Home

Vector NTI® Express Software User Guide

Contents

1. D gt view contig Name L n Originallen S trimme A Click on contig name in tree S m err S BIK 58 RCCCGTATCANTACAAACGAGTOGAGAGTCCTOTCTTGCCACNTGTCCTTGTTCCACGI ONEI3R 819 819 o ACCCGTATCA TACAAACGAGTGGAGAGTCCTGTCTTGCCACIITGTCCTTGTTCCACGt ONE1SF 567 724 76 lt lt ONELSF ONE16F 689 767 o ONE17R 737 759 o E U Contig2 ONESR 756 756 ONEBR 718 764 44 19 gt gt oner U Contig3 ONEIOF 688 758 70 ONE2R 705 747 42 ONE3R 683 755 59 ONESR 718 770 3 ONESR 720 758 28 g CONTIGACCCGTATCATTACAAACGAGTGGAGAGTCCTGTICTTGCCACCTGTCCTIGTTCCACGGE 7 aan a k Es S lt lt L a Mt P S L Q T S G E S C L a T C P C S T 2 N P Y H Y K R V E 4S P V L P P 1 V P R Add From File Add From Database Delete 3 TH R 1 ET N E 4y R 4 Y So p L 5 E FSSHe G Assemble savecontig ll Contig Viewer Alignment pane The Contig Viewer contains two panes e The Graph Pane displays a graphical representation of the contig assembly The Alignment Pane shows the assembled fragment sequences chromatogram data and translated sequence Contig Viewer The Contig Viewer Graph Pane contains horizontal arrows representing the relative Graph Pane positions of the fragments forming the contig The arrowheads indicate whether the respective fragment is in the dire
2. AU UA 5 7 15 5 1 1 UA AU 8 1 22 6 1 4 CA GU 10 5 27 8 2 2 GU CA 10 2 26 2 2 4 CU GA 7 6 19 2 1 9 GA CU 13 3 35 5 2 7 CG GC 8 0 19 4 2 2 GC CG 14 2 34 9 3 8 GG CC 12 2 29 7 3 3 XX XX 6 0 16 9 1 0 Table 2 RNA Nearest Neighbor thermodynamics continued Notes All values refer to the disruption of a duplex at 1 M NaCl 25 C and pH 7 e The units for dH and dG are kcal mol of interaction whereas those for dS are cal K per mol of interaction The dS value for RNA oligos is adjusted by 10 8 cal K per mol to reflect the entropy associated with helix initiation as it is for DNA oligos The dG value is adjusted by 3 4 kcal mol to account for helix initiation Note that this adjustment is NOT dependent on the base composition of the RNA oligo as it is for DNA oligos refer Thermodynamic Tm Calculation on page 174 Primer Probe Tm For oligos designed using Vector NTI Express s PCR Primers Sequencing Primers and Tanu and Similarity Hybridization Probes features the oligo Tm product Taopt and oligo percent binding Calculations Primer Probe Tm Values similarity are reported in the Text Pane of the Molecule Viewing window Tms for designed primers probes are reported is as follows in Vector NTI Express Therm Tm is reported if the oligo is less than or equal to 35 residues e GC Tm is reported if the oligo is 36 residues or greater For PCR products
3. Zi lt r olw I Zin lt l 000034 Vector NTI Express Software User Guide 171 A Symbols and Formats IUB IUPAC Ambiguity Codes and ASCII Format IUB Formats recognized by Vector NTI Express Amino acids are represented by standard 1 or 3 letter codes 1 Letter Symbol 3 Letter Symbol Meaning E Glu Glutamic acid G Gly Glycine H His Histidine lle Isoleucine L Leu Leucine K Lys Lysine M Met Methionine F Phe Phenylalanine P Pro Proline S Ser Serine T Thr Threonine W Trp Tryptophan Y Tyr Tyrosine V Val Valine B ASX Asparagine or Aspartic acid 172 Vector NTI Express Software User Guide Primer Tm Calculations General Information Vector NTI Express calculates and reports two different melting temperatures for DNA RNA oligonucleotides Thermodynamic Tm Therm Tm and GC Tm Usefulness of Thermodynamic Tm Versus GC Tm Vector NTI Express reports both the Thermodynamic and GC Tm values regardless of the length of the oligo However generally only one of the reported values should be considered useful depending on the length of the oligo as follows Therm Tm useful for oligos that are greater than about 7 10 residues and less than about 35 residues long e GC Tm useful for oligos greater than about 35 residues long Note For oligos that are 7 10 residues or shorter cutoff length depends on the base content of th
4. Cut Copy Delete Delete Select All CHA CYZ Web Analy Homology Modeling using CPHMODELS CBS Protein Feature Search gt Create feature from selection Regenerator BLAST Sequence Back Translation Delete feature Primer Search K Transcription Factors using TESS UPENN Y Edit feature PER K Compare Against gt Homology Modeling using SWISS MODEL ExPASy Back Translation allows you to obtain a DNA sequence from a protein sequence by reversing the translation process You can select from a list of translation and codon usage table options Vector NTI Express Software User Guide 2 Molecule Editor Protein Domain and Motif Finder Analyses 1 With a protein molecule open click on the Back Translation button in the Analysis toolbar EM Choose Table pie O Use Translation Table Use Codon Usage Table Translation Table KA Codon Usage Table es musca Translate into new Nucleotide Back Translation Result M L N Y L L R R K A a ATG CTG AAC GTG CTG CTG AGG AGG AAG GCC 1 T i RAR SAA TTC TGC CTG GTG ACC AAG AAG GGC ATG GCC To TA el IAS Ae AS Cle Hee ACC GCC ACC ACC GCC GCC GCC ACC CAC ACC moe ee OY CCC AGG CTG AAG ACC TTC AAG GTG TAC AGC TOONER VE AE PS AE vi lt gt 2 In the Back Translation Tool select the translation table type Use Translation Table or Use Codon Usage Table 3 Select the specific translation table from the
5. Y TEW is 6Y S NSC TNF H T i 901 TTTAAACCGA GCGAAACCGT GTITAAAATT GIGITTIGGC IGGGCTATCT GAACAGCTGC ATIAACCCGA TTATTTAT AAATTTGGCT CGCITIGGCA CAAATTTTAA CACAAAACCG ACCCGATAGA CITGICGACG TAATTGGGCT Add Attachment to In Silico DNA Sequence Addto5 Terminus Add to 3 Terminus Restriction Site Aarl cacctgc Gateway Site E AGTITET C User Defined Add Attachment s Note Attachments are not optimized for expression Clear all Mutations and Attachments View In Silico DNA Send for Synthesis boc an B jan xw Regenerator tool features The Regenerator tool has two main sequence panes as well as various controls for editing the sequence The top pane contains the input amino acid sequence or DNA sequence and is editable allowing you to add or delete amino acids or bases directly in the sequence The middle pane contains the in silico DNA sequence generated from the mutations selected or entered in the tool Create mutations in the input sequence You can insert delete or substitute amino acids for proteins or bases for DNA in the input sequence directly To insert amino acids or bases place your cursor upstream of the insertion point and type in your desired changes 76 Vector NTI Express Software User Guide Clear mutations View the mutated sequence Refresh the in silico DNA sequence Optimize the expression system and ge
6. 2 In the Records Viewer right click an object or multiple objects then select Duplicate Duplicates of objects are created in the database and included in the current subset The duplicate of an object is named Copy of for example Copy of EPAC Multiple duplicates are numbered for example Copy 2 of EPAC Note Duplicates of objects are not related to the original objects Therefore changes that you make to the original object are not made in duplicates View object properties To view object properties 1 In the Explorer Viewer click Local Database then expand a database 2 In the Records Viewer right click an object then select Properties to open the properties window Note If one object is selected all the named object fields with their values are displayed Some object data like sequence and comments are not stored in named fields and are not displayed in the properties window Export data To export DNA RNA and protein molecules enzymes oligos Contig Assembly projects and BLAST results 1 In the Explorer Viewer click Local Database then select a database 2 In the Records Viewer open the Export Data window e Select an object then click File r Export or e Right click an object then select Export 3 Navigate to the export location 4 Optional Rename the file and or select a new file type then click OK Vector NTIO Express Software User Guide 27 1 Database Explorer Edit data You can e
7. 33 75 81 5 21 58 26 65 33 75 52 82 C Thermodynamic Tm Calculation Notes 174 The Thermodynamic Tm calculation is based on the Nearest Neighbor theory of DNA RNA duplex stability Briefly this theory states that the overall duplex stability and hence the melting temperature of an oligonucleotide can be predicted from the primary sequence based on the relative stability and temperature dependent behavior of every dinucleotide pair in the oligo2 In practice enthalpy 4H and free energy dG values for each of the 10 possible Watson Crick DNA pairwise interactions are used to calculate pairwise entropy dS values via the following standard equation dG dH TAS Note Tis temperature in K The pairwise dH and dS values are then summed to calculate overall values for the oligo under consideration The overall values are used in the following formula3 to calculate the Thermodynamic Tm Therm Tm dH 273 15 16 6 log Na dS dSo R In c 4 e dSo is the entropy associated with helix initiation 10 8 cal mol per K s Ris the Universal Gas Constant 1 987 cal mol per K cis the concentration of the probe in molar units The factor 273 15 corrects for absolute temperature so that the final Tm is in C The pairwise dH and dS values for DNA used in Vector NTI Express are taken from reference 2 Those values along with the corresponding dG values at 25 C app
8. CAH05020 prolactin Nycticebus pygmaeus 2004 07 26 2006 11 14 101278 50657062 220 e E The table of results includes columns appropriate for the database you are querying Click on the link in the Results pane to open the online database record for each result Note Entrez queries are not saved in the Vector NTI Express Software database Vector NTI Express Software User Guide 87 Entrez Search E BLAST and Entrez Searches Editing and To delete an Entrez query right click on it in the Query List pane and select deleting queries Delete search job To edit a query right click on it in the Query List pane and select Edit search 88 Vector NTI Express Software User Guide GenomeBench GenomeBench can be used to download view analyze annotate and save local copies of reference genomic DNA sequences from several principal Distributed Annotation System DAS servers GenomeBench was designed to support the following workflows e Retrieval of genomic data from public DAS servers e Annotating and creating a local copy of a genomic region In support of these workflows it accepts megabase sized genomic sequences and all attendant track annotations All annotated features are linked to their corresponding region of the genomic sequence backbone additional information for any sequence based annotation for example mRNAs ESTs and STSs including other defined features from the GenBank record is easil
9. Full alignment editing capabilities s Dot Plot comparison of any two sequences Open AlignX There are several ways to open the AlignX tool Click on the AlignX button on the main toolbar lt gt IOI 3A a El 90010 ny In Database Explorer right click on a molecule or Ctrl click on multiple molecules and select Alignment to load those molecules into the tool Load an existing AlignX project as described in Manage AlignX projects on page 96 AlignX window The AlignX window consists of the following panes Project Properties pane Contains the Project Description and the Fragments list As molecules are added to an AlignX project they are listed in the Fragments list e Alignment Settings pane Contains the settings used to perform the alignment e Graphs pane Displays a graphical representation of the aligned molecules showing both similarity and sequence complexity Vector NTI Express Software User Guide 95 Align Multiple Sequences Manage AlignX projects highlighted sequences for three more sequences PEOMA MO 20447 za wona Proa Project description Guide tree 3 Graphics pane Fragments list Consensus 825 CTA IcApcDMAI rnare 0I 825 j Iel p DINA3 1Hygro_ 0 ke STR His 825 Alignment pane Alignment settings e ten Manage AlignX projects gt nn s Ek AA r me seq 0 Alignment pane Displays the aligned sequences
10. Min Num Good Reads at Clip Position This is the depth of good coverage at the clip position It applies to the clipping of a poor end region for each read regardless of whether QVs are available Depending on the actual depth of coverage the Minimum Number of Good Reads at Clip Position parameter determines the exact clipping position within the clipping region The larger this value is the more extensive the clipping becomes Default 3 Overlap Tab Overlaps between reads are computed immediately following sequence clipping This step serves as the basis for contig construction In order to ensure the quality each overlap is evaluated with a few measures You can change the rigor of overlap computation The parameters are explained below Overlap Length Cutoff Minimum length required for the length in base pair of all the overlaps Default 40 Vector NTI Express Software User Guide Assembly settings Overlap Percent Identity Cutoff Minimum percent identity of the overlap Default 0 80 e Overlap Similarity Score Cutoff Minimum similarity score for an overlap The score is computed as the sum of match mismatch or gap scores for each pair of bases weighted by QVs Default 900 Base Quality Cutoff for Difference Determines the minimum overlap quality by examining the differences of the overlap at bases of high quality values This is useful only when QVs are available The Base Quality Cutoff for Difference value
11. RAE Display the molecule as linear or circular by clicking on the appropriate button all 2 Vector NTI Express Software User Guide 131 12 Gateway Cloning Gateway Cloning workflow 132 Vector NTI Express Software User Guide TOPO Cloning in Vector NTI Express TOPO Cloning TOPO Technology is a fast efficient way to clone The key to TOPO Cloning is the enzyme DNA topoisomerase I whose biological role is to cleave and rejoin DNA during replication To harness this activity vectors are linearized and each end is conjugated with topoisomerase on the 3 phosphate This enables fast ligation of DNA sequences with compatible ends After 5 minutes at room temperature the enzyme is released the ligation is complete and the recombinant molecule is ready for transformation into E coli Many Life Technologies expression vectors are adapted for one step TOPO Cloning of PCR products in both directional and non directional formats Other vectors contain att recombination sequences exterior to the TOPO cloning sites so that cloned inserts are ready for entry into the TOPO system TOPO vectors can be grouped into three categories based on the nature of their ends Zero Blunt vectors have two blunt ends and can accept blunt ended DNA fragments including amplicons produced by a proofreading polymerase Inserts are cloned in both orientations e T A vectors have two ends with 3 T overhangs They ca
12. To update the In Silico DNA Sequence pane with any mutations click on the Refresh DNA Sequence button In Silico DNA Sequence Expression system Escherichia coli K12 v Genetic Code UNIVERSAL Ma 1 CACCIGCATG GTGTTTCTGA GCGGCAACGC GAGCGATAGC AGCAACTGCA CCCAGCCGCC GGCGCCGGTG AACATTACA GIGGACGTAC CACAAAGACT CGCCGITGCG CICGCTATCG ICGIIGACGI GGGICGGCGG CCGECGECCAC TIGTAATC I S G G S Ss F OCGYV S GN S Y S s V A C H R H S H 1 101 ATICIGGGCG GCCIGATTCI GITTGGCGTG CIGGGCAACA TICIGGIGAT TICIGAGCGTG GCGIGCCATC GCCATCTG TAAGACCCGC CGGACTAAGA CAAACCGCAC GACCCGIIGI AAGACCACTA AGACTCGCAC CGCACGGIAG CGGTAGAC 1 Lv N S A V A Ds s T 8 T vs P FS A Fe V S G 1 i H tY na Optimize the expression system and genetic code e Select the desired Expression system from the dropdown list The in silico DNA sequence will automatically update based on an internal codon usage table for the expression system in Vector NTI Express e Select the desired Genetic code from the dropdown list The in silico DNA sequence will automatically update based on the selection Add attachments You can add the following attachments to the 5 and 3 ends of the in silico DNA sequence Vector NTI Express Software User Guide 77 5 Regenerator Generate a new sequence and send for synthesis Note The 3 end attachmen
13. 65 Vector NTI Express Software User Guide Primer Design Shared Advanced settings Hybridization Description Probes setting P Complementary Select if you are sequencing the complementary strand Strand User Defined Oligo Enter a user defined nucleotide sequence to be evaluated as a probe instead of leaving probe search to the software Analysis Conditions settings For information about additional Analysis Conditions settings see page 60 Advanced settings Click on the Advanced button below the main settings to open the Advanced settings dialog Additional advanced settings are described in Shared Advanced settings on page 66 Shared Advanced settings 66 Click on the Advanced button below the main settings to open the Advanced settings dialog The following Advanced settings are the same for all the primer probe design tools Amplicon tab Click the Amplicon tab to customize parameters relating to the resulting PCR product GC content for the product or a portion of the product and allowed bases adjacent to the primer annealing site can be specified Amplicon setting Description Amplicon GC Enter the minimum and maximum for the desired GC content in the PCR product Next to Primer Choose accepted bases for the four successive bases adjacent to the Annealing Site primer annealing site Set minimum and maximum GC range for a specified length of the amplicon adjacent to the pr
14. GenPept gp gpwithparts Swiss Prot swp TrEMBL EMBL trembl embl Vector NTI Archive pa4 3D molecules pdb Assembly projects Contig Project cepx cep MSA projects Alignment Project IY apr aprx BLAST results Vector NTI Archive ba6 To open a file 1 Click File Open 2 In the drop down list select a subset 16 Vector NTI Express Software User Guide 3 Database Explorer operations Edit Curate Discover Design Confirm Too Import E DNA MSA m Blast results Protein 3D Molecule Exit T Ed Workgroup Shared O In the Open File window navigate to the file select it then click Open Database Explorer operations In Database Explorer you can Create DNA RNA and protein molecules this page gel markers oligos and enzymes page 19 and projects page 33 Import data page 21 and export data page 27 not available in the demonstration version Manage your data by organizing your data into convenient groups subsets and sorting duplicating and deleting data page 23 Edit data page 28 Search the database for text sequence motifs feature types keywords and other information page 28 Open other applications page 30 Copy a molecule page 30 save a molecule page 32 and print molecule data page 33 Create DNA RNA and protein molecules There are five different
15. GeneArt Cloning Design stitching oligos High Order Assembly only Note Create the assembled molecule 146 GeneArt Assembly Wizard This primer design option is available for both Seamless Cloning and High Order Assembly though the length of the PCR primers varies between assembly methods based on their different end homology requirements The primer design rules are described in detail in the GeneArt user guides The PCR primer designs will be saved with the final assembled molecule To design PCR primers to create the necessary homology for a fragment 1 Click in the Amplify column for that fragment 2 The N will change to a Y for that fragment ent Length Orientation Amplify Forward N Reverse Y For High Order Assembly in addition to primer design to create end homology up to three sets of stitching oligos may be designed to create splices across fragments without homology These oligo linkers create a bridge across adjacent fragments to promote recombinational joining in yeast A limit of three sets of stitching oligos may be used in a single High Order Assembly and if stitching oligos are used a total of five fragments plus vector may be included in the assembly This differs from a High Order Assembly without stitching oligos which can include up to 10 fragments plus vector The stitching oligo rules are described in detail in the GeneArt High Order Genetic Assembly System User Guide
16. and 3 intron sequence 3 Use the selection to create a new linear molecule Name it to indicate that it is an exon polylinker 4 Open the exon polylinker file select the exon and delete it Then save the file containing the two concatenated intron sequences 5 Select the file in the Trim vector contaminations task and proceed with trimming Assembly settings Click on the Assemble contig in the workflow the view the assembly settings E Contig Project General Info DemoProject New Project Edit Project seve Project Load Project Export Project Close Project P View Fragments gt Trim ends gt Trim vector contaminations gt Assemble contig gt View Contig Assembly Clipping Overlap Contig Lite Settings Use Quality Values QVs where available Use Forward Reverse Constraints S Y Detect Chimeric Reads M F R Constraints Forward Reverse Delimiter Add s r x Min Dist 0 Max Dist 6000 Assembly tab There are three main check boxes to control some important aspects of the sequence assembly process as shown in the table below Assembly Options Use Quality Values When available base quality values QVs are used to trim poor quality ends compute overlaps between reads construct multiple sequence alignments and generate a consensus sequence Use of such scores is optional when
17. j mm fo x Vector NTI Express Software User Guide Manage ContigExpress projects Manage ContigExpress projects Save and rename a project Open a project Close a project Export a project Navigate the Task List The tools for saving editing and loading projects are located in the Contig Project pane Ly Contig Project E General Info New ContigExpress Project_2012 1 12 9 18 56 New Project Edit Project Save Project Load Project Export Project l Close Project gt MTS w Trim ends Trim vector contaminations Assemble contig gt View Contig To save a new project click on New Project in the pane In the dialog enter a name and any description for the project To save changes to an existing project click on the Save Project button e To change a project name or description click on Edit Project To load an existing project in the database in Database Explorer go to the Projects list double click on the Projects folder select the Contig Assembly Projects folder from the Local Database and double click on the ContigExpress project in the list to open it To load an existing project that has been saved as a cepx or cep file click on the Load Projects button in the Project Properties pane and select the project from the Open dialog To close a project click on the Close Project button If there are uns
18. Express Software checks the information consistency on any of database molecules and recalculates them if necessary Open the Database Explorer 14 The Database Explorer can be opened two ways In Windows click Start Programs or All Programs gt Life Technologies gt Vector NTI Express Vector NTI Express By default Vector NTI Express opens with the Database Explorer screen Vector NTI Express Software User Guide Open the Database Explorer In the main toolbar click the Database Explorer button Ree aa QEA O9OWO amp W Components of the The Database Explorer screen consists of the following components Database Explorer Three databases Database Projects and Results e An Explorer Viewer for navigating among three types of databases The viewer contents change when you click the Explorer buttons below the viewer Explorer bars for opening and navigating the Database Projects and Results databases e A Records Viewer pane for viewing the data and records associated with the Database Projects and Results ASummary Viewer for viewing a snapshot of a selected record Note You can widen narrow lengthen and shorten the size of viewers by clicking and dragging the viewer frames Main Menu d zz TN 5 Toolbar Subset Records Viewer Explorer Viewer Summary Explorer Bars Viewer Drag frames to resize viewers Types of databases There are three types of da
19. bik kelan bes n bl Sachin Sard Rtn et BO lad She 111 Spidey ir soy Bids Hin neg igs ed ba else etka ine Sedge digits ci dis et ea SE 111 Launch Spidey analysis to 111 Analysis JobS SettingS a lk blue ni k hlni la kl data 112 Vector NTI Express Software User Guide 7 Contents Spidey Parameters occ 112 Submit the job si y4 gece a di eae ed 112 View analysis results usiri cy dx SA d all aku EA a i woe E ee 113 CHAPTER 11 Clone28Seq vse sree vice kk kk das 115 bat eh Clon 2980 5545w i nl bere e a he l e a tee nate orl Bet e lon te 115 Clone2Seq WINdOW WW kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk 115 Seleckmolecules tt te ee aa e o de os a 115 Molecule requirements 1 0 e kk kk kk kk ka 116 Display restriction sites in molecules M M W kk kk kk kk kK k kK kK KK KK KK KK KK KK KK kk 116 Generate molecule fragments kk kk kk kK kK kk kK kk kk kk kK kk kk kk kk kk kk kk kk 116 Edit the Fragment Mist lt sola kak dn A dee cei aie arched 117 ModifyfiragimentehdS sennae R bets cede end GEWAD NI nd WEDE hee k h WANA 118 Assemble the molecule kk kk kk kK kk kK kk kK KK kk kk kk kk kk kk kk kk kk kk kk kk ka 118 Multiple fragment cloning kk kk kk kk kk kk kK kK kK kk kK KK KK KK kK kk kk kk kk kK kk kk kk kk 119 CHAPTER 12 Gateway Cloning e e kK KK e cence eens 121 For more informati n esei Se kn da k ya anka ne Sot Pelee be hdr eee oe Rene dent eae 121
20. e Instant overview of project history configure your project submit your request Vector NTIO Express Software User Guide 79 5 Regenerator Generate a new sequence and send for synthesis 80 Vector NTI Express Software User Guide BLAST search Open the BLAST search tool BLAST search settings BLAST and Entrez Searches Vector NTI Express Software includes the search engines BLAST and Entrez Query for querying sequences BLAST Basic Local Alignment Search Tool is a search engine for exploring available public sequence databases for DNA or protein sequence similarities to a query sequence BLAST programs have been designed for speed with a minimal sacrifice of sensitivity to distant sequence relationships BLAST scores have a well defined statistical interpretation making real matches easy to distinguish from random background hits BLAST uses a heuristic algorithm that seeks local as opposed to global alignments and is therefore able to detect relationships among sequences that share only isolated regions of similarity For detailed information on BLAST search types settings parameters search databases etc visit http blast ncbi nlm nih gov Blast cgi e To BLAST search an entire molecule in the database Select the molecule in Database Explorer right click and select BLAST Search Open the molecule in the Molecule Editor and click on the BLAST button on the main toolbar re cle aa e a Z my To BL
21. hh CA EK WEKA KED KE VENAN K Lorde k R NA 41 Enter a sequence o 41 Selecta sequences e kin tl d had ad 42 Cutor copy a SOQUENCe estancias ae dale R AAE RA A REL A n araya d h j 42 Haste a SeQqUenCe emocionar v annmmm j tJ a a 42 Replace a sequence ii da dd R R C dE e 42 Delete a Sequence ooo 42 Reverse Se A el ee de 42 Molecule features ui a A sone uaa alae etn Ge eee Sle 42 Create a molecule feature gt a y lt xS an Ha A n n WE Rett oe we Mead va de canoes 42 Selecta feature ita a an cab bakin ken Ta e eee kd eg Wa EKIN ee ed 43 Hide or display a feature WW kk kk kk kk kk kk kk kk kk kk kk e kk kk kk kk kk kk k 43 Editor delete a feature AA xa kn t d dd Ger Kalak e eee ds Q l n e ay Qa QE An ahd 43 Restriction Analysis Falak xak KE lek E eee ae ae eee eee es il ee 43 Vector NTI Express Software User Guide Contents Selecting enzymes for analysis kk kk kk kk kk kk kK kk kK kk KK kK kk kk kk kk kk kk kk kk k 44 Configuring the enzyme list J L kk kk kk kk kk kk kK KK KK KK KK KK KK KK kK kk kk kK kk kk kk kk ka 44 Filter the analysis results 2 5 3 4 sn kk kk a Se KK kk kk kk kk kk kk kk kk eens 45 Perform the analysis k kk kk kk kk kk kk kk kk kk kK kk kK kk kk kk kk kk kk kk kk kk kk kk kk kk kk 45 ST 9 STs SR SE KV G R eee e a HT a oe eee ET 45 Define start and stop codons kk kk kk kk kK kK kK KK KK KK kk kk kk kk kk kk kk kk kk kk kk kk 46 ORF Types ii bm n m
22. vae gt Attach to 5 Terminus AM Pa Advances Load Save Default AAA The following are the unique settings for Amplify Selection These are also available under the Primers tab if you click on the Advanced button Amplify Selection Description setting Amplicon Must Set the 5 and 3 positions for region of the molecule that must be Include Region of included in the final amplified product Molecule Max bp before Provides additional upstream region where the Primer may be selection made Max bp after Provides additional downstream region where the Primer may be selection made Analysis Conditions settings For information about the Analysis Conditions settings see page 60 Attach to 5 Terminus settings For information about the Attach to 5 Terminus settings see page 61 Advanced settings Primers tab Click on the Advanced button below the main settings to open the Advanced settings dialog For information about the Advanced settings on the Primers tab settings see page 61 Additional Advanced settings Additional advanced settings are described in Shared Advanced settings on page 66 Vector NTI Express Software User Guide 62 PCR Using Existing Oligos settings PCR Using Existing Oligos settings Select PCR Using Existing Oligos to search for suitable PCR primers from among those in the Vector NTI Express Oligo Database With the molecule
