3/3 10K~20K Online UPS
Contents
1. ETPASS se ee i Indicates the output is working E e JE m Battery information Indicates the Battery capacity by 0 25 26 50 51 75 and 76 100 ck Low BATT Indicates low battery level and low battery voltage Vac Input voltage Vdc battery voltage Hz input frequency 1 lapora LA ON33 3 3 Audible Alarm Description Buzzerstatus Muted UPS status Bypass mode Beeping once every 2 minutes Battery mode Beeping once every 4 seconds Yes Fault mode Beeping continuously Warning Beeping twice every second Beeping once every second All Continuously beeping Yes 3 4 Single UPS Operation 1 Turn on the UPS with utility power supply in AC mode 1 After power supply is connected correctly set the breaker of the battery pack at ON position this step is only available for long run model Then set the input breaker at ON position for dual input unit also set the bypass input breaker at At this time the fan is running and the UPS enters to power on mode for initialization several seconds later UPS operates in Bypass mode and supplies power to the loads via the bypass The UPS is operating in Bypass mode NOTE When UPS is in Bypass mode the output voltage will directly power from utility after you switch on the input breaker In Bypass mode the load is not2. IEC EN 61000 2 2 prevent disturbances Category C3 Category C3 Level 3 Level 4 Level 4 Warning This is a product for commercial and industrial application in the second environment installation restrictions or additional measures may be needed to SS lapora 2 Installation and Operation There are two different types of online UPS standard and long run models Please refer to the following model table Long run Parallel function is also available for these two types by request and related installation and operation of Parallel function called Parallel model will be described in detail in the following chapter 2 1 Unpacking and Inspection Unpack the package and check the package contents The shipping package contains e One UPS 9 One user manual 9 One monitoring software CD One RS 232 cable option One USB cable e One parallel cable only available for parallel model e One share current cable only available for parallel model NOTE Before installation please inspect the unit Be sure that nothing inside the package is damaged during transportation Do not turn on the unit and notify the carrier and dealer immediately if there is any damage or lacking of some parts Please keep the original package in a safe place for future use LA ON33 2 2 Rear Panel View T Mees ERREFE T Diagram 1 10K L 15K L 20K L Diagra
3. Vac I n Vac a 5 390 pa en ern 23 LA ON33 alapora Operating mode status ECO mode CVCF mode LCD display LCD display When the input voltage is within voltage regulation range and ECO mode is enabled UPS will bypass voltage to output for energy saving When the output frequency is set to CF the inverter will output constant frequency 50Hz or 60Hz At this mode the UPS will have no bypass output but will still charge battery Operating mode status LA ON33 24 Pe alapora Battery mode Description When the input voltage frequency is beyond the acceptable range or power failure UPS will backup power from battery and alarm will beep every 4 seconds LCD display KX y PEEHI METAI INPUT ecu X 180 Bypass mode Description When input voltage is within acceptable range and bypass is enabled turn off the UPS and it will enter Bypass mode Alarm beeps every two minutes LCD display a 4 f co sis gt C 7 Y O P 25 7 i alapora LA ON33 Operating mode status Battery Test Description When UPS is in AC mode or CVCF mode press Test key for more than 0 05 Then the UPS will beep once and s
4. 60 Hz system Setting range is from 56 0Hz to 58 0 7 480 560 The default value is 48 0Hz 58 0Hz Parameter 3 Set high voltage point for ECO mode 50 Hz Setting range is from 52 0Hz to 54 0 Hz 60 Hz Setting range is from 62 0Hz to 64 0Hz The default value is 52 0Hz 62 0Hz gt Parameter 2 ga OPN Bypass allowed When selected UPS will run at Bypass mode no depending on bypass enabled disabled setting rod er FBD Bypass not allowed When selected it Is not allowed for running in Bypass mode under any situations Parameter 3 ENA Bypass enabled When selected Bypass mode is activated DIS Bypass disabled When selected automatic bypass is acceptable but manual bypass is not allowed Manual bypass means users manually operate UPS for Bypass mode For example pressing OFF button in AC mode to turn into Bypass mode Parameter 3 000 999 Set the maximum discharge time from Omin to 999min UPS will shut down to protect battery if the discharge time arrives before the battery is under voltage The default value is 990min DIS Disable battery discharge protection and backup time will depend on battery capacity 19 P gt 98 LA ON33 10 Reserved RESERVED FOR FUTURE OPTIONS RESERVED FOR FUTURE OPTIONS 12 Neutral loss detection Interface Setting Parameter 2 N L 7 indicates neutral
5. lapara alap USER MANUAL EN 3 3 10K 20K Online UPS Uninterruptible Power Supply System Please comply with all warnings and operating instructions in this manual strictly Save this manual properly and read carefully the following instructions before installing the unit Do not operate this unit before reading through all safety information and operating instructions carefully LA ON33 Table of Contents 1 SAFETY AND EMC INSTRUCTIONS 0 0 0cccececccencececsccncecececenceceeseenenseceneneeeseeneneesseeneneseseeneneeenes 3 1 1 TRANSPORTATION AND STORAGE deeccteecionaaieis caan duoandewadenevensence dems deedstansedeen 3 D2 PREPARATION E E ETE ES AE ET anculd ue ETE SEA T E T AN 3 er EE 3 ee eas a ee ae eae ne ean ren ee 4 oy 4 2 INSTALLATION AND OPERATION 5 2 1 UNPACKING AND INSPECTION cccscececscscecececccccacecaccacaucucececucecucecececa
