KM71 Mut e SalI for insertion at HIS4 GS115 Mut or KM71 Mut 2 If you cloned your insert into pAO815 linearize with e SalI or Stu I for insertion at HIS4 GS115 Mut or KM71 Mut Note that multiple Sac I sites are formed if there are 2 or more multimers in pAO815 3 If you cloned your i
115. on date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 95 Purchaser Notification Limited Use Label License No 74 Pichia Pastoris Expression Sys tem 96 The Pichia Expression System is based on the yeast Pichia pastoris Pichia pastoris was developed into an expression system by scientists at Salk Institute Biotechnology Industry Associates SIBIA and Phillips Petroleum for high level expression of recombinant proteins All patents for Pichia pastoris and licenses for its use as an expression syst
116. opy number i e secondary selection yields some clones with 5 to 9 copies direct selection after electroporation yields clones with an average of 1 to 3 copies Direct selection of Geneticin colonies is not possible with spheroplast transformation Generating The graphic below shows how pAO815 is used to generate multiple expression Multicopy cassette copies in a single vector prior to transformation into Pichia The gene of Inserts in vitro interest is inserted into the vector at a unique EcoR I site The resulting expression cassette the P4ox plus your gene is flanked on the upstream side by a unique Bgl II site and on the downstream site by a unique BamH I site see A below pAO815 containing the gene of interest is digested with Bgl II and BamH I to excise the expression cassette The cassette is then reinserted at the BamH I site to create a tandem repeat of the cassette The reinsertion process can be repeated to generate a series of vectors that contain an increasing number of cassettes linked to a single HIS4 gene see B below Transformation of Pichia with these in vitro formed multimers increases the frequency of multicopy expression cassette recombinants Pichia recombinants may be custom designed to contain a defined number of multicopy inserts For more information see page 24 Bgl Il EcoR EcoRI BamHI A Vector qEEIOXIEZTTRB E HIS4 l 1 Expression Cassette Digestion with BamH I and Bg II Bgl ll BamHI BamHI G
117. oteins 62 At this point you have an optimized protocol for expressing your protein and a method to scale up production of your protein for large scale purification You may already have a method to purify your protein Since every protein is different it is difficult to recommend specific techniques for purification For an overview of methods for purification see Deutscher 1990 or Ausubel et al 1994 Some techniques are listed below and are discussed thoroughly in Guide to Protein Purification Deutscher 1990 Be sure to perform all steps from cell lysis to purified protein at 4 C Ion Exchange Chromatography Gel Filtration Affinity Chromatography Chromatofocusing Isoelectric Focusing Immunoprecipitation Solubilization Membrane Proteins Lectin Affinity Chromatography Prepare Breaking Buffer BB as described in Appendix page 71 1 Wash cells once in BB by resuspending them and centrifuging 5 10 minutes at 3 000 x g at 4 C Resuspend the cells to an ODeo of 50 100 in BB 3 Add an equal volume of acid washed glass beads 0 5 mm Estimate volume by displacement 4 Vortex the mixture 30 seconds then incubate on ice for 30 seconds Repeat 7 more times Alternating vortexing with cooling keeps the cell extracts cold and reduces denaturation of your protein 5 Centrifuge the sample at 4 C for 5 10 minutes at 12 000 x g 6 Transfer the clear supernatant to a fresh container and analyze for your protein The