23. values for the oligo plus a helix initiation free energy term dGo that is added to better reflect experimentally determined free energy values for tested oligos The value of the helix initiation free energy term dGo depends on the base composition of the oligo2 as follows 5 0 kcal mol for oligos containing any G C base pairs 6 0 kcal mol for oligos composed exclusively of A T base pairs Therefore for the example oligo Total dGo 43 7 kcal mol sum of the pairwise dGo values 5 kcal mol free energy term 38 7 kcal mol The 3 End dG is calculated using the number of 3 pairwise dG values specified in the 3 End Length bp box and is not further adjusted Using Vector NTI Express s default probe and salt concentrations 250 pM and 50 mM respectively and the values for dH and dS calculated above Therm Tm can be calculated as follows dH ThermTm __ _ 973 15 16 6 Log Na dS dS9 RILE s AL 973 15 16 6 Log 0 05 250 x 107 0 4165 0 001987 n Vector NTI Express Software User Guide 175 Primer Tm Calculations Oligos Containing IUB Ambiguity Characters 164 7 273 15 16 6 1 301 0 4165 0 001987 23 49 164 7 a sm A 979 95 2 911 60 0 4165 0 04067 164 7 _ 204 75 4632 355 57 294 75 60 82 C Vector NTI Express adjusts the GC and Therm Tm values accordingly based on th
24. Express Software User Guide Data Loading Monitor Local GenomeBench Projects Click on Add to open the Feature Types Filter and select from all available feature types to add them to the Feature Type list 9 Click on the OK in the Load Fragment dialog to begin the download Note It can take some time for all the features to load but you can start working on features that have loaded before the remaining features are loaded 10 11 You can monitor the download progress by clicking on the Download Progress button on the GenomeBench toolbar f Data Loading Monitor Main Sequence The download time can vary considerably depending on the server connection and data volume When the download is finished the GenomeBench Project viewer will display the Request xenoMrna features intronEst features refGene features wgEncodeGencodeManualV4 feat 7 lincRNAsCTTestes_R features mgcFullMrna features vegaPseudoGene features weEncodeGencode2wayConsPseu wegEncodeGencode2wayConsPseu 7 wegEncodeGencodeAutoV4 features 7 burgeRnaSeqGemMapperAlignTes sestanBrainAtlas features ccdsGene features nscanGene features nestedRepeats features Status InLoading InQueue gt InQueue InQueue InQueue InQueue InQueue InQueue InQueue InQueue InQueue gt InQueue InQueue wegEncodeOpenChromChipMcf7Cm InQueue gt InQueue gt InQueue Time
25. Generate a new sequence and send for synthesis Click on View In Silico DNA to open the newly created DNA molecule in the Molecule Editor You can then save the molecule and copy and submit the sequence for synthesis as described below 78 Vector NTI Express Software User Guide Generate a new sequence and send for synthesis Click on the Go to Gene Synthesis button to go to the Life Technologies GeneArt gene synthesis service website There you can create an account and submit the in silico DNA sequence for synthesis Gene Synthesis by GeneArt Life Technologies Corporation completed the acquisition of GeneArt in December 2010 We have combined the convenience of the Life Technologies online ordering system with cutting edge GeneArt service offerings including GeneOptimizer technology for high quality gene expression and optimized gene synthesis How to Order Configure your project Have us configure your project Direct ordering via online portal lowest Ordering via E mail Additional fees for rate manual processing apply Secure data submission Personal support Fast and easy project design e Project set up by GeneArt scientists 2 e Benefit from more than 10 years of Direct online ordering or project or i experience assistance by our experienced specialists Use the Excel data sheet to transfer your sequence directly to e Actual online project status geneartsupportalifetech com
26. The oligo designs will be saved with the final assembled molecule To select stitching oligos for a particular fragment 1 With High Order Assembly selected click in the Stitch column for that fragment 2 The N will change to a Y for that fragment rientation Amplify Stitch rward N N rward 3 Y N ZEN Kez KAN rward N Y rward Y N 1 When you have selected your desired settings in the GeneArt Assembly Wizard click on the Next button 2 Specify a name for the molecule in the database as well as names for any PCR primers and or stitching oligos Vector NTI Express Software User Guide GeneArt Assembly Wizard 3 The final assembly will be displayed in the Molecule Editor Anobi Resalta Dress angee 2510 Tine 06 12 2012 15 54 08 D rinarceseimere Senge Primer 3 eran Primar e Gangan Primers ARA Leen Witch Olgos ABHA Acana Pa Geneer Primers ADRAJANTCIGRNL A Stitch Oliges ADRALAREIERAC 584 A Snitch Oliges_ADRALAStcCOK 2 RPAC f e E CONTACT TEE Croccascca Sicciseras EE AE accrecactz Lo saa a ME AE R uaaa The source fragments will be listed in the Feature Map under Misc Feature Click on a PCR Primer or Stitch Oligo in the Graphics pane to highlight that feature in the sequence Stitch Oligos ADRALAste GDK2 E A F GCL L SLC CGGGICAIGG CACCGGGGOC CAGUCUCIACE IIGUGICAJIA IGiSAGAGUGA GCAALAGITAA ACCGGIIGAA CITI 70
27. defines high quality bases Default 20 e Max OV Sum at Difference Applies only when QVs are available Each overlap is given a difference score based on the QVs and the Base Quality Cutoff for Difference An overlap with a difference score over the Max QV Sum at Difference value is excluded from contig construction Default 200 Max Clearance for Error Rate Applies even and especially when QVs are not available If the error rate of the overlap is greater than the sum of those of the overlapping fragments plus this value the overlap is not used for assembly The smaller the value the better the quality control of the overlaps Default 30 Band Expansion Size This parameter specifies band expansion size The program automatically determines a minimum band of diagonals for an overlapping alignment between two sequence reads The band is then expanded in each direction by a number of bases specified here This affects the computation of both potential overlaps and true overlaps Default 20 Max Gap Length This is the maximum gap length allowed in an overlap Default 20 Max Num Word Matches This parameter controls the fast method for finding potential overlaps between a pair of sequences For each word in one read at most Max Num Word Matches occurrences of the word in the other read are considered for non gapped extension A larger value forces the program to consider more word matches at the expense of ti
28. flanked by attB sites pDONR vector with attP lt gt Entry Clone with attL You can also create an entry clone by the following methods s Select an existing attB containing DNA molecule From within the Gateway Cloning Tool you can select an already existing attB containing DNA molecule in the database such as a Gateway Expression Clone or a pCMVSPORT6 library for recombination with a donor vector to create the entry clone Vector NTI Express Software User Guide 121 12 Gateway Cloning Gateway Cloning Tool Construct an entry clone by alternative molecule construction methods You can construct your own entry clone using other Vector NTI Express molecule construction methods ensuring that the clone contains the required attL1 and attL2 sites labeled as features as described in Add Entry Clones to Use in LR Reaction then save the molecule in the database and select it directly in the Gateway Cloning tool Step 2 Create an expression clone Using the Gateway Cloning Tool entry clones created from any of the above methods are recombined with destination pDEST vectors in an LR recombination reaction to generate expression clones which can drive expression of the sequence of interest when transformed into host cells Gateway Cloning Tool Open the Gateway Cloning Tool Gateway Project pane 122 The Gateway Cloning Tool contains settings and functions for assembling a Gateway const
29. pane and Sequence Pane GC Content Window Size 11 Properties 1 ji 1 1 i 2 sss 1482 2074 2867 801 TICTACACTA TGCACAGACC ACIGATGGAC AGCAGATCTT AGIGCCCAGC AACCAAGITG TIGITCAAGC TGCCTIW AAGATGICAT ACGIGICIGG TGACTACCIG TICGICTAGAA TICACGGGTCG TIGGITCAAC AACAAGTTCG ACGGA ji 01 TCGCACAGCA CCCACTAGCA CTATTGCCCC IGGAGITGIT ATGGCATCCT CCCCAGCACT TCCTACACAG CCIGC j AGCGICGICGT _GGGTGATCGT GATAACGCGC ACCTCAACAA TACCCTAGGA GCGGGTCGTGA ACCATCICIC CGACG dil j gt Selecting an analysis In the Sequence Info pane 1 Select the graph to display from the Select Graph dropdown list 2 Select any additional settings for the specific graph see Analysis parameters on page 72 3 Click on Refresh Graph to display the graph Vector NTI Express Software User Guide 71 4 BioAnnotator Graph and Sequence panes Graph and Sequence panes The graphs in BioAnnotator display physiochemical properties of the DNA molecule The Graph pane consists of the graphical analyses region a vertical Y axis showing minimal and maximal values of analysis results and an individual horizontal X axis displaying numerical positions in the sequence scrollbars and the legend that displays the name of each analysis At any point along the sequence X axis the value Y axis for the property is derived not just from the specific base at that point but from adjacent bas
30. required to match e Remove additional from 5 3 end refers to the additional bases to be removed 158 Vector NTI Express Software User Guide Fragment trimming Select the vector sequence To add a vector sequence to the list of sequences to the Vector List Click on Import to import a vector sequence from a fasta or gb file or Click on Database to select a file in the database e Click on Remove to remove a file from the list Note The vector sequence may be an existing sequence file or you may want to create a sequence file containing the specific residues to be trimmed Preview the trimmed vector contaminations 1 Select the fragments to be trimmed in the Contig Fragment Tree Make sure the vector s you selected were used to amplify the selected fragments 2 Click on Trim to preview the trimming results for the selected fragments 3 Click on a fragment name in the Contig Fragment Tree to display the fragment in the Fragment pane with the trimmed regions highlighted Trim locations are displayed as red nucleotides in the Fragment pane O Assembly 23 gt d NA leed N hhh NACNN NNNNN NNNNN NNNNN NNNNN NNNNN NNNNN NNNNA GNNNN NNNNN 51 J TCACA TTCTN CGCNG ATGGT TGAGA TGTGT ATAAG AGACA GTTAG NNNN 101 GIGAC ACTAT AGAAT ACAAG CITGC TIGIT CITIT TGCAG AAGCT CAGAA 151 TAAAC GCICA ACTIT GGCAG ATCCG CGGCC GCAGA TCTGA ATICC GGAGA 201 TITGT CCNNG CAGAT GCTGC TGGCC TICTG GGAAT CCTGG ACTGT GATTA 251
31. with aligned regions Guide Tree pane A graphical representation of the degree of similarity among AAATTARTACGACICACTATAGEGAGA The tools for saving editing and loading projects are located in the Project Description region of the Project Properties pane Project Properties 2 lt General Information Name pcDNA3 1AlignProject Description Creation Date 2011 Created By 12 11 Last Modification Date 2011 12 11 Last Modified By Load Project Edit Project coors on 9n Save and rename a e To save a new AlignX project click on Save Project in the pane In the dialog project enter a name and any description for the project To save changes to an existing project click on the Save Project button To change a project name or description click on Edit Project Open a project To load an existing project in the database in Database Explorer go to the Projects list double click on the Projects folder select the Alignment Projects folder from the Local Database and double click on the AlignX project in the list to open it a Name 4 Description Author Modified Projects P 2011 12 11 07 09 14 pcDNA3 1AlignProject a g Local Database E Alignment Projects E Contig Assembiy Projects a Cloning Projects E Remote Database pcDNA6 2AlignProject 96 2011 12 10 11 38 55 Vector NTI Express Software User Guide Close a project Export a project Save consensus s
32. 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 00 03 41 In the Data Loading Monitor features are listed as Loading or In Queue To delete an In Queue feature in the list select it and click on Abort Local GenomeBench Projects Vector NTI Express Software User Guide GenomeBench Projects that have been downloaded can be saved in the local Vector NTI Express database for future access To save a project to the local database i e after downloading the data from the DAS server select File gt Save As and specify a name for the project in the dialog To open a saved project open GenomeBench and click on the Load from z Local Database button Then select the project name from the Existing Genome Projects dialog 91 GenomeBench GenomeBench Project Viewer GenomeBench Project Viewer The GenomeBench Project Viewer contains the following panes Map Overview Feature Map Genome Features and Genome Sequence View Map Overview a m a a j e c Une gt aE Tarm Tess Bea TT Bll Rea TIT Il 1 Tl ACC CI TT ATE x 5 700000597479 dwS 1134341 T LA AM LG L uza LOS TOR TAW AWAN DO Doy Ldr 1 577913 a AAA 2 amp amp w Feature Map FONE conse ay 1 55508 TOONS _OOOOS488 cheS 1099818 MART Te 1 114770 AEN 3 928809 chv3 65
33. AAAGG TGTGC Manage project buttons New Project Ed t Project_ Save Project 251 ATITA TACTA IGTIG GGGGT GAAGT CTATG CCGAA TGCTT AAGTG ACAGC 301 AGCAT TTTTG TICAG AGCCG GAATT GTAAC TTTCA CCACG GTTTC CATCC 351 TACAA CIGTG TGTAA AATCC CCAGC GGATG CAGCC TAMAM ATTIT TAACA lt General Info DemoProject Load Project Export Project close Project gt View Fragments 401 ACCAA GAATT TGCTC AGCIT TTGGC CCAGT CIGIA AACCA IGGCT TIGAA T k Li Trim ends 451 ACTGT CTATG AACTG ACAAA GATGT GCACT ATTCG GATGA GTTTT GTCAA ask List R Trim vector contaminations 501 GGGAT GGGGT GCAGA ATGTC ATCGC CAGGA TGTCA CAAGC ACCCC CTGCT Assemble conti gt d 551 GGATT GAGAT TCACC TGCAC GGCCC CCTTC AATGG CIGGA TAAAG TACTA P view Contig 601 ACTCA GATGG GCTCA CCCCA TAATC CCATC TCCTC GGTCT CTTAA TGGAT 651 TAGGA TGTTC CTGCC TCTGG ATTICA TIGGA GCCAT GCATG TACIT GAAGG Name Len Original Len 5 trimme 3 trimme 701 AGTCA GACAC TTACT GGCAA ATGGG ACATT GGTAG TITIT TITIT TTAAA lt V Fragments m wz EVEYE vV ONE10F 758 758 o o B 755 755 o o Y ONEI3R 765 819 54 o Contig Fragment Tree Haste e S Y ONE16F 765 767 o 2 V ONE17R 759 759 o o V ONE2R 747 747 0 o Y ONEZR 755 755 o o V ONEGR 756 756 9 o A p gt Add From File Add From Database Delete Manage fragments contigs buttons
34. Advanced button below the main settings to open the Advanced settings dialog Advanced settings are described in Shared Advanced settings on page 66 Hybridization Probes Select the Hybridization Probe settings to find oligonucleotides that will hybridize to a selected molecule sequence Vector NTI Express can generate a set of oligos or use user defined or database stored oligos to test for hybridization efficiency with a target molecule With the molecule open in the Molecule Editor select the hybridization region then select Primer Design gt Hybridization Probes from the Molecule Editor toolbar E R Kar Zax 5 ra Primer Design Hybridization Probes A Hybridization Probes Ss j a Search Region Le From 1022 bp To 1039 bp Dd ul Max No of Output 1 Ez E b Analysis Conditions ama G Spey Advanced Load Save Default 1 aae T ARA The following are the unique Hybridization Probes settings These are also available under the Primers tab if you click on the Advanced button Hybridization Descriation Probes setting P Search Region Region for which you want to design the probe Enter the start and end coordinates Maximum Number Enter the number of probes to be found for the region The actual of Output result may contain fewer probes than this number if there are not enough possible designs DNA RNA Select the type of nucleotide sequence
35. Analysis Monitor will open with the Sim4 Analysis settings selected and the selected molecule s listed Vector NTI Express Software User Guide 109 Sim4 and Spidey Analysis Sim4 The analysis window has an Analysis Jobs pane containing the analysis settings and an Analysis List pane listing the molecules loaded in the tool Analysis Jobs Name AnalysisType Description Status Modified Date A Sim4Analysis of BRAF Sim4 ibed and spliced DNA seq New Submit Sun Dec 11 11 17 17 PST 20 Sim4 d Sim4Analysis of CDK2 sima i ibed and spliced DNA seq 7 New Submit Sun Dec 11 11 17 18 PST 20 igning a transcribed and spliced DNA seq Name CREB1 from to Strand s Direct Complementary Both wv Sim4 Parameters Word size 1 15 12 Limit of Score Drop off 12 Search for Small Exons No O Yes Diagonal Distance 10 Y Allow ambiguity characters Weight factor for linking HSPs wv HSP score threshold First Stage Second Stage Analysis Jobs Molecule and strand to analyze settings In the Analysis Jobs pane Select the molecule from the Name dropdown list Specify the Strand to analyze The Both option searches both strands and reports the best result Sim4 parameters Word Size The number of DNA bases in a size unit The larger the word size the faster and less sensitive Sim4 becomes Limit of Score Drop off The trigger for stopping ungapped extension Se
36. Gateway Cloning Workflow 0 0 kk ccc ncn KK KK K k KK KK ne KK kk ne ees 121 Gateway Cloning Tool n n kk kk kk kk kk nnn kk kk kk kk kk kk kk ene en kk kk 122 Open the Gateway Cloning Tool JM kk kk kk kk kk kk kk KK kK KK kk kK kK KK KK kk kK kK kk kk 122 Gateway Project Dange kk kk kk kk kk kk kk kK kk kK kK kk kk kk kk kk kk kk kk kk kk kk kk kk 122 Task List pane ccoo a a tee e ls Aka Gr 123 Current n a arta k da 124 Create save and load projects kk kk kk kk kk kk KK kK kK KK kk kk kk kk kk kk kk kk kk kk kk ka 124 Gateway Cloning workflow 0 cc cece kk kK kK KK kK kk kk nent kk kk kk kk kk kk kk 125 O ai gale tania ie weed aed ee eaters he 125 Amplify fragments to Use in a BP reaction kk kk kk KK KK KK KK KK KK KK KK KK KK KK 125 Recombine Entry Clones by BP WWW kk kk kk kk kk kk kK kK kK KK kk KK KK kk kK kK kk kk kk kk 127 Preview Entry Clones kk kk kk kK kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk ka 129 Add Entry Clones to Use in LR Reaction kk kk KK KK KK KK KK KK KK KK KK KK KK 129 Create Expression Clones by LR Mkv kk kk kk kk kk kk kk kk kK kK KK kk kK kk kk kk kk kk kk kk 130 Preview Expression Clones n kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk 131 CHAPTER 13 TOPO Cloning e kk KK KK RR KRE KK RR KE k 133 TOPO Cloning in Vector NTIO Express 2 0 06 LL WWW EWE E E KK KK KK KK KK KE KK KK KK KK 133 TORO Clon
37. GeneArt Assembly Wizard MWW sk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kK kk kk kk kk ka 144 Assembly Settings s sraa kaymak kl we A A 144 Add and organize fragments kk kk kk kk kk kk kK kK kk kK kk kK kk kk kk kk kk kk kk kk k 144 Design PCR primers to create end homology WWW kk kk kk kk kk kK KK KK KK KK KK KK 145 Design stitching oligos High Order Assembly only 00 0 c cece cece eee e ee 146 Create the assembled molecule 146 CHAPTER 15 Parts Assembler KK kk kk KK KK KK KK 149 Additional Information about Parts and Standards 0 0 kK KK KK KK KK KK eee 149 Using the Parts Assembler ce ta di ogden ads class 149 Selecting Rants 9st e aie te ne a sk ee ah ee e Ada WE ee o NT al ae eae 149 Restrictions on Parts xw ya ka w k kan ka aa bal kulk k yk Wu See eae Fe ale khan d ya Bee Ae dana 150 Assembly Settings KL suka y d cece Wi EWAN biba A KA di ee ae ie KE a 150 Completing and previewing the assembly WW kk kk kk kk KK kK KK KK KK KK KK KK KK KK KK 151 Viewing the assembly in Molecule Editor 152 CHAPTER 16 Contig Assembly using ContigExpress 153 About this Chapter cerco velo WE sla WA la nated dade nati days NA H d Kek Eek CARR rerenens 153 Open ContigExpress lt s k Xuya kan KENA MAR BRAN NENN oes td Maye n Ses Cee eee eS 153 GontigExpress WIN OW 2 S a 2 a E T Na a eid Geen Sad cee gas e MIR Rana di oe hela ath eee ts 154 Manage ContigExpress projects cece
38. Note Host Name field If the Workgroup Shared Database Admin application and Vector NTI Express Software are not installed on the same computer enter the IP address of the computer on which the Shared Database Admin application is installed The IP address is shown in the cmd exe window TCP server running at tcp 167 116 197 164 8002 Cot hers can connect gt 3 Click Connect 4 Close the Connect to Workgroup Shared Database window Your connection will not be broken Add users to a You must be an administrator to add users to a workgroup shared database workgroup shared To add users to a workgroup shared database database 1 In C Program Files Life Technologies Vector NTI Workgroup Shared Database Admin h2_setup double click startSharedServer to start the server 2 Double click the Shared Database Administration icon on your desktop to open the Login window 3 Log in s Database Hostname IP localhost e Administrator username admin e Password admin 36 Vector NTI Express Software User Guide A user name should be one word without spaces Edit users in a workgroup shared database Delete users from a workgroup shared database Upload data to a workgroup shared database Download data from a workgroup shared database Disconnect from a workgroup shared database Set preferences 4 Click Login to open the Shared Database Administrator window 5 Click Add then enter information in
39. Position WWW Source 5 Click the Comments tab to enter comments about the enzyme 6 Click the Keywords tab to add or remove keywords that will improve database searches Edit gel marker To edit a gel marker properties 1 In the Explorer Viewer click Local Database then select Gel Markers 2 In the Records Viewer right click a gel marker then select Edit Vector NTIO Express Software User Guide 29 1 Database Explorer Open other applications 3 In the General tab of the gel marker window click the button to select a name for the gel marker 4 Click the Gel Marker tab to edit the following properties Fragment Lists by length all the fragments making up the marker Click Add or Delete to add a fragment to the marker or remove a fragment from the marker Fragment length in b p Enter the length of the fragment in base pair bp then click Add Description Enter or edit the gel marker s description Open other applications You can right click on DNA RNA and protein molecules in the database and open the following applications Web Analyses see page 50 Analysis Monitor see Chapter 10 on page 109 e BLAST Search see Chapter 6 on page 81 e BioAnnotator see Chapter 4 on page 71 AlignX see Chapter 8 on page 95 To open other applications 1 In the Explorer Viewer click Local Database then select DNA RNA Molecules or Protein Molecules 2 In the Records Viewer right
40. RNA and protein molecules n n nnna 000 cece kk kk kk kk kk kk kk kk kk kk kk kk k 17 Create a DNA RNA moleculas Pee kk kk kk kk kk KK KK KK KK KK KK KK KK KK kk k 18 Create a Protein molecule j lt xn sk la En Ll lake l ka a lay d buk Qal b kak n 19 Create gel markers oligos and enzymes kk kk kK KK KK KK KK KK kK KK KK KK KK kk kk 19 Create a gel marker kk kk kk kk kk kk kK kk kK kK kk kk kk kk kk kk kk kk kk kk kk kk kk kk 19 Cr atean Oligo niatan deste pe ei 19 Create anienzyme ois Ka E eed vee na e nene e vin Pens W net vdeo vee vended avay kud e ead 20 Inport data a 2 sect ih Pe ee ihe cinta e JT EEHEERRHH HHHH HH 21 Importimoleculesis Da a N tee ase e e AE we ae ee ee tee Bee 21 File formats ciar vda ve mew ve ka ah n hatreds fe Mine yal re be do kune kul Ba ur ea h 21 M Ort tiles oe weed on ee i ee a tee he ee gle da il te 22 Manadgeidata cit ster Al ns E betes ee eee el dan oa ld al a6 23 Manage Database Projects and Results databases 000 KK KK KK eee ee 23 Manage Database Projects and Results subsets kk kK KK KK 00 cece KK KEK KK 23 Manage database objects kk kk cee kk kk kk kk kk kk kk kk kk kk 25 S T T H TT 28 Edit enzyme properties kk kk kk kk kk kk kk kk KK kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk 28 Editoligo properties ee elated debt tee oe ca AE de 29 Edit gel marker properties WW kk kk kk kk kk kk
41. Selection to Complementary Molecule features Create a molecule feature 42 Molecule features are regions of a DNA or protein sequence that you define and annotate The feature is then displayed in the Graphics pane and listed in the Feature Map Typical DNA molecule features might include coding regions specific ORFs primer binding sites etc Protein molecule features might include structural features binding sites functional domains etc To create a molecule feature 1 Select a portion of the molecule sequence by dragging in the Graphics pane or in the Sequence pane 2 Right click and select Create feature from selection 3 In the Feature dialog select a category from the Feature Type list Various miscellaneous categories are available under Misc Vector NTI Express Software User Guide Select a feature Hide or display a feature Edit or delete a feature Restriction Analysis Feature dialogs for DNA left and protein right ra s r ks Feature X E Feature Feature Type Feature Name Feature Type Feature Name 3 cos A ccdB 2 Bond Modifications 23 Cellular ER di Gy Post Translational Modifi ERS 93 Centromere S Protein Functional Features 2 Conflict 3 D Loop S E DNA RNA Binding DA D Segment 3 Basic 3 Enhancer 83 HMG Box 23 Exon 3 Homeodomain 3 GC Signal 97 H T 23 Glycosylation Site ZM Zinc Finger 23 Homeodomain E DNA RNAbinding B
42. To save database molecules 1 Click File Save in the main menu or Click File Save As to save the molecule with a different name and or to a different location a Enter anew name for the molecule b Select the destination folder for the molecule Optionally save the object as a file Select the file type For DNA RNA molecules Genbank Genbank Old Format EMBL Fasta DDBJ or ASCII text For protein molecules ASCII text GenPept GenPept Old Format Swiss Prot Fasta or TrEMBL 2 Click OK 32 Vector NTI Express Software User Guide Manage the Projects database Print molecule To print molecule data data 1 In the Explorer Viewer click Local Database then select DNA RNA Molecules or Protein Molecules 2 In the Records Viewer double click a molecule to open it 3 Right click in the Properties Viewer Molecule Editor or Sequence Viewer then select Camera to take a screenshot 4 Open an application such as Microsoft Word Excel Paint or Notepad and paste the screenshot 5 Print the data from the application Manage the Projects database You can perform the following operations to manage the Projects database Create a project page 33 e Open a project page 33 Manage Projects subsets page 33 Delete Projects subsets page 34 Create a project To create a project 1 In the main menu click File New then select the type of project you want to create e Alignment Gateway Cloni
43. User Guide 153 Contig Assembly using ContigExpress Open ContigExpress Load an existing ContigExpress project as described in Manage ContigExpress projects on page 155 ContigExpress The ContigExpress window consists of the following panes window Contig Project pane In this pane you open save and close projects navigate Contig Project pane 15 contig Project O assembly 23 154 tasks and add organize and assemble your sequencing fragments This pane includes the following features Project management buttons Task List Contig Fragment Tree Contig and fragment management buttons e Fragment Sequence Viewer Displays the sequence of the selected fragment and any trimmed bases as well as a chromatogram of the fragment Trimming assembly settings see pages 156 164 Settings for trimming and assembling fragments Contig Viewer shown on page 166 Displays the contig assembly in graphical form with the overlapping assembled fragment sequences and chromatograms The Contig Viewer includes the following subpanes Graph Pane Alignment Pane Fragment Sequence Viewer 1 CAATT NICGA TGATG GTIGA GATGT GTATA AGAGA CAGAT GAAGA GCCAA 51 AACAC TGGTG CICCA TIGIC TATTA TGAGC TCAAC AACCG TGTTG GAGAA 101 GCTTT CCATG CCTCC TCCAC AAGTG IGITG GIGGA TGGCT TCACC TGATC 151 CTICA AACAA CAGGA ACAGA TITIG CCTTG GGCCT TCTGT CCAAT GTGAA lt 201 CCGAA ACTCG ACCAT TGAGA ACACC AGGCG GCATA TIGGA
