Home
pSIF Vectors User Manual
Contents
1. Fig 1 Design of the single promoter pSIF H1 shRNA expression cassette The dotted lines at the top of the figure indicate the position of the stuffer fragment that is removed during linearization by digesting the vector with BamHI EcoRI Your shRNA template sequence should be designed to directionally insert between the BamHI and EcoRI nucleotide overhangs i e sticky ends This example shows the siRNA sequence targeting the p53 gene shRNA template insert Reverse 1 Pr Sense Loop Antisense Terminator tccGACTCCAGTGGTAATCTACcttcctgtcagaGTAGATTACCACTGGAGTCtttttgaa aggCTGAGGTCACCATTAGATGgaaggacagtctCATCTAATGGTGACCTCAGaaaaactt Transcription tte 5 GACUCCAGUGGUAAUCUAC t shRNA transcript 3 uuCUGAGGUCACCAUUAGAUG eZ Jac Fig 2 Example shRNA template construct targeting the p53 gene The nucleotides for the specific siRNA sequence targeting the p53 gene are shown in capital letters The shRNA sense and antisense sequences flank the region coding for the loop structure In addition a terminator sequence for the RNA polymerase III is included after the antisense portion The Forward and Reverse arrows refer to the PCR primers contained in this product to confirm positive clones After transcription a stem loop stem shRNA molecule is produced This molecule is processed by the DICER enzyme to generate a double stranded siRNA effector 888 266 5066 Toll Free 650 968 2200 outside US Page 5
2. Purify shRNA lentivector construct plasmid DNA in Midi scale using an Endotoxin free plasmid purification kit see section E Additional Required Materials 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual E Transfection and Analysis of Silencing Efficiency If you are planning to use SBI s pSIF H1 shRNA constructs for viral delivery we recommend first to screen the shRNA constructs generated in section D to determine their effectiveness at knocking down expression of the target gene To rapidly screen the shRNA lentivector constructs in plasmid form you can deliver and express them in HeLa or HEK 293 cells using chemical transfection For example with these cells the Lipofectamine Reagent Invitrogen Cat 18324 111 with Plus Reagent Invitrogen Cat 11514 015 works well in our hands Alternatively you can use your target cells for this analysis If you have already established a transfection method for your target cells use your established conditions If you do not have an established transfection protocol we recommend you compare efficiencies of several transfection procedures e g Invitrogen s Lipofectamine 2000 Cat 11668 027 Roche FUuGENE 6 Cat 11 815 091 001 The goal of these experiments is to achieve at least 90 95 transfection efficiency of target cells which can be measured by analysis of GFP positive cells if you are using constructs with copGF
3. Shen H Barker CK Martins Sharkey CM Sanders DA McCray PB Jr Davidson BL In vivo gene transfer using a nonprimate lentiviral vector pseudotyped with Ross River Virus glycoproteins J Virol 2002 Sep 76 18 9378 88 Page 18 ver 4 080514 www systembio com pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 Lotery AJ Derksen TA Russell SR Mullins RF Sauter S Affatigato LM Stone EM Davidson BL Gene transfer to the nonhuman primate retina with recombinant feline immunodeficiency virus vectors Hum Gene Ther 2002 Apr 10 13 6 689 96 Price MA Case SS Carbonaro DA Yu XJ Petersen D Sabo KM Curran MA Engel BC Margarian H Abkowitz JL Nolan GP Kohn DB Crooks GM Expression from second generation feline immunodeficiency virus vectors is impaired in human hematopoietic cells Mol Ther 2002 Nov 6 5 645 52 Sinn PL Hickey MA Staber PD Dylla DE Jeffers SA Davidson BL Sanders DA McCray PB Jr Lentivirus vectors pseudotyped with filoviral envelope glycoproteins transduce airway epithelia from the apical surface independently of folate receptor alpha J Virol 2003 May 77 10 5902 10 Stein CS Davidson BL Gene transfer to the brain using feline immunodeficiency virus based lentivirus vectors Methods Enzymol 2002 346 433 54 Wang G Sinn PL Zabner J McCray PB Jr Gene transfer to airway epithelia using feline immunodeficiency virus based lentivirus vectors Methods Enzymol 2002
4. System Biosciences SBI User Manual 4 List of Components Each pSIF H1 Vector Kit provides enough plasmid for 20 ligation reactions e pSIF1 H1 Puro shRNA Expression Lentivector Cat SI100C 1 50 ul p SIF1 H1 Puro vector Non linearized 20 ng ul 25 ul Luciferase Control shRNA Template Oligonucleotide Mix 20 uM each 25 ul ForwardF PCR Primer 5 TGTCTTTGGATTTGGGAATCTTAT 3 10 uM 25 ul ReverseF PCR Primer 5 ATTTATTGTATCTGTGGGAGCCTC 3 10 uM e pSIF1 H1 copGFP shRNA Expression Lentivector Cat S1101B 1 50 ul pSIF1 H1 copGFP vector Non linearized 20 ng ul 25 ul Luciferase Control shRNA Template Oligonucleotide Mix 20 uM each 25 ul ForwardF PCR Primer 5 TGTCTTTGGATTTGGGAATCTTAT 3 10 uM 25 ul ReverseF PCR Primer 5 ATTTATTGTATCTGTGGGAGCCTC 3 10 uM The kits are shipped in dry ice and should be stored at 20 C upon receipt Properly stored kits are stable for 12 months from the date received 5 Additional Required Materials For Phosphorylation and Annealing of shRNA Template Oligonucleotides e 74 Polynucleotide Kinase and 10X reaction buffer Recommended New England BioLabs T4 Polynucleotide Kinase 10 U ul Cat M0201S e rATP Recommended GE Amersham Cat 27 2056 01 For Linearizing shRNA Expression Vector e BamHI and EcoRI restriction enzymes Recommended New England BioLabs EcoRI 20 U ul Cat R0101 BamHI 20 U ul Cat RO136S e Qiagen Qiaquick PCR Purificat