118. quickly freeze cells in a bath of liquid nitrogen 6 Store frozen tubes at 70 C Continued on next page 79 PEG 1000 Transformation Method for Pichia continued Transformation 80 1 Use up to 50 ug of each DNA sample in no more than 20 pl total volume Add the DNA directly to a still frozen tube of competent cells Carrier DNA 40 ug of denatured and sonicated salmon sperm DNA should be included with lt 1 ug DNA samples for maximum transformation frequencies Incubate all sample tubes in a 37 C water bath for five minutes Mix samples once or twice during this incubation period Remove tubes from the bath and add 1 5 ml of Buffer B to each Mix contents thoroughly Incubate tubes in a 30 C water bath for 1 hour Centrifuge sample tubes at 2 000 x g for 10 minutes at room temperature Decant supernatant and resuspend the cells in 1 5 ml Buffer C Centrifuge samples a second time and resuspend the cell pellet gently in 0 2 ml of Buffer C Spread entire contents of each tube on an agar plate containing selective growth medium and incubate plates at 30 C for 3 to 4 days Screen for Mut phenotype page 47 or select hyper resistant Geneticin colonies page 42 Lithium Chloride Transformation Method Introduction Preparing Solutions Preparing Cells This is a modified version of the procedure described for S cerevisiae Gietz amp Schiestl 1996 This protocol is provided as an alternative to
119. r K A Hopkins S A and Sreekrishna K 1992 Protocol for Efficient Secretion of HSA Developed from Pichia pastoris Pharm Eng 12 48 51 Bollag D M M D R and Edelstein S J 1996 Protein Methods Second Ed Wiley Liss New York Brake A J Merryweather J P Coit D G Heberlein U A Masiarz G R Mullenbach G T Urdea M S Valenzuela P and Barr P J 1984 a Factor Directed Synthesis and Secretion of Mature Foreign Proteins in Saccharomyces cerevisiae Proc Natl Acad Sci USA 81 4642 4646 Brandes H K Hartman F C Lu T Y S and Larimer F W 1996 Efficient Expression of the Gene for Spinach Phosphoribulokinase in Pichia pastoris and Utilization of the Recombinant Enzyme to Explore the Role of Regulatory Cysteinyl Residues by Site directed Mutagenesis J Biol Chem 271 6490 6496 Brankamp R G Sreekrishna K Smith P L Blankenship D T and Cardin A D 1995 Expression of a Synthetic Gene Encoding the Anticoagulant Antimetastatic Protein Ghilanten by the Methylotropic Yeast Pichia pastoris Protein Expression and Purification 6 813 820 Brierley R A Davis G R and Holtz G C 1994 Production of Insulin Like Growth Factor 1 in Methylotrophic Yeast Cells United States Patent 5 324 639 Buckholz R G and Gleeson M A G 1991 Yeast Systems for the Commercial Production of Heterologous Protein Bio Technology 9 1067 1072 Cavener D R and Stuart C R 1991 Eu
120. re ligase activity You are now ready to ligate the mixture of multimers generated in Step 10 page 27 into dephosphorylated linearized vector 1 Set up the following ligation reactions Dephosphorylated vector page 26 Step 7 4 yl Expression cassette multimers page 27 Step 8 4 yl 10X Ligation Buffer lul T4 DNA Ligase 2 5 units ul 1yul Total volume 10 ul For the vector only control Dephosphorylated vector 4yl Sterile water 4 ul 10X Ligation Buffer lul T4 DNA Ligase 2 5 units ul 1yul Total volume 10 ul Incubate overnight at 16 C You may store the ligation reactions at 20 C until ready to use or transform 1 to 10 ul of each ligation mix into competent F coli Note that too much of the ligation mixture may cause arcing when transforming electrocompetent cells Remember to include the vector only and cells only controls to evaluate your experiment The vector only control will indicate whether your vector was dephosphorylated Since the CIP reaction is not 100 and because you often get degradation of the ends there might be a few colonies on this plate The cells only plate should have no colonies at all 1 Transform competent E coli by your method of choice 2 After adding medium to the transformed cells and allowing them to recover plate 10 ul and 100 ul of each transformation mix onto LB plates with 50 100 pg ml ampicillin Save the remainder of your transformation mix at 4 C 3 Inc
121. rest one can infer from Geneticin hyper resistance that the clone in question contains multiple copies of your gene Protein expression may increase because of a gene dosage effect Thus the presence of the kan gene can be used as a tool to detect transformants that harbor multiple copies of your gene The graphic below shows multiple insertion and linkage of the kan gene to your expression cassette Expression Cassette 1 2nd Insertion Event Expression 5 AOX1 1 ARG4 TT 3 5 P Gene of Interest TT Kan HIS4 E E e Cassette 1 n Expression Cassette 2 J 3rd Insertion Event etc Continued on next page Experimental Outline continued Screening on Direct selection of Geneticin resistance in yeast does not work well because Geneticin newly transformed cells need