44. Vector NTI Express reports the GC the assumption being that the majority of PCR products are larger than 35 residues Tagpt Values The PCR product Tagp optimal annealing temperature for amplification of the fragment in C is calculated using the following formula3 Taopt z 0 3 TMprimer 0 7 Tm product 14 9 C Notes e TMprimer is the Tm of the less stable primer of the pair Vector NTI Express Software User Guide 177 Primer Tm Calculations Primer Probe Similarity Values TMproduct iS the Tm of the PCR product Primer Probe Similarity Values References 178 When designing PCR sequencing or hybridization primers Vector NTI Express reports the overall similarity in percent of an oligo to its binding site based on the oligo s nucleotide composition For oligos containing IUB ambiguity symbols three similarity values are reported Minimum Similarity Maximum Similarity e Average Similarity For Minimum Similarity all ambiguities are classed as complete mismatches i e they are assigned values of 0 at each position For example a 20mer containing 2 Rs and 2 Ns has a Minimum Similarity of 80 For Maximum similarity all ambiguities are considered identical to their cognate nucleotides i e they are assigned values of 1 at each position so the Maximum Similarity is always 100 For Average similarity Vector NTI Express weights each ambiguous nucleotide depending on whether it represent
45. also discard chromatograms for all fragments after import using Project gt Discard All Chromatograms command Full Contigs only Check this box to perform assembly in Full Contig mode You can retrieve chromatograms and maintain dynamic links between the contigs and their component reads Lite Contigs only Check this box to perform assembly in Lite Contig mode All linkage between the contigs and sequence reads will be lost and no chromatogram is retrievable in the Contig Viewer Lite contigs if selected Creates Lite Contigs during the assembly process only if the more than lt gt fragments selected number of fragments is greater than the number specified otherwise creates full regular contigs Perform the assembly 164 After you have selected the trimming and assembly settings select the fragments you want to assemble in the Contig Fragment Tree and click on Assemble Assembly may take some time depending on how many fragments you selected Vector NTI Express Software User Guide Save delete and rename contigs When assembly is complete the assembled contig s and any unassembled fragments will be listed in the Contig Fragment Tree shown below and displayed in the Contig Viewer see next page Name Len Original Len 5 trimme 3 trimme lt U Contig1 ONE10F 688 758 70 0 ONE11R 717 755 38 0 C ONE13R 819 819 o o ONe1sF 567 7
46. button on the main toolbar and for the database type enter structure Save downloaded pdb files in an appropriate file location and access them using the tool as described below Open a molecule in 3D Molecule Viewer 1 To open a PDB molecule in the 3D Molecule Viewer click on the 3 D Molecule Viewer tool on the main toolbar or select it from the Discover menu colarse C3 oo ovo i w 2 In the Open dialog select a pdb file to open it To open a different molecule select File gt Open gt 3D Molecule Note The PDB file you open will remain open in Vector NTI Express until you close the window and you can navigate back to it by clicking the 3 D Molecule Viewer button Vector NTI Express Software User Guide 105 3D Molecule Viewer Elements of the 3D Molecule Viewer window Elements of the 3D Molecule Viewer window The 3D Molecule Viewer window consists of three panes 20 El gt E Molecule Display pane Outline pane 3D Molecule Viewer E Properties 6 3 IES E ua2s Properties pane Tey Property Value BR eoad lt m si 2 PRO 38 el e Graphics pane displays the three dimensional structure of the molecule e Properties pane lists any properties associated with the molecule e Outline pane lists the amino acids in the sequence The right click menu in the Molecule Display pane contains information about the molecule and tools f
47. called a Parities alignment These scores are then used to calculate a guide tree or dendrogram which determines the order in which the sequences are aligned The sequences are then aligned in larger and larger groups until the entire sequences are incorporated in the final alignment Using the additional settings you can designate the scoring matrix used by the algorithm rather than the algorithm making the choice as is done in a traditional Clustal W alignment Clustal W EBI This selection uses the Clustal W algorithm developed by the European Bioinformatics Institute EBI Molecule type Select DNA or Protein from this dropdown list Pairwise alignment These settings control pairwise distances based on the Clustal W algorithm selected The Alignment Type options control the speed sensitivity of the initial alignments e Fast approximate method Slow more accurate method uses two gap penalties for opening or extending gaps and a full amino acid weight matrix By default this slower method is used Vector NTI Express Software User Guide 99 Align Multiple Sequences Alignment settings There are two groups of parameters depending upon which method above is chosen Slow options Description DNA Weight Matrix IUB default or Clustal W Gap Open penalty The penalty for the first residue in a gap Gap Extension penalty The penalty for additional residues in a gap Fast
48. changes in the fragments cause an immediate recalculation and redisplay of the consensus sequence If necessary editing changes in the contig consensus are reflected immediately in the fragment sequences that comprise the contig Note Since fragments in a contig can also be present in contigs from other assemblies in the project such edits are allowed only after you confirm that you are aware that any other assemblies containing the fragment may be dismissed You can enter A T G C N and other acceptable ambiguous nucleotide designations specified by IUB codes refer to Appendix A Symbols and Formats IUB IUPAC Ambiguity Codes and ASCII Format Insertions made in the consensus will be updated to all fragments that map to that position in the consensus Note Gaps will appear in the fragment chromatograms as you add symbols In the Alignment Pane position the cursor immediately ahead of the desired position in a fragment or the consensus and press the Delete button on the keyboard one or more times You can also select a continuous stretch of bases and use the keyboard Delete button to remove them Deletions in a fragment will update the consensus Deletions made in the consensus will be updated to all fragments that map to that position in the consensus Since fragments in a contig can also be present in contigs from other assemblies in the project such edits are allowed only after you confirm that you are aware that any other asse
49. click a molecule then select an application Copy save and print molecules Copy a molecule by taking a screenshot with the Camera tool Save the screenshot as text or as an image in an application such as Microsoft Word or Microsoft Excel Print the text or image Copy a molecule Use the Molecule Editor to copy molecules In the Database Explorer open the Molecule Editor by opening a molecule 1 In the Explorer Viewer click the DNA RNA Molecules folder or the Protein Molecules folder in the Local Database folder to display the molecules in the Records Viewer 2 In the Records Viewer double click a molecule to display a graphical map of a molecule and its sequence The Explorer Viewer is replaced by the Properties Viewer The Records Viewer is replaced by the Molecule Editor The Summary Viewer is replaced by the Sequence Viewer 30 Vector NTI Express Software User Guide Copy save and print molecules Note You can widen narrow lengthen and shorten the size of the viewers and Molecule Editor by clicking and dragging the viewer frames For more information about the Molecule Editor see Chapter 2 on page 39 peores aca m a a e060 N S y N i n Molecule Properties __ A e Editor Viewer wees Eai lt Arab xn mens Sequence Viewer Copy molecule properties feature map and analysis results To copy molecule properties feature map and analysis results 1 In the Explorer Viewer cl
50. e To add them to the Oligos List right click on a primer probe sequence in the Molecule Editor Analysis Results pane and select Add Primers to Oligo List Analysis Results nm E SequencingPrimers S E Sequencing Primers 1028 to 1252 S O Sequencing Domain 1 from 1028 to 1252 e 0 rm Collapse Branch y Camera y Add Primers to Oligo List Save Primers to Oligo Database Save All Analysis Results to Database o Time 15 Vector NTIO Express Software User Guide 59 Primer Design Find PCR Primers Inside Selection settings Find PCR Primers Inside Selection settings 60 Select Find PCR Primers Inside Selection to design primers within a selected region or the entire molecule for PCR amplification With the molecule open in the Molecule Editor select the region to be sequenced then select Primer Design gt Find PCR Primers Inside Selection from the Molecule Editor toolbar A Primer Design Find PCR Primers Inside Selection KA Find PCR Primers P Region of Analysis F From 2136 bp To 2930 bp n a GO Product Length LE Min 596 bp Max 795 bp S l E s Max No of Primers 5 2 gt Sprey gt Analysis Conditions 1 gt Attach to 5 Terminus Advances Loza save Default T AAA The following are the unique settings for Find PCR Primers These are also available under the Primers tab if you click on the Advanced button Find PCR Primers sett
51. inside primers and attached nucleotide sequences if any In the drop down menu specify the REN subset Enzymes will be checked for the presence of their sites in the primers and attached sequences and within the PCR product Pairs tab Click the Pairs tab to specify how closely parameters such as Tm and GC etc must match between two primers in a generated primer set Pairs setting Description Tm Difference Enter difference in degrees Celsius between T for sense and antisense primers GC Enter the difference between GC percentages for sense and antisense primers Primer Primer Complementarity Check the Permitted box for primer primer complementarity enter the minimum permitted value for duplex free energy Primer Primer 3 End Complementarity Check the Permitted box for primer primer 3 end complementarity enter the minimum permitted value for duplex free energy Similarity tab Click the Similarity tab to determine the similarity relationship between the primers and the target sequence Similarity setting Description Best Fit Check this button to specify the search for site s with maximum similarity with no set threshold With Similarities gt Similarity Threshold Check this button to indicate similarity site search above the specified similarity threshold Similarity Threshold Enter the percentage of minimally acceptable similarity La
52. is selected by default and in the Minimum Size field the minimum size in base pairs is specified as 150 This can be changed according to your requirement Check the Nested check box to look for nested ORFs These are ORFs that occur within the main ORF Incomplete Check the Incomplete check box and in the Minimum Size field specify the minimum size in base pairs for the incomplete ORF to be displayed Check the Undefined Start Stop check box to search for ORFs with undefined starts stops or both Check the Nested check box to look for nested ORFs Note An ORF with an undefined start is one that has a stop codon at the end but no corresponding start codon in the same frame An ORF with an undefined stop is one that has a start codon but no stop codon in the same frame Incomplete ORFs are displayed as a dashed arrow in both the Graphics and the Sequence Pane Complete ORFs are displayed as solid arrows Perform the Click on Run to perform the ORF analysis The ORFs will be marked with directional analysis arrows in the Graphics and Sequence panes and listed in the Analysis Results The results of ORF analysis are saved with the molecule va sie ccdB f pDESTR4 R3 Vector lIl 4555bp al 501 CIGACATITA TATICCCCAG AACATCAGGT TAATGGCGTI IITGATCICA TITICGCGCI GACTGTAAAT ATAAGGGGTC TIGTAGTCCA ATTACCGCAA AAACTACAGT AAAAGCGCC zarar 601 CACACTGGCC ATATCGGIGE TCATCATGCE CCAGCTTTCA TCCCCGATAT GCACCACCEC GTETGACCEG TATAGCCACC AC
53. kK kK kk kk kk kk kk kk kk kk kK kk kk kk kk kk kk kk 29 Open otherapplicati0nS8 ss suk Pn eee na ku se oes Gedo ett de We e kaw ana p Sed Pek eb SEE di a nae 30 Copy save and print molecules MM kk kk kk kk kk kk kk kk kk kk kk kK kk kk kk kk kk kk kk kk kk kk kk kk 30 Copy E aT Ep a o a ol ALS E estada 30 Save a mol cule a sya a kad khan E saa y a B e h kla xin anne oe kan n a ea 32 Vector NTI Express Software User Guide 3 Contents Print molecule data sanan s 1322 cece cece een RR bl n Mara yda R AA Kula X a 33 Manage the Projects database 0c cece kk kk kk kk kk kk kk kk kk ka 33 Cr at a projects a dis Mince eed QE WR baya e W n kaks W a ak QEWA ees hits 33 Opena projectes ste ie DE eb AWA DEDE ADE dl E XEN o Se 33 Manage Projects subsets J Jk kk kk kk kk kk kk cece kK kk kk kk kk kk kk kk kk kk kk kk kk k 33 Delete Projects subsets MJ kk kk kk kk kk kk kK kK KK kk kk KK kk kk kk kk kk kk kk kk lk kk kk kk kk k 34 Manage the Results database WWW kk kk kk kk kk kk kk KK KK KK KK kk kK kk kk kk kk kk kk kk kk kk kk ka 34 VIEW RESUIES 2 ob 34 Manage Results subsets LL kk kk kk kk kk kk kK kk KK kk kK kk kk kk kk kk kk kk kk kk kk kk k 34 Workgroup Shared Database WWW kk kk kk kk kk kk kk kk kk kk kK kk kk kk kk kk kk kk kk kk kk kk kk ka 34 About workgroup shared databases kk kk kk kk kk kk kK kk kK KK KK KK kk kK kk kk kk kk k 35 Connect to a workgroup shared databa
54. molecule open click on the Restriction Analysis button on the Analysis toolbar Vector NTIO Express Software User Guide 43 2 Molecule Editor Restriction Analysis The Restriction Analysis tool includes commands for selecting and configuring a list of restriction enzymes and running the analysis Pe 2104 Selected Restriction Enzymes Name Recognition String i Aarl cacctec i Aatll gacgtc gt Acc65l ggtacc R Accl gtmkac A Acelll casete T Acil cege ABA H Acil aacgtt ste Acul ctgaag a Afel agcgct pa ant cttaag E ta sina Spey Clear Selection Configure List Permitted Terminus Types S 3 Y Blunt Ignore RENS having less than 3 K i sites More than 4 sites v Selecting enzymes A default list of restriction enzymes to be used in the analysis will be selected for analysis Click on enzymes in the list to select or deselect them e To clear the list click on Clear Selection To select all the enzymes in the list click Select All Configuring the 1 To configure the enzymes in the Restriction Analysis tool click on Configure List enzyme list 2 Use the commands in the Selected Restriction Enzymes dialog to add or remove the selected enzymes then click on Apply E Selected Restriction Enzymes Selected Enzymes Enzymes in Database SSE Name Recognition String Aarl cacctgc Aatll gacgtc Acc65l gstace Acci gtmkac Acelll cagcte
55. page 39 for information on identifying and naming features Vector NTI Express Software User Guide Preview Expression Clones Gateway Cloning workflow To select a pDEST vector e Click on the Add button and select the pDONR vector from the database e To remove a vector from list select it and click on Remove e To clear the entire list click on Clear All Create the Expression Clone When you have made your selections click on Create Expression Clone The Preview Expression Clones task pane will open The Preview Expression Clones task pane lists all the expression clones created from the entry clones and the destination vector s you selected and includes a preview window for viewing an expression clone E Task Expression Clones Division Sense Site Antisense Site Description SYN antel att82 att81 attB2 Name Accession Express Clone pDEST2 Express Clone pDEST Preview RLS HE insert Pr cos ADRAIA i Terminator Gene Source ADRAIA Promoter Prokaryotic y Express Clone pDEST24 Entry Elon NR221 The Ke lt A1A_1_2306 IS Gateway Project 7615bp y gt la a OE In the Expression Clones list e Select a clone and click on Save to Database to save it as a DNA molecule in the database e Double click on a clone to display it in the Preview window In the Preview window e Using the magnifying tools to zoom in and out of the molecule
56. protein gamma 5 GNG5 mRNA Linear 1730 Homo sapiens G protein coupled receptor kinase 2 like Drosophila GPRK2L mRNA Linear 2557 Homo sapiens G protein coupled receptor kinase 5 GPRK5 mRNA Linear 1109 __ Homo sapiens growth factor receptor bound protein 2 GRB2 mRNA E To remove a fragment from the AlignX project select the checkbox next to the fragment name in the Fragment List and click on the Delete button This will remove the fragment from the project not delete it from the database To select fragments for alignment select the checkboxes next to the fragment names in the Fragments List Vector NTI Express Software User Guide Alignment settings E Alignment settings Click on the Alignment Settings button below the Project Properties pane to view the settings for performing an alignment Alignment Settings Program ClustalW2 Local w Molecule Type DNA v Pairwise Alignment Options Alignment Type O Slow O Fast DNA Weight Matrix IUB wW Protein Weight Matrix Gap Open 10 v Gap Extension 0 1 v Multiple Sequence Options DNA Weight Matrix IUB v Protein Weight Matrix Gap Open 10 v Gap Extension 10 20 Gap Distance 5 v No End Gaps no he Iteration none y Num of Iteration l ov Clustering NJ v I zz Project Properties Program Clustal W local The local Clustal W algorithm calculates a crude similarity between all pairs of sequences
57. selection 42 Creating features GenomBench 93 D data group 26 database 82 Database archives 14 Database Explorer 13 Data types 13 Enzymes 19 File formats 21 Gel markers 19 Importing data 21 Molecules creating 17 Oligos 19 Opening 14 Opening files 16 Operations 17 Search database 23 Subsets 16 Subsets creating 23 database object properties 27 database objects add to subsets 26 delete 27 rename 26 sort 26 Database search 23 Database local 13 delete project subsets 34 delete database objects 27 Deleting features GenomBench 94 disconnect from a shared database 37 DNA molecules parts assembly 149 DNA RNA 180 Characters Used 171 File format for importing 171 DNA RNA and protein molecules export 27 DNA RNA molecule data 13 DNA RNA physiochemical properties 71 duplicate database objects database objects duplicate 27 E edit enzymes oligos gel markers 28 Entrez search 86 Databases 87 Results 87 enzymes export 27 properties edit 28 Expectation value 83 export data 27 F Feature Map 42 File formats 21 file formats 28 File types and extensions 16 Formats ASCII 171 IUB codes 171 G Gateway Cloning 121 gel markers properties edit 29 Gel markers creating 19 Gene synthesis 75 GENEART 141 Assembly tool 143 Fragments adding and editing 144 High order assembly 141 PCR primers 145 Seamless cloning 141 Stitching oligos 146 GeneArt synthesis 79 GenomBench Feat
58. sequences that are 75 conserved e Gap costs The penalty to open a Gap and penalty to extend a Gap Increasing the Gap Costs decreases the number of Gaps introduced in the alignment Filters Low complexity This filter masks off segments of the query sequence that have low compositional complexity as determined by the SEG program of Wootton amp Federhen Computational Chemistry 1993 Regions with low complexity sequence can create problems in sequence similarity searching by producing artificial hits sequences that are not truly related Such hits can produce high scores because of the presence of low complexity regions Human Repeats This option masks Human repeats and is especially useful for human sequences that may contain these repeats Mask for Lookup This option masks only for purposes of constructing the lookup table used by BLAST The BLAST extensions are performed without masking Mask lower case characters With this option selected you can cut and paste a FASTA sequence in upper case characters and denote areas you would like filtered with lower case This allows you to customize what is filtered from the sequence during the comparison to the BLAST databases 1 To perform the search click on Submit 2 The search progress will be displayed left hand pane of the BLAST search viewer When the search is complete the search will be flagged as Complete 3 Right click on the search result and select from t
59. terminology that assume a working knowledge of the your operating system the Internet and Internet browsers This guide includes screen captures for the Microsoft Windows version of the software For Macintosh and Linux users the screens will look slightly different but the commands and functions will be the same Vector NTI Express Software User Guide 11 About This Guide 12 Vector NTI Express Software User Guide Overview Database Explorer The Vector NTI Express local database is a database file and associated folder that by default are installed in the root directory of your local hard drive e g C VntiExpress_Database Database Explorer is the tool in Vector NTI Express for managing all the molecules oligos projects analysis results and other data in the local database Eight different types of objects are stored and organized in databases and subsets in the Vector NTI Express local database DNA RNA molecules these contain a nucleic acid sequence as well as annotations primers restriction sites analysis results and other molecule data Upon import from other sources nucleic acid data are parsed and stored in an internal format You can add molecules to the database by importing or creating basic or constructed molecules Protein molecules these contain an amino acid sequence as well as annotations and other features Like DNA molecules upon import from other sources protein molecule data a
60. the Add User window To edit users in a workgroup shared database 1 Open the Workgroup Shared Database Admin application and log in as an administrator 2 In the Workgroup Shared Database Administrator window double click a user to open the Edit User window 3 Edit the user information then click OK to save your edits To delete users from a workgroup shared database 1 Open the Workgroup Shared Database Admin application and log in as an administrator 2 In the Workgroup Shared Database Administrator window select a user click Delete then OK To upload data from the Local Database to a workgroup shared database 1 Connect to a workgroup shared database 2 In the Explorer Viewer click Local Database then select a subset 3 In the Records Viewer right click an object then select Upload to workgroup shared database To download data from a workgroup shared database to the Local Database 1 Connect to a workgroup shared database 2 In the Explorer Viewer click Workgroup Shared Database then select a subset 3 In the Records Viewer right click an object then select Upload to local database To disconnect from a workgroup shared database 1 1 Click Tools in the main menu then Connect to workgroup shared database 2 2 In the Connect to Workgroup Shared Database window click Disconnect Set preferences Set display preferences for molecules You can set preferences for displaying molecules and sequen
61. the search is complete the search will be flagged as Complete and the search results will be displayed in the Results pane Entrez search results are displayed in tabular form in the Results pane Z Entrez Query Database protein Search Term prolactin Protein Name Search Builder AND All Fields Request ID Status Database Search Term Date Time Server Gn C E E Proteinas ZT TET 3 lt gt Results 1 20o1410 rel Taan sll Caption Title CreateDate UpdateDate Taxid Gi Length AAA31578 prolactin Ovis aries 1993 08 30 1993 08 11 9940 387876 240 AhA49611 prolactin Oncorhynchus mykiss gairdneri 1994 08 24 1994 08 23 857570 532239 210 AAAS3281 prolactin Oreochromis niloticus 1994 08 20 1994 11 17 8128 531226 212 AAAS3282 prolactin Oreochromis niloticus 1994 08 20 1994 11 17 8128 531228 200 Baxo9587 prolactin Leucopsarion petersii 2011 04 01 2011 04 01 167318 327343757 190 BAKO9594 prolactin Leucopsarion petersii 2011 04 01 2011 04 01 167318 327343771 60 CAA38264 prolactin Homo sapiens 1994 08 12 2008 10 07 9606 531103 220 CAAS3633 prolactin Capra hircus 1994 09 28 2005 04 18 9925 551230 229 CAAS3634 prolactin Capra hircus 1994 09 28 2008 09 24 9925 551226 229 caas3e3s prolactin Ovis aries 1994 09 28 2005 04 18 9940 551265 229 CAABO660 prolactin Coregonus autumnalis 1993 06 28 2005 04 18 27773 312638 210 CAD30063 prolactin Taenia hydatigena 2002 04 23 2005 04 15 85431 20330092 222
62. the type of algorithm search to be performed In addition to blastn and blastp algorithm searches include megablast Concatenates many queries to save time spent scanning the database It is optimized for aligning sequences that highly similar and is up to 10 times faster than more common sequence similarity programs It can be used to quickly compare two large sets of sequences against each other MEGABLAST permits searching with batches of ESTs or with large cDNA or genomic sequences PHI blast Pattern Hit Initiated BLAST A program for searching a protein database using a protein query it seeks only alignments that preserve a specified pattern contained within the query PSI blast Position Specific Iterated BLAST A program for searching protein databases using protein queries to find other members of the same protein family Database In the dropdown list select the GenBank database to query Menu item Description nr nt Peptide Sequence Database All non redundant GenBank sequences and CDS translations Nucleotide Sequence Database All GenBank EMBL PDB sequences no EST STS GSS or phase 0 1 or 2 HTGS sequences No longer non redundant Refseq RNA Human Genome BLAST databases human RefSeq mrna with NM_ or XM_ accessions Refseq Genomic Human Genome BLAST databases human genomic contig sequences with NT_ accessions Chromosome Nucleotide Sequence Databas
63. then select Edit 3 In the enzyme window click the Enzyme Methylase tab to edit the following properties Recognition String Enter a nucleotide string that can be recognized as the enzyme Cleavage Point Methylation Base Enter the number of the nucleotide immediately after the direct strand cleavage point Description Enter or edit the enzyme s description 4 Click the User Fields tab to edit the values of the following fields e Commercial Sources Organism e Freezer Position WWW Source 5 Click the Comments tab to enter comments about the enzyme 6 Click the Keywords tab to add or remove keywords that will improve database searches Edit oligo To edit an oligo properties 1 In the Explorer Viewer click Local Database then select Oligos 2 In the Records Viewer right click an oligo then select Edit 3 In the oligo window click the Oligo tab to edit the following properties Nucelotide Sequence Enter or edit the oligo s nucleotide sequence Valid characters ATUCG DNA RNA Order Select a DNA or RNA sequence then click Order to open your browser and order your primer sequence from Life Technologies Corporation Reverse Complementary Check the box to replace the oligo sequence with the complementary sequence Description Enter or edit the oligo s description 4 Click the User Fields tab to edit the values of the following fields e Commercial Sources Organism e Freezer
64. they are unavailable assembly will still proceed Default ON Detect Chimeric Reads Chimeric reads consist of pieces from different parts of the sequence region usually generated as artifacts They are identified based on overlap conflicts and are excluded from the construction of contigs The mechanism of detecting chimeric reads can be enabled or disabled with Detect Chimeric Reads check box Default ON 160 Vector NTI Express Software User Guide Assembly settings Assembly Options Use Forward Reverse When reads from both ends of subclones are available Constraints constraints are satisfied if they lie on opposite strands of a double stranded DNA molecule and within a specified minimum and maximum range This corrects assembly errors due to misplacement of reads containing repeat sequences and minimizes occurrence of singletons A few unmet constraints are allowed However if a sufficient number of constraints are not satisfied by a join AND they all suggest an alternative one supported by the overlap information the alternative join will be made For most small and moderate sized projects it is not necessary to use this feature unless in a situation involving large region of repeats Default OFF The Assembly Tab contains some detailed settings related to the use of forward reverse constraints All these settings are disabled when Use Forward Reverse Constraints is unchecked a