6. Line Battery UPS On C e p 9 NoOutputmode 6 o o o Bypassmode J e 5 Battery mode 5 pcvcFmode J e Battery Test e J 5 5 e e o 3 o Note 9 means LED is lighting and means LED is faded Backup Time Info Fault info LCD Panel J Input amp Battery Mute Operation Voltage Info T 5 ee Vac OVER LOAD Vde i H Battery Info Ho Hz Aa i i T OUTPUT oe Load Info LOW BATT OS FA Short es oP Y Mode Operation Info LA ON33 Backup time information 3 Gi Indicates the backup time in pie chart amp in numbers Ww H hours minutes 5 seconds Fault information fh Indicates that the warning and fault occurs Ho Indicates the fault codes and the codes are listed in details in section 3 9 Mute operation Indicates that the UPS alarm is disabled Output amp Battery voltage information Indicates the output voltage frequency or battery voltage Vac output voltage Vdc battery voltage Hz frequency Load information Indicates the load level by 0 25 26 50 51 75 and 76 100 OVER LoD Indicates overload SHORT Indicates the load or the output is short Mode operation information QO Indicates the UPS is connected to the mains
7. calibration range is limited within 9V This function is normally used for parallel operation Parameter 2 it always shows OP V as output voltage 7 Parameter 3 it shows the internal measurement value of the output mors B voltage and you can calibrate it by pressing Up or Down according to the measurement fro an external voltage meter The calibration result will be effective by pressing Enter The calibration range is limited within 9V This function is normally used for parallel operation It will display number 1 under PU to represent the output B voltage 21 98 LA ON33 20 Output C voltage calibration Parameter 2 it always shows OP V as output voltage fad HS Parameter 3 it shows the internal measurement value of the output mice 2 50 C voltage and you can calibrate it by pressing Up or Down according UTU to the measurement fro an external voltage meter The calibration result will be effective by pressing Enter The calibration range is limited within 9V This function is normally used for parallel operation It will display number 2 under OP to represent the output B voltage 3 8 Operating Mode Status Description The following table shows LCD display for operating modes and status 1 If the UPS is in normal operation it will show seven screens one by one that represent 3 phase input volta
8. in each UPS and then turn off the running system All UPSs will transfer to bypass mode Remove all the maintenance bypass covers and set the maintenance switches from UPS to BPS Turn off all the input breakers and battery breakers in parallel system 3 Turn off the output breaker and remove the parallel cable and share current cable from the UPSs that you want to remove Then remove UPSs from the parallel system P AONB 98 4 Turn on the input breaker of the remaining UPSs and the system will transfer to bypass mode Set the maintenance switches from BPS to UPS and put the maintenance bypass covers back 9 Turn on the remaining UPSs by following section 3 5 1 Warning Only for the parallel system e Before turning on the parallel system to activate inverter make sure that all unit s maintenance switch at the same position When parallel system is turned on to work through inverter please do not operate the maintenance switch of any unit 3 6 Abbreviation Meaning in LCD Display pispiay contort menns em r E w e p oO Th F oS om oS w gt o Pe mes FES ieee wo AO o oeoo o oO o Py mwe m PAD ARS tence OO emm se hE meee OOOO O wa A SC al Racor ATA 16 gt a lopora LA ON33 3 7 LCD Setting There
9. loss detection function Parameter 3 DIS Disable the neutral loss detection function The UPS will not detect the neutral loss or not ATO The UPS will automatically detect the neutral is lost or not If neutral loss is detected an alarm will be generated If the UPS is turned on it will transfer to battery mode When neutral is restored and detected the alarm will be muted automatically and the UPS will go back to normal mode automatically CHE The UPS will automatically detect the neutral loss If neutral loss is detected an alarm will be generated If the UPS is turned on it will transfer to battery mode When neutral is restored the alarm will NOT be muted automatically and the UPS will NOT go back to normal mode automatically Here you must mute the alarm and make the UPS go back to normal mode manually The operation is Firstly enter this menu and press the Enter key to make the C HE flash Secondly press the Enter key again to activate the neutral detection check If neutral is detected the alarm will be muted and the UPS will go back to normal mode If neutral is not detected the UPS will continue alarming and stay on the latest status until the neutral is detected well at next manual checking operation is default setting 13 Battery voltage calibration Parameter 2 Select Add or Sub function to adjust battery voltage to real figure Parameter 3 the voltage rang
10. mains is normal The icon Pan the warning code EPO function is enabled At this cP flash on LCD display and alarm The AC input power is not Check if input cable firmly connected well connected to the mains Set the circuit in closed position time the EPO switch is in OFF to disable EPO function beeps every second status or the jumper is open The icon A and ENTITY flash on The external or internal battery Check if all batteries are LCD display and alarm beeps every is incorrectly connected connected well second UPS is overload Remove excess loads from UPS output UPS is overloaded Devices connected to the UPS are fed Remove excess loads from UPS The icon A and LOYER flash on directly by the electrical network output LCD display and alarm beeps twice via the Bypass every second After repetitive overloads the UPS is locked in the Bypass mode Connected devices are fed directly by the mains Remove excess loads from UPS output first Then shut down the UPS and restart it Fault code is shown as 43 The icon UPS is overload too long and OVER LOAD lights on LCD display and becomes fault Then UPS shut down automatically Fault code is shown as 14 the icon The UPS shut down check output wiring and if automaticaly because short SHORT lights on LCD display and on the UPS connected devices are in short alarm beeps continuously output circuit status R
