Tutorial for Windows and Macintosh Local-BLAST
Contents
1. Search db p Organize v Include in library Share with Burn New folder 3 Hi e Name Date modified Type Size J mito nt 10 7 2014 11 50 PM File 133 624 KB _ mito nt gz 10 8 2014 11 25 AM GZ File 39 486 KB mito nt nhr 10 8 2014 11 47 AM NHR File 727 KB _ mito nt nin 10 8 2014 11 47 AM NIN File 60 KB mito nt nsq 10 8 2014 11 47 AM NSQ File 32 914 KB INVOKING A SEQUENCHER CONNECTIONS SESSION Now that you have Local BLAST installed and have created a compatible database you are ready to run some searches First you need to choose the sequence or sequences you will be using as queries and create a new session with them in Sequencher Connections e Launch Sequencher e Goto the File menu and select New Project From Template gt rCRS Edit Select Assemble Contig Sequence View Window Help New Project New Project From Template rCRS Open Project ELM a9 mg am A mm Select the sequence named rCRS the Window menu and select Add to Connections Session Add to Connections Session k e You will then see the Session Launcher dialog Gene Codes Corporation 2015 Local BLAST p 5 of 10 e Select the Add to new Connections Session for individual sequences radio button e Enter Local BLAST mito in the New Session Name field Add to new Connections Session for individual sequen2. mitochondrion complet gi 408772040 ref NC 018753 1 Nomascus gabriellae mitochondrion J Lo n oo oo 0 00 e Go e T Co o o Lo v p On Co CONCLUSION In this tutorial you have created your own Local BLAST database using a FASTA file as the source of your sequences You have learned how to query this database using locally installed version of BLAST You have also learned how to create additional channels so that you can test the veracity of your results using a second algorithm and different BLAST options Finally you have learned how to use the Schematic and compare results Gene Codes Corporation 2015 Local BLAST p 10 of 10
3. 6 ref NC 012920 1 Homo sapiens mitochondrion compl gi 196123578 ref NC 011137 1 Homo sapiens neanderthalensis mit gi 292606408 ref NC 013993 1 Homo sp Altai mitochondrion com gi 568192363 ref NC 023100 1 Homo heidelbergensis mitochondrio gi 195952353 ref NC 011120 1 Gorilla gorilla gorilla mitochond gi 5835149 ref NC 001645 1 Gorilla gorilla mitochondrion comp gi 5835834 ref NC 002083 1 Pongo abelii mitochondrion complet gi 5835163 ref NC 001646 1 Pongo pygmaeus mitochondrion compl I in I I e e ma Lo On H Lo LO C Co C J eC e gt gi 5835121 ref NC 001643 1 Pan troglodytes mitochondrion complete genome Length 16554 Score 1173 bits 635 Expect 0 0 Identities 965 1124 86 Gaps 24 1124 2 Strand Plus Plus Query 1 TICTTIICATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACC IEEE LE EE EE COCU TEEPE CE CUCCO Pd Sbjct 15442 TICTITCATGGGGAAGCAAATTTAGGTACCACCTAAGTACTGGCTCATTCAT TACAACC Query 61 GCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACT IEEE LEE EE EL EE EE LEE EE ELLE Pe gd gu Sbjct 15501 GCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATCGTACAGTACCAT ATCACC Query i121 TGACCACCTGTAGTACATAAAAACCCAAT CCACATCAAAACCCCCTCCCCATGCTTACA From within the Text XML or Sequence tabs you can save the results by right clicking and selecting Save as Text for Text and S
4. BI or create your own With Sequencher Connections simple interface for setting up and running BLAST searches you ll find a system that meets your needs Your BLAST results are shown in Connections tabbed windows which allow for easy viewing of the results in different formats In this tutorial you will query the revised Cambridge Reference Sequence against a database of mitochondrial sequences This tutorial also quides you through creating a Local BLAST database from a FASTA file Information on using Sequencher Connections other powerful features can be found in the Sequencher Connections tutorial and chapter in the Sequencer User Manual ABOUT FILE FORMATS In this tutorial you will download a FASTA file from which you will use one of the tools of the BLAST toolkit to create your own database If you want to use your own data you will need to provide your own query sequence file s in FASTA or FASTQ format and a BLAST database If you have been working with a well characterized genome then you will probably be able to obtain pre formatted BLAST databases from the NCBI BLAST website at ftp ttp ncbi nlm nih gov blast db Note If you are on a Mac and prompted for name and password when trying to access any of the ftp sites in this tutorial select the Connect as Guest radio button and click Connect Once you have downloaded the tar gz archive unzip it and copy the files to your Local BLAST database location describe
