BD GenomeWalker Universal Kit
Contents
1. walk another step by sequencing the distal end of the BD GenomeWalker product s designing a new gene specific primer and repeating the amplification protocol The promoter is present but the reporter is not expressed There are several possible reasons why you might not detect promoter activity even if your promoter reporter construct contains the promoter These include the following i The fragment is cloned in the wrong orientation Reclone and test in the opposite orientation ii The promoter is too weak to be detected in your assay If this is the case it may be possible to add an enhancer to your construct or reclone your fragment s in a vector that has an enhancer BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 24 Version No PR47605 BD GenomeWalker Universal Kit User Manual VII Suggestions for Characterizing Products continued ili The promoter needs to be induced and you do not have the means to induce it Again recloning into a vector that has a strong enhancer may allow you to detect promoter activity iv The promoter is tissue or stage specific Again recloning into a vector that has a strong enhancer may allow you to detect promoter activity Alternatively it may be possible to demonstrate the presence of a promoter by testing the construct in another host cell or in the whole organism v Reporter construct makes a bicistronic message The cloned fragment2. 1 ug ul on a 0 5 agarose EtBr gel in 0 5X TBE along with DNA size markers such as a 1 kb ladder or 4 Hind III digest Genomic DNA should be bigger than 50 kb with minimum smearing 2 Check the purity of genomic DNA by Dra digestion a In a 0 5 ml reaction tube combine the following 5 ul Experimental genomic DNA 1 6 ul Dral 10 units ul 2 ul 10X Dra Restriction Buffer 11 4 ul Deionized H O Also set up a control digestion without enzyme b Mix gently by inverting tube Do not vortex vigorous mixing will shear genomic DNA c Incubate at 37 C overnight d Run 5 ul of each reaction on a 0 5 agarose EtBr gel along with 0 5 ul of experimental genomic DNA as a control At this point you should see a smear indicating that your DNA can be digested by restriction enzymes BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 10 Version No PR47605 BD GenomeWalker Universal Kit User Manual IV Construction of BD GenomeWalker Libraries continued C Digestion of Genomic DNA For each library construction you should set up a total of five reactions For your experimental genomic DNA set up four blunt end digestions one for each blunt end restriction enzyme provided Additionally set up one Pvu Il digestion of human genomic DNA as a positive control 1 Label five 1 5 ml tubes DL1 DL2 DL3 DL4 and positive control 2 For each reaction combine the following in a separate 1 5 ml tube 25
3. C annealing 68 C extension See Appendix C for cycling parameters for the GeneAmp PCR Systems 2400 and 9600 19 Analyze 5 ul of the secondary PCR products on a 1 5 agarose EtBr gel along with DNA size markers such as a 1 kb ladder or A Hind III digest If you do not see any product perform four additional cycles Store the unused portion of each secondary PCR at 4 C until you have confirmed that the procedure has been successful At that point proceed with analyzing and cloning the fragments of interest e g putative promoter fragments as described in Section VII BD Biosciences Clontech 18 www bdbiosciences com Protocol No PT3042 1 Version No PR47605 BD GenomeWalker Universal Kit User Manual VI Expected Results and Troubleshooting Guide A Expected Results 1 Primary PCR A sample gel showing the results of primary BD GenomeWalker PCR can be seen in Figure 2 in the Introduction In general primary PCR should produce multiple fragments ranging in size from about 500 bp to 5 kb There may be smearing in some lanes You should continue with secondary PCR if you obtain any bands or smearing with your gene specific primer 2 Secondary PCR a Positive control primers PCP1 and PCP2 The expected size of the band amplified from both the human positive control library and the library you constructed using the positive control human genomic DNA should be 1 5 kb b Experimental PCR primers In approximately
4. Cat No 631713 Sinai et al 1994 This kit also includes pBgal Control Vector and reagents necessary for 100 chemiluminescent assays pEGFP 1 Promoter Reporter Vector Cat No 632319 uses a bright codon optimized variant of the green fluorescent protein GFP to monitor promoter activity Cormack et al 1996 April 1996 Clontechniques Kitts et al 1995 Allofthese vectors have large multiple cloning sites to facilitate cloning Note on ATG start codon If your gene specific primer was down stream of the ATG start codon in your gene of interest then you may wish to eliminate the ATG from your promoter reporter construct s This may prevent a possible false negative result due to the expression of a bicistronic message See Section 4 b v below 4 Explanation of possible results of tests for promoter activity Some BD GenomeWalker products will have no promoter activity when cloned in both orientations in a promoter reporter vector There are several possible explanations a None of the fragments contains the promoter Your primer may be several kb from the promoter and or there may be intervening restriction sites between the primer and the pro moter This may also be an indication that the primer does not fall within the first exon or within a downstream exon that is within 6 kb of the promoter If this is the case you may need to obtain sequence data from closer to the 5 end of the transcript Alternatively you can
5. PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 13 BD GenomeWalker Universal Kit User Manual V BD GenomeWalker DNA Walking continued the BD GenomeWalker Kit The optimal cycling parameters may vary with different polymerase mixes gene specific primers and thermal cyclers Recommended cycling parameters for the PE Biosystems GeneAmp PCR Systems 2400 and 9600 are provided in Appendix C Please refer to the Troubleshooting Guide Section VI for suggestions on optimizing PCR conditions 2 Use some form of hot start PCR It is advantageous to use some form of hot start in PCR and the protocol assumes that BD TaqStart Antibody has been included in the 50X polymerase mix see Section III Additional Materials Hot start can also be performed using wax beads Chou etal 1992 or manually D Aquila et al 1991 If you use a manual or wax based hot start you will need to adapt the protocol to these particular methods 3 Touchdown PCR The PCR cycling parameters in steps V C 9 and V C 18 are for touchdown PCR Don et al 1991 Roux 1995 Hecker and Roux 1996 Touchdown PCR involves using an annealing extension tem perature thatis several degrees higherthan the T of the primers during the initial PCR cycles Although primer annealing and amplification is less efficient at this higher temperature it is much more specific The higher temperature also enhances the suppression PCR effect