11. overload the buzzer will beep twice every second 4 When the UPS is overload please remove some loads immediately It is recommended to have the total loads connected to the UPS less than 80 of its nominal power capacity to prevent overload for system safety 5 If the overload time is over acceptable time listed in spec at AC mode the UPS will automatically transfer to Bypass mode After the overload is removed it will return to AC mode If the overload time is over acceptable time listed in spec at Battery mode the UPS will become fault status At this time if bypass is enabled the UPS will power to the load via bypass If bypass function is disabled or the input power is not within bypass acceptable range it will cut off output directly 12 LA ON33 Pe 98 4 Charge the batteries 1 After the UPS is connected to the utility power the charger will charge the batteries automatically except in Battery mode or during battery self test 2 Suggest charging batteries at least 10 hours before use Otherwise the backup time may be shorter than expected time 3 Make sure the battery numbers setting on the control board Please refer to the section 3 4 12 for detailed setting is consistent to real connection 5 Battery mode operation 1 When the UPS is in Battery mode the buzzer will beep according to different battery capacity If the battery capacity is more than 25 the buzzer will beep once every 4 s
12. the load and the breaker should be qualified with leakage current protective function if necessary 6 Put the terminal block cover back to the rear panel of the UPS LA ON33 gt a lopora Warning Only for standard model e Make sure that the UPS is not turned on before installation The UPS should not be turned on during wiring connection e Do not try to modify the standard model to the long run model Particularly do not try to connect the standard internal battery to the external battery The battery type and voltage may be different If you connect them together it may cause the hazard of electric shock or fire Warning Only for long run model e Make sure a DC breaker or other protection device between UPS and external battery pack is installed If not please install it carefully Switch off the battery breaker before installation NOTE Set the battery pack breaker in OFF position and then install the battery pack e Pay highly attention to the rated battery voltage marked on the rear panel If you want to change the quantity of the battery pack please make sure you modify the setting simultaneously The connection with wrong battery voltage may cause permanent damage of the UPS Make sure the voltage of the battery pack is correct e Pay highly attention to the polarity marking on external battery terminal block and make sure the correct battery polarity is connected Wrong connection may cause permanen
13. then the buzzer will beep once The UPS will turn into Bypass mode NOTE 1 If the UPS has been set to enable the bypass output it will bypass voltage from utility power to output sockets and terminal even though you have turned off the UPS inverter NOTE 2 After turning off the UPS please be aware that the UPS is working at Bypass mode and there is risk of power loss for connected devices 2 In Bypass mode output voltage of the UPS is still present In order to cut off the output switch off the input breaker for dual input unit also switch off the bypass line breaker A few seconds later there is no display shown on the display panel and UPS is complete off 8 Turn off the UPS without utility power supply in Battery mode 1 Turn off the UPS by pressing OFF button for at least 0 5s and then the buzzer will beep once 2 Then UPS will cut off power to output and there is no display shown on the display panel 9 Mute the buzzer 1 To mute the buzzer please press the Mute button for at least 0 5s If you press it again after the buzzer is muted the buzzer will beep again 2 Some warning alarms cannot be muted unless the error is fixed Please refer to section 3 3 for more details 13 LA ON33 lapora 10 Operation in warning status 1 When Fault LED flashes and the buzzer beeps once every second it means that there are some problems for UPS operation Users can get the fault code from LCD pane
14. 11 WARNING ste cscntoe 9st vd csc ceeds det dace eects She tacetasem sce ects ered cet neti abo sedeecacoeea seme eet sebeces a eb 28 9 5155 29 5 STORAGE AND MAINTENANCE 30 Reo lt lt aaa nnd eae TE a TO UE IO rT 30 30 34 2 gt a LA ON33 lapora 1 Safety and EMC instructions Please read carefully the following user manual and the safety instructions before installing the unit or using the unit 1 1 Transportation and Storage Please transport the UPS system only in the original package to protect against shock and impact The UPS must be stored in a ventilated and d
15. 92x250x826 815x250x826 592x250x826 815x250x826 592x250x826 Outline DXWXH Net Weight Kas 109 3 Dimension 920x380x1025 700x385x1017 920x380x1025 700x385x1017 920x380x1025 700x385x1017 Packaging DXWXH mm Net Weight 59 127 45 ENVIRONMENT 0 40 C the battery life will down when gt 25 C lt 95 and non condensing MANAGEMENT Derate capacity to 60 of capacity in CVCF mode and to 90 when the output voltage is adjusted to 208VAC lf the UPS is installed or used in a place where the altitude is over 1000m the output power must be derated 1 per 100m Product specifications are subject to change without further notice 31 LA ON33 Ps alapora
16. Battery voltage calibration Y OY YY TY Yy 14 Charger voltage adjustment Y CY Y Y y Y 15 InverterAvoltage adjustment Y OY 16 Inverter B voltage adjustment Y y CY 17 Inverter C voltage adjustment yY 18 OutputA voltage calibration OY 19 Output B voltage calibration Y y 20 Output C voltage calibration Y yl UY Y Yes means that this program can be set in this mode Note All parameter settings will be saved only when UPS shuts down normally with internal or external battery connection Normal UPS shutdown means turning off input breaker in bypass no output mode Code Description lt lt lt lt lt lt 17 me S 98 LA ON33 01 Output voltage Interface S tee Parameter 3 Output voltage wf Ei You may choose the following output voltage in parameter 3 3 g A 208 Presents output voltage is 208Vac LSV 220 Presents output voltage is 220Vac 230 Presents output voltage is 230Vac 240 Presents output voltage is 240Vac 02 Output frequency 60 Hz CVCF mode Parameter 2 Output Frequency n Dire C Setting the output irequency You may choose following three wie options in parameter 2 50 0Hz The output frequency is setting for 50 0Hz PON m una 60 0Hz The output frequency is setting for 60 0Hz ATO If selected output frequency w