5. 346 500 14 Wang G Slepushkin V Zabner J Keshavjee S Johnston JC Sauter SL Jolly DJ Dubensky TW Jr Davidson BL McCray PB Jr Feline immunodeficiency virus vectors persistently transduce nondividing airway epithelia and correct the cystic fibrosis defect J Clin Invest 1999 Dec 104 11 R55 62 FIV vector system development Browning MT Schmidt RD Lew KA Rizvi TA Primate and feline lentivirus vector RNA packaging and propagation by heterologous lentivirus virions J Virol 2001 Jun 75 11 5129 40 Curran MA Kaiser SM Achacoso PL Nolan GP Efficient transduction of nondividing cells by optimized feline immunodeficiency virus vectors Mol Ther 2000 Jan 1 1 31 8 Johnston JC Gasmi M Lim LE Elder JH Yee JK Jolly DJ Campbell KP Davidson BL Sauter SL Minimum requirements for efficient transduction of dividing and nondividing cells by feline immunodeficiency virus vectors J Virol 1999 Jun 73 6 4991 5000 Johnston J Power C Productive infection of human peripheral blood mononuclear cells by feline immunodeficiency virus implications for vector development J Virol 1999 Mar 73 3 2491 8 Poeschla EM Wong Staal F Looney DJ Efficient transduction of nondividing human cells by feline immunodeficiency virus lentiviral vectors Nat Med 1998 Mar 4 3 354 7 Poeschla E M Looney D J and Wong Staal F 2003 Lentiviral nucleic acids and uses thereof US Patent NO 6 555 107 B2 Sauter SL Gasmi M Dube
6. H1 copGFP Vector Cat S1101B 1 contains a copGFP gene CopGFP is a novel fluorescent protein 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual derived from copepod plankton Panalina sp which is similar to EGFP but has a brighter color This gene serves as a fluorescent reporter for the transfected or transduced cells Two approaches have been developed for in vivo expression of siRNA from plasmid and viral vectors In one approach the sense and anti sense strands are transcribed separately from two independent promoters and form the siRNA duplex Lee 2002 Miyagishi 2002 With the second approach a single stranded shRNA sequence with a fold back stem loop structure also known as a hairpin is expressed from a single promoter Abbas Terki 2002 Qin 2003 Wiznerowicz 2003 This sequence is then converted into double stranded siRNA after intracellular processing cleaves the loop Brummelkamp 2002 Paddison 2002 In both approaches the siRNA molecules are transcribed from constitutive RNA polymerase Ill promoters i e U6 and or H1 and terminated with TTTTT Ts sequences Tuschl 2002 The U6 and H1 promoters are different in size but contain the same conserved sequence elements Myslinski 2001 The pSIF H1 Vectors are designed to express a single stranded shRNA sequence with a fold back stem loop structure also known as a hairpin from a RNA polymerase Ill H1 promoter Abba
7. 8 3457 inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA H1 RNA promoter 3098 3312 RNA polymerase Ill promoter for expression of siRNA insert SV40 Poly A 3545 3676 Transcription termination and polyadenylation SV40 Ori 3685 3831 Allows for episomal replication of plasmid in aoe cells pUC Ori 4201 4874 C Allows for high copy replication in E coli AmpR 5019 5879 C amb resistant gene for selection of the olasmid i in E coli The notation C refers to the complementary strand ver 4 080514 www systembio com pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 CMV 5 LTR RRE cPPT pSIF1 H1 copGFP pUC ORI shRNA Vector CMV 6 420 bp EcoRI copGFP sv40 bs 7 Sami g SV40 Poly A iss ie 3 ALTR HI Feature Location Function Hybrid CMV promoter R U5 long terminal repeat required for viral packaging and transcription gag 7621011 Packagingsignal O o me ons feagai tansong an packaging of viral transcripts Central polypurine tract includes DNA Flap cPPT 1150 1391 region involved in elre ia and integration of transduced viral genome Human cytomegalovirus CMV constitutive promoter for transcription of copGFP Copepod green fluorescent protein similar to copGFP 1753 2511 regular EGFP but with brighter color as a reporter for the transfected transduced cells Woodchuck h
8. F PCR Primer 10 uM 0 5 ul 5 ul ReverseF PCR Primer 10 uM 0 5 ul 5 ul 50X dNTP mix 10 mM of each 2 5 ul 25 ul 10X PCR Reaction Buffer 19 5 ul 195 ul Deionized water 0 5 ul 5 ul Taq DNA Polymerase 5 U l 24 0 ul 240 ul Total volume b Mix the master mix very well and aliquot 24 ul into each well of a 96 well PCR plate or individual tubes c Add 1 ul of each bacterial culture from C 1 into each well or tube from C 2 b Mix d Proceed with PCR using the following program 94 C 4 min 1 cycle 94 C 0 5 min then 68 C 1 min 25 cycles 68 C 2 min 1 cycle ver 4 080514 www systembio com pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 SI1101B 1 e Take 5 ul of PCR product from step d and run it on a 3 agarose EtBr gel in 1X TAE buffer Clones without an insert will yield a product of 176 bp The expected size of amplified clones with a shRNA template insert should be about 220 240 bp depending on expected length of the shRNA template insert see Fig 2 for details Some clones may not yield a product These are results of recombination during propagation in E coli f Confirm identity of shRNA template inserts by sequence analysis of positive PCR products using the ForwardF PCR primer D Purify shRNA Lentivector Construct a Take 15 20 ul of each positive bacteria culture from Step C 1 c inoculate each clone in 25 ml of LB broth media with 50 ug ml ampicillin and grow overnight at 37 C with shaking b
9. NNNNNNTTTTTG 3 3 GNNNNNNNNNNNNNNNNNNNGAAGGACAGT CT NNNNNNNNNNNNNNNNNNNAAAAACTTAA 5 For each selected template sequence two complementary oligonucleotides the top strand and complementary bottom strand need to be synthesized phosphorylated and annealed before ligation step A 50 uM scale reaction for oligonucleotide synthesis with regular desalting purification is sufficient for cloning into the pSIF H1 Vectors For the best cloning efficiency we recommend to phosphorylate oligonucleotides using T4 polynucleotide kinase The phosphorylation procedure is shown below in step B 1 2 Cloning of shRNA Template Oligonucleotides into pSIF H1 Vector 1 Linearize the pSIF vector with EcoRI BamHI a Setup a 50 ul restriction digest as follows 33 8 ul Deionized water 5 ul 10x NEB 3 buffer 0 2 ul 100x BSA 0 5 wl BamHI 20 U L NEB 0 5 ul EcoRI 20 U uL NEB 10 ul pSIF vector 0 2 ug uL 50 ul Total volume b Digest overnight at 37 C c Purify linearized plasmid DNA using Qiagen Qiaquick PCR purification kit Elute purified DNA in 30 uL EB buffer Page 10 ver 4 080514 www systembio com pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 2 Phosphorylate and Anneal the shRNA Template Oligonucleotides Note This protocol was developed for regular non phosphorylated oligos If your oligonucleotides are already phosphorylated dilute them to 10 uM in 1X T4 polynucleotide kinase buffer he