time to express sufficient amounts of the resistance factor Since yeast grows much more slowly than bacteria significant numbers of recombinant yeast are killed before they accumulate enough of the resistance factor to survive direct plating on antibiotic The most efficient procedure to generate Geneticin resistant and hyper resistant clones requires an initial selection of His transformants followed by screening for varying levels of Geneticin resistance While direct selection of Geneticin resistant colonies using electroporation is possible Scorer et al 1994 secondary selection on Geneticin results in clones with a greater chance of higher c
122. rexpress their protein Be sure to include a single copy insert as a control Test all your Geneticin resistant colonies for their Mut phenotype page 47 so that you induce expression properly Continued on next page 45 In Vivo Screening of Multiple Inserts continued Ste 7 Be sure to purify your clones by streaking for single colonies and making frozen m c glycerol stocks of all your Geneticin resistant colonies Always initiate P 7 expression studies from frozen stocks not old plates Determining If you find that your Geneticin resistant His recombinants significantly Copy Number overexpress your protein you may wish to quantify the copy number of your gene Copy number may be analyzed by Southern or quantitative dot slot blots See page 88 for information on these techniques It is very important to include genomic DNA isolated from Pichia recombinants transformed with vector alone and recombinant vector with a single copy of your gene as controls in order to evaluate your experiment Trouble Since there is a tendency to isolate false positives colonies that appear to be shooting Geneticin hyper resistant but are not it is very important to purify your putative Geneticin resistant colonies and confirm the observed level of Geneticin resistance before proceeding further The other most common problem with the in vivo method is that very few Geneticin resistant colonies are isolated This usually mea
123. rial Phage Display Library and Their Production in the Yeast Pichia pastoris Bio Technology 13 255 260 Rodriguez M Rubiera R Penichet M Montesinos R Cremata J Falcon V Sanchez G Bringas R Cordoves C Valdes M Lleonart R Herrera L and delaFuente J 1994 High Level Expression of the B microplus Bm86 Antigen in the Yeast Pichia pastoris Forming Highly Immunogenic Particles for Cattle J Biotechnol 33 135 146 Romanos M 1995 Advances in the Use of Pichia pastoris for High Level Expression Curr Opin Biotech 6 527 533 Romanos M A Clare J J Beesley K M Rayment F B Ballantine S P Makoff A J Dougan G Fairweather N F and Charles I G 1991 Recombinant Bordetella pertussis Pertactin p69 from the Yeast Pichia pastoris High Level Production and Immunological Properties Vaccine 9 901 906 Romanos M A Scorer C A and Clare J J 1992 Foreign Gene Expression in Yeast A Review Yeast 8 423 488 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Ed Cold Spring Harbor Laboratory Press Plainview New York Scorer C A Buckholz R G Clare J J and Romanos M A 1993 The Intracellular Production and Secretion of HIV 1 Envelope Protein in the Methylotrophic Yeast Pichia pastoris Gene 136 111 119 Scorer C A Clare J J McCombie W R Romanos M A and Sreekrishna K 1994 Rapid Selection Using G418 o
124. rifuge for 2 3 minutes at room temperature Time points hours 0 6 12 24 1 day 36 48 2 days 60 72 3 days 84 and 96 4 days For secreted expression transfer the supernatant to a separate tube Store the supernatant and the cell pellets at 80 C until ready to assay Freeze quickly in liquid N or a dry ice alcohol bath For intracellular expression decant the supernatant and store just the cell pellets at 80 C until ready to assay Freeze quickly in liquid N or a dry ice alcohol bath Analyze the supernatants and cell pellets for protein expression by Coomassie stained SDS PAGE and western blot or functional assay see Analysis by SDS Polyacrylamide Gel Electrophoresis page 54 Continued on next page Expression of Recombinant Pichia Strains continued Muf Intracellular or Secreted You can test the effectiveness of your expression conditions by growing GS115 which is Muf and secretes albumin to the medium Remember to include GS115 or KM71 transformed with the parent vector as a control for background intracellular expression 1 Using a single colony inoculate 100 ml of MGY BMG or BMGY in a 1 liter baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until the culture reaches an ODeo 2 6 approximately 16 18 hours Harvest the cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature To induce expression decant the supernatant and resuspend cell pe