17. Set the acceptable low voltage for bypass Setting Li J e range is from 110V to 209V and the default value is 110V 1 5 SY e Parameter 3 Set the acceptable high voltage for bypass Setting 8 range is from 231V to 276V and the default value is 264V l Parameter 2 Set the acceptable low frequency for bypass NMU L 50 Hz system Setting range is from 46 0Hz to 49 0Hz a 60 Hz system Setting range is from 56 0Hz to 59 0Hz 46H 930 The default value is 46 0Hz 56 0Hz FT Parameter 3 Set the acceptable high frequency for bypass 50 Hz Setting range is from 51 0Hz to 54 0 Hz 60 Hz Setting range is from 61 0Hz to 64 0Hz The default value is 54 0Hz 64 0Hz 18 P 98 LA ON33 05 mode enable disable Parameter 3 Enable or disable ECO function You may choose following two options DIS disable ECO function ENA enable ECO function lf ECO function is disabled voltage range and frequency range for ECO mode still can be set but it is meaningless unless the ECO function is enabled Parameter 2 Low voltage point in ECO mode The setting range is og from 5 to 10 of the nominal voltage no 399 p1 Parameter 3 High voltage point in ECO mode The setting range is g c 7 from 5 to 10 of the nominal voltage Salt Parameter 2 Set low voltage point for ECO mode Tee y 50 Hz system Setting range is from 46 0Hz to 48 0Hz m 3A
18. are three parameters to set up the UPS Refer to following diagram Parameter 1 It is for program alternatives Refer Parameter 1 to below tables for the programs to set up Parameter 2 and parameter 3 are the setting o g options or values for each program 888 888 4 ia Note Please select Up or Down button to change the programs or parameters Parameter 2 Parameter 3 Note The following order of setting code only presents when UPS is in Bypass Mode or no output mode The setting code number will change its number under other modes For example when the UPS is in AC mode the total available settings are only 10 Then setting code of Bypass mode setting will become 01 Maximum battery discharge time setting will become 02 and so on Programs available list for parameter 1 Bypass AC ECO CVCF Battery Battery No output mode Mode Mode Mode Mode Test 01 Outputvotage S S T e e 02 Outputfrequency oo YT 1 03 Voltage range for bypass J Yo Jo To T To y 04 Frequency range for bypass 05 ECO mode enable disable J T Do 0 06 Voltage rangefor ECO mode J J T Do 0 07 Frequency range for ECO mode Yo J T Do 0 08 Bypass mode seting Y yJ P D 0 09 Maximum battery dischargetime Y Y Y 1 Y 10 Reserved for future options Reserved for future options 12 Neutral loss detection Y CY YY y Y 13
19. cenenenanananeuenucununecenenenanenenetaneteneneneness 5 ee AS ts 6 2 3 SINGLE UPS INSTALLATION ccccecececececececececcccccccccceeauauauauauacauauaeaeaeaenenenenenensneneauauauaenenenenenenenenenenensneneneners 7 2 4 UPS INSTALLATION FOR PARALLEL SYSTEM ccccececececececececececacacacacaeaenenenenenenenenenenenenecetetecetececeneneneneneneners 8 2959 DOP MARE INSTALLATION wists 9 on A A ee ee ee ee ee ee ee 10 meee ea ce ee ee ee eer 10 32 INDIO ROR SAIN loci occ sev vac case ca a A T 10 3 3 AUDIBLE ALARM ieclsrsaicecpnaizdie exe in sei cren nie de woraelaroelelcccepemsde 12 3 4 SINGLE UPS OPERATION cccccccccecececececececececececececscscucucuccececcacacacacacauacauauauaestacacacacacaeacauavauauauaucucucuaeaeaes 12 PARALLEL OPERATION sicaawe dais E and dane E Gomeddeetaandiseaeaiesiuieabaeasebaawsddevaanek 14 3 6 ABBREVIATION MEANING IN LCD DISPLAY sssedaccndivcatcntalisiccdasdadowindaceatsedaloce lactaleciudauscsistabscadndaeeciasdeiaxiawduan 16 TN Re BES 5 Ce ane co COO aT Oa 17 3 8 OPERATING MODE STATUS DESCRIPTION cccccecececececececececccucccauauacauauacceeeeeeeauauaeuauauauaeaeaeaeneaenenenenenenenes 22 nen A me ee 27 ROR 27 3
20. ds later the UPS will enter to battery mode c Then turn on another UPS A few seconds later the UPS will enter to battery mode and add to the parallel system d If you have the third UPS follow the same procedure as c Then the parallel system is complete If you need more detailed information please contact your supplier or service centre for parallel operation instruction 2 Add one new unit into the parallel system 1 You cannot add one new unit into the parallel system when the whole system is running You must cut off the load and shutdown the system 2 Make sure all the UPS are parallel models and follow the wiring in section 2 4 3 Install the new parallel system refers to the previous section 3 Remove one unit from the parallel system There are two methods to remove one unit from the parallel system Method 1 1 Press the OFF key twice and each time should last for more than 0 5s Then the UPS will enter into bypass mode or no output mode without output 2 Turn off the output breaker of this unit and then turn off the input breaker of this unit 3 After it shuts down you can turn off the battery breaker for long run model Remove the parallel cable and share current cable Then remove the unit from the parallel system Method 2 1 If the bypass is abnormal you cannot remove the UPS without interruption You must cut off load and shut down the system 2 Make sure that bypass setting is enabled