65. ways to create DNA RNA and protein molecules Import a molecule from DDBJ EMBL FASTA GCG GenBank GenPept SWISS PROT TrEMBL and Vector NTI Archive formats or from an ASCII file of flexible format The sequence and feature map are converted from the file and the new molecule becomes part of the Vector NTI Express Software database Create molecules from nucleotide or amino acid sequences that you define You can manually enter these sequences or you can paste from a clipboard and enter the sequence as a new molecule Translate a coding region of an existing DNA or RNA molecule to create protein molecules Construct new DNA RNA molecules from user defined compatible component fragments from other molecules Design DNA RNA molecules from components in a user defined fragment list using the built in biological knowledge of Vector NTI Express Software to design the recombination process All new molecules are integrated into the database and can be used in all future operations and analyses Vector NTI Express Software User Guide 17 1 Database Explorer Create DNA RNA and protein molecules Create a DNA RNA To create a DNA RNA molecule molecule 1 In the main menu click File New 2 In the drop down list select DNA to open the New DNA Molecule window 3 Enter a name select the form and enter a description then click OK 18 Vector NTI Express Software User Guide Create gel markers oligos and enzymes Cre
66. 01 CACCGAGTTC CCGACCECCA CCAGAGECCC CECCCTECIT CCCIGCTECC CIGGCACCCA GICCAGCTAG GCACIGECCC A6TT GIGECTCAAS GECTESCEET _ GGTCTCCGGG GCCCCACCAA GCGACGACGE _GACCGCTCGCT CAGETCGATC CGTGACCECE TCAAC The PCR primers and stitching oligos are listed in the Analysis Results pane and will be added to the Ordering list Vector NTI Express Software User Guide 147 Ti GeneArt Cloning GeneArt Assembly Wizard 148 Vector NTI Express Software User Guide Additional Information about Parts and Standards Parts Assembler Using Vector NTI Express Software you can assemble standard DNA parts that encode basic biological functions from molecules using defined assembly standards The standard DNA sequences defined in Vector NTI Express have been developed via an open technical standards setting process led by the BioBricks Foundation At its most basic level a part is any DNA sequence with a defined biological function e g a promoter region a sequence encoding a protein etc To join two parts together upstream and downstream sequences containing sites for specific restriction enzymes are added to each part This allows for the creation of larger parts by chaining together smaller ones in any desired order In the process of chaining parts together the restriction sites are removed allowing the further use of those restriction enzymes without breaking the new larger assembly apart To facilitate this assembly process each part
67. 1 Analyses DNA RNA BioAnnotator 73 Analysis Monitor Sim4 analysis 109 Spidey analysis 111 analysis results manage 34 ASCII Format 171 Back Translation 51 Back translation of proteins 75 BioAnnotator Analysis types 73 Bioannotator 71 Bioniformatic Web resources 30 BLAST results export 27 BLAST Search description 81 lt Title of Publication in footer gt Index expectation value 83 filter masks 84 program descriptions 81 web site reference 81 word size 84 BLAST search 81 Algorithms 81 Databases 82 Parameters for scoring and filtering 83 Results 85 C Camera tool 31 Cloning Gateway Cloning 121 GENEART 141 TOPO Cloning 133 collaborative research 35 connect to a workgroup shared database 35 Contig assembly See also ContigExpress 153 Contig Assembly projects export 27 ContigExpress 153 Ambiguous bases finding 168 Assembly settings 160 Assembly viewing 166 Chromatograms hiding showing 168 Clipping settings 161 Contig consensus sequence 167 Contig Viewer Alignment Pane 167 Contig Viewer Graph Pane 166 Coverage bar 167 Editing a sequence 169 Fragments adding 156 Lite settings 164 Opening 153 Overlap settings 162 Projects exporting 155 Projects managing 155 Saving contigs as molecules 165 179 Index Task List 155 Translate the consensus sequence 168 Trimming ends 157 Trimming vector sequences 158 Window features 154 Workflow 155 copy molecules 30 create projects 33 Create feature from
68. 108 Vector NTI Express Software User Guide Sim4 Launch Sim4 analysis tool Sim4 and Spidey Analysis Sim4 and Spidey are tools for aligning expressed nucleic acid sequences e g MRNA with genomic sequences in online databases Vector NTI Express includes these tools for analyzing molecules stored in the database Sim4 is a similarity based tool for aligning an expressed nucleic acid sequences EST cDNA mRNA with a genomic sequence For more information about Sim4 see http www hgmp mrc ac uk Sim4 employs the following multi stage BLAST based technique e Sim4 detects all possible exact matches of W mers between the two sequences and extends them to maximal scoring gap free segments exon cores e Exon cores are extended into the adjacent as yet unmatched fragments using greedy alignment algorithms Heuristics are used to favor configurations that conform to the splice site recognition signals If necessary the process is repeated with less stringent parameters on the unmatched fragments Sim4 functions similarly to BLAST but performs a more thorough mRNA alignment search To open the Sim4 Analysis tool In Database Explorer right click on a molecule or use Ctrl click or Shift click to select multiple molecules and right click In the right click menu select Analysis Monitor gt Sim4 Analysis With a molecule open in Molecule Editor click on the Sim4 Analysis button in the Molecule Editor toolbar The
69. 2367 Sense Primer 8 Start 1 GC 42 86 Length 49 Sequence GGGGACAAGTITGTACA Tm 63 84 C dG 89 31 kcal mol GH 387 3 kcal mol dS 993 5 cal mol E Antisense Primer j lt amp J Primer Pair Data A lw Recombine Entry In the Recombine Entry Clones by BP task pane you can modify the list of fragments Clones by BP with attB sites and select a donor pDONR vector or vectors with which to create entry clones n Task BP Inserts gt amplify Fragments to use in BP Reaction Name Accession Type Division Sense Site Antisense Site Description gt Recombine Entry Clones by BP The PCR Product of CD The PCR Product of C Entry Cloning attB1 attB2 Homo sapiens cyclin dependent kinas gt Preview Entry Clones The PCR Product of AD The PCR Product of A Entry Cloning attB1 attB2 Homo sapiens adrenergic alpha 14 r gt Add Entry Clones to use in LR Reaction D gt Create Expression Clones by LR L gt Preview Expression Clones r Redar pDONR Vector Name Accession Type Division SenseSite Antisense Site Description pDONR221 pDONR221 Entry Cloning attP1 attP2 aa E cateway Project Add c ear l remove Create Entry Clone L RT BP Inserts The fragments you amplified with attB sites are listed in the BP Inserts list at the top of the pane e To add a previously amplified fragment with attB sites or a fragment designed
70. 25 bases contains lt 3 ambiguities n Scanning entire fragment trim util 5 end 25 bases contains lt 3 bases with QV lt 10 New Project Edit Project Save Project F Trim at least 50 bases Load Project Export Project Close Project Td J gt View Fragments gt gt Trim vector contaminations D gt assemble contig D gt View Contig 5 end settings s Remove blocks of off scale peaks gt than ___ consecutive bases removes the defined number of consecutive bases that are below acceptable criteria e Scanning entire fragment trim until 5 end bases contains lt ___ ambiguities trims poorly resolved bases e Scanning entire fragment trim until 5 end bases contains lt ___ bases with QV lt trims bases based on the defined chromatogram quality e Trim at least __ bases is an arbitrary setting that may be based upon the fact that your primers have tails 3 end settings From max peak trim from first block of ___ consecutive bases lt ___ of max value to the end removes bases in the defined region of the sequence whose peaks do not meet the value you define e Scan entire fragment trim until remaining 3 end bases contains lt ___ ambiguities trims poorly resolved bases e Scan entire fragment trim until 3 end bases contains lt ___ bases with QV lt trims bases based on the defined chromatogram quality e Trim at least __ bases i
71. 3 4 5 6 748 9 10 T TC AN N N N NIN Cleavage Point on Complementary Strand 4 Cleavage Point 2 NNNNNINNAAGT 7 6 5 4 3 2 1 1 2 3 4 NNNINNNNTTCA 6 Select the enzyme type regular restriction enzyme or methylase then click the User Fields tab 7 Click a cell in the table click Change Value to open a data entry window then enter a value To remove a value click Remove Value After you have finshed entering values click the Comments tab 8 Enter comments about the enzyme then click the Keywords tab 20 Vector NTI Express Software User Guide Import data 9 To add a keyword for the enzyme enter a new word or select an item in the list of existing keywords To move the keyword into the keyword list click lt Add To remove an item from the keyword list select it then click gt Remove 10 To save your data click OK To close the Enzyme window without saving your data click Cancel Import data You can import DNA RNA and protein molecules enzymes oligos and gel markers assembly projects and BLAST results in the Vector NTI Express Software Local Database Import molecules You can import molecules including their feature tables from DDBJ EMBL FASTA GCG GenBank GenPept SWISS PROT TrEMBL and Vector NTI Advance Archive files Two types of DNA RNA molecules can exist in the Vector NTI Express Local Database e Circular DNA Molecules e Linear DNA RNA Molecules Molecules are importe
72. 4496 974515 1222609 1222662 e Create New Feature Create a new feature using the same settings and fields as in the Edit Feature dialog Vector NTI Express Software User Guide 93 7 GenomeBench Editing features s Delete the selected feature Deletes the selected feature 94 Vector NTIO Express Software User Guide Align Multiple Sequences The simultaneous alignment of multiple nucleotide or amino acid sequences is an essential tool in molecular biology Alignment enables you to design PCR primers for amplifying a region of aligned DNA RNA molecules Multiple alignments are used to find diagnostic patterns characterize protein families as well as detect or demonstrate a similarity between new sequences and existing families of sequences They are also useful in predicting secondary and tertiary structures of new sequences suggesting oligonucleotide primers for PCR and serving as an essential prelude to molecular evolutionary analysis AlignX is the multiple sequence alignment tool of Vector NTI Express Software In addition to aligning sequences it can be used to create and manage sequence alignment projects It uses a modified Clustal W algorithm and incorporates the following features Profile alignment Guide tree construction displayed in graphical representation Use of residue substitution matrices Secondary structure consideration Multicolored alignment presentation Automatic consensus calculation
73. 84 76 141 ONE16F 689 767 o 78 g Contig 2 ONE3R 755 755 o ONEGR 753 770 0 17 g Contig3 ONESR 756 756 0 0 ONE8R 718 764 44 2 EU Fragments m ONE17R 759 759 0 0 9NE2R 747 747 0 0 FJ ONE9R 758 758 o o J TW011R 765 765 0 0 a Add From File Add From Database Note If a contig cannot be created from the fragments an alert box will be displayed Note Although Vector NTI Express does not have an exact upper size limit for a ContigExpress project your project size may be limited by available computer resources If you do encounter an out of memory situation you should consider assembly in Lite Contig Mode see Lite Settings Tab on page 164 Many a times the out of memory problem occurs due to the presence of too many assemblies in the ContigExpress Project In this case you are advised to delete some of these assemblies as described below save the project and restart ContigExpress Limiting the number of assemblies in a project is always a good idea with large projects If you decide to use Lite Contig Mode but don t want to lose the linkage between your contigs and fragments you can discard chromatogram data see Lite Settings Tab on page 164 and trade the ability to invoke chromatograms for a larger capacity Save delete and rename contigs Save contig assemblies Delete a contig assembly Re assemble contigs Most of these commands are located below the Contig Fragment T
74. 9823 EZO 1 1427882 19019913 139004 N FOO 114564 ill ote D Genome Festures 7 Genome Sequence view Genome Features Sequence View Map Overview The Map Overview pane presents a graphical depiction of the entire chromosome and has the following features e A ruler marks the length of the chromosome The rod shaped band depicts the sequence chromosome e Narrowed areas on the rod indicate centromeric regions e Cytoband patterns are indicated by the vertical dark lines that run the length of the rod Pause the cursor over a particular cytoband to display a tool tip with information about the cytoband 56M 64M 72M 80M 88M 1 r n n T KAL bebs T I XE 1250k 1300k 1350k 1400k oband p14 2 58600000 63700000 Centromeric regions and cytoband patterns are shown only for those DAS servers that provide the information in the correct format Feature Map The Feature Map Pane shows a graphical depiction of the features for the currently loaded fragment Like the Overview Pane the Feature Map Pane has a ruler at the top to help you visualize the orientation of features along the length of the fragment 92 Vector NTI Express Software User Guide Genome Features and Genome Sequence Editing features Feature types or tracks display along the left side of the Feature Map Pane Different features are depicted with various graphical representations and are labeled with the feature name Sho
75. A DNA Metal Binding P Insertion Other Binding 3 Intron To 813 Other Functional From 108 3 l 23 J Segment y complementary ey Connectine Pesce a fase ETN Lain diazas Doria J 156_ Location From 508 Loestian Life Technologies 10600 4 Enter a Feature Name and optional Description 5 The Location range is auto populated based on your selection Enter a different range in the fields if desired 6 For a DNA feature select the Complementary checkbox if the feature is located on the reverse strand 7 Click on Add or Delete to add or remove Annotation keys When adding a key a blank key is created in the table type to replace the text 8 When you are finished click on OK The feature will displayed in the Graphics pane and in the Feature Map To select a molecule feature click on it in the Graphics pane or in the Feature Map To hide a feature or group of similar features deselect the appropriate checkbox in the Feature Map To re display it re select the checkbox To edit a feature right click on it in the Graphics pane and select Edit feature The Feature dialog will open To deselect a feature right click on it in the Graphics pane and select Delete feature You will be prompted to confirm the deletion Restriction Analysis You can identify the restriction sites in a DNA RNA sequence for hundreds of restriction enzymes To begin with a DNA RNA
76. AST search part of a sequence open the sequence in the Molecule Editor select the desired part of the sequence in the Graphics or Sequence pane and right click to select BLAST sequence e To open a blank BLAST search window and type and paste a sequence directly into the tool click on the BLAST button on the main toolbar without selecting a molecule first The BLAST search tool settings are displayed in the right hand pane of the tool the results of a search are displayed in the left hand pane Select the following settings to define your search Program In the Program dropdown menu specify the type of database search to be performed blastn Compares a nucleotide query sequence against a nucleotide sequence database Vector NTIO Express Software User Guide 81 BLAST and Entrez Searches BLAST search blastp Compares an amino acid query sequence against a protein sequence database blastx Compares a nucleotide query sequence translated into all reading frames against a protein sequence database tblastn Compares a protein query sequence against a nucleotide sequence database dynamically translated in all six reading frames both strands tblastx Compares the six frame translations of a nucleotide query sequence against the six frame translations of a nucleotide sequence database 7his program cannot be used with the nr database Algorithm In the Algorithm drop down menu specify
77. Acil ccgc ACI aacgtt PETE Acul ctgaag lt lt Add Afel agcgct Remove All AHH cttaag AI acryat L_J Agel accget Ahdi gacnnnnngtc Alel cacnnnngtg Alol gaacnnnnnntcc Alul aget Select All e 44 Vector NTI Express Software User Guide Filter the analysis results Perform the analysis ORF Finder ORF Finder To filter the analysis results by the terminus type of the restriction cut site select or deselect the checkboxes under Permitted Terminus Types Note 5 and 3 refer to the overhang of the resulting cut site e g with 5 deselected restriction sites with 5 overhangs will be removed from the analysis Ignore RENs Having Less Than More Than Sites hides restriction sites that do not fall within the range of the specified number of cut sites Such RENs will be listed but deselected in the Restriction Map in the Analysis Results They will not be displayed at all in the Graphics and Sequence panes When you have made your selections click on Run The sites will be displayed in the Graphics and Sequence panes and listed in the Analysis Results The results of Restriction Analysis are saved with the molecule e BssSI L 2910 gt P 4 Ac Acl 2977 4 bla promoter A BssSI 2603 i wa Acul 2013 BstAPI 2409 yattR3 Aatll 2660 DrdI 2496 l M13 40 forward primer M13 20 forward primer b gt GACIGIAAAT ATAAG
78. CACATTC AGAAAAAGAC AACTATATAG ATAGITIAIT TITA GCCGATTGIT ACCGAAGCCT TACGAATCAA AACGIGTAAG TCITITICIG TIGATATATC TATCAAATAA AAATY The assembled molecule consists of the two original sequences joined together with a standard bridging sequence or scar created by the overlap of the restriction digested ends The scar sequence is determined by the restriction enzymes used in the assembly standard as described on the web pages mentioned earlier The original parts are listed in the Components list in the Properties pane The scar is listed in the Feature Map and displayed as feature in the Graphics pane The General Description includes the information you entered about the assembled part including device type and chassis 152 Vector NTI Express Software User Guide Contig Assembly using ContigExpress ContigExpress is a program for assembling and editing sequencing fragments either in the form of text sequences or chromatograms from automated sequencers into longer contiguous sequences or contigs ContigExpress uses CAP3 to drive the assembly process This widely used sequence assembly program can use quality value scores QVs in ends trimming contig construction and consensus calculation It also produces excellent results when QVs are unavailable It is capable of using forward reverse constraints to evaluate contigs a feature that helps in accurate placement of repetitive sequence fragments It can also ident
79. CTA 3 Forward Primer 1 for Fragment 2 9 nt 6 nt Reverse Primer for Fragment1 3 ATA CCC CAC TTA AGC CCG AGC 5 1 1 E Sequences specific Sequences specific to Fragment 1 to Fragment 2 High Order Assembly Workflow diagram and an example of PCR primers designed to generate a 30 bp fragment end homology x x x x x x DNA fragments ae Assembled construct Transformation associated recombination 30 nt homology T 1 5 TCG AGC GCA TIT CGC CGT AAA GCG AGT TTA TTA GGA CTA 3 1 1 1 i Forward Primer for Fragment 2 15 nt 15 nt Reverse Primer i 3 GTG AAT TCG AGC TCG CGT AAA GCG GCA TIT CGC TCA AAT 5 1 for Fragment 1 ap a Sequences specific i Sequences specific to Fragment 1 1 to Fragment 2 142 Vector NTI Express Software User Guide Open the GeneArt Assembly Too Open the GeneArte Assembly Tool From the molecule editor From the main toolbar with no molecule selected You can open the GeneArt Assembly Wizard from the Molecule Editor with a molecule loaded or from the main toolbar with no molecule selected Note All molecules used in GeneArt assembly must be linear 1 With a linear DNA molecule loaded in the Molecule Editor select the part of the sequence you want to clone or make no selection to clone the whole molecule Note The selected molecule or sequence must be gt 100 bp e Right click and select Load in GeneArt or click on the
80. CTIGCG CIGGA GAGCT GITAT CIGIA ACTGG AAGAC TCTCC ATTAA CCTGC Additional notes on vector trimming Trimming contamination from TOPO cloning projects TOPO vectors are represented in the Vector database as they are supplied and used i e as linear molecules In this form it is impossible to define a polylinker crossing both cloning termini We recommend temporarily converting the vector to circular DNA RNA menu gt Edit gt DNA RNA Molecule tab in order to define a suitable polylinker Many TOPO vectors are highly symmetric about the 2 cloning termini Use of the default trimming parameters may trim the entire read We recommend values of gt 15 for the overlap size and gt 85 for the match threshold Trimming an intronic sequence from sequencing reads of amplified exons You can use vector trimming operations to remove intronic sequences from amplified exons In these workflows the sequencing reads are often primed from sites in the intron regions To do this it is necessary is to create a polylinker that joins together direct strand sequence from before and after the exon under investigation 1 Using Vector NTI Express Software open a file containing the annotated exon bounded by intron sequence Vector NTI Express Software User Guide 159 Contig Assembly using ContigExpress Assembly settings 2 Make a continuous selection from 50 bases before to 50 bases after the exon i e the exon as well as 5
81. DONR2 Entry Clone pDONR2 Expression Cloni sm attl2 Expression Cloni atta attl2 Add Clear All Remove Destination Vector Name Accession Type Division Sense Site Antisense Site Description pDEST24 pDEST24 Expression Cloni SYN attR1 attR2 lt gt E Gateway Project Add Clear All poem Create Expression Clone Entry Clones Any entry clones that you generated from the previous tasks in the workflow will be listed in the Entry Clones list To select new or additional entry clones in the database click on the Add button and select from the dialog box e To remove an entry clone from the list select it and click on the Remove button e To clear the list click on Clear All pDEST Vector The pDEST vector is a type of Gateway Cloning vector that contains attR sites which are recombined with the fragments containing attL sites to create expression clones attP attP by product LR Clonase II _ destination vector expression clone A variety of pDEST vectors are sold by Life Technologies and in silico sequences for these are installed as part of the default Vector NTI Express installation IMPORTANT To be recognized as a pDEST vector in Vector NTI Express a molecule must contain the correct attR1 and attR2 sequences and these sites must be labeled as features in the molecule with the feature names attR1 and attR2 See Chapter 2 Molecule Editor on
82. E odd 87 Editing and deleting querieS kn deka kad lama kal ka Ewan NE RA T RE NR AT K E 88 CHAPTER 7 GenomeBench see e kk kK kk KK KK KK KK kk kK kk k 89 Download data from public DAS Servers 000 e kk kK KK kk KK kk kk kk kk kk kk kk kk kk 89 Data Loading Monitor 2 y ya k s k X yuk ke ta Wa Sed a de e dia kk N 91 Local GenomeBench Projects s a akil Karek E nnn e BIKA eee eens 91 GenomeBench Project Viewer kk kk kk kk kk kk kk kK kK kk kk kk kk kk kk kk kK kk kk kk kk kk kk kk kk k 92 Map Ov ryl W xwa an n xana ku Qal ate kal a bah died de a dhe a R ul ya a eee hie delal ye dek Aka 92 F at reMap sara a NNN i Rig ie ee ee ee ete eae Minas 92 Genome Features and Genome Sequence cece cence KK KK eens 93 Editing features 0c cece ele dk E A eS e dM hl ok gerr 93 CHAPTER 8 Align Multiple Sequences 00cceee eee kk k 95 Open AUQNX 5 1 2xx 4 4 ka Rd E R n ku hence u a bah kake ba Ma Pal aka da dane vee k j kd sea E 95 ANA WI OW xi 1 Xa cee Oo eee ee ett oe ek ee eet ee i eg ie ee 95 Manage AlignX projects 02 0 cece kk kk kk kk kk kk kk kk kk kk kk ees 96 Save and rename a project kk kk kk kk kk kK kK kk KK kk kK kk kk kk kk kk kk kk kk kk kk ka 96 Vector NTI Express Software User Guide Contents Opera project ica is A Sana Nie aa he ee tae Saat 96 Close a project a a cu inka cds nov eee need vee el a S R e
83. GGGTC TIGIAGTICCA ATTACCGCAA AAACTACACT AAAACCGCCA BstXI e 601 CACACTGGCC ATATCGGTGG TCATCATGCG CCAGCTITCA TCCCCGATAT GCACCACCGG GIGIGACCGG TATAGCCACC _AGTAGTACGC GGICGAAAGI AGGGGCIATA CGIGGIGGCC To identify ORFs in a DNA or RNA sequence click on the ORF Finder button p in the Analysis toolbar of the Molecule Editor Sa The ORF Finder tool contains settings for identifying ORFs within the sequence _ bd Start Codons ATG GTG D4 StopCodons CC TAATGATAG 1 Default Start amp Stop HT IW Include Stop Codon in ORF R ORF Types 7 ORFs which have both start and stop ARA ai codons defined as above H Minimum Size 150 bp Nested wre ORFs which do not have both defined oF start or stop codons Minimum Size bp E Undefined izi s ma Es PE pv 5 Ad L Vector NTI Express Software User Guide 45 2 Molecule Editor ORF Finder Define start and e stop codons ORF Types In the Start and Stop Codon fields enter start and stop codons for the new ORFs Click the Default Start amp Stop button to set the start and stop codons to the following conventional values Start codons ATG GTG Stop codons TAA TGA TAG Check the Include Stop Codon in ORF box if you want the stop codon to be considered as a part of the ORF Otherwise the stop codon is not considered as part of the ORF and is not included Complete The Complete check box
84. GeneArt Cloning button on the main toolbar as garsa Q Ey J o o Ale my 2 Select the strand you want to analyze Direct or Complementary 3 The GeneArt Assembly Wizard will open with the molecule or sequence loaded 1 With no molecule selected click on the GeneArt Cloning button on the main toolbar or select Design gt GeneArt Cloning 2 The GeneArt Assembly Wizard will open with no sequence loaded GeneArt Assembly Wizard with molecule selected GeneArt Assembly GeneArt Assembly Wizard Assembly Parameters Assembly Seamless Cloning Molecule form E Circular O Linear Fragments Vector Source DNA Order StartPosition Fragment Length Orientation Amplify N L 2226 Forward N Vector NTI Express Software User Guide 143 TY GeneArt Cloning GeneArt Assembly Wizard GeneArts Assembly Wizard Assembly settings Add and organize fragments 144 The GeneArt Assembly Wizard window lists the molecules and fragments to be assembled and includes settings for assembly The tool includes different options for Seamless Cloning or High Order Assembly 1 Select the appropriate Assembly option from the dropdown list 2 Select the Molecule Form you want for the final assembly Circular or Linear The Assembly Wizard has tools for adding and removing fragments and designating their order of assembly Fragment requirements A fragment for GeneArt Assembly can be any molecule in the database that is g
85. One Direction Direct Part Two Direction Direct Assembly Methods Assembly Standard 10 Enter a name for your new construct in the Name field Device Type A device in is any construction that performs a particular biological function The Device Type section of the dialog allows you to characterize the type of device you are constructing This information will be included in the General Description information of the assembled molecule The dropdown list includes standard types of devices Alternatively you can select Unassigned from the list or enter your own device description by selecting the Other checkbox and typing in the field Chassis Parts are typically integrated into the genome of a particular organism a k a a chassis for propagation and functionality You can specify the genome of the organism that you will be using by selecting the appropriate checkbox or entering text in the Other field This selected chassis will be listed in the General Description information of the assembled molecule Assembly Direction and Standard Select the direction of each molecule to use for the final assembly and select the assembly standard to use from the dropdown list Note If there is no shared assembly standard that will work with both molecules this dropdown list will be blank and no assembly will be possible When you click on OK in the Construct and Assemble dialog the assembled molecule will open in a