125. roduce more protein Continued on next page Experimental Outline continued Experimental A flow chart is provided below to help you understand the process Process Clone gene of interest into pAOSIS pPIC3 5K or pPIC9K Create in vitro multimers using recombinant pAOSIS Transform appropriate Pichia pastoris strain GS115 for Mutt KM71 for Mut Plate transformants on histidine deficient medium Screen transformants containing pPIC3 5K or pPIC9K constructs on various concentrations of G418 Select transformants with the highest reisistance to G418 Confirm Mut phenotype by testing on his glucose and his methanol plates Select 6 10 colonies of each Mut phenotype and test for expression Select highest expressers for scale up in a shake flask or fermentor Methods Pichia Strains Introduction Pichia pastoris is quite similar to Saccharomyces cerevisiae as far as general growth conditions and handling You should be familiar with basic microbiological and sterile techniques before attempting to grow and manipulate any microorganism You should also be familiar with basic molecular biology and protein chemistry Some general references to consult are Guide to Yeast Genetics and Molecular Biology Guthrie amp Fink 1991 Current Protocols in Molecular Biology Ausubel et al 1994 Molecular Cloning A Laboratory Manual Sambrook et al 1989 Protein Methods Bollag et al 1996 a
126. s K2100 03 Platinum Taq DNA Polymerase 100 reactions 10966 018 250 reactions 10966 026 500 reactions 10966 034 Taq DNA Polymerase Recombinant 100 units 10342 053 500 units 10342 020 Easy DNA Kit 1 kit K1800 01 FastTrack 2 0 mRNA Isolation Kit 1 kit K1593 02 Micro FastTrack 2 0 mRNA Isolation Kit 1 kit K1520 02 Overview Review Articles General Characteristics of Pichia pastoris Similarity to Saccharomyces Pichia pastoris asa Methylotrophic Yeast Introduction The information presented here is designed to give you a concise overview of the Pichia pastoris expression system It is by no means exhaustive For further information read the articles cited in the text along with the following review articles Buckholz amp Gleeson 1991 Cregg amp Higgins 1995 Cregg et al 1993 Nico Farber et al 1995 Romanos 1995 Sreekrishna et al 1988 Wegner 1990 A general review of foreign gene expression in yeast is also available Romanos et al 1992 As a eukaryote Pichia pastoris has many of the advantages of higher eukaryotic expression systems such as protein processing protein folding and posttranslational modification while being as easy to manipulate as E coli or Saccharomyces cerevisiae It is faster easier and less expensive to use than other eukaryotic expression systems such as baculovirus or mammalian tissue culture and generally gives higher expression levels As a yeast
127. samples again by western blot Centricon and Centriprep filters Millipore are very useful for this purpose Protein Lowry BCA Pierce or Bradford protein determinations can be performed to Concentration quantify the amounts of protein in the cell lysates and medium supernatants In general Pichia cell lysates contain 5 10 ug ul protein Pichia medium supernatants will vary in protein concentration primarily due to the amount of your secreted protein Pichia secretes very few native proteins If the protein concentration of the medium is gt 50 pg ml 10 ul of medium will give a faint band on a Coomassie stained SDS PAGE gel Continued on next page 55 Analysis by SDS Polyacrylamide Gel Electrophoresis continued Controls N gio 7 o Nous Analyzing Protein Expression 56 Include the following samples as controls on your SDS PAGE e Molecular weight standards appropriate for your desired protein e A sample of your protein as a standard if available e Asample of GS115 or KM71 with the parent plasmid transformed into it This shows the background of native Pichia proteins that are present intracellularly Inclusion of this sample will help you differentiate your protein from background if you express it intracellularly e Analyze the GS115 p Gal and Albumin controls also as they should indicate any problems with the media or expression conditions In addition to Coomassie stained SDS PAGE we strongly r