10. Oxford Univ Press Dull T Zufferey R Kelly M Mandel R J Nguyen M Trono D and Naldini L 1998 A third generation lentivirus vector with a conditional packaging system J Virol 72 8463 8471 Gould D J and Favorov P 2003 Vectors for the treatment of autoimmune diseases Gene Therapy 10 912 927 Lee N S Dohjima T Bauer G Li H Li M J Ehsani A Salvaterra P and Rossi J 2002 Expression of small interfering RNAs targeted against HIV 1 rev transcripts in human cells Nature Biotechnol 20 500 505 Morgan R A Cornetta K and Anderson W F 1990 Application of the polymerase chain reaction in retroviral mediated gene transfer and the analysis of gene marked human TIL cells Hum Gene Ther 1 135 149 Pfeifer A Kessler T Yang M Baranov E Kootstra N Cheresh D A Hoffman R M and Verma I M 2001 Transduction of liver cells by lentiviral vectors Analysis in living animals by fluorescence imaging Mol Ther 3 319 322 Qin X F An D S Chen I S and Baltimore D 2003 Inhibiting HIV 1 infection in human T cells by lentiviral mediated delivery of small interfering RNA against CCR5 Proc Natl Acad Sci USA 100 183 188 Quinn T P and Trevor K T 1997 Rapid quantitation of recombinant retrovirus produced by packaging cell clones Biotechniques 23 1038 1044 Sui G Soohoo C Affar E B Gay F Forrester W C and Shi Y 2002 A DNA vector based RNAi tec
11. P reporters or H2Kk positive cells for constructs in the pSIF1 H1 H2kk vector For shRNA knockdown studies using transfection it is important to optimize the selected transfection protocol and then keep the parameters constant to ensure reproducible results Depending on what is appropriate for your target gene the silencing efficiency of different shRNA constructs can be estimated by determining the concentration of target mRNA using RT PCR assessing the amount of target protein by Western blot or ELISA or assaying for activity of the target protein Usually shRNA constructs with 70 80 silencing efficiency are suitable for gene functional analysis studies Once you identify a functional shRNA construct you can package this construct into pseudoviral particles and efficiently transduce these shRNA constructs into target cells of your choice For this purpose you will need to purchase the pPACKF1 Lentivector Packaging Kit SBI Cat LV100A 1 and 293TN Producer Cell Line SBI Cat LV900A 1 The pPACKF1 User Manual Lentivector Expression Systems Guide to Packaging and Transduction of Target Cells includes the procedural information for packaging the shRNA expression constructs This user manual is also available on the SBI web site www systembio com Although you can create stable transfectants with the pSIF constructs using standard transfection and selection protocols transduction of the lentiviral pSIF shRNA constructs using pac
12. SBI System Biosciences pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual ver 4 080514 pSIF H1 shRNA Cloning and Expression Lentivectors Contents Vi 888 266 5066 Toll Free Introduction and Background Purpose of this Manual Lentiviral shRNA Expression System pSIF shRNA Expression Lentivectors List of Components Additional Required Materials Safety Guidelines 7MOOW gt Protocol A shRNA Oligonucleotide Design and Synthesis B Cloning of shRNA Template into pSIF Vector C Identify Clones with shRNA Inserts ss D E Troubleshooting A Using the Positive Control B Troubleshooting Specific Results References Appendix A Maps and Features for pSIF Vectors B Sequences of Luciferase Control shRNA Template Oligos C Related Products 650 968 2200 outside US Cat s SI100C 1 S1101B 1 Page 1 System Biosciences SBI User Manual A 1 Introduction and Background Purpose of this Manual This manual provides details and information necessary to clone an shRNA template into the pSIF H1 shRNA Cloning and Expression Vectors pSIF1 H1 Puro and pSIF1 H1 copGFP Vectors Specifically it provides critical instructi
13. SIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 e g HEK 293 cells need to be transiently co transfected with the expression and packaging vectors Expression constructs packaged in pseudoviral particles are secreted by producer cells in culture media and could be used directly to transduce expression construct in target cells Following transduction into the target cells this expression construct is reverse transcribed integrated into the genome of the target cell and provides a high level of expression of siRNA For a detailed description of SBI s Lentivector expression system please refer to the Lentivector Expression Systems Guide to Packaging and Transduction of Target Cells user manual The most popular lentiviral expression system is HIV based Federico 2003 Heiser 2004 Machida 2003 Despite improved biosafety features third generation HIV cloning vectors still pose a potential biohazard risk due to the possible recombination with endogenous viral sequences to form a self replicating HIV virus SBI s FlV based Expression system addresses these issues since they are derived from a feline immunodeficiency virus Curran 2002 Sauter 2001 Loewen 2003 Both of SBI s HIV based and FlV based lentivector systems meet Biosafety Level 2 BSL 2 based on the criteria published by the Centers for Disease Control for details see section F 3 pSIF shRNA Expression Lentivectors The pSIF siRNA expressio
14. at at 95 C for 2 min and anneal as in steps 1 d 1 e a Dissolve the shRNA template oligonucleotides in an appropriate amount of deionized water to a final concentration of 20 uM b Set up 20 ul phosphorylation annealing reactions for each experimental shRNA template and Luciferase Control Template Mix as follows 1 yl Top Strand shRNA template oligo 20 uM 1 yl Bottom Strand shRNA template oligo 20 uM 2 ul 10X T4 Polynucleotide Kinase Buffer 2 ul 10 mM ATP 12 ul Deionized water 2 ul T4 Polynucleotide Kinase 10 U ul 20 ul Total volume For the insert minus control use 2 ul deionized water in place of the top and bottom strands For the positive control use 1 ul of the Luciferase Control shRNA Template Mix and 1 ul deionized water Incubate the phosphorylation reaction at 37 C for 30 minutes in a thermocycler Heat the reaction mix to 95 C for 2 min in a thermocycler Turn off the thermocycler and let it cool to room temperature mogao Use 0 5 ul of 1 uM shRNA template for the following ligation reaction 3 Ligate the shRNA Template into Linearized pSIF H1 Lentivector a Setup 10 ul ligation reactions for each phosphorylated shRNA template as follows 1 0 ul Linearized pSIF H1 Vector 50 ng ul 0 5 ul Phosphorylated ds shRNA template step 1 1M 1 0 ul 10X T4 DNA Ligase Buffer 6 5 ul Deionized water 1 0 ul T4 DNA ligase 40 U l 10 0 ul Total volume For negative control use insert minus and for