6. can be strung together to create longer walks e Walking from 5 or 3 ends generated by RACE using the BD SMART RACE cDNA Amplification Kit Cat No 634914 Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 25 BD GenomeWalker Universal Kit User Manual Vill References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A amp Struhl K 1994 In Current Protocols in Molecular Biology Greene Publishing Associates and John Wiley amp Sons Inc NY Vol 1 Ch 2 Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from A bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Cheng S Fockler C Barnes W M amp Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 5695 5699 Chou Q Russell M Birch D Raymond J amp Bloch W 1992 Prevention of pre PCR mispriming and primer dimerization improves low copy number amplifications Nucleic Acids Res 20 1717 1723 Cormack B P Valdivia R amp Falkow S 1996 FACS optimized mutants of the green fluorescent protein GFP Gene 173 33 38 D aquila R T Bechtel L J Videler J A Eron J J Gorczyca P amp Kaplan J C 1991 Maximizing sensitivity and specificity by preamplification heating Nucleic Acids Res 19 3749 Don R H Cox P T W
7. contains the ATG and some portion of the open reading frame from the gene of interest This results in a bicistronic message in which two ORFs may compete for trans lation the downstream ORF i e the reporter may not be efficiently translated If you suspect this to be the case test for promoter activity at the RNA level by performing RT PCR Reporter expression can be assayed by Northern blot however RT PCR is much faster and more sensitive if suitable primers are available vi The cloned fragment s contains a strong negative enhancer There are numerous instances of so called negative enhanc ers that prevent transcription of a functional promoter If you suspect this to be the case try recloning in the presence of a known strong enhancer or testing subclones in which upstream sequences have been deleted 5 Deletion analysis of promoters After finding fragments that have promoter activity you may want to perform a deletion analysis to define the minimal promoter Any stan dard nested deletion method is compatible with this system C Other Applications of the BD GenomeWalker Method Other possible applications of the BD GenomeWalker DNA walking method include e Mapping intron exon boundaries e Walking short distance upstream or downstream in genomic DNA from known sequences e g expressed sequence tags EST or other sequence tagged sites STS Although individual steps are limited to 6 kb multiple steps
8. for different thermal cyclers For example the cycling parameters in this protocol which were developed on the PE Biosystems DNA Thermal Cycler 480 do not work with their GeneAmp PCR Systems 2400 and 9600 Both the 2400 and 9600 systems use much shorter cycling parameters and smaller thin walled tubes 0 2 ml vs 0 5 ml These systems also eliminate the need to overlay the reaction with mineral oil The following parameters for primary and secondary BD GenomeWalker PCR give good results with the standard 50 ul positive control reaction with no mineral oil overlay and the 2400 and 9600 thermal cyclers Primary PCR Step V C 9 e 7 cycles 94 C 2 sec 72 C 3 min e 32 cycles 94 C 2 sec 67 C 3 min e 67 C for an additional 4 min Secondary PCR Step V C 18 e 5 cycles 94 C 2 sec 72 C 3 min e 20 cycles 94 C 2 sec 67 C 3 min e 67 C for an additional 4 min Notes Length of denaturation time We have observed that differences of only a few seconds in the denaturation time at 94 C can dramatically affect results with the 2400 and 9600 systems For example positive control products larger than 2 3 kb were not detectable when the incubation time is increased from 2 to 5 sec The extremely short incubation time at 94 C may be necessary to preserve the integrity of the larger genomic DNA templates required for LD PCR in the BD GenomeWalker protocol Reaction volume Although the GeneAmp PCR Systems 2400 and 9600 allow
9. half the cases single major bands will be ob served with each of the four libraries The exact size of the major bands will depend on the positions of restriction sites in your gene Typically products of secondary PCR will range from 0 2 to 6 kb Fragments generated from nested gene specific primers that are less than 0 4 kb from one of the restriction sites represented in the BD GenomeWalker libraries may appear as alow molecular weight smear on a 1 5 agarose EtBr gel If this is the case with one or more of the BD GenomeWalker libraries run the particular PCR product s on a 2 agarose EtBr gel In our experience no product is observed in one or more of the libraries in approximately half the cases This is usually because the distance from the primer to the restriction site is greater than the capability of the system 6 kb This limit reflects the diminished suppression PCR effect as template size increases For more information about suppression PCR see Appendix B Targets greater than 6 kb often become indistinguishable in a smear of high molecular weight material Such smearing may also occur in lanes that do contain major bands but should not affect the major bands The absence of a major band in one or more of the libraries does not mean that products obtained with other libraries are not correct Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 19 BD GenomeWalker Universal Kit Use
10. with AP1 see Appendix B allowing a critical amount of gene specific product to accumulate The annealing extension temperature is then reduced to slightly below the primer T for the remaining PCR cycles permitting efficient exponential amplification of the gene specific prod uct As noted above we recommend using primers with Ta s greater than 68 C to allow you to use the touchdown cycling programs given in this protocol 4 Use of the positive controls In each experiment we suggest that you include a positive control in which you amplify the supplied control library using the positive control primers PCP1 and PCP 2 This will confirm that your DNA polymerase mix is functional and thermal cycling parameters are compatible with the BD GenomeWalker protocol 5 Amplify all four libraries with each set of GSPs To maximize your chances of success we recommend that you amplify all four libraries with each new gene specific primer 6 Use the recommended amounts of enzymes The enzyme amounts have been carefully optimized for the BD GenomeWalker amplification protocol and reagents BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 14 Version No PR47605 BD GenomeWalker Universal Kit User Manual V BD GenomeWalker DNA Walking continued C Procedure for PCR based DNA Walking in BD GenomeWalker Libraries The BD GenomeWalker DNA walking protocol consists of eight primary and secondary PCR amplific