5. CUUEN CHER Tutorial for Windows and Macintosh Local BLAST 2015 Gene Codes Corporation Gene Codes Corporation TCA AGT Gene Codes Corporation 775 Technology Drive Ann Arbor MI 48108 USA 1 800 497 4939 USA 1 734 769 7249 elsewhere 1 734 769 7074 fax www genecodes com gcinfo genecodes com Local BLAST About File Formats sccccsssscsssssccsssecccssseccssseccssssccesssccessnscsssssccssssecssssccesssscssssecsessnecssssecess 3 Installing 3 Creating a New BLAST 0 4 Invoking a Sequencher Connections 5 Running Local BLAST 6 Viewing your Local BLAST Local BLAST Options 8 Cn NR 10 Gene Codes Corporation 2015 Local BLAST p 2 of 10 Local BLAST Running BLAST searches locally can save time and provide you with flexibility in terms of which version of BLAST and database you choose to use You can download pre formatted BLAST databases from NC
6. Value 1 10E 1 Masking Alignments 10 z Filter for Low Complexity Word Size 11 Filter Human Repeats You now have results using two different Local BLAST algorithms blastn and megablast You can compare the results using Sequencher Connections Schematic and you can look at the alignments To compare the results using the Schematic perform the following steps e Right click on either the number next to the sequence whose schematic you wish to view or its name In this case right click on rCRS e Show Schematic from the menu If you hold the cursor over a single alignment in the Schematic you will see a tooltip showing information about that alignment Local BLAS T mito nt Local BLASTn e lick the cell in the Local BLAST mito nt channel that has the status of DORG e Click the cell in the Local BLASTn channel that has a status of e Compare the two lists of results and view the actual alignments The top image shows the list of alignments obtained using the megablast algorithm while the second image shows the list of alignments obtained using the blastn alogorithm with a Word size of 11 Note how the list of results differs If you go on to explore the alignments you will see that even where the same sequence is reported it may have fewer aligned bases Gene Codes Corporation 2015 Local BLAST p 9of10 Local BLAST using megablast Score E Sequences producing significant alignments Bi
7. ces Add to new Connections Session for grouped sequences New Session Name Local BLAST mito Add to an existing Connections Session Click the OK button e ASequencher Connections session window will appear RUNNING LocAL BLAST When you launch a new Connections session for individual sequences two default channels are created These channels are BLAST at NCBI and Primer BLAST at NCBI You need to create a channel for Local BLAST e Right click the column BLAST nr and select Insert Local BLAST Channel Before e Right click on the column Local BLAST and select Options Run on Each Sequence Cancel Running Jobs Insert BLAST Channel Before Insert Primer BLAST Channel Before Insert Local BLAST Channel Before Remove Channel Gene Codes Corporation 2015 Local BLAST Run on Each Sequence Cancel Running Jobs Insert BLAST Channel Before Insert Primer BLAST Channel Before Insert Local BLAST Channel Before Remove Channel 6 of 10 Loca BLAST BLAST nr Primer BLAST Local BLAST Search Tool Name Local BLAST App Folder C Program Files NCBI blast 2 2 28 bin Se iv ant ein mito nt e Ifyou prefer you can name this channel to something more memorable by typing the new name into the Name field otherwise its default name will be Local BLAST mito nt e lik the OK button to close the Options dialog e Right click the Local BLAST mito nt c