86. Preview window You can use the tools in the window to magnify the assembly or view it as a linear or circular molecule Vector NTI Express Software User Guide 151 1 5 Parts Assembler Viewing the assembly in Molecule Editor Click on Save in the Preview window to save the assembly as a molecule in the database Viewing the assembly in Molecule Editor To view the assembled molecule in the Molecule Editor open the Database Explorer and open the molecule Properties Dom Do Cl mar R Zos E General Description ey 53 q SE 1 DNA PartsAss bieri j beyi keke at SCAR BB Assembly Standard 10 mee DeviceType Protein Generator Chassis EscherichiaColi rm Length 1087 bp F Form Linear R 2 Standard Fields L nen PartsAssembler1 En References 1087bp M E Comments re insert BBs_A340620 F vector BBa _80010 101 GCITATCIGA TATGACTAAA ATGGTACATT GIGAATATTA TITACICGCG ATCATITATC CTICATICIAT GGITA CGAATAGACT ATACIGATIT TACCATGIAA CACITATAAT AAATGAGCGC TACIAAATAG GAGIAAGATA CCAA 201 TIACCCTAAA AAATGGAGGC AATATTATGA TGACGCTAAT TTAATAAAAT ATGATCCTAT AGTAGATTAT TCTA Feature Map AATGGGATTT TITACCICCG TIATAATACT ACIGCGATTA AATTATTITA TACTAGGATA TCATCTAATA AGAT 301 AATATATTTG AAAACAATGC TGTAAATAAA AAATCICCAA ATCTAATTAA AGAAGCGAAA ACATCAGCTIC TTAT A lysis Results TIATATAAAC TITIGITACG ACATITATIT TITAGAGGIT TACATTAATT TCITCGCITI TGTAGTCCAG AATA 401 CGGCTAACAA TGGCTTCGGA ATGCITAGIT TIG
87. Save Project button To close a project click on the Close Project button If there are unsaved changes you will be prompted to save the project before closing 124 Vector NTI Express Software User Guide Gateway Cloning workflow To load an existing project in Database Explorer go to the Projects list double click on the Projects folder select the Cloning Projects subfolder from the Local Database and double click on the Gateway Cloning project in the list to open it Projects Name Description Author Modified Cloning Technology CDK2 Gateway Cloning project 2011 12 08 12 15 40 Gateway_stt81_att82 Gd Local Database EQ Alignment Projects E Contig Assembly Projects E Cloning Projects Gi Remote Database G Database Dee P peen Wu Results Gateway Cloning workflow The Task List displays the default Gateway Cloning workflow e Amplify Fragments to Use in BP Reaction e Recombine Entry Clones by BP e Preview Entry Clones e Add Entry Clones to Use in LR Reaction Create Expression Clones by LR e Preview Expression Clones This section describes each task in the workflow Amplify fragments The Amplify Fragments to Use in a BP Reaction task is the default task displayed to Use in a BP when you first open the Gateway Cloning Tool reaction The first step in this task to select the fragment s you want to amplify by PCR for use in a BP cloning reaction These fragments w
88. Sequence Info pane 72 Vector NTI Express Software User Guide Window size Analyses descriptions and parameters Analysis parameters All the graphs have a Window Size parameter This is the number of adjacent data points used in averaging values for each displayed data point and the optimal value is analysis dependent The default window size has been optimized based on the selected analysis but this value can be changed You can experiment with different window sizes and their effect on the resulting graph by entering a different number in this field After any change click on Refresh Graph Melting temperature and free energy are calculated using the nearest neighbors method For constants and algorithms used to calculate thermodynamic parameters see Appendix B The available DNA RNA analyses and their specific parameters are Free Energy dG kcal mol This can be recalculated for a different temperature by entering a new value in the Temperature field C e Melting Temperature GC Content C This can be recalculated for a different Salt Concentration mMol and Formamide of the solution by entering new values in the appropriate fields e Sequence Complexity GC Content e Nucleic Acid Distribution Select the bases for which you want to calculate the percent distribution using the checkboxes under Sequence includes e Melting Temperature Thermodynamic C This calcul
89. T pa Protein A k Transmem_1 Source g ADRA1A 499aa Y gt lt Properties Feature Map 1 MVFLSGNASD VILGGLILFG VLGNILVILS VACHRHLHSV THYYIVNLAV _ADLI 101 IWAAVDVLCC TASIMGLCII SIDRYIGVSY PLRYPTIVIQ RRGLMALLCV WALSLVISIG PLFGWRQPAP EDE G_PROTEIN_RECEP_F1_1 201 LVMYCRVYVV AKRESRGLKS GLKIDKSDSE QVILRIHRKN APAGGSGMAS AKIKTHFSVR LLKFSREKKA AKTI 301 FKPSETVFKI VFWLGYLNSC INPIIYPCSS QEFKKAFQNV LRIQCLRRKQ SSKHALGYTL HPPSQAVEGQ HKD 401 SSMPRGSARI TVSKDQSSCT TARTKSRSVI RLECSGMILA HCNLRLPGSR DSPASASQAA GTTGDVPPGR RH AMIDATION e Click on a feature in the Analysis Results pane to show expanded details for that result Click on a checkbox in the Analysis Results pane to show or hide that feature in the Sequence pane Right click in the Analysis Results pane and select Save All Analysis Results to Database to save these to Analysis Results in your local database Vector NTIO Express Software User Guide 53 2 Molecule Editor Protein Domain and Motif Finder Analyses e Analysis Results saved to the database will listed in the Database Explorer under Results in the Analysis Results folder Ll Results Name v Analysis Type Analysis Object Name PscanAnalysis of ADCY7 at M Pscan ADCY7 cu u a PscanAnalysis of ADCY7 at M Pscan ADCY7 BLAST Results lt S ex PatmatmotifsAnalysis of AD Patmatmotifs ADRAIA cli a PatmatmotifsAnalysis
90. TACTACEC GGICGAAAGI AGGGECTATA CGTGETEGCC By default ORFs are displayed for the direct and complementary strands If single stranded sequence is displayed only the ORFs for that strand are shown 46 Vector NTI Express Software User Guide Translation tool Translation tool Translation results To translate a RNA or RNA sequence into amino acids click on the Translate button in the Analysis toolbar of the Molecule Editor xT The Translation tool contains settings for translating the sequence TI a Select Genetic Code UNIVERSAL v Select Translation Source G Direct Strand O Complementary Strand O 6 Frame Translation Translate ORF s Translation Frames 26 29 E Agr En a 2 O Translate into new Protein lu 1 Select the genetic code for the desired organism to use as the basis for the translation from the Genetic Code dropdown list For more information on genetic codes visit www ncbi nih gov Taxonomy Utils wprintgc cgi mode c 2 Select the Translation Source from among the following options Direct Strand displays a translation of the direct strand sequence in the current frame Complementary Strand displays a translation of the complementary strand sequence in the current frame 6 Frame Translation displays up to 6 translations of the sequence depending on the selections in the Translation Frame checkboxes Translate ORFs if you have used the ORF Fi
91. TITITIGICT CTACATAATA GATGTATTAT CTGTAAAACA GACATTTTGT CAACATATCC GITGTATAGG GTCGAC CAGCTC AGICACTATG CTAAAACGTA TCAGIGATAC AGCCTACTCG TCGGATGAGC CTAITGICCT GATAACAGGA CAATGCCGTA TIAAATCATA AATITAGIAT ARAAGARATA AGAAA GCAGCATAGG TITICITIAT TGCATCAAGA ACGTAGTTCT TCTIT ACAATI TGITA AAAACATCTA TITIGIAGAT CCTATTCATA GGATAACTAT TACGCTACTG ATGCGATCAC TCATAGTCCT AGTATCAGCGA GAAAATCATC CTTTTAGTAG Analysis Results CGGCITCATC GCCGAAGTAG TGGATITICA ACCTAAAAGT TATICCCCAG ATAAGGGGTC ATATCGGIGG i GCCTCTATAC CGGAGATATG AACATCAGGT TIGTAGICCA TCATCATGCG TTACTAAACG AATGATTIGC TGATAAAGIT TCIGTAATIT AGACATTARA CTACTC CACACTGGCC CCAGCTITICA TCCCCGATAT GTAAAC gt Sequence pane The Graphics pane displays a graphical representation of the molecule including features The Sequence pane displays the molecule sequence as well as the result The Properties pane displays information about the molecule The Feature Map displays a list of the defined features in the molecule 40 Feature Map 5 Feature Map E V Misc Recombination 2 E Primer 3 V Promoter Prokaryotic 1 a cps 3 E ccdB Complementary 508 813 E Cm R Complementary 1158 1816 amp V Amp R 2791 3651 a 11311311 Properties Vector NTI Express Software User Guide Enter or edit a sequence The Analysis Res
92. Usefulness of Thermodynamic Tm Versus GC Tm kk kk cn 173 Effects of Primer Probe and Salt Concentration on Tm Calculations naaa aaan unauna 173 MOC Tm Calculation jon ici A E n aEHEEHEEuu EE HNE HB MM MDMTI 173 Thermodynamic Tm Calculation s an kk kk kk kk kK kK KK KK KK KK KK KK kK KK KK kK kK kK kk kk kk kek 174 EETA E EA E E n A A DD N 175 Oligos Containing IUB Ambiguity Characters MM WWW kk kk kk kk kk kk KK KK KK KK KK KK KK KK KK kk 176 RNA Olgos vecina ad e rd E T RR 176 Primer Probe Tm Tagp and Similarity Calculations oooocccccccccccccocorcrrooo 177 Primer Probe Tm Values Jeeta lea tate KK KK KK KK KK KK KK KK KK KK KK k 177 Taner Valu S nostra Kaka Pewa y ahe h ca ya whe Se b d be na D a edab ae Fe dad ae dene T 177 Primer Probe Similarity Values 2 0 0 kk kk kk kk kK KK kK KK KK KK KK KK KK kK kK kk kk 178 References e ta o ente e na rar RAA e EN OS QA 178 HIG OX O E a Ooa hoes 179 Vector NTI Express Software User Guide Note on screen captures About This Guide This user guide provides reference information for Vector NTI Express Software a Java based cross platform application that can run on computers using the following Operating systems Microsoft Windows XP SP3 and Windows 7 Mac OS X e Linux For installation and licensing information see the Vector NTI Express Release Notes and Installation Licensing Guide This guide uses conventions and
93. arch for Small Exons If Yes is selected an additional search for small exons is performed Diagonal Distance The upper boundary of diagonal distance within consecutive HSPs in an exon Allow Ambiguity Characters If checked allows the following ambiguity characters ABCDGHKMNRSTVWXY If unchecked only the following characters are allowed ACGTNX Weight Factor for Linking HSPs The multiplication factor used when calculating the score of a chain of HSPs Defaults Resets Sim4 parameters to the original default values HSP Score Threshold Submit the job 110 First Stage The threshold for HSPs for the first stage of comparison If no value is specified the default value is used Second Stage The threshold for HSPs when aligning the extended and unmatched portions If no value is specified the default value is used When you have made your selections click on Submit Vector NTI Express Software User Guide View analysis results Spidey Launch Spidey analysis tool Spidey When analysis is complete a Completed checkbox will appear next to the job name in the Analysis Monitor The Analysis Monitor contains a list of all the analyses performed by Vector NTI Express including Sim4 analyses Click on Analysis Monitor on the main toolbar to open it gt diras QexG ooeve oF To view the analysis for a particular molecule you can Open the molecule in the Molecule Editor and click on Analys
94. are them among several Vector NTI Express Software users on a network Workgroup shared databases are not a replacement for local databases each Vector NTI Express Software application still must have its own local database The local database is used in all operations for example the construction design and creation of viewers The local database is also the place for storing private and temporary data The main purpose of the workgroup shared database is to store common data The only operations you can perform on workgroup shared databases are Copying data to and from the local database For instance you can copy some of your molecules and enzymes from your local database into the workgroup shared database In order to use them in the design process your colleague must first copy them to his or her local database Performing various database management operations such as creating and deleting subsets Running database searches In addition to biological data each database contains information about its creator and registered users Only the creator and registered users can have access to database data The database creator can also change database properties remove registered users and define the password required to become a register user Note Vector NTI Express workgroup shared databases use portable data format PDF and file naming conventions to ensure that both Macintosh and Windows users of Vector NTI Express Sof
95. ata on page 28 Open other applications on page 30 Open other applications on page 30 Copy save and print molecules on page 30 Manage the Projects database on page 33 Manage the Results database on page 34 Workgroup Shared Database on page 34 Set preferences on page 37 Parent descendant relationships to keep track of your constructs user fields comments and keywords are kept for all molecules in the database All database molecules and other objects can be placed into archives data files of special format that can be transferred to another computer Macintosh or Windows and read by Vector NTI Express Software Through archives you can share molecules constructs or other objects with your colleagues or simultaneously use them on several computers for instance at work and at home In Vector NTI Express Software archives All DNA RNA molecule information is written to and read from an archive file This information includes molecule component fragments if the molecule is constructed from other molecules and parent descendant connections between molecules Vector NTI Express Software automatically checks the consistency of molecule archive information adding necessary parents including DNA parents of translated protein molecules or disconnecting them if you neglected to transfer them to the archives When the archive is loaded into a new database Vector NTI
96. atabase You can view BLAST results and analysis results and manage the BLAST Results and Analysis Results databases View results To view BLAST results and analysis results 1 Click the Results bar 2 In the Results Viewer expand the Local Database then select BLAST Results or Analysis Results In the Records Viewer double click a result to open the BLAST Viewer or Molecule Editor Manage Results To manage subsets in the Results databasse subsets 1 Click the Results bar 2 In the Projects Viewer expand the Local Database 3 Right click a subset then select a managerial operation For more information see Manage Database Projects and Results subsets on page 23 Workgroup Shared Database This section describes how to 34 Connect to a workgroup shared database page 35 Add users to a workgroup shared database page 36 A user name should be one word without spaces Edit users in a workgroup shared database page 37 Delete users from a workgroup shared database 37 Upload data to a workgroup shared database page 37 Download data from a workgroup shared database page 37 Disconnect from a workgroup shared database page 37 Vector NTI Express Software User Guide About workgroup shared databases Connect to a workgroup shared database Workgroup Shared Database You can create special databases repositories of DNA RNA or protein molecules enzymes oligonucleotides and gel markers and sh
97. ate a Protein To create a protein molecule molecule 1 In the main menu click File New 2 In the drop down list select Protein in the New Protein Molecule window 3 Enter a name and description then click OK Create gel markers oligos and enzymes Gel marker oligonucleotide and enzyme objects can be created from scratch using editors in Vector NTI Express Software or by importing them from FASTA files Vector NTI Archive files an oligo list and a REBASE database Create a gel To create a gel marker marker 1 2 3 In the main menu click File New In the drop down list select Gel Marker to open the Gel Marker window Enter a name Click the browse button to open the Choose Database Gel Marker window then click OK 4 Select a gel marker type 5 Click the Gel Marker tab enter a fragment length then click OK Create an oligo To create an oligo 1 In the main menu click File New 2 In the drop down list select Oligo to open the Oligo window 3 4 In the General tab enter a name then click the Oligo tab Enter the nucleotide sequence then select the oligo type To replace the oligo with its complementary sequence check the Reverse Complementary box Enter a description then click the User Fields tab Click a cell in the table click Change Value to open a data entry window then enter a value To remove a value click Remove Value After you have finshed enterin
98. ation 1 When you have made your selections click on the Assemble button Note that this button will not be available unless both molecules are linear 2 In the Construct dialog enter a name for the assembly and select the desired molecule type and start position and whether the resulting assembly is circular or linear ES Construct Dialog Name Clone2Seq Circular O Linear Start Position Recipient s Start Position fa E of Fragment fa Vector NTI Express Software User Guide Multiple fragment cloning 3 Click on Construct The assembled molecule will be displayed in a preview window K Clone Preview Preview Ra HS Attenuator ADRAIA Attenuator ADRAIA Attenuator _ AERAR Clone2Seq 10 3454bp N f WIS Attenuator Attenuator Note You can use the tools in the window to magnify the molecule or display it as linear or circular 4 Click on Save to save the molecule to the database To clone multiple fragments using Clone2Seq first create a clone from two fragments as described above then generate a clone from the cloned molecule and the next fragment Repeat as necessary Vector NTIO Express Software User Guide 119 Clone2Seq 120 Vector NTI Express Software User Guide For more information Gateway Cloning Workflow Gateway Cloning Gateway Cloning Technology is a rapid and highly efficient method for the cloning and subcloning of DNA
99. ation is dependent on the Salt Concentration mMol and Formamide of the solution as well as the concentration of any probe in the solution Probe Concentration in pMol e Entropy dS cal K mol e Enthalpy dS kcal mol After any change click on Refresh Graph Vector NTI Express Software User Guide 73 4 BioAnnotator Analysis parameters 74 Vector NTI Express Software User Guide Regenerator The Regenerator application in Vector NTI Express Software enables you to back translate a DNA sequence from a protein sequence or modify an existing DNA sequence for a given expression system You can introduce mutations such as insertions deletions and substitutions or modifications like restriction or Gateway sites in the back translated DNA sequence which can then be optimized for a specific expression system Regenerator Workflow Pe oe JS Load a protein or DNA sequence into Regenerator from the Molecule Editor If desired introduce insertions deletions or substitutions into the sequence Select the desired expression system If desired add attachments relevant to downstream cloning to the back translated DNA sequence Save the newly created DNA sequence as a molecule in the database and or send it for synthesis Open Regenerator To launch Regenerator 1 2 3 Load a protein or DNA molecule into the Molecule Editor Select part of the sequence or make no selection to select the entire sequenc
100. aved changes you will be prompted to save the project before closing To export a project as a cepx file click on the Export Project button and enter a project name in the Export ContigExpress Project dialog Click on a step in the Task List to display the settings for that step Vector NTI Express Software User Guide 155 Contig Assembly using ContigExpress Add fragments to assemble Add fragments to assemble Add fragments Remove fragments Rename fragments The tools for adding the sequence fragments to assemble are located below the Contig Fragment Tree Name Len Original Len 5 trimme E Fragments n ONE10F 758 758 o ONE11R 755 755 0 ONE13R 819 819 o C ONe1sF 784 784 o ONE1EF 767 767 0 ONE17R 759 759 0 ONE2R 747 747 0 ONE3R 755 755 0 ONESR 756 756 0 ONEGR 770 770 o ONE8R 764 764 o ONESR 758 758 0 C TW011R 765 765 0 lt gt Add From File Add From Database As you add fragments they are displayed in tree format with selection boxes that allow to select individual fragments for subsequent trimming and assembly To add individual fragments Click Add from File to select a supported file type GenBank gb FASTA txt ABI abi ABI ab1 Staden SCF scf Legacy ContigExpress project file containing multiple fragments cep Click Add from Database to select DNA mole
101. ay Cloning workflow the Task List displays the current task and allows you to move between tasks by clicking on a different task 123 Vector NTI Express Software User Guide 12 Gateway Cloning Create save and load projects Current Task pane This pane displays the commands and settings for the currently selected task in the project As you navigate through the Task List workflow the functions in this pane will change Fragments to Amplify Name Accession From To Sense Site Antisense Site Description pCR8 GW TOPO pCR8 GW TOPO 211 270 GNGS GNGS 1 698 Homo sapiens guanine nucleotide bin Add Remove PCR Amplification Settings Analysis Conditions Tm C GC Length gt 40 0 gt 35 0 gt 109 oua O ANA lt 65 0 lt 60 0 lt 114 Add GGGG attBx 5 extensions of Sense Primer of Antisense Primer attB3 ACAACTTTGTATAATAAAGTTGCT v attB4 ACAACTTTGTATAGAAAAGTTGGGTG vw Add to oligo list Add generated primers to oligo list Advanced Amplify Create save and load projects The tools for saving editing and closing projects are located in the Gateway Project pane Gateway Project E General Info CDK2 Gateway Cloning project To save a new Gateway Cloning project click on Edit Project in the Gateway Project pane In the dialog enter a name and any description for the project To save changes to a project click on the
102. cece kk kk ka kk kk kk kk kk kk kk kk kk kk kk 155 Save and rename a project kk kk kk kK kk kk KK kK kk KK kk kk kk kk kk kk kk kk kk kk kk 155 Openia project iii ence Se hick eee Mew SP Pied pm 155 Close a Projected rea e NRENHNHnENE HE HEEEEEHNHE N N nE IIJ H MMMM E A T 155 EXporta pro ect Las o Pane hoc ek A ead du kak b e 155 Navigate the Task List kurk A Eek kt D Wi dg KINA aA DAYA K na WA eb RQ 155 Add fragments to assemble kk kk kk kk kk kK kK kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk 156 A0dTagngnte e diar rehenes N X sai 9 HEnEEDHEEEEHEEHEEHH NMDDMDMDJD i u I 156 Remove fragments 0324 cad QE KAN E N eee A eg AT a a 156 Rename fragments kk kk kk kk kk kk kk kk kk kk kk kk kk kk kK kk kk kk kk kk kk kk kk kk kk kk ka 156 AN wereee K Z Re a ah ta ee RL Stel 156 Vector NTI Express Software User Guide 9 Contents 10 Select fragments to triM kk kk kk kk kk kk kk kK KK KK KK KK KK KK KK KK KK kk kk kk kk kK kk kk kk 157 Naya e ieee ce ene MNMNMNMNMNNNNHNnNnHnNnREEDa DMRyMDMDBDMDBDBB NTR R Kd R RRR 157 Trim Vector contaminations sag sord WE dla al k WE a WE AWA Se add KALE kk SAL 2 eae 158 Assembly settingS kk kk kk kk kk kk kk kk ee kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk 160 Pertorm the assembly xl ll te bek ba Qi bl aya Mil abt eee A hebet Avi D Dak kuz 164 Save delete and rename contigs kk kk kk kk kk kK kk KK kK KK KK KK kK kk
103. ces and register your email address with the National Center for Biotechnology Information NCBI To set display preferences for molecules 1 In the main menu click Tools Preferences to open the Preferences window Vector NTI Express Software User Guide 37 1 Database Explorer Set preferences In the Display Preference view click the background color and highlight color buttons to open the Color palette Select background and highlight colors then click OK To save your preferences click Apply or click Restore Defaults to keep the original settings Set display To set display preferences for sequences preferences for 1 sequences 2 Expand Display Preference then click Sequence Preference Click Sequence fill color and Sequence line color to open the Color palette and select colors Enter values for the sequence width and sequence line width parameters To change the title font click the Change button then select and define a font To change the title font color click the button to open the Color palette and select a color Click Apply to save your preferences Register with the To register your email address with the NCBI NCBI 2 3 38 Click NCBI Configuration Enter your email address then click Register to open your email application Click OK to close the Preferences window Vector NTI Express Software User Guide Molecule Editor The Molecule Editor in Vector NTI E
104. click an object then select Rename to open the Rename window 3 Enter a new name then click OK Clear a local database subset Note Clearing a Local Database subset of its contents does not permanently delete the contents from a local database To clear a subset of its contents 1 In the Explorer Viewer click Local Database then expand a database 2 Right click a subset select Clear subset to open the Subset Management window then click OK Vector NTI Express Software User Guide Manage database objects Manage data Dismiss local database subsets Dismissing a subset deletes the subset from a local database To dismiss Local Database subsets 1 In the Explorer Viewer click Local Database then expand a database 2 Right click a subset then select Dismiss subsets to open the Subset Managment window then click OK Delete the contents of a local database subset Note Deleting the contents of a subset permanently deletes them from the Local Database To delete the contents of a Local Database subset 1 In the Explorer Viewer click Local Database then expand a database 2 Right click a subset select Delete Subset Contents to open the Vector NTI Express window then click OK View a summary of a local database subset To view a summary of a Local Database subset 1 In the Explorer Viewer click Local Database then expand a database 2 Right click a subset then select Subset Summary to open the Subset Summa
105. ct or complementary strand with the names of the fragments displayed above the fragment lines 166 Vector NTI Express Software User Guide Contig Viewer Alignment pane Scale Fragment sequence Overlapping region Chromatogram data Consensus sequence lt lt ONE11R gt gt ONE16F gt gt ONE9R lt lt ONEGR View the assembly Contig coverage bar The Contig Coverage bar spans the length of the contig and contains segments of varying patterns colors that represent the amount and type of fragment coverage in that segment ONESR 5 ONE6R 45 lt lt 759 TWO11R 1 lt lt 679 400 600 800 Contig Coverage Bar NS TRAS DOS SS N N NN The patterns and colors are Single fragment gray bar with slants Two fragments in the same direction red cross hatching Two fragments in different directions blue checkerboard e Multiple fragments in both directions solid blue bar The Contig Alignment Pane displays the nucleotide sequences of the fragments that form the contig with overlapping regions aligned appropriately and displayed relative to their positions in the contig The consensus sequence is displayed below the fragments and chromatograms for the fragments are displayed Translations can be identified and displayed You can edit the sequences here and see how your actions are reflected in the contig alignment and consensus Use the horizontal and vertical scroll bars in the Alignm
106. cules from the local database Note Press the Ctrl or Shift keys to select multiple files molecules To remove fragments from the assembly project select the checkboxes next to the fragment names in the tree and click on the Delete button This removes fragments from the project only and does not delete them from the database To rename a fragment right click on the fragment name in the list and select Edit Enter a new name for the fragment in the dialog box Fragment trimming 156 Fragment trimming is an operation performed on fragments to optimize sequencing results and contig assembly Trimming is performed on fragment ends to remove unresolved or poor quality nucleotides based on chromatogram results It is also used to remove residue vector sequences from the fragments Vector NTI Express Software User Guide Fragment trimming Select fragments To select or deselect fragments for trimming click the checkbox next to each to trim fragment name in the Contig Fragment Tree To select or deselect all the fragments in the list click the top level Fragments checkbox Trim ends Click on Trim ends in the Task list of the Contig Project pane to select the settings that determine how fragment ends are trimmed Za menes da a Contig Project 5 end 3 end Post Trim 5 General Info Remove blocks of off scale peaks gt than 3 consecutive bases DemoProject Y Scanning entire fragment trim util 5 end
107. d in the DNA RNA Molecules subset and Protein Molecules subset within the Local Database The DNA RNA Molecules and Protein Molecules subsets contain descriptions of a molecule s features You can also import nucleotide or amino acid sequences from an ASCII file of flexible format and Vector NTI Express Software will automatically create the new database molecule and assign the sequence to the molecule File formats The following file formats can be imported into Vector NTI Express File Format DNA RNA All nucleotide files gb gbwithparts fasta fas fa mpfa fna molecule fsa seq embl gcg ma4 ddbj Genbank gb gbwithparts DDBJ ddbj Fasta fasta fas fa mpfa fna fsa seq EMBL embl GCG gcg Vector NTI Archive ma4 Vector NTI Express Software User Guide 21 1 Database Explorer Import data File Format Protein molecule All protein files fasta fas fa mpfa fna fsa seq gp gpwithparts swp pa4 trembl Fasta fasta fas fa mpfa fna fsa seq GenPept gp gpwithparts Swiss Prot swp TrEMBL EMBL trembl embl Vector NTI Archive pa4 Enzyme REBASE rebase Vector NTI Archive gad Oligo Vector NTI Archive oa4 Oligo List txt Fasta IY fasta fas fa mpfa fna fsa seq Gel marker Vec