11. 12 Version No PR47605 BD GenomeWalker Universal Kit User Manual V BD GenomeWalker DNA Walking A Primer Design You will need to design two gene specific primers one for primary PCR GSP1 and one for secondary PCR GSP2 The nested PCR primer should anneal to sequences beyond the 3 end of the primary PCR primer i e upstream of the primary PCR primer when walking upstream and downstream of the primary PCR primer when walking downstream Whenever possible the outer and nested primers should not overlap if overlapping primers must be used the 3 end of the nested primer should have as much unique sequence as possible In general the gene specific primers should be derived from sequences as close to the end of the known sequence as possible For walking upstream from cDNA sequence the primer should be as close to the 5 end as possible Ideally the primers should be derived from the first exon of the gene If primers are derived from downstream exons the resulting PCR products are less likely to contain the promoter particularly if the interven ing intron s and exon s comprise more than a few kb see Figure 2 Gene specific primers should be 26 30 nucleotides in length and have a GC content of 40 60 Even if the T s seem high do not design primers shorter than 26 bp At BD Biosciences Clontech we typically use 27 mers This will ensure that the primers will effectively anneal to the template at the recomme
12. 2 Polymerase Mix 50X You will need a Taq based 50X polymerase mix suitable for LD PCR Conventional PCR with a single polymerase will not produce a band in most BD GenomeWalker experiments This protocol has been optimized with the BD Advantage 2 Polymerase Mix Cat No 639201 This enzyme mix was specifically developed for PCR amplifications of genomic DNA templates of all sizes This 50X mix contains BD TITANIUM Taq DNA Polymerase a nuclease deficient N terminal deletion of Taq DNA polymerase plus BD TaqStart Antibody to provide automatic hot start PCR Kellogg et al 1994 and a minor amount of a proofreading polymerase BD Advantage 2 Polymerase Mix is also available in the BD Advantage 2 PCR Kit Cat No 639206 BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 8 Version No PR47605 BD GenomeWalker Universal Kit User Manual lll Additional Materials Required continued BD TaqStart Antibody Cat No 639250 If you are not using BD Advantage 2 Polymerase Mix we strongly recom mend that you use some form of hot start in BD GenomeWalker PCR To do this simply include BD TaqStart Antibody in the 50X polymerase mix see PT1576 1 available at www bdbiosciences com clontech BD TaqStart Antibody is included in BD Advantage 2 Polymerase Mix This antibody is an effective method for hot start PCR that is simpler and more convenient than wax based or manual methods The BD TaqStart Antibody binds t
13. BD GenomeWalker Universal Kit User Manual Cat No 638904 PT3042 1 PR47605 Published 23 August 2004 BD GenomeWalker Universal Kit User Manual Table of Contents I Introduction 3 ll List of Components 7 Ill Additional Materials Required 8 IV Construction of BD GenomeWalker Libraries 10 A General Considerations 10 B Quality of Genomic DNA 10 C Digestion of Genomic DNA 11 D Purification of DNA 11 E Ligation of Genomic DNA to BD GenomeWalker Adaptors 12 V BD GenomeWalker DNA Walking 13 A Primer Design 13 B General Considerations 13 C Procedure for PCR based DNA Walking 15 VI Expected Results and Troubleshooting Guide 19 VII Suggestions for Characterizing BD GenomeWalker Products 22 Vill References 26 IX Related Products 27 Appendix A Sequences of the Positive Control Primers 28 Appendix B Design of the BD GenomeWalker Adaptor 28 Appendix C Parameters for GeneAmp Systems 2400 amp 9600 30 List of Figures Figure 1 Flow chart of the BD GenomeWalker protocol 4 Figure 2 Map of the human tissue type plasminogen activator tPA locus and results of primary and secondary BD GenomeWalker PCR using tPA primers 5 Figure 3 Structure of the BD GenomeWalker adaptor and adaptor primers 8 Figure 4 Simple restriction mapping of BD GenomeWalker PCR products from the human tPA locus 22 Figure 5 The suppression PCR effect 29 BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 Versio
14. DNA If this is the case repeat to ensure that digestion is complete Normally if the DNA is completely digested a single major band should be observed after secondary PCR However multiple bands may result from the species used e g some plants are multiploid or from genes that belong to multi gene families Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 21 BD GenomeWalker Universal Kit User Manual VII Suggestions for Characterizing BD GenomeWalker Products A Restriction Mapping of BD GenomeWalker PCR Products BD GenomeWalker PCR products are generally clean enough to allow simple restriction mapping without cloning An example of such an experi ment is shown in Figure 4 _ tPA2 Pvu ll BamH lt tPAI L T T T T T Ssp EcoRV Pvull Dral Exon 18K i FOR y Library 0 9 kb i Dra Library 1 5 kb 3 Pvu II Library 3 9 kb a Ssp Library Restriction digests PCR products Bamu Pvu Il l i DN SN VY NN ANSAN SO SS SY FS o D m L LAA m m DLL Pye VeXy Teea mo oo 0 5 Figure 4 Simple restriction mapping of BD GenomeWalker PCR products from the human tPA locus The map shows the positions of the relevant restriction sites in the genomic DNA and in the predicted BD GenomeWalker PCR products The gel on the left shows the products of BD GenomeWalker PCR The gel on the right shows the pattern of restriction fragments generate
15. Mix Step V C 2 Add the DMSO to the Master Mix last Note You will need to perform more cycles in the presence of DMSO For the primary PCR perform 36 cycles instead of 32 for the secondary PCR perform 24 cycles If this fails repeat again using a final concentration of 6 DMSO and 3 glycerol in primary and secondary PCR If neither DMSO concentration solves the problem try increasing the temperature to 99 C for five seconds at the beginning of the first cycle 4 Nonspecific PCR products observed with your gene specific primers Generally the simplified touchdown PCR cycling program suggested in this protocol can significantly improve BD GenomeWalker results by increasing specificity However if you still observe nonspecific prod ucts the following methods may help a If possible redesign your GSPs to have T s greater than 70 C For this purpose GSPs should be 26 30 bp in length with a GC content of 40 60 Do not design primers shorter than 26 bp b If it is impossible to redesign your GSPs try a touchdown PCR cycling program For primary PCR start with an annealing tempera ture of 72 C and decrease it by 1 C every second cycle to a touchdown at 67 C Keep the annealing temperature at 67 C for the remaining 32 cycles For secondary PCR follow the same procedure but use only 20 cycles after the annealing temperature reaches 67 C c The problem may result from incomplete restriction digestion of your
16. ainwright B J Baker K amp Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Freier S M Kierzek R Jaeger J A Sugimoto N Caruthers M H Neilson T amp Tumer D H 1986 Improved free energy parameters for predictions of RNA duplex stability Proc Natl Acad Sci USA 83 9373 9377 Friezner Degen S J Rajput B amp Reich E 1986 Structure of the human tissue type plasminogen activator gene J Biol Chem 261 6972 6985 Hecker K H amp Roux K H 1996 High and low annealing temperatures increase both specificity and yield in touchdown and stepdown PCR BioTechniques 20 478 485 Kellogg D E Rybalkin l Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hotstart PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase BioTechniques 16 1134 1137 Kitts P Adams M Kondepudi A Gallagher D amp Kain S January 1995 Green fluorescent protein A novel reporter for monitoring gene expression in living cells and organisms Clontechniques X 1 1 3 Living Colors Enhanced GFP Vectors April 1996 Clontechniques XI 2 2 3 Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods Appl 4 5185 5194 Sambrook J Fritsch E F amp Maniatis T 1987 Molecular Cloning A Laboratory Manual Second Edition Cold Spring Harbor Laborat