15. based vectors Proc Natl Acad Sci U S A 2002 Apr 30 99 9 6216 21 Crystal RG Bad for cats good for humans Modified feline immunodeficiency virus for gene therapy J Clin Invest 1999 Dec 104 11 1491 3 Curran MA Kaiser SM Achacoso PL Nolan GP Efficient transduction of nondividing cells by optimized feline immunodeficiency virus vectors Mol Ther 2000 Jan 1 1 31 8 Curran MA Ochoa MS Molano RD Pileggi A Inverardi L Kenyon NS Nolan GP Ricordi C Fenjves ES Efficient transduction of pancreatic islets by feline immunodeficiency virus vectors 1 Transplantation 2002 Aug 15 74 3 299 306 DePolo NJ Reed JD Sheridan PL Townsend K Sauter SL Jolly DJ Dubensky TW Jr VSV G pseudotyped lentiviral vector particles produced in human cells are inactivated by human serum Mol Ther 2000 Sep 2 3 218 22 Derksen TA Sauter SL Davidson BL Feline immunodeficiency virus vectors Gene transfer to mouse retina following intravitreal injection J Gene Med 2002 Sep Oct 4 5 463 9 Haskell RE Hughes SM Chiorini JA Alisky JM Davidson BL Viral mediated delivery of the late infantile neuronal ceroid lipofuscinosis gene TPP to the mouse central nervous system Gene Ther 2003 Jan 10 1 34 42 Hughes SM Moussavi Harami F Sauter SL Davidson BL Viral mediated gene transfer to mouse primary neural progenitor cells Mol Ther 2002 Jan 5 1 16 24 Kang Y Stein CS Heth JA Sinn PL Penisten AK Staber PD Ratliff KL
16. d DNA Replace the reagents if they demonstrate poor activity Ensure that you have not picked plasmids without shRNA template insert Colonies without an insert will yield a product of about 100 bp Please also note that due to recombination you will not be able to amplify any product from plasmid isolated from some of the colonies Always confirm that you have right insert by sequence analysis of PCR product or sequencing of shRNA expression cassette in purified lentivector constructs If problematic you may wish to consider using recombination deficient bacterial strains such as STBL2 Invitrogen Cat No 10268 019 or SURE Stratagene Cat No 200238 Page 16 ver 4 080514 www systembio com pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 D References General references Abbas Terki Blanco Bose N Deglon Pralong W and Aebischer P 2002 Lentiviral mediated RNA interference Hum Gene Ther 13 2197 2201 Buchschacher G L and Wong Staal F 2000 Development of lentiviral vectors for gene theraphy for human diseases Blood 95 2499 2504 Burns J C Friedmann T Driever W Burrascano M and Yee J K 1993 Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors concentration to a very high titer and efficient gene transfer into mammalian and non mammailian cells Proc Natl Acad Sci USA 90 8033 8034 Cann A J ed 2000 RNA Viruses A Practical Approach
17. e 293TN Producer Cell Line SBI Cat LV900A 1 transiently transfected with the pPACKF1 plasmids and an FlV based expression construct produce packaged viral particles containing a lentiviral construct e pSIH Single Promoter shRNA Cloning Vectors HIV based gt pSIH1 H1 Puro shRNA Cloning and Expression Vector Cat SI500A 1 gt pSIH1 H1 copGFP shRNA Cloning and Expression Vector Cat SI501A 1 gt pSIH1 H1 H2Kk shRNA Cloning and Expression Vector Cat SI502A 1 These HIV based single promoter shRNA cloning vectors allow you to clone short hairpin siRNA shRNA templates under the H1 promoter and efficiently transduce these shRNA constructs in a wide range of cells D Technical Support For more information about SBI products to download manuals in PDF format and to get vector map and sequence information please use our web site http www systembio com For additional information or technical assistance please call or e mail us at System Biosciences SBI 211 South Whisman Road Mountain View CA 94041 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail tech systembio com Page 22 ver 4 080514 www systembio com pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 F Licensing and Warranty Statement Limited Use License Use of the pSIF H1 shRNA Cloning and Expression Vector i e the Product is subject to the following terms and condition
18. e product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind
19. epatitis virus posttranscriptional WPRE 2518 3106 regulatory element enhances the stability of the viral transcripts Required for viral reverse transcription self inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA H1 RNA promoter 3257 3471 RNA polymerase IIl promoter for expression of siRNA insert SV40 Poly A 3704 3835 Transcription termination and polyadenylation SV40 Ori 3844 3990 Allows for episomal replication of plasmid in EAA cells pUC Ori 4360 5033 C Allows for high copy replication in E coli AmpR 5178 6038 C oe resistant gene for selection of the plasmid in E coli The notation C refers to the complementary strand 3 ALTR AU3 3227 3616 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual B Sequences of Luciferase Control shRNA Template Oligonucleotides sense 5 GATCCGTGCGTTGTTAGTACTAATCCTATTTGTGAAGCAGATGAAATAGGGTTGGTACTAGCAACGCACTTTTTG 3 E E EE PEP PEP PEPE PPE PPP PEPE PPE PPE PPP PPP PPP PPP 3 GCACGCAACAATCATGAT TAGGATAAACACTTCGTCTACTTTATCCCAACCATGATCGTTGCGTGAAAAACTTAA 5 antisense C Related Products e pPACKF1 Lentivector Packaging Kit Cat LV100A 1 Unique lentiviral plasmids that produce all the necessary FIV viral proteins and the VSV G envelope glycoprotein from vesicular stomatitis virus required to make active pseudoviral particles Th
20. expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2008 System Biosciences SBI Page 24 ver 4 080514 www systembio com SBI System Biosciences System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Tel 888 266 5066 Toll Free in US 650 968 2200 Fax 650 968 2277 E mail info systembio com Web www systembio com ver 4 080514