8. ch bar type cmd and press enter e At the command prompt in the cmd window enter this command cd C Program Files NCBNblast 2 2 28 db You now need to verify that you are in the same folder as the mito nt file by running the list command Mac ls Windows dir at the command prompt e the makeblastdb tool on the FASTA file makeblastdb in mito nt input_type fasta dbtype nucl e Note The Mac installer may not update the PATH environment variable with the path to BLAST s executables As a result you may need to run the above command as usr local ncbi blast bin makeblastdb in mito nt input type fasta dbtype nucl Gene Codes Corporation 2015 Local BLAST p 4 of 10 Administrator C Windows system32 cmd exe C Program Files NCBI blast 2 2 28 db gt makeblastdb in mito nt input type fasta dbtyupe nucl Building a new DB current time 16 68 2614 11 51 32 New DB name mito nt New DB title mito nt Sequence type Nucleotide Deleted existing BLAST database with identical name Keep Linkouts T Keep MBits T Maximum file size 1808088088088B Adding sequences from FASTA added 5087 sequences 2 48967 seconds C Program Files NCBI blast 2 2 28 dhb gt BLAST database files created are mito nt nhr mito nt nin and mito nt nsq e Quit the DOS command prompt or Terminal session G i C Program Files NCBI blast 2 2 28 db v
9. d in the instructions below for Creating a New BLAST Database INSTALLING LocAL BLAST In this tutorial you will need to install BLAST locally on your machine and download the mito nt FASTA file from NCBI We recommend using BLAST version 2 2 28 as this is the default version in Sequencher Windows and Mac installers for BLAST can be downloaded from fip ttp ncbi nlm nih gov blast executables blast 2 2 28 After running the Local BLAST installer you will need to set up the BLASTDB environment variable There are different instructions for Mac and Windows operating systems For Mac OS systems e From the Finder open a Terminal window by clicking on the Terminal icon in the Applications Utilities folder e In the terminal window that appears enter the following command line you can also copy and paste this command into the Terminal window echo BLAST gt ncbirc echo BLASTDB usr local ncbi blast db gt gt ncbirc This will create a hidden file called ncbirc in your Home directory To ensure this change takes effect you must log out and log back into your account For Windows operating systems Click Start gt gt Control Panel gt gt System gt gt Advanced System Settings lick the Advanced tab gt gt Environment Variables e Under User variables for dick the New button Gene Codes Corporation 2015 Local BLAST p 3 of 10 Note This will enable only the curr
10. ent user to use Local BLAST You can however enable Local BLAST for all users by creating a New System variable e For the Variable name enter BLASTDB e For the Variable value enter C Program Files NCBNblast 2 2 28 db Click OK CREATING A New BLAST DATABASE Before you can run Local BLAST you will also need to have a database which has a compatible format installed on your computer You can download segments of the databases that are used on the BLAST servers at NCBI or you can use the makeblastdb utility to create a database from a file containing FASTA sequences To create a database from such a file follow these steps e Download mito nt gz from ftp ftp ncbi nlm nih gov blast db FASTA and the file to the location BLAST databases are stored in this example C Program Files NCBNblast 2 2 28 db on Windows or usr local ncbi blast db on Mac You may need to create this directory e Unzip the file A FASTA file named mito nt will appear in that folder If you are working on Windows using a Cygwin or DOS cmd command prompt or Terminal window on Mac you now need to navigate to the db folder On Mac operating systems e From the Finder open a Terminal window by clicking on the Terminal icon in the Applications Utilities folder e At the command prompt in the Terminal window enter this command cd usr local ncbi blast db On Windows operating systems e the Start Menu and in the sear