17. at corrects misincorporated nucleotides In the BD GenomeWalker protocol the use of LD PCR extends the range of possible PCR products to about 6 kb The precise reason for the upper limit on BD GenomeWalker products is not clear It may be due to the loss of the suppression PCR effect see Appendix B As discussed in Section Ill we recommend our BD Advantage 2 Polymerase Mix Cat No 639201 BD Advantage 2 Polymerase Mix is available separately and in the BD Advantage 2 PCR Kit Cat No 639206 Applications The BD GenomeWalker Universal Kit enables researchers to create uncloned libraries for walking by PCR in any genomic DNA In less than a week the method provides access to the genomic DNA sequences adjacent to a known DNA sequence in any species Using both the BD SMART RACE cDNA Amplifica tion Kit Cat No 634914 and the BD GenomeWalker Universal Kit you can clone full length cDNAs and the surrounding genomic sequences without ever screening a library In addition to obtaining promoters BD GenomeWalker DNA walking can also be used to map intron exon junctions and to walk bidirectionally from any sequence tagged site STS or expressed sequence tag EST Although individual steps are limited to about 6 kb multiple steps can be strung together to create longer walks Consequently this method is useful for filling in gaps in genome maps particularly when the missing clones have been difficult to obtain by conventional li
18. ations four experimental libraries two positive controls BD GenomeWalker Human Positive Control Library and one positive control library constructed from Control Human Genomic DNA and two negative controls without templates For both positive controls use the positive control gene specific primers PCP1 and PCP2 provided For primary PCR use 1 ul of each library For secondary PCR use 1 ul of a 50X dilution of the primary PCR product All BD GenomeWalker PCR steps have been optimized with the BD Advantage 2 Polymerase Mix which includes BD TaqStart Antibody for automatic hot start PCR 1 Label the 0 5 ml PCR tubes For convenience we suggest using the plan in Table GSP1 and GSP2 indicate your gene specific primers TABLE SUGGESTED LABELING PLAN DNA 1 PCR 2 PCR Library DL Tube No Primers Tube No Primers DL 1 1A GSP1 amp AP1 1B GSP2 amp AP2 DL 2 2A i 2B DL 3 3A y 3B DL 4 4A 4B Negative control No 1 None 5A i 5B Positive control No 1 Control library 6A PCP1 amp AP14 6B PCP2 amp AP2 Negative control No 2 None 7A a 7B Positive control No 2 Pre constructed control library 8A i 8B i Primer contained in primary PCR master mix Primer contained in secondary PCR master mix Positive control for library construction You construct this library from the 3 control human genomic DNA provided in the kit see Section IV Positive control for PCR This preconstructed library is
19. brary screening methods In all applications BD GenomeWalker PCR products are generally pure enough to allow restriction mapping without cloning Nevertheless a discussion of cloning PCR products and testing them for promoter activity is included at the end of this manual BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 6 Version No PR47605 BD GenomeWalker Universal Kit User Manual ll List of Components Store human genomic DNA at 4 C all other components at 20 C Note These reagents are sufficient for constructing three sets of four BD GenomeWalker libraries Each construction is enough for 80 reactions e Restriction enzymes and buffers 30 100 25 50 50 100 25 50 e 75 e 10 e 40 36 250 250 e 10 50 50 Protocol No PT3042 1 Version No PR47605 ul ul ul Dra 10 units ul 10X Dra Restriction Buffer EcoR V 10 units ul 10X EcoR V Restriction Buffer Pvu II 10 units ul 10X Pvu Il Restriction Buffer Stu 10 units ul 10X Stu Restriction Buffer Control Human Genomic DNA 0 1 ug ul T4 DNA Ligase 6 units ul 10X Ligation Buffer BD GenomeWalker Adaptor 25 uM Adaptor Primer 1 AP1 10 uM Nested Adaptor Primer 2 AP2 10 uM See Figure 3 on the next page for the sequences of AP1 amp AP2 BD GenomeWalker Human Positive Control Library Positive Control tPA Primer PCP1 10 uM Positive Control tPA Nested Primer PCP2 10 uM See Ap
20. d by digestions of each PCR product with either BamH or Pvu Il Lane M DNA size markers BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 Version No PR47605 BD GenomeWalker Universal Kit User Manual VII Suggestions for Characterizing Products continued B Cloning BD GenomeWalker Products and Testing for Promoter Activity 1 Cloning BD GenomeWalker products Once you have obtained major bands using your gene specific primer you will usually want to clone the fragments into a general purpose cloning vector using restriction sites or into a TA type cloning vector using the A overhang left by Taq DNA polymerase In some cases you may wish to clone directly into a promoter reporter vector See Section B 3 below If your secondary PCR produces a single major band with little background and no minor bands you may be able to clone the fragment directly If the product of your secondary reaction has significant background you will need to gel purify the desired band We recom mend either the NucleoSpin Extract Kit Cat No 635960 or 635961 or the NucleoTrap Gel Extraction Kit Cat No 636018 for gel purifying PCR products Note on TAE vs TBE gels We recommend that you use Tris Acetate EDTA TAE buffer instead of Tris Borate EDTA TBE buffer in your agarose gels when purifying DNA fragments for cloning In our expe rience DNA purified from TBE gels is more difficult to clone than DNA purifi
21. e BD SMART RACE cDNA Amplification Kit 634914 e BD Clontech PCR Select cDNA Subtraction Kit 637401 e BD Delta Differential Display Kit 637405 e NucleoTrap Gel Extraction Kit 636018 e NucleoSpin Extract Kit 635960 635961 Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 27 BD GenomeWalker Universal Kit User Manual Appendix A Sequence of the Positive Control Primers The positive control primers in the BD GenomeWalker Universal Kit are derived from exon 1 of the tissue type plasminogen activator tPA cDNA PCP1 tPA1 5 AGA AAC CCG ACC TAC CAC GGC TTG CTC CTT 3 PCP2 tPA2 5 CCC TTT CCT CGC AGA GGT TTT CTC TCC AGC 3 Appendix B Design of the BD GenomeWalker Adaptor The BD GenomeWalker Adaptor has three design features that are critical to the success of BD GenomeWalker DNA walking These features which can be seen schematically in Figure 1 in the Introduction are as follows 1 The use of a5 extended adaptor that has no binding site for the AP1 primer used in primary PCR An AP1 binding site can only be generated by extension of the gene specific primer 2 Blocking of the exposed 3 end of the adaptor with an amine group to prevent extension of the 3 end which would create an AP1 binding site 3 The use of an adaptor primer that is shorter than the adaptor itself suppression PCR As shown in Figure 5 the suppression PCR effect prevents ampli