21. e spec AWG Neutral NOTE 1 The cable for 10K 10K L should be able to withstand over 40A current It is recommended to use 10AWG or thicker wire for Phase and 8AWG or thicker for Neutral for safety and efficiency NOTE 2 The cable for 15K 15K L should be able to withstand over 63A current It is recommended to use 8AWG or thicker wire and 6AWG or thicker for Neutral for safety and efficiency NOTE 3 The cable for 20K 20K L should be able to withstand over 63A current It is recommended to use 8AWG or thicker wire and or thicker for Neutral for safety and efficiency NOTE 4 The selections for colour of wires should be followed by the local electrical laws and regulations Remove the terminal block cover on the rear panel of UPS Then connect the wires according to the following terminal block diagrams Connect the earth wire first when making wire connection Disconnect the earth wire last when making wire disconnection L12 L3 N L12 L3 N L12 L N w F tt dL Saad ot Output Line Input Bypass Input Terminal Block wiring diagram for 10K L 15K L 20K L For dual input unit if there is two separate input connect the Line input and bypass input respectively if there is only one common input please connect the line input and bypass input together NOTE 1 Make sure that the wires are connected tightly with the terminals NOTE 2 Please install the output breaker between the output terminal and
22. e is from OV to 9 9V the default value is OV 20 P gt 98 LA ON33 14 Charger voltage adjustment I Lee A Parameter 2 you may choose Add or Sub to adjust charger voltage Parameter 3 the voltage range is from OV to 9 9V the default value j 7 i Add 026 s Before making voltage adjustment be sure to disconnect all batteries first to get the accurate charger voltage Any modification should be suitable to battery specifications Parameter 2 you may choose Add or Sub to adjust inverter A voltage Parameter 3 the voltage range is from OV to 9 9V the default value is OV Parameter 2 you may choose Add or Sub to adjust inverter B voltage Parameter 3 the voltage range is from OV to 9 9V the default value is OV Zii 4 k to represent It will display number 1 under Afe or inverter B voltage Parameter 2 you may choose Add or Sub to adjust inverter C voltage Parameter 3 the voltage range is from OV to 9 9V the default value is OV Ziri a to represent It will display number 2 under Act or inverter C voltage Parameter 2 it always shows OP V as output voltage Parameter 3 it shows the internal measurement value of the output A voltage and you can calibrate it by pressing Up or Down according to the measurement from an external voltage meter The calibration result will be effective by pressing Enter The
23. econds if the battery voltage drops to the alarm level the buzzer will beep quickly once every sec to remind users that the battery is at low level and the UPS will shut down automatically soon Users could switch off some non critical loads to disable the shutdown alarm and prolong the backup time If there is no more load to be switched off at that time you have to shut down all loads as soon as possible to protect the devices or save data Otherwise there is a risk of data loss or load failure 2 In Battery mode if buzzer sound annoys users can press the Mute button to disable the buzzer 3 The backup time of the long run model depends on the external battery capacity 4 The backup time may vary from different environment temperature and load type 5 When setting backup time for 16 5 hours default value from LCD panel after discharging 16 5 hours UPS will shut down automatically to protect the battery This battery discharge protection can be enabled or disabled through LCD panel control Refer to 3 7 LCD setting section 6 Test the batteries 1 If you need to check the battery status when the UPS is running in AC mode CVCF mode ECO mode you could press the Test button to let the UPS do battery self test 2 Users also can set battery self test through monitoring software 7 Turn off the UPS with utility power supply in AC mode 1 Turn off the inverter of the UPS by pressing OFF button for at least 0 5s and
24. em protection install UPS monitoring software to fully configure UPS shutdown Install CD or visit the website http www laparaups com en software php for the latest software version e S 98 LA ON33 3 Operations 3 1 Button Operation gt Turn on the UPS Press and hold the button more than 0 5s to turn on the UPS ON Enter Button gt Enter Key Press this button to confirm the selection in setting menu gt Turn off the UPS Press and hold the button more than 0 5s to turn off the UPS OFF ESC Button gt Esc key Press this button to return to last menu in setting menu gt Battery test Press and hold the button more than 0 5s to test the battery while in Test Up Button AC mode or CVCF mode gt UP key Press this button to display next selection in setting menu gt Mute the alarm Press and hold the button more than 0 5s to mute the buzzer Mute Down Button Please refer to section 3 4 9 for details gt Down key Press this button to display previous selection in setting menu Test Up gt Press and hold the two buttons simultaneous more than 15 to enter escape the Mute Down Button setting menu CVCF mode means converter mode Constant Voltage amp Constant Frequency 3 2 LED Indicators and LCD Panel LCD panel BYPASS LINE BATTERY FAULT O O O G gt LED indicators LED Indicators There are 4 LEDs on front panel to show the UPS working status Mode LED Bypass
25. emove excess loads from UPS output and restart it alarm beeps continuously A UPS internal fault has occurred There are two Contact your dealer possible results Other fault codes are shown on LCD display and alarm beeps continuously Charge the batteries for at least 7 hours and then check Battery backup time is shorter than capacity If the problem persists nominal value consult your dealer Batteries defect Contact your dealer to replace the battery Fan is locked or not working or The icon Lana flash on LCD the UPS temperature is too Check fans and notify dealer display and alarm beeps every second high Check and correct the input neutral connection If it is OK and the alarm is still on the LCD refer to the LCD setting section to enter the neutral loss check i menu to see if parameter 3 is The input neutral wire is Warning code 02 is shown icon disconnected CHE If it is so please press flashes on LCD display and alarm beeps Enter key first to make the every second CHE flash and press Enter key again to make the UPS clear the alarm If the warning still persists please check input fuses L2 amp L3 The L2 or L3 input fuse is Replace fuse broken Batteries are not fully charged 29 7 i alapora LA ON33 5 Storage and Maintenance 5 1 Storage Before storing charge the UPS at least 7 hours Store the UPS covered and upright in a cool dry location During s