21. g WPRE in its entirety for its intended use The Product containing WPRE is being transferred to you in furtherance of and reliance on such license Any use of WPRE outside of SBI s Product or the Product s intended use requires a license from the Salk Institute for Biological Studies This license agreement is effective until terminated You may terminate it at any time by destroying all Products containing WPRE in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all Products containing WPRE in you control and so notify SBI in writing This License shall be governed in its interpretation and enforcement by the laws of California Contact for WPRE Licensing The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Office for Technology Management Phone 858 435 4100 extension 1275 Fax 858 450 0509 CMV Promoter The CMV promoter is covered under U S Patents 5 168 062 and 5 385 839 and its use is permitted for research purposes only Any other use of the CMV promoter requires a license from the University of lowa Research Foundation 214 Technology Innovation Center lowa City IA 52242 SBI has pending patent applications on various features and components of the Product For information concerning licenses for commercial use contact SBI Purchase of th
22. h and Safety Web site at http www cdc gov od ohs biosfty ombl4 bmbl4s3 htm It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and always follow standard microbiological practices which include e Wear gloves and lab coat all the time when conducting the procedure e Always work with pseudoviral particles in a Class II laminar flow hood e All procedures are performed carefully to minimize the creation of splashes or aerosols e Work surfaces are decontaminated at least once a day and after any spill of viable material All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory Page 8 ver 4 080514 www systembio com pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 1 Protocol shRNA Template Oligonucleotide Design and Synthesis Typically 4 or 5 target sequences in the gene of interest need to be selected and tested to identify functional siRNAs with at least 70 silencing efficiency of target MRNA Although there is no standard rule for selecting the target mRNA binding sites for siRNA sequences we have found the following criteria
23. here are no ligation inhibitors present EDTA and high salt can inhibit ligation reactions Make sure that your ds shRNA template oligonucleotide concentration is 14M and use 0 1 1 ul of this oligonucleotide in ligation reaction Higher concentration of ds shRNA template oligonucleotide could reduce yield of shRNA lentivector construct Check the quality of the competent cells Handle the competent cells gently Many cells cannot be refrozen once thawed The quality of the competent cells can be tested by transforming with any circular plasmid Check antibiotic selection The plates used for cloning should contain 50 100 pg ml ampicillin in the media You can check the activity of the antibiotic by mixing wild type E coli with small numbers of E coli that have been successfully transformed with any plasmid containing the Amp gene 2 Too many clones without shRNA insert Confirm pSIF vector was completely linearized Run a small aliquot of the EcoRI BamHI digested vector A single band should be observed if not redigest and gel purify Confirm activity of the EcoRI and BamHI restriction enzymes Perform a small scale test digestion on the pSIF vector with EcoRI and BamHI separately to confirm they both are able to linearize the vector If not replace the enzyme 3 No product was amplified from selected clones Confirm activity of the Taq DNA polymerase Test the activity of the enzyme reaction by amplifying a known sequence from any plasmi
24. hnology to suppress gene expression in mammalian cells Proc Natl Acad Sci U S A 99 5515 5520 Wiznerowicz M and Trono D 2003 Conditional suppression of cellular genes lentivirus vector mediated drug inducible RNA interference J Virology 16 8957 8961 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual FIV vector reviews Curran MA Nolan GP Nonprimate lentiviral vectors Curr Top Microbiol Immunol 2002 261 75 105 Curran MA Nolan GP Recombinant feline immunodeficiency virus vectors Preparation and use Methods Mol Med 2002 69 335 50 Loewen N Barraza R Whitwam T Saenz DT Kemler Poeschla EM FIV Vectors Methods Mol Biol 2003 229 251 71 Naldini L Lentiviruses as gene transfer agents for delivery to non dividing cells Curr Opin Biotechnol 1998 Oct 9 5 457 63 Sauter SL Gasmi M FIV vector systems Somat Cell Mol Genet 2001 Nov 26 1 6 99 129 FIV vector applications Alisky JM Hughes SM Sauter SL Jolly D Dubensky TW Jr Staber PD Chiorini JA Davidson BL Transduction of murine cerebellar neurons with recombinant FIV and AAV5 vectors Neuroreport 2000 Aug 21 11 12 2669 73 Brooks Al Stein CS Hughes SM Heth J McCray PM Jr Sauter SL Johnston JC Cory Slechta DA Federoff HJ Davidson BL Functional correction of established central nervous system deficits in an animal model of lysosomal storage disease with feline immunodeficiency virus
25. ign of 27 nt oligos we recommend the program available at Dr Gregory Hannon s web site http katahdin cshl org 9331 homepage sIRNA RNAi cgi type shRNA The program is designed to incorporate a few G U mismatches in the sense portion of stem that will help to stabilize hairpins during propagation in bacteria 2 A hairpin loop sequence between sense and antisense portion The 9 nt loop sequence 5 TTCAAGAGA 3 is most commonly used in RNA silencing experiments Brummelkamp 2002 but we have used a 12 nt sequence 5 CTTCCTGTCAGA 3 which generates similar results Loop sequences of 3 to 15 nucleotides have been used successfully by different investigators 3 ATTTTT terminator sequence for RNA polymerase III 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual 4 A BamHI and EcoRI restriction site overhang sequences for directional cloning of annealed shRNA template oligonucleotides into the pSIF H1 vector 5 Using of initiation G nucleotide in the first position of sense portion of shRNA is not necessary as RNA polymerase III could initiate transcription from any 1 nucleotide of H1 promoter The top and bottom strands of the shRNA template oligonucleotides should be designed to look like the following diagram after annealing See also Figure 1 RNA Pol III BamHI Sense Strand Loop Antisense Strand Terminator EcoRI 5 GATCCNNNNNNNNNNNNNNNNNNNCTT CCT GT CAGANNNNNNNNNNNNN