22. e final cycle Note Do not use a three step cycling program e g 95 C melting 60 C annealing 68 C extension See Appendix C for cycling parameters for GeneAmp PCR Systems 2400 and 9600 BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 16 Version No PR47605 BD GenomeWalker Universal Kit User Manual V BD GenomeWalker DNA Walking continued 10 Analyze 5 ul of the primary PCR products on a 1 5 agarose EtBr gel along with DNA size markers such as a 1 kb ladder If you do not see any product perform five additional cycles Expected results of primary PCR In all lanes except for negative controls you should observe your predicted banding patterns Be aware however that there may be smearing in some lanes and you may observe a multiple banding pattern ranging in size from about 500 bp to 5 kb See Figure 2 in the Introduction Section for a sample gel showing products of primary PCR If you obtain any bands or smearing with your gene specific primer continue with secondary PCR as described in Steps 11 19 even if your products are weaker than the positive control or the bands in Figure 2 If you do not observe any product or smear with your gene specific primers consult the Troubleshooting Guide Section VI 11 Using a clean 0 5 ml tube for each sample dilute 1 ul of each primary PCR including positive and negative controls into 49 ul of deionized H O 12 Prepare asecondary PCR mast
23. e primer and the upstream restriction site is greater than the capability of the system N Amine group that blocks extension of the 3 end of the adaptor ligated genomic fragments AP Adaptor primers GSP Gene specific primers BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 Version No PR47605 BD GenomeWalker Universal Kit User Manual l Introduction continued Map of tPA locus and expected PCR products tPA2 Presumed promoter p 400 bp P iinn 7 tPA1 T Pvu Il Exon I 1 5 kb m Pl Library Gel of primary PCR products Gel of secondary PCR products M Pvull M Pvull Figure 2 Map of the human tissue type plasminogen activator tPA locus Friezner Degen et al 1986 and results of primary and secondary BD GenomeWalker PCR using tPA primers Primary and secondary nested PCR was performed using BD Advantage 2 Polymerase Mix and the cycling parameters described in the protocol The tPA primers used in this experiment are the positive control primers PCP1 and PCP2 provided with the kit Lane M 1 kb ladder of DNA size markers Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 5 BD GenomeWalker Universal Kit User Manual l Introduction continued PCR amplification Most of the extension is carried out by a primary polymerase while a secondary polymerase provides the critical 3 gt 5 exonuclease or editing function th
24. e up front fee component may be purchased from Applied Biosystems or obtained by purchasing an Authorized Thermal Cycler No right to perform of offer commercial services of any kind using PCR including without limitation reporting the results of purchaser s activities for a fee or other commercial consideration is hereby granted by implication or estoppel Further information on purchasing licenses to practice the PCR Process may be obtained by contacting the Director of Licensing at Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 or the Licensing Department at Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda California 94501 Suppression PCR is covered by U S Patent No 5 565 340 Foreign patents pending GeneAmp and AmpliTaq are registered trademarks of Roche Molecular Systems Inc licensed to the Perkin Elmer Corporation NucleoTrap and NucleoSpin are registered trademarks of MACHEREY NAGEL GmbH and Co KG BD BD Logo and all other trademarks are property of Becton Dickinson and Company Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 31
25. ech Version No PR47605 9 BD GenomeWalker Universal Kit User Manual IV Construction of BD GenomeWalker Libraries A General Considerations 1 Construction of BD GenomeWalker DNA libraries should begin with very clean high molecular weight genomic DNA This requires a higher quality preparation than the minimum suitable for Southern blotting or conventional PCR Isolation procedures for genomic DNA canbe found in various reference manuals e g Ausubel et a 1994 Sambrook et al 1987 however keep in mind that methods vary for different species To ensure that your genomic DNA is of adequate quality follow the procedure described in Section IV B 2 Work in an area away from all PCR products Use only equipment that is not exposed to PCR products 3 For PCR use only deionized H O Milli Q or equivalent Do not use DEPC treated or autoclaved H O 4 Human genomic DNA and positive control gene specific primers PCP 1 and PCP 2 are provided to test the system They are designed to walk upstream from exon of the human tissue type plasminogen activator gene 5 The following protocol is designed for the construction of four libraries from experimental genomic DNA and one Pvu II library from positive control human genomic DNA provided in kit B Quality of Genomic DNA 1 Check the size of genomic DNA on a 0 5 agarose EtBr gel Load 1 ul of experimental genomic DNA 0 1 ug ul and 1 ul of control genomic DNA 0
26. ed from TAE gels Note on EtBr and UV damage to DNA Minimize the exposure of your DNA to UV light 2 Sequencing and scanning for regulatory elements Prior to testing BD GenomeWalker products for promoter activity most researchers will want to sequence at least part of their clones and look for common regulatory sequence motifs such as promoters or enhancers 3 Testing for promoter activity BD GenomeWalker products can be clonedinto a promoter reporter vector to test for the presence of a promoter Cloning in both orientations will provide a positive and negative control Suitable promoter cloning vectors from BD Biosciences Clontech include the following e pSEAP2 Basic is sold separately Cat No 631715 and as a component in the chemiluminescent BD Great EscAPe SEAP Reporter System 3 Cat No 631 706 Yang etal 1994 This kitalso includes pSEAP2 Control and reagents necessary for 100 chemi luminescent assays The reporter molecule in the BD Great EscAPe system is a secreted form of alkaline phosphatase SEAP which can be conveniently measured directly in the culture medium using a sensitive chemiluminescent assay Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 23 BD GenomeWalker Universal Kit User Manual VII Suggestions for Characterizing Products continued pfgal Basic is sold separately Cat No 631707 and as a compo nent in the Luminescent B gal Reporter System 3