128. sonicate for 10 seconds using a microtip and 20 30 power Sonicate to get the cells into solution and not to lyse the cells Dilute cells by 10 and plate 50 ul and 100 ul onto MD plates Incubate overnight at 30 C Screen for the Mut phenotype using the method of choice Continued on next page Screening for Mut and Mut Transformants continued Scoring Templates pes essc BE HD ED EIE EJEI EE EIE EJEI a a Ely aa AG fafa ofa arfa 43 e foe o e e e uw ce pv ar E ar E 49 Expression of Recombinant Pichia Strains Introduction Media Proteases Aeration 50 The purpose of this section is to determine the optimal method and conditions for expression of your gene Below are some factors and guidelines that need to be considered before starting expression in Pichia pastoris As with any expression system optimal expression conditions are dependent on the characteristics of the protein being expressed You will need BMGY BMMY buffered complex glycerol or methanol medium BMG BMM buffered minimal glycerol or methanol medium or MGY MM minimal glycerol or minimal methanol medium for expression see Appendix pages 68 70 BMG BMM BMGY and BMMY are usually used for the expression of secreted proteins particularly if pH is important for the activity of your protein Unlike MGY and MM they are all buffered media Because these media are buffered with
129. t expression provides a positive control for expression conditions The cell free B galactosidase assay provided below can also be found in Miller 1972 page 403 and can be used to evaluate expression of B galactosidase You will need to prepare the following e A fresh crude cell lysate of GS115 B Gal see page 54 e Zbuffer e ONPG solution e 1M sodium carbonate solution Recipes for the solutions are below 60 mM Na HPO 7H2O 40 mM NaH5 PO H O 10 mM KCI 1mM MgSO 7H O 50 mM f mercaptoethanol pH 7 0 1 Dissolve the following in 950 ml deionized water Na HPO 7H O 16 1 8 NaH PO H O 5 5 8 KCI 0 75g MgSO 7H O 0 246 g B mercaptoethanol 2 7 ml 2 Adjust pH to 7 0 with either NaOH or HCl and bring the volume up to 1 liter with water 3 Do notautoclave Store at 4 C 4 mg ml in 100 mM phosphate buffer pH 7 0 1 Dissolve the following in 90 ml deionized water Na HPO 7H O 1 61 8 NaH PO H O 0 55 8 2 Adjust pH to 7 0 with either NaOH or HCl 3 Add 400 mg ONPG Stir to dissolve and bring the volume up to 100 ml with water 4 Storeat 4 C away from light Dissolve 12 4 g sodium carbonate in 100 ml of deionized water Store at room temperature Continued on next page p Galactosidase Assay continued Procedure Note Determining Specific Activity Sample Calculation 1 Determine protein concentration of your lysate by Lowry Bradford or BCA assay Equilibrate Z buffer ON
130. t al 1991 Scorer et al 1993 Zaret amp Sherman 1984 If you have problems expressing your gene check for premature termination and AT rich regions It may be necessary to change the sequence in order to express your gene Scorer et al 1993 e The predicted protease cleavage sites for the a factor signal sequence in pPIC9K are indicated in the figure page 21 e You must clone the open reading frame ORF of the mature gene of interest in frame and downstream of the a factor signal sequence in pPIC9K Continued on next page 17 Cloning into the Pichia Multi Copy Expression Vectors continued General Cloning Strategies generally fall into three different categories Strategies 1 Ligation of a compatible restriction fragment a Forced directional insertion involving the use of two different sites in the multiple cloning site b Ligation of the fragment with the same restriction end on both ends into a single compatible site PCR amplification of the fragment containing the gene of interest in such a way that compatible restriction ends are generated for ligation into the appropriate vector Direct cloning of an amplified fragment containing the gene of interest via the TA Cloning Kit see page viii followed by subcloning of a compatible fragment into the vector of choice Cloning Refer to Ausubel et al 1994 pages 3 16 1 to 3 17 3 or Sambrook et al 1989 Procedures pages 5 10 to 5 13 for