26. in the enhancer of U3 region of LTR ensures self inactivation of lentiviral construct after transduction and integration into genomic DNA of the target cells e CMV promoter upstream of 5 LTR in pSIF expression vector allows efficient Tat independent production of viral RNA reducing the number of genes from FIV that are used in this system e Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev and the corresponding proteins are expressed from a plasmid lacking packaging signals and shares no significant homology to any of the expression lentivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent virus e None of the FIV genes gag pol rev will be present in the packaged recombinant expression construct as they are expressed from a packaging plasmid lacking packaging signal Therefore the lentiviral particles generated are replication incompetent e Pseudoviral particles will carry only the expression construct of your target gene Despite the above safety features use of FlV based vectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous viral sequences to form self replicating virus or the possibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Healt
27. ion Kit Cat No 28104 For Ligating and Transforming shRNA Constructs e T4DNA Ligase and 10X ligation reaction buffer Recommended New England BioLabs T4 DNA Ligase 400 U l Cat M0202S Before using dilute T4 DNA ligase 10 fold with 1X T4 DNA ligase buffer to 40 U ul e Competent E coli cells RecA Recommended Invitrogen OmniMAX 2 T1 cells Cat C8540 03 e Petri plates containing LB Agar media with 50 ug ml Ampicillin For Screening shRNA Inserts e Taq DNA polymerase and 10X reaction buffer Recommended Clontech Titanium Taq DNA polymerase Cat 639208 e dNTP mix Page 6 ver 4 080514 www systembio com pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 Recommended GE Amersham dNTP set Cat 27 2035 01 e PCR machine e 3 1X TAE Agarose gel For Purifying shRNA Constructs after Cloning e Plasmid purification kit Recommended QIAGEN Endotoxin free Plasmid Kit The following kit combinations can be used for Midi scale preparation up to 200 ug of endotoxin free plasmid DNA gt QIAfilter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Maxi Kit Cat 12362 gt QIAfilter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Buffer Set Cat 19048 Please visit the QIAGEN website to download the specialized protocol that is not contained in the user manual gt http www1 giagen com literature protocols pdf QP15 pdf Transfection of pSIF Constructs into Target Cel
28. ion or transduction of the pSIF H1 Luciferase shRNA construct in the Luciferase reporter cell line B Troubleshooting Specific Results 1 Getting Few or No Clones Check design of the shRNA template Check the sequence of the shRNA oligonucleotides to ensure that after sense anti sense annealing the ends present the 5 GATC and 5 TTAA overhangs for proper annealing with the restricted ends of linear pSIH H1 Vector Also confirm that the top and bottom strand sequences are complementary to each other Check annealing To ensure a high percentage 80 of double stranded DNA after annealing check the concentration of shRNA template oligonucleotides using a spectrophotometer and mix equal molar amounts of each strand To check annealing run 5 ul of annealed insert from step B 1 f using a 12 polyacrylamide gel and compare the band s location with that of the original single stranded oligonucleotides Confirm oligonucleotides were correctly synthesized Verify the size of the oligonucleotides using a 12 native polyacrylamide gel Check quality of T4 polynucleotide kinase and T4 DNA ligase Test the activity of your ligase and reaction buffer using a different vector and insert Test the activity of T4 polynucleotide kinase by labeling annealed control Luciferase with 22B_yATP Replace the reagents if they show poor activity 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual Ensure t
29. kaged pseudoviral particles is the most efficient way to express siRNA in wide range of cells including dividing non dividing and hard to transfect varieties Page 14 ver 4 080514 www systembio com pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 C Troubleshooting A Using the Positive Control The Luciferase Control shRNA Template Oligonucleotide Mix is a mixture of complementary DNA strands with sticky ends 5 GATC and 5 TTAA to match with the BamHI and EcoRI ends on the linearized pSIF H1 Vector The 64 base hairpin shRNA template sequence consisting of 26 base sense 12 base loop and 26 base antisense sequences targets the wild type Firefly Luciferase gene When run in parallel with your experimental annealed double stranded shRNA oligonucleotides Luciferase Control shRNA Template Oligonucleotide Mix serves as positive control to check if your phosphorylation and ligation reactions and transformation procedure work well Using the protocol described in II B ligation with this control insert mix should provide at least 5 10 times more colonies than ligation of the vector without an insert The control pSIF construct with the Luciferase shRNA template can also be used to monitor the efficiency of target Luciferase mRNA silencing A cell line with a constant expression level of Luciferase can easily be generated The level of Luciferase expression should be reduced at least 5 fold after transfect