27. er mix for all eight reactions plus one additional tube Combine the following reagents in an 0 5 ml tube 9rxns sper rxn 360 ul 40 ul deionized H O 45 ul 5 ul 10X BD Advantage 2 PCR buffer 9 ul 1 ul dNTP 10 mM each 9 ul 1 ul AP2 10 uM 9 ul 1 ul BD Advantage 2 Polymerase Mix 50X 432 ul 48 ul Total volume Mix well by vortexing without introducing bubbles and briefly spin the tube in a microcentrifuge 13 Add 48 ul of the secondary PCR master mix to the appropriately labeled tubes Table l 14 For reactions 1B through 5B add 1 ul of GSP2 to each tube For reactions 6B through 8B add 1 ul of PCP2 to each tube 15 Add 1 ul of each diluted primary PCR product from Step 11 to the appropriately labeled tubes Be sure to include the positive and negative controls 16 Overlay the contents of each tube with one drop of mineral oil and place caps firmly on tubes 17 Briefly spin tubes in a microcentrifuge Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 17 BD GenomeWalker Universal Kit User Manual V BD GenomeWalker DNA Walking continued 18 Commence cycling in a DNA Thermal Cycler 480 PE Biosystems using the following two step cycle parameters e 5 cycles 94 C 72 C e 20 cycles 94 C 67 C 25 sec 3 min 25 sec 3 min e 67 C for an additional 7 min after the final cycle Note Do not use a three step cycling program e g 95 C melting 60
28. fication of templates where the 3 end has been extended to create an AP1 binding site Though rare such extension does occur presumably due to incomplete amine modification or incomplete adaptor ligation Given the exponential nature of PCR amplification such events would lead to nonspecific amplification and unacceptable backgrounds in the absence of suppression PCR Each of these features helps eliminate nonspecific amplification among the general population of DNA fragments In combination with touchdown PCR and nested PCR these innovations allow amplification of a specific target from a very complex mixture of DNA fragments all of which have the same terminal structure using a single set of gene specific primers Of the three features suppression PCR is the most critical Siebert et al 1995 BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 28 Version No PR47605 BD GenomeWalker Universal Kit User Manual Appendix B Design of the BD GenomeWalker Adaptor cont e On rare occasions the 3 end of the BD GenomeWalker Adaptor is extended creating a template with the full adaptor sequence on both ends e Melt at 95 C e Anneal at 68 C API Suppression PCR No primer binding panhandle structure suppresses PCR e DNA synthesis ane Even when the adaptor is extended very little f
29. included in the kit Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 15 BD GenomeWalker Universal Kit User Manual V BD GenomeWalker DNA Walking continued 2 Prepare enough primary PCR master mix for all eight reactions plus one additional tube Combine the following reagents in an 0 5 ml tube 9 rxns per rxn 360 ul 40 ul deionized H O 45 ul 5 ul 10X BD Advantage 2 PCR Buffer 9 ul 1 ul dNTP 10 mM each 9 ul 1 ul AP1 10 uM 9 ul 1 ul BD Advantage 2 Polymerase Mix 50X 432 ul 48 ul Total volume Mix well by vortexing without introducing bubbles and briefly spin the tube in a microcentrifuge 3 Add 48 ul of the primary PCR master mix to the appropriately labeled tubes 4 For reactions 1A through 5A add 1 ul of GSP1 to each tube For reactions 6A through 8A add 1 ul of PCP1 to each tube 5 Add 1 ulof each DNA library including the positive control library to the appropriately labeled tubes Do not add any library DNA to the negative control 6 Add 1 ul of H O to each negative control 7 Overlay the contents of each tube with one drop of mineral oil and place caps firmly on tubes 8 Briefly spin tubes in a microcentrifuge 9 Commence cycling in a DNA Thermal Cycler 480 PE Biosystems using the following two step cycle parameters e 7 cycles 94 C 25 sec 72 C 3min e 32 cycles 94 C 25 sec 67 C 3min e 67 C for an additional 7 min after th
30. n No PR47605 BD GenomeWalker Universal Kit User Manual l Introduction BD GenomeWalker DNA walking is a simple method for finding unknown genomic DNA sequences adjacent to a known sequence such as a cDNA Siebert et al 1995 BD GenomeWalker Kits Cat Nos 638901 638902 and 638903 are available for human mouse and rat genomes respectively however researchers who are interested in other species need a more general approach The BD GenomeWalker Universal Kit is designed with this in mind enabling researchers to apply this powerful method of DNA walking to the species of their choice Using your genomic DNA of interest the first step is to construct pools of uncloned adaptor ligated genomic DNA fragments which are referred to for convenience as BD GenomeWalker libraries The starting DNA must be very clean and have a high average molecular weight requiring a higher quality preparation than the minimum suitable for Southern blotting or conventional PCR To ensure that your genomic DNA is of adequate quality the kit includes controls for comparison Separate aliquots of DNA are completely digested with different restriction enzymes that leave blunt ends The BD GenomeWalker Universal Kit comes with a set of four restriction enzymes however alternative restriction enzymes that leave blunt ends may be substituted Each batch of digested genomic DNA is then ligated separately to the BD GenomeWalker Adaptor After
31. nded annealing and extension temperature of 67 C Primers should not be able to fold back and form intramolecular hydrogen bonds and sequences at the 3 end of your primers should not be able to anneal to the 3 end of the adaptor primers There should be no more than three G s and C s in the last six positions at the 3 end of the primer Five restriction sites have been incorporated into the BD GenomeWalker Adaptor Sal cohesive ends Miu cohesive ends and overlapping Srf cohesive ends Sma blunt ends and Xma cohesive ends sites The sites in the Adaptor Primer allow easy insertion of PCR products into commonly used promoter reporter vectors If you wish to use other restriction sites to clone the resulting PCR products suitable sites should also be designed into the 5 end of GSP2 i e the nested gene specific primer used for secondary PCR Alternatively BD GenomeWalker PCR products can be cloned into a general purpose cloning vector using restriction sites or into a TA type cloning vector using the A overhang left by7Taq DNA polymerase See Section VII B 3 for a discussion of our various promoter cloning reporter vectors and reporter assay systems B General Considerations 1 Cycling parameters The cycling parameters in this protocol have been optimized using the PE Biosystems DNA Thermal Cycler 480 BD Advantage 2 Poly merase Mix and the reagents and positive control primers provided in Protocol No
32. o and inactivates Taq DNA polymerase and thus eliminates DNA synthesis from nonspecifically bound primers while reactions are being assembled PCR amplification proceeds efficiently after an initial 1 min incubation at 94 C which irreversibly inactivates the BD TagStart Antibody See Kellogg et al 1994 for adiscussion of hot start PCR with inactivating antibodies Hot start with wax beads Chou et al 1992 or manual hot start D aquila ef al 1991 can also be used 10X PCR reaction buffer If you are using a DNA polymerase mix other than BD Advantage 2 Polymerase Mix use the PCR reaction buffer provided with the enzyme mix dNTP mix 10 mM each of dATP dCTP dGTP amp dTTP Store at 20 C 0 5 ml PCR tubes We recommend GeneAmp 0 5 ml PCR Reaction Tubes PE Biosystems Cat No N801 0737 or N801 0180 Deionized H O Milli Q filtered or equivalent 1 kb ladder of DNA size markers The following product is not required but recommended BD Advantage 2 PCR Kit Cat No 639206 or 639207 30 rxns 100 rxns 30 ul 100 ul 50X BD Advantage 2 Polymerase Mix 200 ul 600ul 10X BD Advantage 2 PCR Buffer 200 ul 600ul 10X BD Advantage 2 SA PCR Buffer 50 ul 120 ul 50X dNTP Mix 10 mM each 30 ul 100u l Control DNA Template 100 ng ul 30 ul 100ul Control Primer Mix 10 uM 2 5ml 5 0ml PCR Grade Water User Manual PT3281 1 Protocol at a Glance PT3281 2 Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clont