131. tate the DNA Resuspend in 17 ul of sterile water Set up the dephosphorylation reaction in a microcentrifuge tube as follows BamH I digested recombinant pAO815 17 ul 10X CIP Buffer 2 ul CIP 1 Unit yl 1ul Total volume 20 ul Incubate at 37 C for 15 minutes Add 30 ul of sterile water to the reaction to make a final volume of 50 ul Add 50 ul of phenol chloroform and extract your DNA solution Transfer the aqueous solution to a new tube Precipitate the DNA by adding 5 ul of 3 M sodium acetate and 110 pl 100 ethanol Incubate on ice for 30 minutes Resuspend pellet in 8 pl sterile water Save on ice if you plan to ligate your insert immediately see Ligation and Digestion of Expression Cassette next page or store at 20 C Continued on next page In Vitro Multimerization Protocol continued Ligation and Ligation of the expression cassette generates head to tail head to head and tail Digestion of to tail multimers Creation of head to tail multimers will be in the correct Expression orientation for expression and will destroy both the BamH I and Bgl II sites Cassette between the expression cassettes Digestion of the multimers with BamH I and Bgl II will eliminate those multimers with tail to tail and head to head orientation After digestion with these two restriction enzymes you will have a mixture of multimers containing 1 2 3 etc copies of your gene that can be ligated into BamH I linearized recombinant pAO
132. ted in top agarose or agar to protect them from lysis prior to selection 1 Mix together 100 300 ul of each spheroplast DNA solution from Step 7 above with 10 ml of molten RD agarose and pour on RDB plates Allow the top agarose to harden Note there is enough of the spheroplast DNA solution to plate duplicate and triplicate plates 2 Invert plates and incubate at 28 30 C Transformants should appear in 4 6 days 3 For cell viability Mix 100 ul of spheroplasts with 900 pl of 1 M sorbitol Mix 100 ul of this diluted sample with 10 ml of molten RDH and pour on a RDHB plate Allow top agarose to harden 5 Invert plates and incubate at 28 30 C Appearance of colonies after 4 6 days demonstrates that the spheroplasts can regenerate into dividing cells Continued on next page Transformation of Pichia continued Analyzing Hist Transformants Evaluating Your Transformation Experiment Screening by Functional Assay If you transformed Pichia with constructs based on pPIC3 5K or pPIC9K proceed to In Vivo Screening of Multiple Inserts page 42 If you transformed Pichia with constructs based on pAO815 proceed to Screening for Mutt and Muts Transformants page 47 Transformation efficiency is generally 10 to 10 His transformants ug of DNA using the spheroplast method There should be no colonies on the No DNA or pBR322 plate or the plasmid only no cells plate Some researchers have used a functional assay
133. the signal sequence e HIS4 selection in Pichia e For insertion at AOX1 in GS115 or KM71 linearize with Sac I generates Hist Mutt in GS115 and His Mut in KM71 e For insertion at HIS4 linearize with Sal I generates Hist Mut in GS115 and His Mut in KM71 e For gene replacement at AOXT in GS115 linearize with Bg II generates His Mut See page 34 for alternate restriction sites if your insert DNA has a Bgl II Sac I or Sal I site Map of pPIC9K The figure below shows the map of pPIC9K Details of the multiple cloning site and the a factor secretion signal are shown on page 21 The sequence of pPIC9K is available on our website www invitrogen com or from Technical Support page 94 Comments for pPIC9K 9276 nucleotides 5 AOX1 promoter fragment bases 1 948 5 AOX1 primer site bases 855 875 a Factor secretion signal s bases 949 1218 a Factor primer site bases 1152 1172 Multiple Cloning Site bases 1216 1241 3 AOX1 primer site bases 1327 1347 3 AOX1 transcription termination TT bases 1253 1586 HIS4 ORF bases 4514 1980 Kanamycin resistance gene bases 5743 4928 3 AOX1 fragment bases 6122 6879 pBR322 origin bases 7961 7288 Ampicillin resistance gene bases 8966 8106 15 p Description Map of pAO815 16 AO815 pAO815 is a plasmid designed for in vitro generation of multimers of your gene for integration into the Pichia genome Other details about pAO815 are provided below