30. ls e Transfection reagent Recommended Lipofectamine 2000 Invitrogen Cat 11668 027 Packaging of pSIF Constructs in Pseudoviral Particles e In order to package your pSIF shRNA constructs into VSV G pseudotyped viral particles you will need to purchase the pPACKF 1 Lentivector Packaging Kit Cat LV100A 1 The protocol for packaging and transduction of packaged pseudoviral particles is provided in the User Manual for the Lentivector Expression System e 293 Producer Cell Line Recommended SBI 293TN Cell Line Cat LV900A 1 or ATCC 293 Cells Cat CRL 11268 e Transfection Reagent Recommended Invitrogen Lipofectamine Cat 18324 111 and Plus Reagent Cat 11514 015 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual 6 Safety Guidelines SBI s pSIF lentivectors together with the pPACKF1 packaging plasmids comprises a third generation FlV based cloning vector system The original FIV expression system was developed by Eric M Poeschla David J Looney and Flossie Wong Staal at UCSD Poeschla 1998 Poeschla 2003 The feline immunodeficiency virus FIV was originally isolated from cat blood Despite common close exposure of humans to FIV through contact with domestic cats including bites scratches etc no human infection or disease has ever been associated with FIV Poeschla 2003 This system is designed to maximize its biosafety features including e Deletion
31. n system is a third generation of FlV based expression lentivectors developed for gene therapy applications Poeschla 2003 See section F for safety guidelines The pSIF vectors see detailed functional map in Appendix provide the following features e H1 expression cassette provides constitutive and efficient RNA polymerase Ill dependent transcription of shRNA transcripts in wide range of cell lines e CMV promoter promotes high level of expression of copGFP fluorescent reporter or puromycin N acetyl transferase drug selectable marker for detection and selection of transduced cells e Hybrid CMV 5 LTR promoter provides a high level of expression of the full length viral construct in 293 cells e Genetic elements CPPT GAG LTRs necessary for packaging transducing and stable integration of the viral expression construct into genomic DNA e V40 origin for stable propagation of the pSIF plasmid in 293 producer cells e The pUC origin for high copy replication and maintenance of the plasmid in E coli cells e The ampicillin resistance gene for selection in E coli cells WPRE element enhances stability and translation of the CMV driven transcripts e The SV40 polyadenylation signal enables efficient termination of transcription and processing of recombinant transcripts The pSIF1 H1 Puro Vector Cat SI100C 1 contains a puromycin resistance gene to enable drug selection of target cells stably expressing the siRNA The pSIF1
32. nsky TW Jr A highly efficient gene delivery system derived from feline immunodeficiency virus FIV Methods Mol Med 2003 76 405 32 Song JJ Lee B Chang JW Kim JH Kwon YK Lee H Optimization of vesicular stomatitis virus G pseudotyped feline immunodeficiency virus vector for minimized cytotoxicity with efficient gene transfer Virus Res 2003 May 93 1 25 30 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual E Appendix A Maps and Features for pSIF H1 Vectors Page 20 CMV S LTR AmpR RRE PPT pSIF1 H1 Puro s shRNA Vector CMV pUC ORI 6 261 bp EcoRI Puro SV40 ORI BamHI 3 ALTR H1 Feature Location Function CMV S LTR 1 415 Hybrid CMV promoter R U5 long terminal repeat required for viral packaging and transcription 762 1011 Packaging signal 1012 1143 Rev response element binds gag and involved in packaging of viral transcripts Central polypurine tract includes DNA Flap cPPT 1150 1391 region involved in sn translocation and integration of transduced viral genome CMV promoter 1394 1745 Human cytomegalovirus CMV constitutive promoter for transcription of copGFP Puro 1753 2352 Puromycin resistant marker for selection of the transfected transduced cells Woodchuck hepatitis virus posttranscriptional WPRE 2359 2947 regulatory element enhances the stability of the viral transcripts Required for viral reverse transcription self 3 ALTR AU3 306
33. ons on designing and synthesizing shRNA templates cloning the shRNA templates into the H1 expression cassette of pSIF H1 Vectors and verifying final vector constructs This manual does not include information on packaging the pSIF H1 vector construct into pseudotyped viral particles or transducing your target cells of choice with these particles This information is available in the user manual Lentivector Expression Systems Guide to Packaging and Transduction of Target Cells which is available on the SBI web site www systembio com Before using the reagents and material supplied with this system please read the entire manual Lentiviral shRNA Expression System Short double stranded RNAs with sizes 19 29 bp can efficiently mediate gene silencing in mammalian cells by guiding sequence specific degradation of target mRNA sequences Bernstein 2001 Hammond 2000 Synthetic double stranded siRNA molecules can be introduced into cells to suppress gene expression transiently Alternatively shRNA templates can be cloned into an shRNA expression vector such as SBI s FlV based or HIV based RNAi Cloning and Expression Lentivectors and expressed in the cells of choice Lentiviral expression vectors are the most effective vehicles for delivering genetic material to almost any mammalian cell including non dividing cells and whole model organisms As with standard plasmid vectors it is possible to introduce shRNA lentivector constructs in plasmid f
34. orm into the cells with low to medium efficiency using conventional transfection protocols However by packaging the lentiviral shRNA construct in pseudoviral particles you can obtain highly efficient transduction and heritable expression of siRNA even with most difficult to transfect cells like primary stem and differentiated cells The expression construct transduced in cells is integrated into genomic DNA and provides stable long term expression of the target gene Endogenously expressed siRNA effectors provide long term silencing of the target gene and allow the researcher to generate cell lines and transgenic organisms with a stable knockdown phenotype for functional studies The lentiviral siRNA expression system consists of three main components 1 The lentiviral expression vector e g pSIF1 H1 Puro 2 The lentiviral packaging plasmids e g PPACKF1 Packaging Plasmid mix 3 A pseudoviral particle producer cell line e g 293TN cells The lentiviral expression vector contains the genetic elements responsible for packaging transduction stable integration of the viral expression construct into genomic DNA and expression of the siRNA effector sequence The packaging vector provides all the proteins essential for transcription and packaging of an RNA copy of the expression construct into recombinant viral particles For production of a high titer of viral particles producer cells Page 2 ver 4 080514 www systembio com p