33. or both the PCR positive control and the library control but no product observed with your gene specific primers a b Try decreasing the temperature for annealing and extension to 65 C or lower Check the design of your primers If the positive control PCP primers produce the expected PCR products but your gene specific primers do not produce major PCR products with any of the libraries you will probably need to redesign your primers If your primer sequence was derived from cDNA sequence information the primary or secondary PCR primer may cross an exon intron junction If this is the case it will be necessary to redesign one or both gene specific primers Remember that all primers should be able to anneal efficiently at 70 C i e have a Tm 70 C If you are sure your primers do not cross intron exon boundaries recheck the sequence of your primers In some instances primers will fail to produce any products due to a mistake in primer design or synthesis BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 20 Version No PR47605 BD GenomeWalker Universal Kit User Manual VI Expected Results and Troubleshooting Guide continued c Your target template may have a high GC content Such templates are difficult to amplify Repeat your experiment using a final concen tration of 5 DMSO in primary and secondary PCR For each PCR add 2 5 ul of DMSO and only 37 5 ul of deionized H O to the Master
34. ory Cold Spring Harbor NY Siebert P D Chenchik A Kellogg D E Lukyanov K A amp Lukyanov S A 1995 An improved method for walking in uncloned genomic DNA Nucleic Acids Res 23 1087 1088 Sinai P Kondepudi A Yang T Adams M Kitts P amp Kain S October 1994 The Luminescent 6 Gal chemiluminescent assay for B galactosidase Application to the analysis of cis regulatory elements Clontechniques IX 4 1 4 Yang T Kondepudi A Adams M Kitts P amp Kain S July 1994 Quantitative detection of specific gene regulation with the Great EscAPe secreted alkaline phosphatase Genetic Reporter System Clontechniques 1X 3 1 5 BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 Version No PR47605 BD GenomeWalker Universal Kit User Manual IX Related Products For a complete listing of all BD Biosciences Clontech products please visit www bdbiosciences com clontech Cat No e BD GenomeWalker Kits Human 638901 Mouse 638902 Rat 638903 e BD Advantage 2 PCR Kit 639206 639207 e BD Advantage 2 Polymerase Mix 639201 e BD TaqgStart Antibody 639250 e BD Great EscAPe SEAP2 Reporter System 3 631706 Includes two vectors listed below pSEAP2 Basic Vector 631715 pSEAP2 Control Vector 631717 e Luminescent gal Reporter System 3 631713 Includes two vectors listed below ppgal Basic Vector 631707 pBgal Control Vector 631709 e pEGFP 1 Promoter Reporter Vector 632319
35. pendix A for the sequences of the positive control primers supplied with the kit www bdbiosciences com BD Biosciences Clontech 7 BD GenomeWalker Universal Kit User Manual ll List of Components continued BD GenomeWalker Adaptor Srfl Mul Sall Smal Xma 5 GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT 3 l 3 H N CCCGACCA P0 5 Adaptor Primer 1 AP1 22 mer Nested Adaptor Primer 2 AP2 19 mer 5 GTAATACGACTCACTATAGGGC 3 5 ACTATAGGGCACGCGTGGT 3 Figure 3 Structure of the BD GenomeWalker adaptor and adaptor primers The adaptor is ligated to both ends of the genomic DNA fragments to create BD GenomeWalker libraries The amine group on the lower strand of the adaptor blocks extension of the 3 end of the adaptor ligated genomic fragments and thus prevents formation of an AP1 binding site on the general population of fragments The design of the adaptor and adaptor primers is critical for the suppression PCR effect Figure 5 The T s of AP1 and AP2 are 59 C and 71 C determined by nearest neighbor analysis Freier et al 1986 lll Additional Materials Required The following reagents are required but not supplied e Phenol e Chloroform e Glycogen 10 ug ul e 3Msodium acetate e 95 ethanol e 80 ethanol e TE 10 mM Tris 0 1 mM EDTA 10 0 1 pH 7 5 e TE 10 mM Tris 1 mM EDTA 10 1 pH 7 5 0 5X TBE buffer or TAE buffer See Note in Section VII B 1 BD Advantage
36. r Manual VI Expected Results and Troubleshooting Guide continued B Troubleshooting Guide 1 No products with the positive control primers even after increasing the number of primary cycles from 32 to 37 a b C Reduce all annealing extension temperatures by 2 C i e 72 C to 70 C and 67 C to 65 C Reduce the length of the incubation at 94 C Check your 50X polymerase mix by PCR using two specific primers and a 1 10 kb template that has previously been successful 2 Expected products observed with positive control primers but no product observed either from library positive control or from your experimental libraries a Check the ligation step If the PCR positive control produces the expected PCR product but the control library and your experimen tal libraries do not it is probably due to failure of your ligation In this case repeat the adaptor DNA ligation step Check the digestion and purification steps The DNA concentration should be the same before and after phenol chloroform extraction Run samples of the DNA on an agarose gel before and after purification If the intensity of EtBr staining is two fold less after purification you should concentrate the DNA This can be accom plished either by ethanol precipitation or placing tubes in a rotating evaporator e g Savant SpeedVac and resuspending the DNA in a lower volume 3 Expected products observed with positive control primers f
37. stance PCR LD PCR Barnes 1994 Cheng et al 1994 In LD PCR a combination of two thermostable DNA polymerases is used to increase the range and accuracy of Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 3 BD GenomeWalker Universal Kit User Manual l Introduction continued Genomic DNA DSO OOM e Digest separate aliquots with restriction enzymes e Ligate to GenomeWalker Adaptor Amplify gene of interest from all four libraries Genomic DNA fragment GSP2 fs Ma GSP1 ii bar len AP1 e AP2 BD GenomeWalker Adaptor Pik Primary PCR v r AP2 Secondary or nested PCR E Examine products on y an agarose EtBr gel M 1 2 34M e Clone amp characterize major PCR products e Test for promoter activity by cloning into reporter vector Figure 1 Flow chart of the BD GenomeWalker protocol The gel shows a typical result generated by walking with BD GenomeWalker human libraries and gene specific primers Lane 1 EcoR V Library Lane 2 Dra Library Lane 3 Pvu II Library Lane 4 Ssp Library Lane M DNA size markers The absence of a major product in one of the libraries is not unusual In our experience there is no major band in one or more lanes in approximately half of the BD GenomeWalker experiments As explained in the Expected Results and Troubleshooting Guide Section VI this is usually because the distance between th