26. ges An bn Cn 3 line input voltages Ab bC CA and frequency in turns 2 If parallel UPS systems are successfully set up it will show one more screen with PAR in parameter 2 and assigned number in parameter 3 as below parallel screen diagram The master UPS will be default assigned as 001 and slave UPSs will be assigned as either O02 or 003 The assigned numbers may be changed dynamically in the operation Parallel screen Operating mode status UPS Power On Description When UPS is powered on it will enter into this mode for a few seconds for initializing the CPU and system LCD Display 88 ri 1i g i p vee over Load LOAD ae OOO J il ea Cas org j E O P a cel 22 gt alopora LA ON33 Operating mode status No output mode Description When bypass voltage frequency is out of acceptable range or bypass is disabled or forbidden UPS will enter into no output mode if powering on or turning off the UPS It means that the UPS has no output Alarm beeps every two minutes LCD Display l 6 LE AC mode Description When the input voltage is within acceptable range UPS will provide pure and stable AC power to output The UPS will also charge the battery at AC mode LCD displa Play m z
27. ill be decided according to the latest normal utility frequency If it is from 46Hz to 54Hz the output frequency will be 50 0Hz If it is from 56Hz to 64Hz the output 50 Hz Normal mode frequency will be 60 0Hz ATO is default setting H se Parameter 3 Frequency mode cnn re Setting output frequency at CVCF mode or not CVCF mode You 141451 may choose following two options in parameter 3 CF Setting UPS to CVCF mode If selected the output frequency will be fixed at 50Hz or 60Hz according to setting in parameter 2 The a input frequency could be from 46Hz to 64Hz ATO NCF Setting UPS to normal mode not CVCF mode If it is selected the output frequency will synchronize with the input frequency within Hios 46 54 Hz at 50Hz or within 56 64 Hz at 60Hz according to setting in m nn parameter 2 If 50 Hz selected in parameter 2 UPS will transfer to HEL SUU 5 battery mode when input frequency is not within 46 54 Hz If 60Hz LI selected in parameter 2 UPS will transfer to battery mode when input frequency is not within 56 64 Hz Parameter 2 is ATO the Parameter 3 will show the current frequency Note For single unit it will have bypass output for a couple of seconds after the unit is powered on Therefore to avoid damage on connected devices it is strongly suggested to add an additional Output relay board for CVCF application 03 Voltage range for bypass Parameter 2
28. l Please check the trouble shooting table in chapter 4 for details 2 Some warning alarms cannot be muted unless the error is fixed Please refer to section 3 3 for details 11 Operation in Fault mode 1 When Fault LED illuminates and the buzzer beeps continuously it means that there is a fatal error in the UPS Users can get the fault code from display panel Please check the trouble shooting table in chapter 4 for details 2 Please check the loads wiring ventilation utility battery and so on after the fault occurs Don t try to turn on the UPS again before solving the problems If the problems can t be fixed please contact the distributor or service people immediately 3 For emergency case please cut off the connection from utility external battery and output immediately to avoid more risk or danger 12 Operation of changing battery numbers 1 This operation is only available for professional or qualified technicians 2 Turn off the UPS If the load could not be cut off you should remove the cover of maintenance bypass switch on the rear panel and turn the maintenance switch to BPS position first 3 Switch off the input breaker for dual input unit also switch off the bypass input breaker and switch off the battery breaker only available for long run model 4 Remove the cabinet cover and disconnect battery wire for standard mode Then modify the jumper of JS3 on the control board to set the battery numbers a
29. m 10K L 15K L 20K L Input Output terminal Rear panel 1 RS 232 communication port 9 Bypass Input Circuit Breaker only for dual input unit 2 USB communication port 10 Input Output terminal See Diagram 2 3 Emergency power off function connector EPO 11 Line Input circuit breaker connector 12 Maintenance bypass switch 4 Share current port only for parallel model 13 Output grounding terminal 5 Parallel port only for parallel model 14 Output terminal connect to mission critical loads 6 Intelligent slot 15 Line input terminal 7 Power stage fan 16 Bypass Input terminal only for dual input unit 8 External battery terminal only for long run model 17 Input Grounding terminal 6 Pe alapora LA ON33 2 9 Single UPS Installation Installation and wiring must be performed in accordance with the local electric laws regulations and the following instructions must be executed by professional personnel 1 5 Make sure that the mains wire and breakers in the building are enough for the rated capacity of UPS to avoid the hazards of electric shock or fire NOTE Do not use the wall receptacle as the input power source for the UPS as its rated current is less than the UPS s maximum input current Otherwise the receptacle may be burned and destroyed Switch off the mains switch in the building before installation Turn off all the connected devices before connecting to the UPS Prepare wires based on the following tabl
30. of batteries Do not attempt to dispose of batteries by burning them This could cause battery explosion The batteries must be rightly deposed according to local regulation toxic Please replace the fuse only with the same type and amperage in order to avoid fire hazards AN Do not open or destroy batteries Escaping electrolyte can cause injury to the skin and eyes It may be Do not disassemble the UPS system 30 LA ON33 7 i 7 Specifications INPUT 110 VAC Ph N 3 at 50 Load 176 VAC Ph N 3 at 100 Load Voltage Low Line Loss Voltage 10V Range 300 VAC Ph N 3 High Line Loss Voltage 10V OUTPUT Output voltage 208 220 230 240VAC Frequency Range Synchronized Range 46Hz 54 Hz 50Hz system 56Hz 64 Hz 60Hz system Frequency Range Batt Mode 50 Hz 0 1 Hz or 60Hz 0 1 Hz sveriong AC mode ooo 100 110 10min 110 130 1min gt 130 1sec Battery mode 100 110 30566 110 130 10sec gt 130 1sec lt 2 100 Linear Load lt 5 100 Non linear Load Line lt Line Battery 0 ms Transfer 0 ms Time when phase lock fails lt 4ms interruption occurs from inverter to bypass Inverter lt Inverter ECO lt 10 ms EFFICIENCY 1 A 1056 max 2 A 1090 max Depending on applications 18 20 Charging Current 4 A 10 max Charging Voltage 273 VDC 1 PHYSICAL Model OK 10k 15 15K L 20K__ 2 a 815x250x826 5