108. databases 1 To begin select the desired NCBI database from the Database dropdown list PubMed A database of biomedical literature citations and abstracts from MEDLINE life science journals and online books Gene Wide ranging database containing nomenclature Reference Sequences RefSeqs maps pathways variations phenotypes and links to genome phenotype and locus specific resources worldwide OMIM Database of human genes and genetic phenotypes Protein Database of translations from annotated coding regions in GenBank RefSeq and TPA as well as records from SwissProt PIR PRF and PDB Structure Database of three dimensional genetic and protein structures Popset Database of DNA sequences that have been collected to analyze the evolutionary relatedness of a population Nucleotide Database of genome gene and transcript sequences from several sources including GenBank RefSeq TPA and PDB SNP Database of single nucleotide polymorphisms SNPs 2 Search terms will vary by database You can enter known search terms directly in the Search Term field or you can use the Search Builder function to construct your search from known database elements and Boolean operators For a description of search terms and operators visit www ncbi nlm nih gov books NBK3837 3 Select the desired Page size 4 When you have made your selections click on Submit 5 The search progress will be displayed Query List pane When
109. depending on the organism chosen The top few splice donor sites by score are then evaluated as to how much they affect the original alignment boundaries The site that affects the boundaries the least is chosen and is evaluated as to the presence of an acceptor site The alignments are truncated or extended as necessary so that they terminate at the splice donor site and so that they do not overlap For details on Spidey analysis see http www ncbi nlm nih gov IEB Research Ostell Spidev index html To open the Spidey Analysis tool In Database Explorer right click on a molecule or use Ctrl click or Shift click to select multiple molecules and right click In the right click menu select Analysis Monitor gt Spidey Analysis With a molecule open in Molecule Editor click on the Spidey Analysis button in the Molecule Editor toolbar Vector NTIO Express Software User Guide 111 1 0 Sim4 and Spidey Analysis Spidey The Spidey Analysis tool will open with the selected molecule s listed The analysis window has an Analysis Jobs pane containing the analysis settings and an Analysis List pane listing the molecules loaded in the tool Anabysis Jobs Spidey Name Can Analysis Jobs Molecule and organism to analyze settings In the Analysis Jobs pane e Select the molecule from the Name dropdown list e Specify the Organism to analyze for your genomic sequence Spidey Parameters Minimum mRNA Genomic Identity Perce
110. dropdown list Note For more information about translation and codon usage tables visit www ncbi nih gov Taxonomy Utils wprintgc cgi mode c 4 Select the Translate into new nucleotide checkbox to create a DNA RNA molecule from the resulting analysis 5 Click on the Submit button If you selected the checkbox in step 3 you will be prompted to enter a name for the molecule and save it to the database The results will be displayed in the Back Translation Result field Protein Domain and Motif Finder Analyses Protein Domain Analysis PROSITE and PRINTS databases 52 You can analyze a protein sequence in Vector NTI Express against databases of known protein domains families functional sites and motif fingerprints PROSITE and PRINTS are databases of biologically significant protein patterns and profiles that can be used to identify the function of uncharacterized proteins Comparing an unknown polypeptide sequence in Vector NTI Express to the motifs in these databases can help determine any known protein families and domains to which the sequence may belong Vector NTI Express Software User Guide Protein Domain and Motif Finder Analyses For more information about the PROSITE database visit http prosite expasy org e For more information about the PRINTS database visit www bioinf man ac uk dbbrowser PRINTS index php Local versions of the PROSITE and PRINTS motif databases are provided as part of t
111. e Right click in the Graphics pane and select Regenerator or click on the Regenerator button in the Molecule Editor toolbar g Vector NTI Express Software User Guide 75 5 Regenerator Regenerator tool features The Regenerator tool will open amp Regenerator Protein to be Expressed MVFLSGNASD SSNCTQPPAP VNISKAILLG VILGGLILFG VLGNILVILS VACHRHLHSV THYYIVNLAV ADLLLTSTVL IWAAVDVLCC TASIMGLCII SIDRYIGVSY PLRYPTIVIQ RRGLMALLCV WALSLVISIG PLFGWRQPAP EDETICQINE LVMYCRVYVV AKRESRGLKS GLKIDKSDSE QVILRIHRKN APAGGSGMAS AKIKIHFSVR LLKFSREKKA AKILGIVVGC FKPSETVFKI VFWLGYLNSC INPIIYPCSS EFKKAFQNVL RIQCLRRKQS SKHALGYTLH PPSQAVEGQH KDMVRIPVGS SMPRGSARIT VSKDQSSCIT ARIKSRSVIR LECSGMILAH CNLRLPGSRD SPASASQAAG TTGDVPPGRR HQAQLIFVFL 2 Tomake Mutations Substitutions Highlight the amino acid s and type in your changes Deletions Highlight the amino acid s and use Delete or Backspace key Note Deletions will not marked in the protein sequence Insertions Place your cursor upstream of the insertion point and type in your changes Refresh DNA Sequence In Silico DNA Sequence Expression system Escherichia coli K12 Genetic Code UNIVERSAL EX K A AX T S Y Gc FVS WS FP FF FAN L A 1 x 801 AAAARAAGCG GCGAAAACCC JIGGGCATTGI GGIGGGCIGC TITGIGCICI GCIGGCTGCC GITITITCIG GIGATGCC TTITITICGC CGCTITIGGG ACCCGTAACA CCACCCGACG AAACACGACA CGACCGACGG CAAAAAAGAC CACTACGC mm ERE Sak R E 3
112. e complete chromosomes EST Nucleotide Sequence Database EST Expressed Sequence Tags mouse and human EST others Nucleotide Sequence Database EST Expressed Sequence Tags other than mouse and human 82 Vector NTI Express Software User Guide BLAST search E Menu item Description GSS Nucleotide Sequence Database Genome Survey Sequence includes single pass genomic data exon trapped sequences and Alu PCR sequences HTGS Nucleotide Sequence Database Unfinished High Throughput Genomic Sequences PAT Protein sequences from the Patent division of GenBank PDB Peptide Sequence Database Saccharomyces cerevisiae protein sequences genomic CDS translations Nucleotide Sequence Database Saccharomyces cerevisiae genomic nucleotide sequences Alu repeats Peptide Sequence Database Translations of select Alu repeats from REPBASE Nucleotide Sequence Database Select Alu repeats from REPBASE DBSTS Nucleotide Sequence Database Database of GenBank EMBL DDBJ sequences from STS Divisions ENV NT Limit by Entrez Query This checkbox lets you limit the BLAST search to the results of an Entrez query against the database chosen This can be used to limit searches to subsets of the BLAST databases Select the checkbox and in the field below enter terms that would normally be allowed in an Entrez search session For example protease NOT hiv1 Organism this form
113. e input formamide concentration Oligos Containing lUB Ambiguity Characters RNA Oligos 176 Vector NTI Express can analyze oligos that contain IUB nucleotide ambiguity characters i e R Y W S M K B D H V and N In the case of ambiguity characters Vector NTI Express uses average pairwise dH and dS values for calculating the Tm For example for the dinucleotide pair CB Vector NTI Express averages the CC CG and CT thermodynamic parameters Table lt Blue gt lt Emphasis gt 1 to obtain average pairwise dH and dS values for CB It then sums the average pairwise thermodynamic parameters and calculates the Therm Tm values according to the equation described above refer Thermodynamic Tm Calculation on page 174 In the case of GC Tm Vector NTI Express applies the appropriate GC contribution represented by each ambiguity symbol to the standard GC Tm formula see GC Tm Calculation on page 173 For example a B ambiguity symbol contributes only two thirds the amount of a G or C residue to overall GC content RNA oligos use a different set of pairwise thermodynamic values than DNA oligos Pairwise thermodynamic values for RNA are summarized in the following table Interaction dH kcal mol dS cal mol K dG kcal mol AA UU 6 6 18 4 1 1 Table 2 RNA Nearest Neighbor thermodynamics Vector NTI Express Software User Guide Primer Probe Tm Values E
114. e and load settings 2 Click on Primer Design in the toolbar and select from the dropdown list of design tools Find PCR Primers Inside Selection Amplify Selection Sequencing Primers Hybridization Probes PCR Using Existing Oligos Primer3 Each primer tool opens in a separate pane in the Molecule Editor window with the basic settings accessible in the pane For advanced settings click on the Advanced button in the pane to open a separate dialog box Primer Design pane O 109 primer Design Sequencing Primers 4 DNA_ Cana 7 compementary trans ag 9 at ei Come ret 510 Probe Conc leel 250 0 dd Tempermure iC 25 0 E Ej eis ie m Advanced settings Save and load settings The Save and Load buttons at the bottom of each pane or at the bottom of each tab in the Advanced settings dialog allow you to save your primer probe design settings to a file and load the settings file for subsequent analyses Design settings are saved as pcr files This is useful for saving frequently used settings Run the design tool Primer probe design results 58 After you have selected the desired settings see the following pages for more details about individual settings click on Run in the primer design tool or click on OK in the Advanced settings dialog of the tool The primer or probe designs will be added as features in the molecule and listed in the Feature Map and displayed in the Graphics pane of t
115. e fragment will be added to the Fragment List Note Fragments in the list are named for the molecule as well as the region that was cut For example ADRA1A_1_608 is a fragment of the ADRA1A molecule taken from the 1 608 bp region 4 To select the fragment for cloning right click on the fragment in the list and select Select as left molecule or Select as right molecule u 0 ADRA1A_363 Setas left molecule H ADRA1A_602 Set as right molecule ADRAJA_821 Delete Fragment pcDNA3 1 Hi Save Fragment to Database 5 The fragment will be added to the appropriate pane and the cut ends will be displayed below that pane View Sequence Aarl ADRA1A_602_824 Alul ce X M09 K SR NNNN lt LE Mpio ooo AG q Br Semen nnnnnnnnnn nnn nnn kn kK 66666 TC 5 6 Repeat this procedure for the second molecule Edit the Fragment Right click on a fragment in the Fragment List and select Delete Fragment to delete it List or Save Fragment to Database to save it as a molecule in the database Vector NTI Express Software User Guide 117 Clone2Seq Modify fragment ends Assemble the molecule 118 1 To modify the ends of a molecule or fragment click on Modify Ends then select the desired modification using the dropdown list a Modify Ends ADRA1A_363_1477 gag Partial bases Partial fill in 2 The modification will be previewed in the dialog Click on OK to make the modific
116. e particular oligo being analyzed Vector NTI Express reports a Therm Tm value of zero Effects of Primer Probe and Salt Concentration on Tm Calculations Tm calculations are highly dependent on primer and salt concentrations varying these concentrations can greatly affect the Tm for any given primer Therefore it is important that you adjust the primer and salt concentrations appropriately so that accurate Tm values are generated Note In Vector NTI Express the default parameters for primer and salt concentration are 250 pM and 50 mM respectively for calculating Tm values Other Tm calculators commonly use a default probe concentration of 50 nM Because of this Vector NTI Express default parameter Tm values may not correspond to the default Tm values calculated using other programs Before comparing Vector NTI Express Tm values with those generated by other Tm calculators make sure that the parameters are adjusted appropriately GC Tm Calculation The GC Tm calculation1 does not rely on the thermodynamic properties of the oligo i e dHo dSo and dG values The formula for GC Tm is as follows Tm 81 5 16 6 log Nat 0 41 GC 675 probe length Vector NTI Express Software User Guide 173 Primer Tm Calculations Thermodynamic Tm Calculation Example Note Na is in molar units For oligo GTGCGAGGCAGCTGCGGTAA at 50mM salt Tm 81 5 16 6 log 0 05 0 41 65 675 20 81 5 16 6 1 30 26 65
117. eactivity and dimerization To open the tool click on the Oligo Duplex Analysis button in the Molecule oa Editor ery Dd Da User Defined Primer Name i Sequence ETTI Description Led Bi z ARA D hd A Selected Oligos Primers tea GTTTGTACAAAAAAGCAGGCTNN sina GGGGACCACTTTGTACAAGAAAGCTGGGTN fe _j EB spidey 3 dG Temperature C 25 0 Stem Length bp 3 Analyze Save Results Analysis Results 6Total GGGGACAAGITTGTACAAAAAAGCAGGCINN TIBA T j NNTCGGACGAAAAAACATGTTTGAACAGGGG Stem Length Dimer dG 8 0 kcal mol GGGGACAAGTTTGTACAAAAAAGCAGGCTNN III III NNTCGGACGAAAAAACATGTTTGAACAGGGG Stem Length Dimer df 4 2 keal ma1 w Entering or Using the tool you can analyze oligo sequences that you enter in the fields at the top selecting oligos or you can analyze saved oligos in the database Enter an oligo name and sequence under User Defined Primers at top of the window and click on Add to List to add it to the list of oligo sequences below and or Save to Database to save it as an oligo in the database e Click on Select Oligos in Database to select one or more saved oligos in the database to analyze Use Ctrl click and Shift click to select multiple oligos from the Oligos in Database dialog 48 Vector NTI Express Software User Guide Analysis parameters Run the analysis Silent Mutation Analysis The selected oligos
118. ear in the following table Interaction dH kcal mol dS cal mol per K dG kcal mol AA TT 9 1 24 0 1 9 AT TA 8 6 23 9 1 5 TA AT 6 0 16 9 1 0 CA GT 5 8 12 9 2 0 GT CA 6 5 17 3 1 3 CT GA 7 8 20 8 1 6 GA CT 5 6 13 5 1 6 Table 1 DNA Nearest Neighbor thermodynamics Vector NTI Express Software User Guide Thermodynamic Tm Calculation El CG GC 11 9 27 8 3 6 GC CG 11 1 26 7 3 1 GG CC 11 0 26 6 3 1 XX XX 6 0 16 9 1 0 Table 1 DNA Nearest Neighbor thermodynamics continued Notes All values refer to the disruption of a duplex at 1 M NaCl 25 C and pH 7 e The units for dH and dG are kcal mol of interaction whereas those for dS are cal K per mol of interaction Example The oligo 5 GTGCGAGGCAGCTGCGGTAA is parsed as follows dH 65 ss 114 119 56 78 11 0 114 58 78 111 78 58 11 1 119 110 65 60 91 G T G C G A G G C ADE A DD Tenor A dS 173 129 26 7 278 135 208 206 267 129 208 267 208 129 267 278 WH 173 169 24 0 dG 13 20 31 36 16 16 31 31 20 16 31 16 20 31 36 31 13 10 19 e Total dH 164 7 kcal mol The total dS reported by Vector NTI Express is the sum of the pairwise values above and the entropy associated with helix initiation dSo Thus for the example oligo above e Total dS 405 7 10 8 416 5 cal mol per K The total dG is the sum of the pairwise dG
119. ease the Expect value Because a short query is more likely to occur by chance in the database even a perfect match can have low statistical significance and may not be reported Increasing the E value lets you look farther down the hit list and see matches that would normally be discarded because of low statistical significance Word size Word size is roughly the minimal length of an identical match an alignment must contain if it is to be found by the algorithm Mega BLAST is most efficient with word sizes 16 and larger although word size as low as 8 can be used If the value W of the word size is divisible by 4 it guarantees that all perfect matches of length W 3 will be found and extended by Mega BLAST search however perfect matches of length as low as W might also be found although the latter is not guaranteed Any value of W not divisible by 4 is equivalent to the nearest value divisible by 4 with 4i 2 equivalent to 4i Scoring Parameters e Match Mismatch Scores Reward and penalty for matching and mismatching bases Many nucleotide searches use a simple scoring system that consists of a reward for a match and a penalty for a mismatch The absolute reward penalty ratio should be increased as one looks at more divergent sequences A ratio of 0 33 1 3 is appropriate for sequences that are about 99 conserved a ratio of 0 5 1 2 is best for sequences that are 95 conserved a ratio of about one 1 1 is best for
120. een T for sense and antisense primers GC Enter limits in degrees Celsius for primer melting temperature Tm temperature at which 50 of primer is a duplex and the difference between T for sense and antisense primers Primer Length Defaults to 20 25 recommended for Gateway Primers DNA RNA button Select the type of nucleotide sequence Add GGGG atfBx 5 Extensions The default a B extensions are for single fragment cloning attB1 for the sense primer and attB2 for the antisense primer Select from the dropdown list to replace the defaults with other a B sequences for creating Entry Clones for MultiSite Gateway Cloning projects Add generated primers to oligo list Select this checkbox to add the primers you generate to the oligo list Note For additional amplification settings click on Advanced The advanced amplification settings are identical for all PCR primers and are described in Chapter 3 Primer Design 126 Vector NTI Express Software User Guide Gateway Cloning workflow Amplify When you have made your selections click on the Amplify button The next task pane will be displayed and the generated PCR product s will appear listed in the BP Inserts subpane and also listed in the Gateway Project pane Gateway Project E General Info CDK2 Gateway Cloning project The PCR Product of ADRA1A_1_2306_attB1_attB2 E FindPCRPrimers E Product of Length
121. el markers oligos enzymes and projects e Open an assembly project DNA protein and 3D molecules and BLAST results Import DNA and protein molecules gel markers enzymes oligos BLAST results and assembly projects Edit molecules by inserting deleting and replacing sequence fragments and features You can also modify the display format and general data of molecules In the Database Explorer you can create subsets in a database and search databases Create a Local Database subset To create a subset 1 In the Explorer Viewer click Local Database right click a subset for example DNA RNA Molecules then select Add subset to open the Create Subset window 2 Enter a subset name for example Hexokinase description of the subset for example A collection of hexokinase genes then click OK Search a Local Database subset To search a Local Database subset 1 In the Explorer Viewer click Local Database then expand a database 2 Right click a database then select Search to open the Search window 3 Enter text To search for the exact text check Exact match only Click OK to begin the search Manage Database Projects and Results subsets in the Explorer Viewer You can e Adda subset page 24 Search a local database or subset page 24 Edit the properties of a local database subset page 24 Rename a local database subset page 24 Clear a local database subset page 24 e Dismiss l
122. ences The graphs in this pane interact with the sequences as listed in the Alignment pane Note All graphs display the values averaged in a window of a specific length defined by window parameter that slides along the alignment To generate the Similarity graph upper graph specific values in a 0 1 range are assigned to each residue at a given alignment position in each aligned sequence depending on whether the residue is identical similar or weakly similar to the corresponding residue of the consensus sequence The values 1 identical 0 5 similar and 0 2 weakly similar for each residue at a given position are totaled the sum is divided by the number of the sequences in the alignment normalizing the resulting value The Complexity graph lower graph is calculated as a sum of all pairwise residue substitution scores at a given alignment position divided by the number of pairs in the alignment The scores are taken from the residue substitution matrix used for alignment calculation Vector NTIO Express Software User Guide 101 Align Multiple Sequences Alignment pane Magnify the graphs Select a region In Windows click in the Graphs pane and use the mouse wheel to change the horizontal scale of the graph to zoom in on particular features A scroll bar will appear below the graph as you magnify On the horizontal scale either numerical positions in the sequence or residues can be shown depending on t
123. ent Pane to view the fragment sequences overlapping regions and consensus sequence 760 770 780 790 800 810 820 830 240 1 ri 1 H 1 1 1 i L 4 TCAAGTA 2 ACTACCAATGTCCCATTTGCCAG TAAGTGTCTGACTCCTTC ACTACCAATGTCCCATTTGCCAG TAAGTGTCTGACTCCTTC CONTIG TCAAGTAGATGAGGGGCTTATCGCTCCCCCAAGACTTTAAAAAAAAAAAACTACCAATGTCCCATTTGCCAG TAAGTGTCTGACTCCTTCA x x mn x L x Positions with Ns Ambiguities or gaps are flagged with are flagged with Vector NTI Express Software User Guide 167 Contig Assembly using ContigExpress Translate the consensus sequence Symbols in the sequence Inthe consensus sequence asterisks indicate positions containing Ns and plus symbols indicate ambiguity and or gaps In the fragment sequence gaps are indicated by a hyphen symbol Highlight a region Drag your cursor over a region in the Graph Pane to highlight that region in the Alignment Pane and vice versa Find Next Previous Ambiguous Symbol To search the consensus sequence for ambiguous positions or symbols N or R click on the Find Next Ambiguous or Find Previous Ambiguous buttons to the right of the Graph Pane or right click on the consensus sequence and select the commands from the right click menu gt F If an ambiguous position or symbol is found its position is selected and displayed If there are no more ambiguous symbols in the specified direction an alert pops up Hide o
124. equence Open dnd file Select fragments to align E e To load an existing project that has been saved as a apr aprx or aln file click on the Load Projects button in the Project Properties pane and select the project from the Open dialog To close a project click on the Close Project button If there are unsaved changes you will be prompted to save the project before closing To export an AlignX project as a aprx file click on the Export Project button and enter a project name in the Export MSA Project dialog Export MSA Project E VNTI Database BAnalysesTable D BLASTSearch My Recent IC QBLASTSearchAppDB Documents Citation 3 2 CntData Ej O EnzData E GMData ES MedLineStyle J2 MolData L2 MotData E OligData My Documents os Tables 93 B temp w Ji VecContData My Computer ka File name CDNA3 1Aliqn Project Save as type apx After you perform an alignment you can save the consensus sequence as a separate molecule in the database Click on Save Consensus and specify a sequence file name To open a external dnd file generated from a Clustal W analysis click on Open DND Select fragments to align The tools for selecting the fragments to align are located in the Fragments List region of the Project Properties pane Fragments Length pcDNA3 1 Hygro 5601 C pcDNA3 1 His C 5513 Add From File Add From Database Vector NTI Express So
125. es as well For each property the algorithm determines the optimum window of adjacent bases to be considered when calculating the value for a point For instructions in modifying the Window Size parameter see Window size on page 73 Highlight sequence To highlight a particular data region drag your cursor in the Graph or Sequence pane region in the graph and the corresponding region will be highlighted in both panes Magnify the graph In Windows click in the Graph pane and use the mouse wheel to change the horizontal scale of the graph to zoom in on particular features A scroll bar will appear below the graph as you magnify Determine the To determine the value at a particular point on the graph hold your cursor over the value at a point in bar in the graph at that point A popup number will be displayed reflecting the value the graph at that point If you have magnified the graph and highlighted a region in the sequence you can see the value calculated for that specific region GC Content 100 0 Note The Window Size parameter described below means that there is not necessarily a 1 1 correlation between a particular base or small group of bases in the sequence and a value in the graph Due to physiochemical interactions within a sequence each analysis algorithm necessarily calculates graph values from a window of surrounding data points Analysis parameters The following parameters and setting are available in the
126. escription Primer 3 End Check the first box and enter the number of consecutive 3 bases that must match the amplicon with 100 similarity Check the second box and specify the maximum acceptable match between the Amplicon and the designated number of bases on the 2 end of the primer Qualities tab Click the Qualities tab to set parameters that govern primer quality by determining how much weight should be assigned to the parameters on other tabs These values affect scoring functions that evaluate the quality rating of the primer sets generated The importance factors are integers between 1 and 10 used in calculating the score evaluating primer oligo quality The lower the factor the less weight given in the calculation For example for minimal importance enter 1 in the appropriate box For maximum importance enter 10 Vector NTI Express Software User Guide 69 3 Primer Design Shared Advanced settings 70 Vector NTI Express Software User Guide BioAnnotator BioAnnotator is a sequence analyzer that performs certain types of DNA RNA sequence analyses and displays the results as linear graphics Launching BioAnnotator To open BioAnnotator s Right click on a DNA RNA molecule in the Database Explorer and select Bioannotator or With a molecule open in the Molecule Editor click on the Bioannotator button on the right side toolbar The BioAnnotator window contains three panes a Sequence Info pane Graph
127. f ADCY7 Pscan Scans protein sequenc Z Completed Mon Dec 05 08 59 28 PST 2 y Selected Analytical Application Applications 4 V BlastProDom 7 FPrintscan Y cenezD Y Hamar V HMMPanther Y HMMPfam V HMMPIR V HMMSmart Y HMMTigr Y Patternscan V ProfileScan Y SignalPHMM Y Superfamily Y THM 3 Select the analytical application s to use from the available list of InterProScan tools then click on Submit Note The more applications you select the longer the analysis will take 4 When the analysis is complete it will be listed in the left hand pane as Complete 54 Vector NTI Express Software User Guide Protein Domain and Motif Finder Analyses 5 Double click on the complete job to return to the molecule with the results displayed in the Sequence pane and the Analysis Results ADRALA 20 checrma BACEOOA 061924 76 secs rhodapein i Zad s2 l wcs Mama N Rae X gt m a Score 690 54 D Senses tnverPredean Os DESALFEVLO TMS 4 Click on a feature in the Analysis Results pane to show expanded details for that result e Click on a checkbox in the Analysis Results pane to show or hide that feature in the Sequence pane e Right click in the Analysis Results pane and select Save All Analysis Results to Database to save these to Analysis Results in your local database Analysis Results saved to the database wi
128. ftware User Guide 97 Align Multiple Sequences Select fragments to align Add fragments Remove fragments Select fragments to align 98 To add fragments Click Add from File to select gb gp or fasta sequence files e Click Add from Database to select DNA or protein molecules from the local database Note Press the Ctrl or Shift keys to select multiple files molecules Data from the local databasae subset man Form Length Description Linear 6196 Homo sapiens adenylate cyclase 7 ADCY7 mRNA BaculoDirect Linear DNA_v Circular 139370 Invitrogen Vector BRAF Linear 2510 Homo sapiens v raf murine sarcoma viral oncogene homolog B1 BRAF mRNA CDK2 Linear 2226 Homo sapiens cyclin dependent kinase 2 CDK2 transcript variant 2 mRNA CREB1 Linear 2964 Homo sapiens cAMP responsive element binding protein 1 CREB1 transcript variant A MRNA EPAC Linear 3261 Homo sapiens Rap1 guanine nucleotide exchange factor directly activated by cAMP EPAC mRNA FIN Linear 2647 Homo sapiens FYN oncogene related to SRC FGR YES FYN mRNA Linear 3367 Homo sapiens guanine nucleotide binding protein G protein alpha inhibiting activity polypeptide 1 GNAQ Linear 1700 Homo sapiens guanine nucleotide binding protein G protein q polypeptide GNAQ mRNA Linear 1666 Homo sapiens guanine nucleotide binding protein G protein beta polypeptide 2 GNB2 mRNA Linear 698 Homo sapiens guanine nucleotide binding protein G