38. the libraries have been constructed the protocol takes just two days and consists of two PCR amplifications per library Figure 1 The first or primary PCR uses the outer adaptor primer AP1 provided in the kit and an outer gene specific primer GSP1 provided by the researcher The primary PCR mixture is then diluted and used as a template for a secondary or nested PCR with the nested adaptor primer AP2 and a nested gene specific primer GSP2 This generally produces a single major PCR product from at least three of the four libraries and often in all four Figure 1 Each of the DNA fragments which begin inaknown sequence atthe 5 end of GSP2 and extend into the unknown adjacent genomic DNA can then be cloned and further analyzed The kit also provides human genomic DNA to be used as a positive control for library construction as well as a preconstructed BD GenomeWalker human library as a positive control for PCR Figure 2 shows typical results of primary and secondary PCR with these positive controls Amplification of the Pvu Il BD GenomeWalker human library with the adaptor primers and primers derived from exon 1 of the human tissue type plasminogen activator tPA gene PCP1 and PCP2 should generate a single major product 1 5 kb in length Long distance PCR with the BD Advantage 2 PCR Kit BD GenomeWalker reactions should be performed with a 50X polymerase mix containing a combination of DNA polymerases suitable for long di
39. ul Genomic DNA 0 1 ug ul 8 ul Restriction enzyme 10 units ul 10 ul Restriction enzyme buffer 10X 57 ul Deionized H O Mix gently by inverting tube Do not vortex Vigorous mixing will shear genomic DNA 3 Incubate at 37 C for 2 hr 4 Vortex the reaction at slow speed for 5 10 sec Return to 37 C overnight 16 18 hr 5 From each reaction tube remove 5 ul and run on a 0 5 agarose EtBr gel to determine whether digestion is complete You may wish to save an additional aliquot of each sample to run on the gel used in Step D 17 see below D Purification of DNA 1 To each reaction tube add an equal volume 95 ul of phenol 2 Vortex at slow speed for 5 10 sec 3 Spin briefly to separate the aqueous and organic phases 4 Using a pipet transfer the upper aqueous layer into a fresh 1 5 ml tube Discard the lower organic layer properly into the chlorinated hazardous waste To each tube add an equal volume 95 ul of chloroform Vortex at slow speed for 5 10 sec Spin briefly to separate the aqueous and organic phases Using a pipet transfer the upper aqueous layer into a fresh 1 5 ml tube Discard the lower organic layer properly into the chlorinated hazardous waste 9 To each tube add 2 volumes 190 ul of ice cold 95 ethanol 1 10 volume 9 5 ul of 3 M NaOAc pH 4 5 and 20 ug of glycogen 10 Vortex at slow speed for 5 10 sec 11 Centrifuge at 15 000 rpm for 10 min 12 Decant s
40. ull length amplification occurs Figure 5 The suppression PCR effect In rare cases the 3 end of the BD GenomeWalker Adaptor gets extended Though rare such extension does occur presumably due to incomplete amine modification during oligonucleotide synthesis or incomplete adaptor ligation This creates a molecule that has the full length adaptor sequence on both ends and can serve as a template for end to end amplification Without suppression PCR these rare events would lead to unacceptable backgrounds due to the exponential nature of PCR amplification However in suppression PCR the adaptor primer is much shorter than the adaptor itself Thus during subsequent thermal cycling nearly all the DNA strands will form the panhandle structure shown above which cannot be extended At the appropriate annealing extension temperature this intramolecular annealing event is strongly favored over and more stable than the intermolecular annealing of the much shorter adaptor primer to the adaptor The suppression PCR effect will be reduced or lost if you use an annealing temperature lower than 60 65 C The upper limit of the suppression PCR effect is about 6 kb Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 29 BD GenomeWalker Universal Kit User Manual Appendix C Parameters for GeneAmp Systems 2400 amp 9600 As noted elsewhere in this manual cycling parameters may have to be optimized
41. upernatant and wash pellet in 100 ul of ice cold 80 ethanol CON OD oO Protocol No PT3042 1 www bdbiosciences com BD Biosciences Clontech Version No PR47605 11 BD GenomeWalker Universal Kit User Manual IV Construction of BD GenomeWalker Libraries continued 13 Centrifuge at 15 000 rpm for 5 min 14 Decant supernatant and air dry the pellet 15 Dissolve pellet in 20 ul of TE 10 0 1 pH 7 5 16 Vortex at slow speed for 5 10 sec 17 From each reaction tube remove 1 ul and run on a 0 5 agarose EtBr gel to determine the approximate quantity of DNA after purification E Ligation of Genomic DNA to BD GenomeWalker Adaptors For each library construction you should set up a total of five ligation reactions You will have four blunt end digestions of your experimental genomic DNA and one positive control Pvu Il digestion of human genomic DNA 1 From each tube transfer 4 ul of digested purified DNA to a fresh 0 5 ml tube To each add the following 1 9 ul BD GenomeWalker Adaptor 25 uM 1 6 ul 10X Ligation Buffer 0 5 ul T4DNA Ligase 6 units ul 2 Incubate at 16 C overnight Note A PCR thermal cycler holds a very constant temperature and is recommended in place of a water bath for this reaction 3 To stop the reactions incubate at 70 C for 5 min To each tube add 72 ul of TE 10 1 pH 7 5 5 Vortex at slow speed for 10 15 sec A BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1
42. you to reduce the reaction volumes in many applications we have not optimized the BD GenomeWalker protocol for lower reaction volumes BD Biosciences Clontech www bdbiosciences com Protocol No PT3042 1 Version No PR47605 BD GenomeWalker Universal Kit User Manual Notes Notice to Purchaser This product is intended to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use BD Biosciences Clontech products may not be resold modified for resale or used to manufacture commercial products without written approval of BD Biosciences Clontech A license under U S Patent Nos 4 683 202 4 683 195 4 965 188 and 5 075 216 or their foreign counterparts owned by Roche Molecular Systems Inc and F Hoffmann La Roche Ltd Roche has an up front fee component and arunning royalty component The purchase price of this product includes limited nontransferable rights under the running royalty component to use only this amount of the product to practice the Polymerase Chain Reaction PCR and related processes described in said patents solely for the research and development activities of the purchaser when this product is used in conjunction with a thermal cycler whose use is covered by the up front fee component Rights to the up front fee component must be obtained by the end user in order to have a complete license to use this product in the PCR process These rights under th
Download Pdf Manuals
Related Search