31. oltage calibration Refer to Program 18 19 and 20 section 3 7 in LCD setting to make sure the difference between real output voltage and detected value of UPS is less than 1V 3 Turn off each UPS Refer to section 3 4 7 Then follow the wiring procedure in section 2 4 4 Remove the cover of parallel share current cable port on the UPS connect each UPS one by one with the parallel cable and share current cable and then screw the cover back 5 Turn on the parallel system with utility power supply in AC mode a Turn on the line input breaker of each UPS for dual input also turn on bypass input breaker After all UPSs enter to bypass mode measure the voltage difference between two UPS for the same phase to make sure the phase sequence is correct If these two voltage differences are near to zero it means all connections are correct Otherwise please recheck if the wirings are connected correctly b Turn on the output breaker of each UPS c Turn on each UPS in turns After a while the UPSs will enter to AC mode synchronously and then the parallel system installation is complete 6 Turn on the parallel system without utility power supply in Battery mode a Turn on the battery breaker only available in long run model and output breaker of each UPS NOTE It is not allowed to share one battery pack for long run UPSs in parallel system Each UPS should be connected to its own battery pack b Turn on any UPS A few secon
32. protected by UPS To protect your precious devices you should turn on the UPS Refer to next step 2 Press and hold the ON button for 0 5s to turn on the UPS and the buzzer will beep once 3 A few seconds later the UPS will enter to AC mode If the utility power is abnormal the UPS will operate in Battery mode without interruption NOTE When the UPS is running out battery it will shut down automatically at Battery mode When the utility power is restored the UPS will auto restart in AC mode 2 Turn on the UPS without utility power supply in Battery mode 1 Make sure that the breaker of the battery pack is at ON position only for long run model 2 Press the ON button to set up the power supply for the UPS UPS will enter to power on mode After initialization UPS will enter to No Output mode then press and hold the ON button for 0 5s to turn on the UPS and the buzzer will beep once 3 Afew seconds later the UPS will be turned on and enter to Battery mode 3 Connect devices to UPS After the UPS is turned on you can connect devices to the UPS 1 Turn on the UPS first and then switch on the devices one by one the LCD panel will display total load level 2 If it is necessary to connect the inductive loads such as a printer the in rush current should be calculated carefully to see if it meets the capacity of the UPS because the power consumption of this kind of loads is too big 3 Ifthe UPS is
33. ry place 1 2 Preparation Condensation may occur if the UPS system is moved directly from cold to warm environment The UPS system must be absolutely dry before being installed Please allow at least two hours for the UPS system to acclimate the environment _ Do not install the UPS system near water or in moist environments A Do not install the UPS system where it would be exposed to direct sunlight or nearby heater A Do not block ventilation holes in the UPS housing 1 3 Installation A Do not connect appliances or devices that would overload the UPS e g big motor type equipment to the UPS output sockets or terminal Place cables in such a way that no one can step on or trip over them A Do not block air vents in the housing of UPS The UPS must be installed in a location with good ventilation Ensure enough space on each side for ventilation UPS has provided earthed terminal in the final installed system configuration equipotential earth bonding to the external UPS battery cabinets _ The UPS can be installed only by qualified maintenance personnel _An appropriate disconnect device as short circuit backup protection should be provided in the building wiring installation 4 An integral single emergency switching device that prevents further supply to the load by the UPS in any mode of operation should be provided in the building wiring installation 4 Connect the earth before connecting wiring terminal of the b
34. s following table Battery Number in series Pin1 amp pin2 Pin3 amp pin4 Pind amp pin6 Pin7 amp pin8 se a o o X Note 1 connect with jumper 0 No jumper X pins are for other functions 5 Modify the battery pack for the setting number carefully After having completed it put the cover back switch on the battery breaker for long run model 6 Switch on the Line Input breaker for dual input also switch on the bypass input breaker and the UPS will enter Bypass mode If the UPS is in maintenance Bypass mode turn the maintenance switch to UPS position and then turn on the UPS 3 5 Parallel Operation 1 Parallel system initial strtup First of all please make sure all UPSs are parallel model and have the same configuration 1 Turn on each UPS to AC mode respectively Refer to section 3 4 1 Then measure the inverter output voltage of each phase for each UPS to check if the inverter voltage difference between actual output and setting value is less than 1 5V typical 1V with multimeter If the difference is more than 1 5V please calibrate the voltage by configuring inverter voltage adjustment Refer to Program 15 16 and 17 section 3 7 in LCD setting If voltage difference remains more than 1 5V after calibration please contact your local distributor or service centre for help LA ON33 98 2 Calibrate the output voltage measurement by configuring output v