134. tion Proteins secreted into the media are usually gt 50 homogeneous and will require some additional purification It is optimal to concentrate the protein if the expression level is not particularly high There are several general methods to concentrate proteins secreted from Pichia These general methods include e Ammonium sulfate precipitation e Dialysis e Centrifuge concentrator for small volumes e 2 Centricon or Centriprep devices available from Millipore e Pressurized cell concentrators for large volumes e 2 Amicon ultrafiltration devices available from Millipore e Lyophilization A general guide to protein techniques is Protein Methods Bollag et al 1996 A general procedure for cell lysis using glass beads is provided on the next page There is also a cell lysis protocol in Current Protocols in Molecular Biology page 13 13 4 Ausubel et al 1994 and in Guide to Protein Purification Deutscher 1990 We also recommend lysis by French Press follow the manufacturer s suggestions for yeast Basic guidelines are available for fermentation of Pichia from Invitrogen We recommend that only those with fermentation experience or those who have access to people with experience attempt fermentation Contact Technical Support for more information page 94 61 Protein Purification and Glycosylation Introduction Some Protein Purification Techniques Procedure for Cell Lysis Analysis of Glycopr
135. to boil the carrier DNA prior to each use Store a small aliquot at 20 C and boil every 3 4 times the DNA is thawed Centrifuge the LiCl cell solution from Step 7 previous page Remove the LiCl with a pipet For each transformation sample add the following reagents in the order given to the cells PEG shields the cells from the detrimental effects of the high concentration of LiCl 240 ul 50 PEG 36 pl 1 M LiCl 25 ull 2 mg ml single stranded DNA Plasmid DNA 5 10 ug in 50 ul sterile water Vortex each tube vigorously until the cell pellet is completely mixed 1 minute Incubate the tube at 30 C for 30 minutes without shaking Heat shock in a water bath at 42 C for 20 25 minutes Centrifuge the tubes at 6 000 to 8 000 rpm and remove the transformation solution with a pipet Gently resuspend the pellet in 1 ml of sterile water Plate 25 to 100 ul on RDB or MD plates Incubate the plates for 2 4 days at 30 C Screen for Mut phenotype page 47 or select hyper resistant Geneticin colonies page 42 PCR Analysis of Pichia Integrants Introduction Analysis by PCR The following protocol is designed to allow you to analyze Pichia integrants to determine if the gene of interest has integrated into the Pichia genome Isolate genomic DNA from 6 10 Mut or Mut Pichia clones using the protocol on page 86 Isolate DNA from the strain transformed with the parent plasmid After isolating your DNA use the procedure below to identify
136. transformation by electroporation Transformation efficiency is between 10 to 10 cfu yg linearized DNA Lithium acetate does not work with Pichia pastoris Use only lithium chloride 1M LiCl in distilled deionized water Filter sterilize Dilute as needed with sterile water 50 polyethylene glycol PEG 3350 in distilled deionized water Filter sterilize Store in a tightly capped bottle 2 mg ml denatured fragmented salmon sperm DNA in TE 10 mM Tris HCI pH 8 0 1 0 mM EDTA Store at 20 C 1 Grow a 50 ml culture of Pichia pastoris in YPD at 30 C with shaking to an ODoeo of 0 8 to 1 0 approximately 10 cells ml 2 Harvest the cells and wash with 25 ml of sterile water and centrifuge at 1 500 x g for 10 minutes at room temperature 3 Decant the water and resuspend the cells in 1 ml of 100 mM LiCl Transfer the cell suspension to a 1 5 ml microcentrifuge tube 5 Pellet the cells at maximum speed for 15 seconds and remove the LiCl with a pipet Resuspend the cells in 400 ul of 100 mM LiCl 7 Dispense 50 pl of the cell suspension into a 1 5 ml microcentrifuge tube for each transformation and use immediately Do not store on ice or freeze at 20 C Continued on next page 81 Lithium Chloride Transformation Method continued Transformation 82 1 Boil a 1 ml sample of single stranded DNA for five minutes then quickly chill in ice water Keep on ice Note It is neither necessary nor desirable