35. positive control use Luciferase shRNA template from step 1 Dilute T4 DNA ligase 400 U ul 10 fold to 40 U l with 1X T4 DNA ligase buffer if you are using New England Biolabs enzyme b Incubate the ligation reaction at 16 C for 1 2 hrs 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual 3 Transform E coli with the ligation product a For each experimental shRNA template use the whole volume of ligation product for transformation Follow the manufacturer s protocol for transforming the competent cells Plate an appropriate amount of cells on LB plates with 50 ug ml ampicillin and grow overnight at 37 C You can expect to get at least 10 fold more colonies in the experimental samples in comparison with the negative control vector only ligation reaction C Identify clones with the target shRNA template 1 Prepare colony cultures a Randomly pick up 10 well separated colonies from each plate and grow each clone in 100 ul of LB Broth with 50 ug ml ampicillin at 37 C for 2 hours with shaking Take 1 ul of each bacteria culture for PCR screening see C 2 and continue to grow the culture for another 6 hours Store the bacterial culture at 4 C Screen for shRNA template inserts Page 12 a Prepare a PCR master mix for each clone you would like to screen for the presence of a shRNA template insert as follows trxn 10 rxn Composition 0 5 ul 5 ul Forward
36. s If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms FIV Vector System This Product is for non clinical research use only Use of this Product to produce products for sale or for any diagnostic therapeutic clinical including pre clinical veterinary or high throughput drug discovery purpose the screening of more than 10 000 compounds per day is prohibited In order to obtain a license to use this product for these commercial purposes contact The Regents of the University of California This Product or the use of this Product is covered by U S Patent No 6 555 107 owned by The Regents of the University of California WPRE Technology System Biosciences SBI has a license to sell the Product containing WPRE under the terms described below Any use of the WPRE outside of SBI s Product or the Products intended use requires a license as detailed below Before using the Product containing WPRE please read the following license agreement If you do not agree to be bound by its terms contact SBI within 10 days for authorization to return the unused Product containing WPRE and to receive a full credit The WPRE technology is covered by patents issued to The Salk Institute for Biological Studies SBI grants you a non exclusive license to use the enclosed Product containin
37. s Terki 2002 Qin 2003 Wiznerowicz 2003 The hairpin type siRNA shRNA template oligonucleotides need to be cloned into unique BamHI EcoRI sites located just downstream of an H1 promoter Figure 1 The pSIF H1 vectors are provided in ready for ligation linearized form that has been predigested with BamHI and EcoRI and purified to remove the stuffer fragment The linearized vector contains two unique 5 overhangs to facilitate directional cloning of shRNA template oligos with minimal self ligation background Figure 1 When the shRNA construct is expressed from constitutive H1 promoter and terminated with the TTTTT sequence the shRNA transcript folds into the hairpin structure which is recognized by the DICER enzyme cleaved to form a functional ds siRNA and transferred to a RISC complex for selective digestion of complementary target mRNAs Brummelkamp 2002 Paddison 2002 Figure 2 Two PCR primers are designed for regions flanking the shRNA insert in order to provide a simple way for screening of plasmid clones for the presence of shRNA inserts by PCR Figure 2 Page 4 ver 4 080514 www systembio com pSIF H1 shRNA Cloning and Expression Lentivectors Cat s SI100C 1 S1101B 1 pSIF H1 Vector H1 Promoter 44 EcoRI BamHI P53 shRNA template oligos 1 P Sense Loop Antisense Terminator 5 gatccGACTCCAGTGGTAATCTACcttcctgtcagaGTAGATTACCACTGGAGTCtttttg 3 3 gCTGAGGTCACCATTAGATGgaaggacagtctCATCTAATGGTGACCTCAGaaaaacttaa 5
38. useful e 19 29 nt in length usually longer oligos 25 27 nt are more robust and give better silencing efficiencies although 19 nt oligos could be also used e Unique sequence with less than 70 homology with other mRNA sequences in a RefSeq database Especially avoid homology to other non target MRNA sequences in central portion of siRNA flanking sequences usually tolerate mismatches especially G U and A C without reduction in silencing efficiency e 40 55 GC content e Nomore than 4 consecutive A s or T s e Nomore than 5 consecutive G s or C s e No thermodynamically stable secondary structure lt 0 Kcal mol e A5 terminus 3 5 flanking nucleotides on the anti sense strand should be more AT rich than the 3 terminus The template sequences coding for the shRNA targeted to each selected target site must contain both the sense and anti sense strand and be designed to form a stem loop structure when transcribed In addition both the top and bottom strands of the entire shRNA sequence sense loop antisense terminator must be synthesized and annealed to make a double stranded DNA sequence that can be cloned into the pSIF vector The features of the oligonucleotides coding for the shRNA template sequence should include the following 1 The 19 29 nucleotide sense and antisense MRNA sequences Usually longer siRNAs 25 27 nt have better silencing efficiencies although 19 nt oligos are more commonly used For the des
Download Pdf Manuals
Related Search
Related Contents
nCounter_CNV_Data_Analysis_Guidelines Sussex Historic Landscape Characterisation: Volume I SAP-CMRV1924EH Programme des Rendez-vous aux jardins 2015 dans la Drôme Swingline S7035556 stapler unit ScanMate Copyright © All rights reserved.
Failed to retrieve file