11. equence tabs and Save XML for the XML tab LocAL BLAST OPTIONS The majority of options for Local BLAST and BLAST are the same The most important Local BLAST difference is the option to use any database that you are able to obtain or create BLAST at NCBI is updated at regular intervals with Local BLAST you are in control of the version you use For this tutorial we have used version 2 2 28 For more details on using these options please refer to the chapter called Sequencher Connections in the Sequencher User Manual e Right click on the column BLAST nr and select Insert Local BLAST Channel Before e Right click on the new Local BLAST column and select Options e Change the channel Name to local blastn e Choose a new Default Graphic Color e Choose mito nt from the Database drop down menu e Choose blastn from the Optimize for drop down menu e You are warned that you need to change the Word Size to 11 you can type the number 11 directly over the existing value e lick the OK button to dismiss the dialog e Right click on the new Local BLAST mito nt column and select Run on Each Sequence Gene Codes Corporation 2015 Local BLAST p 8 of 10 BLAST nr local megablast Primer BLAST Local BLAST Search Tool Name This applies to Default Graphic Color App Folder C Program Files NCBI blast 2 2 28 t bin Browse Database mito nt x Optimize for Somewhat similar blastn Y Descriptions 10 z E
12. olumn and select Run on Each Sequence The status of the channel will go from Queued to Pending to Dane File Len Local Run on Each Sequence Cancel Running Jobs Options Insert BLAST Channel Before Insert Primer BLAST Channel Before Insert Local BLAST Channel Before Remove Channel Note that if you close and reopen a session that had earlier search results the Done status changes to Done Also if a session had previous search results and a new search is run but then cancelled before the search is completed the earlier results will be restored VIEWING YOUR LocAL BLAST RESULTS The results of your session can be viewed in the tabs labeled Web View and Text The Sequence tab contains the original query sequence If you used the mitochondrial sequence and database used in this tutorial then your results will look like the following image e lick the cell in the Local BLAST mito nt channel that has a status of results will appear in the Web View tab Now dick in the Text tab Notice that there are no hyperlinks to other parts of the results in this view Gene Codes Corporation 2015 Local BLAST p 7 of 10 Web View Query Length 1122 td ct O m Sequences producing significant alignments H H Lo gi 5835121 ref NC 001643 1 Pan troglodytes mitochondrion comp gi 5835135 ref NC 001644 1 Pan paniscus mitochondrion complet gi 25183110
13. ts Value gi 5835121 ref NC 001643 1 Pan troglodytes mitochondrion comp 1173 0 0 gi 5835135 ref NC 001644 1 Pan paniscus mitochondrion complet 1151 0 0 gi 251831106 ref NC 012920 1 Homo sapiens mitochondrion compl 1064 0 0 gi 196123578 ref NC 011137 1 Homo sapiens neanderthalensis mit 961 0 0 gi 292606408 ref NC 013993 1 Homo sp Altai mitochondrion com 929 0 0 gi 568192363 ref NC 023100 1 Homo heidelbergensis mitochondrio 843 0 0 gi 195952353 ref NC 011120 1 Gorilla gorilla gorilla mitochond 667 0 0 gi 5835149 ref NC 001645 1 Gorilla gorilla mitochondrion comp 625 9e 178 gi 5835834 ref NC 002083 1 Pongo abelii mitochondrion complet 584 1e 165 gi 5835163 ref NC 001646 1 Pongo pygmaeus mitochondrion compl 556 3e 157 Local BLAST using blastn Score E Sequences producing significant alignments Bits Value gi 5835121 ref NC 001643 1 Pan troglodytes mitochondrion comp 1260 gi 5835135 ref NC 001644 1 Pan paniscus mitochondrion complet 1242 gi 251831106 ref NC 012920 1 Homo sapiens mitochondrion compl 1040 gi 196123578 ref NC 011137 1 Homo sapiens neanderthalensis mit 957 gi 292606408 ref NC 013993 1 Homo sp Altai mitochondrion gi 568192363 ref NC 023100 1 Homo heidelbergensis mitochondrio gi 195952353 ref NC 011120 1 Gorilla gorilla gorilla mitochond gi 5835149 ref NC 001645 1 Gorilla gorilla mitochondrion comp gi 5835834 ref NC 002083 1 Pongo abelii
Download Pdf Manuals
Related Search