129. g of at least one site significantly widening the set of possible solutions compared to just single mutation analysis A DNA or protein molecule sequence or part of a sequence can be analyzed using a variety of online databases search engines and analysis tools Note These analyses require an active Internet connection 1 In the Graphics or Sequence pane select the region of the sequence to analyze or select Ctrl A to select the entire sequence 2 Right click and select Web Analyses gt search type gt search database Note You can also right click on a molecule in the Database Explorer to analyze the entire sequence 3 The sequence will be automatically transferred to the analysis engine on the web Vector NTI Express Software User Guide Back Translation DNA Molecule Web Analyses M13 reverse primer N Cut Ctrl x Copy Ctrl C Paste Ctrl v Delete Delete pDESTR4 R3 Vector II p C t 4555bp Amp R Camera Gene Prediction gt RADAR EBI Reverse Selection to Complementary DNA Feature Search CpG Island using EMBOSS cpgplotGEBI Create feature from selection RNAI Launch TOPO Cloning Te bla promoter Regenerator E Load in GeneArt Matas Launch Gateway Load in Parts Assembler BLAST Sequence M13 40 forward primer _ Primer Design L A M13 20 forward primer Protein Molecule Web Analyses Region_2 Protein Region_4 r j 1 Region_1 Source Region_3
130. g values click the Comments tab Enter comments about the oligo then click the Keywords tab To add a keyword for the oligo enter a new word or select an item in the list of existing keywords To move the keyword into the keyword list click lt Add To remove an item from the keyword list select it then click gt Remove To save your data click OK To close the Oligo window without saving your data click Cancel Vector NTI Express Software User Guide 19 1 Database Explorer Create gel markers oligos and enzymes Create an enzyme To create an enzyme 1 In the main menu click File New 2 In the drop down list select Enzyme to open the Enzyme window 3 In the General tab enter a name then click the Enzyme Methylase tab 4 Enter the recognition string of the enzyme 5 In the Cleavage Point Methylation Base field enter the number of the nucleotide immediately after the direct strand cleavage point The following example demonstrates how cleavage points of palindromic sites are defined Cleavage Point 2 AJA T AT T Lc 3 4 5 6 T T A T ATA In the Cleavage Point on Complementary Strand field enter the number of the nucleotide immediately after the complementary strand cleavage point The following example demonstrates how cleavage points are defined for non palindromic sites on both direct and complementary strands Cleavage Point on Complementary Strand 10 Cleavage Point 8 AAGTNNNINNN 1 2
131. g workflow the Task List displays the current task and allows you to move between tasks by clicking on a different task Current Task pane will change This pane displays the commands and settings for the currently selected task in the project As you navigate through the Task List workflow the functions in this pane Fragments Name Accession From To Length Form Description ADRAIA ADRAIA 1 2306 2306 Linear Homo sapiens adrenergic alpha 1A r CREB1 NM_004379 1 2964 2964 Linear Homo sapiens cAMP responsive elem PCR Amplification Setting Analysis Conditions Tm C SBC Length gt 40 0 gt 35 0 gt 18 ona Oana lt 65 0 lt 60 0 lt 25 Cloning termini O Blunt T A O Directional Add to Oligo List O Add generated primers to oligo list Advanced Amplify Vector NTI Express Software User Guide 135 13 TOPO Cloning Create save and load projects Create save and load projects The tools for saving editing and closing projects are located in the TOPO Project pane Ly TOPO Project j General Info TOPOCloningADRAIA Edit Project To save anew TOPO Cloning project click on Edit Project in the TOPO Project pane In the dialog enter a name and any description for the project To save changes to a project click on the Save Project button To close a project click on the Close Project button If there are unsaved chan
132. ges you will be prompted to save the project before closing To load an existing project in Database Explorer go to the Projects list open the Cloning Projects folder in the Local Database and double click on the TOPO Cloning project in the list to open it E Projects Name Descript Author Modified Cloning Technology ADRA1A_TOPO_Project 2011 12 10 09 59 33 TOPOCloning_T A S E Local Database CDK2 Gateway Cloning project 2011 12 10 05 48 46 Gateway_attB1_sttB2 Bij Alignment Projects New Parts Assembler Project 2011 12 11 01 37 19 BioBrick E Contig Assembly Projects E Cloning Projects i Remote Database Gu Database Eras TT General Description ka Results TOPO Cloning workflow The Task List displays the default TOPO Cloning workflow Amplify Fragments to Use in TOPO Reaction Create TOPO Clones e Preview Clones This section describes each task in the workflow Amplify fragments The Amplify Fragments to Use in TOPO Reaction task is the default task displayed to Use in TOPO when you first open the TOPO Cloning Tool reaction 136 Vector NTI Express Software User Guide TOPO Cloning workflow The first step in this task to select the fragment s you want to amplify by PCR for use in a TOPO cloning reaction These fragments will be listed in the Fragments list Fragments Name Accession From To Length Form Description ADRAIA ADRAIA 1 2306 2306 Linear Homo sapiens adre
133. gth of the primer s 3 region that should be analyzed Sense Primer 3 Nucleotides Check the nucleotide boxes to specify permitted last primer nucleotides for the sense primer Antisense Primer 3 Nucleotides Check the nucleotide boxes to specify permitted last primer nucleotides for the antisense primer Uniqueness Tab Click the Uniqueness tab to select settings to determine the uniqueness of the generated primers These parameters can be used to help ensure that generated primers bind to the desired template area with greater specificity than to the rest of the PCR product Uniqueness tab setting Description Uniqueness Checks for Choose the area of the molecule to check for primer uniqueness Either the entire molecule or the Amplicon only can be selected for the uniqueness check Max Allowed Similarity Check this box and enter the similarity threshold to check primer uniqueness on the molecule Primers which have parasitic hybridization with similarity gt this threshold will be rejected Note this similarity threshold must be lt the minimum similarity required for hybridization of user defined primers if any Max Consecutive Match for Entire Primer Check this box and enter the maximum acceptable match of consecutive bases for the entire primer and the Amplicon Vector NTI Express Software User Guide Shared Advanced settings Uniqueness tab setting D
134. he Vector NTI Express installation 1 To begin the analysis with a protein molecule open click on the Protein Domain button in the Analysis toolbar of the Molecule Editor window 2 Select the local version of the PROSITE or PRINTS database installed with Vector NTI Express ProSite database Local PRINTS Database Local mri S 3 In the Analysis Jobs window the name of the job will appear listed in the left hand pane and the status will be New submit eS s AnalysisType Description Status Modified Date Patmatmotifs A PatmatmotifsAnalysis of ADRA1A Patmatmotifs Scan a protein sequen Completed Mon Dec 05 08 34 Name ADCY7 w Patmatmotifs Parameters Accession number Description Full USA 4 Select the parameters that will be included with the results then click on Submit 5 When the analysis is complete it will be listed in the left hand pane as Complete 6 Double click on the complete job to return to the molecule with the results displayed in the Sequence pane and the Analysis Results Analysis Results E E PatmatmotifsAnalysis of ADRAIA 8 V AMIDATION G_PROTEIN_RECEP_F1_1 Accession number NP_150646 Description alpha 1A adrenergic receptor isc Full USA No Mon Dec 05 08 38 07 PST 2011 E aper O ADRATA X a a S Rag L
135. he Molecule Editor see Molecule features on page 42 Primer and probe designs are sorted in descending order in the Feature Map according to their rating values calculated based on the importance factors assigned in the Qualities tab see page 69 The molecule region of each design is listed in parentheses Vector NTI Express Software User Guide Run the design tool The results are also listed under Analysis Results in the Molecule Editor window along with specific information about each oligo sequence Analysis Results BE E SequencingPrimers E C Sequencing Primers 1028 to 1252 S C Sequencing Domain 1 from 1028 to 1252 ceTTTARACCCECTGATCAG Dec 50 0 Length 20 Site 1002 Tm 52 6 C dG 34 7 kcal mol dH 159 3 kcal mol dS 412 1 cal mol Time 15 01 2012 22 18 21 S E HybridizationProbes amp Hybridization Probes 1028 1252 O Time 15 01 2012 23 38 21 Primer and probe designs are also be listed in the Ordering dialog under Primers Save primer probe There are a number of ways to save primer probe designs designs s To save them as Analysis Results in the database right click on a top branch in the Molecule Editor Analysis Results pane and select Save All Analysis Results to Database e To save them as oligos in the Oligos Database right click on a primer probe sequence in the Molecule Editor Analysis Results pane and select Save Primers to Oligo Database
136. he chromosome DAS Authority Sources ER s Last Update Tima 2011 11 08 19 16 Sas ray Authority Y Sources hg19 Human sapiens Human Feb 2009 GRCh37 hg19 Geno NCBIM 1 RGSC 7 NCBI 3 Chromosomes Last Update Time 2011 11 08 19 16 Chromosomes Name Length Orientation 249250621 Forward 243199373 Forward 198022430 Forward 191154276 Forward 180915260 Forward 171115067 Forward 159133663 Forward In the DAS Server dialog select the server from the DAS Authority list Select the genomic source from the Sources list Select the desired chromosomes from the Chromosomes list then click on OK A In the Load Fragment dialog specify the base range of the sequence to download using the Start and Length fields 8 Select the feature information to download from the Feature Type list which displays a selected list of features available in the DAS databases E Load Fragment Positions Start 15000 Length 25000 Feature Type Name Category wgEncodeHaibMethylRrbsT47dE transcription weEncodeOpenChromChipMcf7C transcription wegEncodeHaibTfbsEcclEralphaa transcription sgpGene transcription wgEncodeGencodeManualV4 transcription lincRNAsTranscripts transcription xenoEst transcription nestedRepeats transcription Add Remove Use Ctrl click and Shift click to make multiple selections Click on Remove to remove selected features from the download 90 Vector NTI
137. he degree of zooming in the graphics pane Drag your cursor over a region of a graph to highlight that same region in the Alignment pane Alignment pane Select a region Dot Plot 102 The Alignment pane displays aligned sequences and the resulting consensus sequence The top row in the pane consists of the alignment consensus Consensus residues are those that appear most commonly at a particular site Note You can save the consensus sequence as a separate sequence molecule click on Save Consensus in the Project Properties pane Drag your cursor over a sequence region in the Alignment pane to highlight that same region in the Graphs pane Note The View Dot Plot button is only available when two fragments are selected in the Fragments List The Dot Plot is a method for comparing two sequences to find all possible matches of residues This method can also be used to find direct or inverted repeats in protein and DNA sequences It can predict regions in RNA that are self complementary and therefore might form a double stranded region or secondary structure In the Dot Plot method of sequence comparison one sequence A is listed on the X axis of the graph and the other sequence B is listed on the Y axis Starting with the first positions in A and B the program slides the window of n characters along the sequences performing a comparison of adjacent positions in the windows If the similarity of residues in each position is abo
138. he following options Save to Local Database saves the search in the local database Save as tab delimited file save as a text file Vector NTI Express Software User Guide BLAST Result Viewer Table pane Graphics pane Sequence pane BLAST search 6 Edit search change the search parameters and re Submit Delete BLAST job clears the results from the list Request ID Status Database Tool Query Length Hit Count Date Time Save to Local Database Save as tab delimited file Edit search Delete BLAST job 4 Double click on the search result to open the result in the BLAST Result Viewer Note BLAST results that have been saved to the database may be opened in Database Explorer click on Results and open the BLAST Results folder Double click on a BLAST search result in Database Explorer or the BLAST tool to open the result in the BLAST Result Viewer mm a oS oe The Viewer contains three main panes The Table pane displays a textual list of query hit molecules for the sequence The Graphics pane displays the corresponding sequence of each hit in graphical form The Sequence pane displays the Query sequence hit sequence with Accession number and Consensus sequence Click on a row in the Table pane or a feature in the Graphics pane to display the corresponding sequence in the Sequence pane Table pane columns e E Value This value reflects the likelihood that the
139. he table for that standard Some standards also include additional rules For more information about assembly standards visit http openwetware org wiki The_BioBricks_Foundation Standards Technical Formats Assembly Standard Parts must not contain the following restriction sites 10 EcoR Not l Xba l Spel Perl Nhe Pvu ll Xho Avril Sap 12 EcoR Spe Nhe Not Pst 20 EcoR Xba Spe Sbf 21 EcoR Bgl ll Bam Xho 23 EcoR Not Xba Spe Pst lin addition sequences must be in frame without start or stop codons and may not begin with TC 25 EcoR Not Xba NgoMI aka NgoMIV Agel Spe Pst Note If you are planning to create and share parts with other individuals and groups using these standards we recommend designing them so that they contain none of the restriction sites listed for any of the assembly standards to ensure maximum portability When you have selected two molecules click on the Assemble button at the bottom of the window Vector NTI Express Software User Guide Completing and previewing the assembly Using the Parts Assembler The Construct and Assemble dialog will open with options for assembly ES Construct and Assemble Name AssemblyProjectl Device Type Protein Generator Other Chassis Escherichia coli J Saccharomyces cerevisiae Bacillus subtilis Other Assembly Settings Part
140. ick Local Database then select DNA RNA Molecules or Protein Molecules 2 In the Records Viewer double click a molecule to open it 3 Right click anywhere in the Properties Feature Map or Analysis Results viewers then select Camera to take a screenshot of the data The data is copied to the clipboard and can be pasted in other applications Copy molecule image To copy an image of DNA RNA molecules and protein molecules 1 In the Explorer Viewer click Local Database then select DNA RNA Molecules or Protein Molecules 2 In the Records Viewer double click a molecule to open the Molecule Editor 3 Right click the graphical depiction then select Camera 4 Click anywhere in the graphic to take a screenshot The image is copied to the clipboard and can be pasted in other applications Copy a sequence To copy a sequence Vector NTI Express Software User Guide 31 1 Database Explorer Copy save and print molecules 1 In the Explorer Viewer click Local Database then select DNA RNA Molecules or Protein Molecules 2 In the Records Viewer double click a molecule to open the Molecule Editor 3 Select a sequence Click and drag across a sequence region in the molecule image or Click and drag across the text in the Sequence Viewer Right click then select Copy The data is copied to the clipboard and can be pasted in other applications Save a molecule Molecules you create can be saved to only to the Local Database
141. ify and discard chimeric sequencing reads that frequently result from lane tracking errors One of the major strengths of CAP3 is its consensus generation algorithm based on weighted sum of QVs ContigExpress analysis can be saved as a ContigExpress Project which contains the fragments their assemblies and assembly options In ContigExpress fragments can be edited directly with the chromatograms in full view Changes are tracked and a history is maintained The contigs generated can be saved to theVector NTI Express database About this chapter This chapter has the following sections Open Conl gEXDI 88 x a i a aa sad su ede wares ane Ea KE Cae Se ees Le 153 Manage ContigExpress projects ss uk 00 6 R 0 R cece eee RRR R KR R 155 Add fragments to Assemble TTT 156 Fracinent imine 0 sa ee k AAA a E a k kd eens ceeds 156 Assembly settings g seks se a el A Wa A ERROR ER ES 160 CESTAS assembly egener anaE 0008502443 andes esd hd IA 164 Save delete and rename contigs si ka ka aka kulk K kwa kk kn 165 View the assembly A mm che een ine Cree eens 166 Translate the consensus Sequence K K x K K K cece K eR 168 Edit the contig seguent x da a ka kik ka kk E la A k a A k kan 169 Open ContigExpress To open the ContigExpress tool Click on the ContigExpress button on the main toolbar lt gt OXRA QERA o o o w Ge Vector NTI Express Software
142. igned for a sequence region not an entire molecule The following are the unique settings for the Sequencing Primers tool These are also available under the Primers tab if you click on the Advanced button Sequencing 64 Primers setting Description Sequencing Region Region that you want to sequence Enter the start and end coordinates of the region to be sequenced Sequencing Domain Enter the number of bases to be sequenced in a single sequencing reaction Primer Hybridization Domain Enter the length of region where primers for each sequencing domain should be sought Primers are generated within the set domain Maximum Number Enter the number of primers to be found for each sequencing of Primers domain The actual result may contain fewer primers than this number if there are not enough possible primers DNA RNA Select the type of nucleotide sequence Complementary Select if you are sequencing the complementary strand Strand Vector NTI Express Software User Guide Hybridization Probes Sequencing a Primers setting Desari ier User Defined First Enter a user defined nucleotide sequence to be evaluated as a Primer primer for the FIRST sequencing domain instead of leaving the primer search to Vector NTI Express Software Analysis Conditions settings For information about additional Analysis Conditions settings see page 60 Advanced settings Click on the
143. ill be listed in the Fragments to Amplify list Fragments to Amplify Grane pea From To Sense Site Pape Description GNG5 GNGS 1 698 Homo sapiens guanine nucleotide bin YCRO10C YCRO10C 1 852 S cerevisise chromosome lll complete Load molecules or fragments in the Fragments to Amplify list With a molecule open in Molecule Editor right click in the Graphics or Sequence pane and select Launch Gateway to load the entire sequence in the list With a molecule open in Molecule Editor select a portion of the sequence in the Graphics or Sequence pane right click and select Launch Gateway to load only that part of the sequence in the list Vector NTI Express Software User Guide 125 12 Gateway Cloning Gateway Cloning workflow With the Gateway Cloning window open make sure the Amplify Fragments to Use in BP Reaction task is selected and click on the Add button under Fragments to Amplify to select a complete molecule from the database To change the regions to amplify in the selected molecules type a new range in the From and To fields in the Fragments to Amplify subpane Amplification settings With the fragment s loaded select the desired amplification settings under PCR Amplification Settings The standard options are described below Standard Settings Tm C Enter limits in degrees Celsius for primer melting temperature Tal temperature at which 50 of primer is a duplex and the difference betw
144. imer annealing site Structure tab Click the Structure tab to set acceptable limits for nucleotide repeats palindromes and hairpin loops for the primers You can also check your primers product for a selected group of restriction sites from this tab Structure setting Description Nucleotide Repeats Enter the maximum permitted length of nucleotide repeats in primers Palindromes Enter the maximum permitted length of palindromes in primers Vector NTI Express Software User Guide Shared Advanced settings Structure setting Description Hairpin Loops Stem Length Enter the minimum number of base pairs in a hairpin stem This value is also used as a minimum stacking length for primer primer complementarity and primer primer 3 end complementarity Permitted with dG Check the Permitted box for hairpin loops enter the minimum permitted value for free energy of hairpin loops Primers with hairpin loops which have free energy values gt to this number will be accepted Check Hairpin Loops Palindromes Nucleotide Repeats and Dimers Only Within 3 Region of Check this box and enter the length of a 3 region if all of a primer s features repeats palindromes hairpin loops dimers should be checked only within that 3 region If this box is empty the whole primer will be evaluated Check Primers For Restriction Sites From Check to find possible cloning sites
145. imers GC Enter the limits of G C percentage in the primer and the difference between GC percentages for sense and antisense primers Length Enter primer length limits Note Nucleotide sequences such as RENS attached to a primers 5 end are included when calculating primer length Note The calculation for Tm is dependent on primer and salt concentrations varying these concentrations can greatly affect the Tm for any given primer Make sure to adjust these parameters according to your reaction conditions when performing your PCR analysis to ensure that you obtain accurate Tm values Attach to 5 Terminus settings Click on the Attach to 5 Terminus dropdown to access these settings Attach to 5 Terminus setting Description Attach to 5 Terminus Enter a short lt 18 bp nucleotide sequence if any to be attached of Sense Primer to the 5 end of either primer To choose from recognition sites of and or Antisense database RENs click the Browse button next to each field Primer Note This sequence while considered in primer parameters does not affect the calculation of complementarity between primer and molecule A sequence can be attached to the primer whether or not the primers are user defined or designed by the software Advanced settings Primers tab Click on the Advanced button below the main settings to open the Advanced settings dialog Under the Primers tab the settings described above are lis
146. in and out of the molecule Rag e Display the molecule as linear or circular by clicking on the appropriate button d After creating entry clones click on Add Entry Clones to Use in LR Reaction in the Task List to proceed to the next task in the workflow Any entry clones that you generated from the previous tasks in the workflow will be listed in this window To select new or additional entry clones in the database click on the Add button and select from the dialog box Vector NTI Express Software User Guide 129 Gateway Cloning Gateway Cloning workflow Create Expression Clones by LR 130 IMPORTANT To be recognized as an entry clone in Vector NTI Express a molecule must contain the correct attL1 and attL2 sequences and these sites must be labeled as features in the molecule with the feature names attL1 and attL2 See Chapter 2 Molecule Editor on page 39 for information on identifying and naming features To remove an entry clone from the list select it and click on the Remove button In the Create Expression Clones by LR task pane you can modify the list of entry clones and select a destination pDEST vector or vectors with which to create expression clones Task gt Amplify Fragments to use in BP Reaction D gt Recombine Entry Clones by BP D gt Preview Entry Clones use in LR Reaction Antisense Site Description Entry Clone pDONR22 Entry Clone pDONR22 Entry Clone p
147. in the Name column to download the sequence and database information for that query molecule from the NCBI database and save it as a separate molecule in Vector NTI Express Software The database information for the sequence will be populated in the Properties of the created molecule Note You will be prompted to submit your email address when connecting to the NCBI database You can use the NCBI Entrez cross database search engine directly from Vector NTI Express Software For more information about this search engine visit www ncbi nlm nih gov sites gquery Note An Internet connection is required to perform this search To perform an Entrez search click on the Public Database Search button on the main toolbar Se ECO QEXA O W P The Entrez search tool will open Request ID Status Database Search Term Date Time amp Entrez Query Database protein v SearchTerm prolactin gt Noresults Page oto Page size 10 Search Builder AND vw au Fields v BLAST The Entrez search tool includes the following panes e Query pane Contains settings for formulating a query e Query List pane Lists the status of each query request e Results pane Displays the results of a query Vector NTI Express Software User Guide Entrez search settings Entrez search results Entrez Search 6 The Entrez search engine allows you to search across a wide variety of NCBI
148. ing Description Region of Analysis The start and end coordinates of the region to amplify You can enter new coordinates or select a region of the sequence before opening the tool to pre populate the region coordinates Product Length Enter the maximum and minimum lengths of the molecule target region Note Unless you specify differently here the minimum amplicon length may be less than the target sequence you selected Maximum Number of Primers Enter the number of sense antisense primer pairs to be found The actual result may contain fewer than this number if there are not enough possible primers Analysis Conditions settings Click on the Analysis Conditions dropdown to access these settings Analysis Conditions setting Description DNA RNA radio button Select the type of target nucleotide sequence Salt Concentration Enter the PCR reaction salt concentration in mMol if known Probe Concentration Enter the value of probe concentration in pMol if known dG Temperature Enter the temperature in degrees Celsius to be used for calculating free energy values Vector NTI Express Software User Guide Amplify Selection settings Analysis Conditions w Description setting Tm Enter limits in degrees Celsius for primer melting temperature Tn temperature at which 50 of primer is a duplex and the difference between T for sense and antisense pr
149. ing TOW aci coa rs Gre bln br Bobs dae bo Sok Ue yd Ieee 133 Open the TOPO Cloning Tool 0 0 cece cece eeee 133 TOPO Project pane escra renidi ir e RT R R e eee v e KR R aS K T 134 BETAN dD N DN D A DA ete Ete RT RG lace tas 135 Current Task pane aka ayda hd akla E e la ont Maule hak ed Ht Eha ALA Kurr l eka At 135 Create save and load projects kk kk kk kk kk kk kk kk KK KK kK kk kk kk kk kk kk kk kk kk kk ka 136 TOPOS Cloning Workflow A i 2 4 xaa giyan dk desl dal da a az e rd ea e 136 8 Vector NTI Express Software User Guide Contents A DD A Dm EE e U TT aah 136 Amplify fragments to Use in TOPO reaction 2 00 kK KK KK KK enn ees 136 Create TOPOS Clos it A d Sans bn Be etek wre 139 CHAPTER 14 GeneArt Cloning 00c e KK KERR KK KO 141 INTFOUUCUON anit acc ante accion dinates XEN N eatin cise sce Sia hoe Ree 141 GeneArt Seamless Cloning Overview 20200 cece kk kk kk kk kk kk kk k 141 GeneArt High Order Assembly Overview W kk kk kk kk kk kk kk kk kk kK kK kk kK kK kk kk 141 How GeneArt Assembly Works ccc kk kk kk KK KK KK KK KK KK KK KK KK KK KK KK kK kk kk kk ka 142 Open the GeneArt Assembly Tool WWW kk kk kk kk kk kk kK kk kK KK KK KK KK kK kk kk kK kk kk ka 143 SSR L LE L QENDMMMD N NNN NMMAIIW I WJMJIMEENEETEDMDMWM DIM 143 From the main toolbar with no molecule selected kk kK KK KK KK KK KK KK 143