35. t damage of the UPS e Make sure the protective earth ground wiring is correct The wire current spec color position connection and conductance reliability should be checked carefully e Make sure the utility input amp output wiring is correct The wire current spec color position connection and conductance reliability should be checked carefully Make sure the L N site is correct not reverse and short circuited 2 4 UPS Installation for Parallel System If the UPS is only available for single operation you may skip this section to the next 1 Install and wire the UPSs according to the section 2 3 2 Connect the output wires of each UPS to an output breaker 3 Connect all output breakers to a major output breaker Then this major output breaker will directly connect to the loads 4 Each UPS is connected to an independent battery pack NOTE The parallel system cannot use one battery pack Otherwise it will cause system permanent failure 5 Refer to the following wiring diagram P gt lapora LA ON33 _ I e I ae ee ae ee UPS Output e Bypass Lnput Tnput 58 ee ee ee ee ee ee se I ee ee ee ee _ ete ee 1 62 e eS ee ee Wiring diagram of parallel system for 10K L 15K L 20K L 2 5 Software Installation For optimal computer syst
36. tart Battery Test The line between I P and inverter icons will blink to remind users This operation is used to check the battery status LCD display XK on py 4 g m CEU Tr gt N 7 y 229 380 E eee 5 Warning status Description If some errors occur in the UPS but it is still running normally it will show One more screen to represent the warning situation In the warning screen the icon will be flashing and it can show up to 3 error codes Each code indicates one different error You can find the meaning in the warning code LCD display table Fault status Description When the UPS has fault happened the inverter will be blocked It will display fault code in screen and the icon AN will light up You can find the code meaning in the fault code table LCD display VERN JA Ped over Low a 0 INPUT OUTPUT Y Y S PA AS 3 lt lt 7 f TE a 5 3 i oon OVER LOAD Hz Hz INPUT OUTPUT I AV 26 7 alapora LA ON33 3 9 Fault Code Fault Fault event Fault event code code Inverter A negative power fault Inverter B negative power fault 09 Busunder None 1 C negative powerfault 06 Converteroverc
37. torage recharge the battery in accordance with the following table Storage Temperature Recharge Frequency Charging Duration 5 2 Maintenance The UPS system operates with hazardous voltages Repairs may be carried out only by qualified maintenance personnel Even after the unit is disconnected from the mains components inside the UPS system are still connected to the battery packs which are potentially dangerous Before carrying out any kind of service and or maintenance disconnect the batteries and verify that no current is present and no hazardous voltage exists in the terminals of high capability capacitor such as BUS capacitors Only persons are adequately familiar with batteries and with the required precautionary measures may replace batteries and supervise operations Unauthorized persons must be kept well away from the batteries Verify that no voltage between the battery terminals and the ground is present before maintenance or repair In this product the battery circuit is not isolated from the input voltage Hazardous voltages may occur between the battery terminals and the ground Batteries may cause electric shock and have a high short circuit current Please remove all wristwatches rings and other metal personal objects before maintenance or repair and only use tools with insulated grips and handles for maintaining or repairing When replace the batteries install the same number and same type
38. uilding A Installation and wiring must be performed in accordance with the local electrical laws and regulations 7 i LA ON33 1 4 Operation Do not disconnect the earth conductor cable on the UPS or the building wiring terminals in any time since this would cancel the protective earth of the UPS system and of all connected loads The UPS system features its own internal current source batteries The UPS output sockets or output terminal blocks may be electrically live even if the UPS system is not connected to the wiring outlet of the building In order to fully disconnect the UPS system first press the OFF button and then disconnect the mains Ensure that no liquid or other foreign objects can enter into the UPS system otherwise guarantee would not be accepted The UPS can be operated by any individuals with no previous experience 1 5 Standards LA ON33 Safety IEC EN 62040 1 EMI Conducted Emission IEC EN 62040 2 Radiated EMISSION IEC EN 62040 2 era eee ee ee eee ere IEC EN 61000 4 2 IEC EN 61000 4 3 E IEC EN 61000 4 4 IEC EN 61000 4 5 IEC EN 61000 4 6 Power frequency Magnetic field IEC EN 61000 4 8 Low Frequency
39. urrent 6 24 Inverter relay short circuited None Inverter soft start failure neutral short circuited 15 Inverter B output line to 42 DSP communication failure None neutral short circuited 16 Inverter C output line to 43 Overload neutral short circuited 17 SHORT 46 Inverter A B output line to line Incorrect UPS setting None short circuited 18 Inverter B C output line to line 47 MCU communication failure None short circuited 19 Inverter C A output line to line short circuited 3 10 Warning Indicator wami fomes aem Over charge Beeping every second EPO enable Beeping every second Fan failure Over temperature Beeping every second Charger failure Beeping every second I P fuse broken A O Beeping every second Overload 3 times in 30min Beeping every second 27 e S lapora LA ON33 3 11 Warning Code 04 IP phase abnormal OOO O 05 system 90 min 39 09 Overload 0A Fan failure 35 0B__ EPO enable 3D Over temperature Utility extremely unbalanced Charger failure 3D Bypass unstable These alarms are only for the single input unit 28 gt a lapora LA ON33 4 Trouble Shooting If the UPS system does not operate correctly please solve the problem by using the table below Symptom No indication and alarm in the front display panel even though the
Download Pdf Manuals
Related Search