137. ubate overnight at 37 C If you do not get transformants or very few transformants plate out the remainder of the transformation mix onto LB ampicillin plates Continued on next page In Vitro Multimerization Protocol continued Analyzing Transformants Pick 20 transformants and inoculate 2 ml LB containing 50 100 pg ml ampicillin Grow overnight at 37 C Isolate plasmid DNA and digest with Bgl II and BamH I to release any multimers from pAO815 Be sure to include Bgl II BamH I digested pAO815 as a control It is possible to get vector rearrangements and deletions with large vectors in E coli Including Bg II BamH I digested pAO815 will allow you to detect these rearrangements deletions in the vector backbone Analyze your digests on a 1 agarose gel You should see bands corresponding to 1 copy 2 copies 3 copies etc of your expression cassette plus the vector backbone The number of copies you obtain may depend on how well a large vector is tolerated by the E coli host strain Once you have identified plasmids with multiple copies of your expression cassette be sure to purify the original colony by streaking for single colonies and confirming your construct If you have difficulties see the next page Prepare frozen glycerol stocks of E coli containing each of your multimeric constructs Prepare 5 10 ug of each plasmid for transformation into Pichia Proceed to Preparing Transforming DNA page 32 Conti
138. ug 314 pmoles lyophilized 5 GCAAATGGCATTCTGACATCC 3 a Factor sequencing primer 2 pg 315 pmoles lyophilized 5 TACTATTGCCAGCATTGCTGC 3 The following prepackaged media is included for your convenience Instructions for use are provided on the package Store at room temperature Media Amount Yield YP Base Medium 2 pouches 2 liters of YP medium YP Base Agar Medium 2 pouches 2 liters of YP medium Yeast Nitrogen Base 1 pouch 500 ml of 10X YNB Continued on next page Materials continued Required Equip ment and Supplies not provided 30 C and 37 C rotary shaking incubator Water baths capable of 16 C 37 C 45 C 65 C and 100 C Centrifuge suitable for 50 ml conical tubes floor or table top Baffled culture flasks with metal covers 50 ml 250 ml 500 ml 1000 ml and 3L 50 ml sterile conical tubes 6 ml and 15 ml sterile snap top tubes Falcon 2059 or similar UV Spectrophotometer Mini agarose gel apparatus and buffers Agarose and low melt agarose Polyacrylamide gel electrophoresis apparatus and buffers Media for transformation growth screening and expression Appendix pages 64 71 5 SDS solution 10 ml per transformation Sterile cheesecloth or gauze EcoR I BamH I and Bg II restriction enzymes and appropriate buffers Glass milk Sterile water CIP calf intestinal phosphatase 1 unit yl 10X CIP Buffer Phenol chloroform 3M so
139. w recombination with AOXI Continued on next page In Vitro Multimerization Protocol continued For More Information There are a number references in the literature you can consult to optimize synthesis of in vitro multimers A partial list is provided below Cohen B and Carmichael G G 1986 A Method for Constructing Multiple Tandem Repeats of Specific DNA Fragments DNA 5 339 343 Eisenberg S Francesconi S C Civalier C and Walker S S 1990 Purification of DNA Binding Proteins by Site specific DNA Affinity Chromatography Methods Enzymol 182 521 529 Graham G J and Maio J J 1992 A Rapid and Reliable Method to Create Tandem Arrays of Short DNA Sequences BioTechniques 13 780 789 Rudert W A and Trucco M 1990 DNA Polymers of Protein Binding Sequences Generated by Polymerase Chain Reaction Nucleic Acids Res 18 6460 Simpson R T Thoma F and Brubaker J M 1985 Chromatin Reconstituted from Tandemly repeated Cloned DNA Fragments and Core Histones A Model System for the Study of Higher order Structure Cell 42 799 808 Takeshita S Tezuka K i Takahashi M Honkawa H Matsuo A Matsuishi T and Hashimoto Gotoh T 1988 Tandem Gene Amplification in vitro for Rapid and Efficient Expression in Animal Cells Gene 71 9 18 Taylor W H and Hagerman P J 1987 A General Method for Cloning DNA Fragments in Multiple Copies Gene 53 139 144 31 Preparing Transform

Multi-Copy Pichia Expression Kit

Contents

Download Pdf Manuals

Related Search

Related Contents