150. ion about the Attach to 5 Terminus settings see page 61 Advanced settings Click on the Advanced button below the main settings to open the Advanced settings dialog Advanced are described in Shared Advanced settings on page 66 Vector NTI Express Software User Guide 63 Z Primer Design Sequencing Primers settings Sequencing Primers settings Select Sequencing Primers to find primers for sequencing a DNA molecule fragment With the molecule open in the Molecule Editor select the region to be sequenced then select Primer Design gt Sequencing Primers from the Molecule Editor toolbar bd Primer Design Sequencing Primers D 4 E T 7 F H are Sequencing Primers La Seguencing Region F From 1022 bp To 1039 bp Dd J Domain E Sequencing Domain 300 fea s ma Primer Hybridization Domain 50 El Spitey Max No ofPrimers 1 1 gt Analysis Conditions soi x Advanced Load Save Default AAA Primers will be generated anywhere within the designated Primer Hybridization Domain upstream and downstream If the sequencing region is long enough it is divided by Vector NTI Express into smaller sequencing domains areas in which a single sequencing reaction will take place The size of the primer hybridizing domain may then be set as well as other primer parameters Several primer options are evaluated and sorted from best to worst Note Sequencing primers are des
151. is Results Open the Analysis Monitor and double click on the particular analysis Spidey is an mRNA to genomic alignment program It takes as input a single genomic sequence and a set of mRNA accessions or FASTA sequences All processing is done one mRNA sequence at a time The first step for each mRNA sequence is a high stringency BLAST against the genomic sequence The BLAST alignments are sorted by score and then assigned into windows by a recursive function For more information about Spidey see www ncbi nlm nih gov spidey After the genomic windows are constructed the initial BLAST alignments are freed and another BLAST search is performed this time with the entire mRNA against the genomic region defined by the window and at a lower stringency than the initial search Spidey then uses a greedy algorithm to generate a high scoring non overlapping subset of the alignments from the second BLAST search This consistent set is analyzed carefully to make sure that the entire mRNA sequence is covered by the alignments Once the mRNA is completely covered by the set of alignments the boundaries of the alignments are adjusted so that the alignments abut each other precisely and so that they are adjacent to good splice donor and acceptor sites To position the exon boundaries the adjacent exon alignment overlap region plus a few base pairs on each side is examined for splice donor sites using functions that have different splice matrices
152. itle of Publication in footer gt Headquarters 6 5791 Van Allen Way Carlsbad CA 92008 USA Phone 1 760 603 7200 Toll Free in USA 800 955 6288 For support visit www appliedbiosystems com support technologies www lifetechnologies com
153. itself may not contain any of these restriction sites Vector NTI Express Parts Assembler is compatible with BioBrick part standards For general information about the BioBricks Foundation visit www biobricks org For information about parts and assembly standards including instructions and tutorials visit http openwetware org wiki The_BioBricks_Foundation Standards Technical Resources The DNA sequences of thousands of public domain standard biological parts are available through the Registry of Standard Biological Parts at http partsregistry org For a detailed description of the assembly standards visit http openwetware org wiki The_BioBricks_Foundation Standards Technical Formats Note BioBrick is a trademark of the BioBricks Foundation Inc The BioBrick trademark is used herein merely for the purpose of fair use The BioBricks Foundation Inc is not affiliated with Life Technologies Corporation The BioBricks Foundation Inc has not authorized sponsored or otherwise endorsed this product or our use of the BioBrick trademark herein Information about BioBrick and the BioBricks Foundation Inc can be found at www biobricks org Using the Parts Assembler Selecting Parts To open the Parts Assembler e Click on the Parts Assembler button on the main toolbar erse ez3 e Select File gt New gt Parts Assembler Project from the main menu The Parts Assembler window is divided into two panes one for each part
154. k kK kK kK KK kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk 75 Open Regenerator nannan un nrn n rnrn rnrn rrara nnana 75 Regenerator t olfeat res isis dd eed 76 Create mutations in the input sequence Ml Jk kk kk kK kk KK KK KK KK KK KK KK KK KK KK KK kK kk kk kk kk k 76 Clear mutations ico eee ce dain Meee R E R a RR R ae cra ene 77 View the mutated sequence rr 77 Refresh the in silico DNA Sequence WWW kk kk kk kk kk kK kK kK KK KK KK KK KK kK KK kk kk kk kk 77 Optimize the expression system and genetic code kk kk kk kk kk kK KK KK KK KK KK KK KK KK 77 AddattachMents gt a aub ka ih k cos K Ml nala IE ee Seas KK a Sea eed 77 Clear attachments esise seren l k awke rr 78 Generate a new sequence and send for synthesis WWW kk kk kk kk kk kK KK KEK KK RR KK KK KK 78 CHAPTER 6 BLAST and Entrez Searches see x e e K 81 BLAST Search 3 s va ke w k E Zina k k A Pak ala al a vk W R ae be ka rad na 81 Open the BLAST search Loo 81 BLAST Search Settings iiri Za can A A AI 81 Perform the BLAST SORI D T n l anl lan i nab n k 05 l n a Wek AN e beka SR Q R k 84 BLAS I ResultVieWer is iii 205154 sdb aden ile AJA Q MAWA ca Di 85 Entrez Search 2 5 Halla ay wad hala kk a ba ee Wa Kw ea Wa RE wind way bbe kind ae er S kla n 86 Open Entrez search Log 86 E ntrezsearehsettiNgS ii las din A a a kU 87 Entrez Seanrchiresults ya enna shot ii ar We
155. kk kk kk kk kk kk kk 165 Save contig assemblies WWW kk kk kk kk kk kk kK kk KK kk kK kk kk kk kk kk kk kk kk kk kk kk kk 165 Delete a contig assembly kk kk kk kk kk kk kk kk kk kK KK kk kk kk kK kk kk kk kk kk kk kk kk ka 165 Re assemble contigs kk kk kk kk kk kk kk kK KK kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk ka 165 Renam a contig 5 4 5 97 ees ce A Kel WD RW Ee eb AE 166 View theassembly serra l k kral a K deen A A av 166 Contig Viewer Graph Pane WW kk kk kk kk kk kk kk kk kk kK kk kk kk kk kk kk kk kk kk kk kk kk kk 166 Contig Viewer Alignment pane 0 0000 cece ccc kk kK kk kk kk kk kk kk kk k 167 Translate the consensus Sequence JV Ak kK kk KK KK kK KK KK KK KK KK KK KK kK KK kk kk kk kK kk kk kk kk 168 Edit the contig sequence AVVA kk kk kK kK KK KK KK KK KK KK KK KK kk kK eee eens 169 SCT Sc on wat eaed E Ie a ay pata aoe twin diay 169 Deletions kak O EIA Aur eae gee 169 Saving sequence Changes cece cece kk kk kk kk kk kk kk kk kk kk kk kk kk kk 169 APPENDIX A Symbols and Formats IUB IUPAC Ambiguity Codes and ASCII Format DD nm n mm 171 Format for ASCII Sequence Files WW kk kk kk kk kk kK kK kK KK eee kk kk kk kk kk kk kek 171 IUB Formats recognized by Vector NTIO Express WWW ccc cence ccc WW WW WE EEE KAKA 171 APPENDIX B Primer Tm Calculations ss e e e anaana nnna 173 General Information essa ccc en sk ka alal kk a ATR kk S R pole bt ace Gaba Oh eee ee eee d 173
156. l Vectors To select a vector e Click on the Add button and select the vector from the database e To remove a vector from list select it and click on Remove e To clear the entire list click on Clear All Create the TOPO Clone When you have made your selections click on Create TOPO Clone The Preview Clones task pane will open Vector NTIO Express Software User Guide 139 13 TOPO Cloning TOPO Cloning workflow 140 Vector NTI Express Software User Guide 14 Introduction GeneArt Seamless Cloning Overview GeneArt High Order Assembly Overview GeneArt Cloning Using Vector NTI Express you can create GeneArt assemblies from DNA molecules in the database Simply select the fragments to be assembled and the software will e Analyze the sequences for homologies between the fragments Design PCR primers to create the necessary end homologies Design stitching oligos for use in GeneArt High Order assemblies e Display the assembled molecule with the specified primers and or stitching oligos in a single molecule file For more information about GeneArt technology visit our web site at www lifetechnologies com and search for GeneArt Detailed technical information for each type of GeneArt assembly method is available in the following user guides GeneArt Seamless Cloning and Assembly Kit User Guide and GeneArt High Order Genetic Assembly System User Guide These are available for d
157. lick on Create Entry Clone The Preview Entry Clones task pane will open Vector NTI Express Software User Guide Preview Entry Clones Add Entry Clones to Use in LR Reaction Gateway Cloning workflow The Preview Entry Clones task pane lists all the entry clones created from the attB containing fragment s and the donor vector s you selected and includes a preview window for viewing an entry clone E Task Entry Clones D gt Amplify Fragments to use in BP Reaction Name Accession Type Division Sense Site Antisense Site Description D gt Preview Entry Clones Entry Clone pDONR22 Entry Clone pDONR2 Entry Cloning attl1 attl2 gt Add Entry Clones to use in LR Reaction gt Create Expression Clones by LR gt Preview Expression Clones Preview RRE L j I cbs 2 ADRA1A ADRAIA j j i ji c ADRAIA ADRAIA insert __ f eneore MBE Entry Clone p 224 Product of ADRA1A_1_2306_ Ss ae A853bp ADRAIA appara ADRAIA ADRAIA NA j li li ji NOA i Terminator Gateway Project Primer rs Ml gt Entry clones contain attL1 and attL2 sites and are used to generate expression clones via an LR reaction In the Entry Clones list e Select a clone and click on Save to Database to save it as a DNA molecule in the database Double click on a clone to display it in the Preview window In the Preview window e Using the magnifying tools to zoom
158. lignment and the sequence being added Default 6 Min Num Constraints Correction This is the minimum difference between the numbers of constraints satisfied in the current assembly and in the alternative assembly A difference greater than this value if the contig is also supported by an alternative set of overlaps results in the alternative join Min Num Constraints Linking This is the minimum number of constraints for reporting a link between two contigs Lite Settings Tab In ContigExpress you can create two different types of contigs Full Contigs or Lite contigs On the Lite Settings tab you can specify the type of contigs you want to assemble in the project In Full contigs mode chromatogram data are retrievable and sequence editing performed in the Contig Viewer are reflected in the individual fragment files Lite contigs disregard fragment chromatogram data and there is no dynamic association between a Lite Contigs and its component fragments Editing done on Lite Contigs is NOT reflected in the original fragment sequences original sequences remain unedited Assembly in Lite Contig mode reduces memory consumption and is therefore the preferred contig type for assembling large projects Lite Settings Parameters Discard chromatogram Check this box to discard sequence file chromatogram data data on import when the sequences are imported Check this box before you import your sequence reads Note you can
159. ll listed in the Database Explorer under Results in the Analysis Results folder G Results Name v G Local Database ES BLAST Results a Analysis Results Ed Remote Database Vector NTI Express Software User Guide Analysis Type Pscan Patmatmotifs Patmatmotifs InterProScan Analysis Object Name PscanAnalysis of ADCY7 at M PatmatmotifsAnalysis of AD PatmatmotifsAnalysis of AD InterProScanAnalysis of ADR ADCY7 ADRA1A ADCY7 ADRAIA General Description 55 2 Molecule Editor Protein Domain and Motif Finder Analyses 56 Vector NTI Express Software User Guide Primer Design This chapter describes the functions for designing primers and probes in Vector NTI Express including settings for designing PCR primers sequencing primers and hybridization probes Vector NTI Express can design primers for an entire DNA molecule sequence or part of a sequence selected in the Molecule Editor window After selecting the target sequence the maximum and minimum product length and parameters are determined and the software evaluates rates and sorts several design options You can further fine tune the oligos and annealing parameters if you wish save the primers or probes as separate molecules in the database or to the Oligo List order custom oligos from Life Technologies or use the primers in recombinant cloning strategies The following table summarizes the various primer
160. m j 46 Perform the analysis er Qad gana xa A la A daka wu z k aah une ka Av 46 WranStatlontOOl dy ma teh ti ids hb he Hien roa hess Me ad d n j S Ged 47 Translation results ict cock deed Meatball ae bee N e anal eee 47 Oligo Duplek Analysis ioaren 2 xal vue dace e Weed Seles 48 Entering or selecting oligoS MM kk kk kk kk kk c KK KK KK KK KK kk kK kK kK e kk kk kk kk kk kk kk 48 Analysis parameters v di kt a Sak A la ak we Men eee 49 Run the analySiS o 49 Silent MutationAnalySIS a ii pie 49 Web MaS a A A A RR L Ad Kae 50 Back Translat ES RS XERE KARE a EI RESNA 51 Protein Domain and Motif Finder Analyses n nann kk kk kk kK KK KK KK KK KK KK KK KK KK kk kk 52 Protein Domain Analysis PROSITE and PRINTS databases WWW KK KK RR KK 52 Motif Finder InterProScan sequence Search 2 00 0c cece cece KK KK KK KK eens 54 CHAPTER 3 Primer Design sse kk kk kk kK KK KK RR KK KK KK KK kk kk 57 Open the primer probe design tools n 26 6 c cece cece eee kk kk kk eect kk kk ees 57 Save and load Set li 05 44 3k sa e ea a do eel a e te A 58 Runthe design tool a ya sky Kul A AA AL d n Z te ne ee 58 Primer probe design results WWW kk kK kk cece cece cece eect tenet kk ke 58 Save primer probe designS n kk kk kk kk cece kk kk kk ete kk kk kk kk kk kk tees 59 Find PCR Primers Inside Selection settings WWW kk kk kk kk kK kk KK KK KK KK KK KK KK KK KK KK KK kk 60 Amplify Selection
161. mblies containing the fragment may be dismissed Sequence changes are saved with the project or if you save the contig as a separate molecule They do not change the fragment molecule itself in the database Vector NTI Express Software User Guide 169 Contig Assembly using ContigExpress Edit the contig sequence 170 Vector NTI Express Software User Guide A Symbols and Formats IUB IUPAC Ambiguity Codes and ASCII Format Format for ASCII Sequence Files An ASCII sequence file must obey the following rules It must be a plain ASCII text file The file must contain the nucleotide amino acid sequence arranged in lines Each line may contain the following Nucleotide amino acid symbols and white space or A number followed by white space and nucleotide amino acid symbols therefore similar to GenBank format in which case the number will be ignored or A number only in which case the number will be interpreted as a block of unknown nucleotides amino acids of the corresponding length IUB Formats recognized by Vector NTI Express The following characters defined by the International Union of Biochemistry IUB are used to represent nucleotides throughout Vector NTI Express Symbol Meaning A adenine thymine cytosine guanine purinelA or G pyrimidine C or T AorT CorG A or C T or G C G or T T G or A C A or T C G or A unknown nucleotide
162. me and computer memory Default 300 Max Overhang Percent Length This parameter controls the different overhang regions before or after the aligned region It is defined as 100 times the total length of the different overhang regions divided by the length of the overlap Overlaps with a value greater than the maximum cutoff are not used for assembly Default 20 Contig Tab Contig Tab includes parameters affecting construction of contig and multiple sequence alignments thus the consensus sequences QVs are used extensively during this process if they are available If unavailable the program assigns a QV of 10 for each base Three of the parameters Match Score Factor Mismatch Score Factor and Gap Penalty Factor are editable only on Contig Tab e Match Score Factor Match Score Factor is a positive integer to award each match between the existing alignment and the sequence being added when calculating the score of global alignments Default 2 e Mismatch Score Factor Mismatch Score Factor is a negative integer to penalize each mismatch between the existing alignment and the sequence being added when calculating the score of global alignments Default 5 Vector NTI Express Software User Guide 163 Contig Assembly using ContigExpress Perform the assembly Gap Penalty Factor Also Gap Penalty Factor is a positive integer to penalize each gap extended when calculating the score of global alignments between the existing a
163. n accept products of PCR amplification with a Tag polymerase whose terminal transferase activity adds 3 A overhangs to the amplicon Inserts are cloned in both orientations e In directional vectors one terminal is blunt ended and the other has a 5 GGTG overhang on the bottom strand PCR products are generated with a 5 CACC extension on one end and this strand when unwound is preferentially annealed to the vector overhang More than 90 of the clones are in the correct orientation and the time spent in screening colonies is thereby reduced The presence of topoisomerase enzyme also helps protect vector ends from degradation particularly from contaminating nucleases that may be present in ligase preparations Moreover the avoidance of restriction site cutback for cloning PCR products means that internal cleavage sites are not a problem Any linear double stranded DNA sequence of interest may be cloned into a TOPO vector using Vector NTI Express In addition linear sequences with 3 A overhangs the products of PCR amplification with a Tag DNA polymerase may be cloned into TOPO TA vectors Such Tag generated molecules can be generated in silico using the TOPO Cloning tool TOPO Cloning Tool Open the TOPO Cloning Tool The TOPO Cloning Tool contains settings and functions for assembling a TOPO construct using the workflow described above and for creating and managing TOPO Cloning projects There are several way
164. n kan oe See bb ne n ele kok 97 S Te T Xku 5553 A ML read KE K ARA Ku Sa kl Xak di Wa 97 Save CONSENSUS SEQUENCE 1 kk kK kK kK KK kK KK KK KK kk kk kk kk kk kk kk kk kk kk kk kk kk k 97 Open did tle Hc lc adn ie et aati ai 97 Select fragments to align kk kk kk kk kK kk cece kK KK kk KK kk kK KK kk kk kK e kK kk kk ka 97 Add fragmentos boas kumet ane KIR e a een bee eae PP ee N Eee erd 98 Remove fragments 2 4 00 xal ene gate ee ul k dalal q kn deletes bake ota 98 Select fragments to align kk kk kk kk kk kk kk kk kK kK kK KK KK kK KK kk kK kk kK kk kk kk kk kk kK kk k 98 Alignment Settings iii EE nnn 99 si gole nela n BORE NY MN a E R e En te HE cae YE EN 99 Molecule types iiss cov ve kana b kun he Ka blln be ed vie s e Hea ee Waal he ade ek 99 Pairwise aliqnment os a nies std aa cee dj nk k WA eis wince nie 99 Multiple sequence options kk kk kk kk kk kk kk kK kk kK KK kk e eee eee kk ka 100 Perform the alignment Li led KK KK KK KK KK KK kK kk kk kK kK kk kk kk ka 101 Guide res pan s n sec dindan hen as Aa Sie tae shies 1 DA Aa S cy Pda al See a ttl cud 101 Graphs paheisiin sade eee pee reed A ee Fed etek ee Bee oe eee Pere 101 Sequence similarity graph 2 0 0 0 2 cece cece kK kK KK kK KK KK kk kk kk kk kk kk kk kk kk kk 101 Sequence complexity graph WW kk kk kk kk kk kk kk kk kk kk kK kK kk kk kk kk kk kk kk kk kK kk kk kk 101 Magnity the graphs w n anak Sa an her
165. nd are enabled and editable when checked Forward and reverse reads must be named identically up to the delimiter default dot and must contain paired suffixes thereafter e g s amp r or x amp y Suffixes may be added and deleted Only the letter immediately following the delimiter is recognized as the suffix Other letters following it if any do not contribute to the identity as forward versus reverse end sequence however they do distinguish one forward reverse pair from another thus making two sequence pairs with the matching reverse forward end sequence Minimum and maximum distances may also be edited Note Take care when defining file names at the sequencer especially when a project is loaded in batches over several days Entries with misplaced suffixes e g lt filename gt F lt projectName gt instead of lt filename gt F lt projectName gt will be overlooked by the constraints feature although they may be included in an assembly e Min Dist Minimum Distance between the forward and reverse reads Default 0 e Max Dist Maximum Distance between the forward and reverse reads Default 6000 e Delimiter the letter separating main part and suffix part in read names In cases that there are multiple occurrences of the designated delimiter the rightmost delimiter is selected The values of minimum and maximum distance are uniformly applied to all sequence pairs Clipping Tab Sequence clipping based on
166. ndation Inc is not affiliated with Life Technologies Corporation The BioBricks Foundation Inc has not authorized sponsored or otherwise endorsed this product or our use of the BioBrick trademark herein Information about BioBrick and the BioBricks Foundation Inc can be found at www biobricks org TaqMan is a registered trademark of Roche Molecular Systems Inc GeneArt is a registered trademark of GENEART AG Windows and Microsoft are registered trademarks of Microsoft Corporation Macintosh Mac and Mac OS are registered trademarks of Apple Inc Limited Use Label License For Research Use Only The purchase of this product conveys to the purchaser the limited non transferable right to use the product only to perform internal research for the sole benefit of the purchaser No right to resell this product or any of its components is conveyed expressly by implication or by estoppel This product is for internal research purposes only and is not for use in commercial applications of any kind including without limitation quality control and commercial services such as reporting the results of purchaser s activities for a fee or other form of consideration For information on obtaining additional rights please contact outlicensingldlifetech com or Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Technical Resources Additional technical resources for Vector NTI Express Software are available online at htt
167. nder to identify ORFs in the sequence this selection will translate the ORFs 3 If you selected 6 Frame Translation select number of direct and complementary Translation Frames used to translate the sequence Up to three direct strand 1 2 3 and three complementary strand 1 2 3 translations may be selected 4 To create a new protein molecule from the translation select the Translate into new protein Otherwise the translation will be displayed within the DNA RNA sequence 5 Click on Run button to perform the translation If you selected Translate into new protein you will be prompted to name the new protein and the protein molecule will be created Otherwise translations of the direct strand will appear above the DNA sequence and translations of the complementary strand will appear below the sequence Vector NTIO Express Software User Guide 47 2 Molecule Editor Oligo Duplex Analysis Translated sequence using 6 Frame Translation with 2 Frames selected 2 ARGLYSGLN LEUTERPRO TER LEUARG GLN ALA ILE ASN PHE VAL TER LYS SERTER THI T T T T T H 1 GLNGLUTHR ALA METTHR MET ILE THRPRO SERTYRGLN LEU CYS ILE GLU LYS LEU ASN L T T T T T T T T T L i T T T T T T T 1 1 CAGGAAACAG CTATGACCAT GATTACGCCA AGCTATCAAC TTTGTATAGA AAAGTTGAAC GTCCTTTGTC _GATACTGGTA CTAATGCGGI _TCGATAGTTG AAACATATCT TITCAACTIG Oligo Duplex Analysis Oligo Duplex Analysis enables the analysis of one or more oligos for potential cross r
168. nergic alpha 1A r BRAF NM_004333 1 2510 2510 Linear Homo sapiens v raf murine sarcoma vi Load molecules or fragments in the Fragments list e With a molecule open in Molecule Editor right click in the Graphics or Sequence pane and select Launch TOPO Cloning to load the entire sequence in the list With a molecule open in Molecule Editor select a portion of the sequence in the Graphics or Sequence pane right click and select Launch TOPO Cloning to load only that part of the sequence in the list With the TOPO Cloning window open make sure the Amplify Fragments to Use in TOPO Reaction task is selected and click on the Add button under Fragments to select a complete molecule from the database To change the regions to amplify in the selected molecules type a new range in the From and To fields in the Fragments to Amplify subpane PCR Amplification Settings With the fragment s loaded select the desired amplification settings under PCR Amplification Settings The standard options are described below Standard settings TmlC Enter limits in degrees Celsius for primer melting temperature Tm temperature at which 50 of primer is a duplex and the difference between Tm for sense and antisense primers GC Enter limits in degrees Celsius for primer melting temperature Tm temperature at which 50 of primer is a duplex and the difference between Tm for sense and antisense primers Primer Length Default
169. netic code To substitute one or more amino acids or bases highlight the desired part of the input sequence and type in your desired changes To delete part of the input sequence highlight the sequence and use the Delete or Backspace key Protein to be Expressed 1 MVFLSGNASD SSNCTQPPAP VNISKAILLG VILGGLILFG VLGNILVILS VACHRHLHSV THYYIVNLAV ADLLLTSTVL 101 IWAAVDVLCC TASIMGLCII SIDRYIGVSY PLRYPTIVIQ RRGLMALLCV WALSLVISIG PLFGWRQPAP EDETICQINE 201 LVMYACRVYV VAKRESRGLK SGLKIDKSDS EQVILRIHRK NAPAGGSGMA SAKIKIHFSV RLLKFSREKK AAKTLGIVVG 301 DFKPSETVFK IVFWLGYLNS CINPIIYPCS SQEFKKAFQN VLRIQCLRRK QSSKHALGYI LHPPSQAVEG QHKDMVRIPV 401 FSSMPRGSAR ITVSKDQSSC TTARTKSRSV TRLECSGMIL AHCNLRLPGS RDSPASASQA AGIIGDVPPG RRHQAQLIFV lt l To make Mutations Substitutions Highlight the amino acid s and type in your changes Deletions Highlight the amino acid s and use Delete or Backspace key Note Deletions will not marked in the protein sequence Insertions Place your cursor upstream of the insertion point and type in your changes Refresh DNA Sequence Click the Clear all Mutations and Attachments to remove mutations and restore the original sequence The View Mutant Protein DNA button is enabled once any mutation is introduced into the input sequence pane Click this button to view the mutated protein or DNA sequence in the Molecule Editor The protein is given a name using the following convention VNTI_ lt Protein Name gt _mutated
170. ng ContigExpress e Clone2Seq TOPO Cloning e Parts Assembler 2 In the project window enter a project name and description then click New Open a project To open a project 1 Click the Projects bar 2 In the Projects Viewer expand the Local Database 3 Select the folder containing the type of project you want to open 4 In the Records Viewer double click a project to open the project application for example Alignment and view its properties Manage Projects To manage subsets in the Projects database subsets 1 Click the Projects bar 2 In the Projects Viewer expand the Local Database then expand a project 3 Select the subset you want to manage 4 Right click a subset then select a managerial operation For more information see Manage Database Projects and Results subsets on page 23 Vector NTI Express Software User Guide 33 1 Database Explorer Manage the Results database Delete Projects You can delete subsets of Alignment Contig Assembly or Cloning projects You cannot subsets delete the Alignment Contig Assembly and Cloning folders in the Local Database To permanently delete the subset of an Alignment Contig Assembly or Cloning project from the database 1 2 3 4 Click the Projects bar In the Projects Viewer expand the Local Database Select the folder containing the type of project you want to delete Right click then select Dismiss subsets Manage the Results d
171. nt identity cutoff for gene models Minimum Length of mRNA Covered mRNA length coverage cutoff in percent for gene models e Limit Number of Gene Models to Sets the maximum number of gene models Spidey analysis returns e E value 1 Pass The E value cutoff for the initial high stringency alignment The higher the value the less stringent and faster the run 2nd Pass The E value cutoff for the low stringency BLAST search within a genomic window based on the high stringency result 3rd Pass The E value cutoff for a very low stringency BLAST search to find hits for mRNA gaps Divergent Sequences If checked search parameters are adjusted to tolerate mismatches and gaps for inter species alignment Use Large Intron Sizes If checked much larger maximal intron sizes are allowed Checking this option increases computation time significantly e Defaults Sets Spidey parameters to original default values Submit the job When you have made your selections click on Submit When analysis is complete a Completed checkbox will appear next to the job name in the Analysis List 112 Vector NTI Express Software User Guide Spidey View analysis The Analysis Monitor contains a list of all the analyses performed by Vector NTI results Express including Spidey analyses Click on Analysis Monitor on the main toolbar to open it lt gt inja QexG ooeve np To view the analysis for a particular molec
172. o nen dan kes n A ANA AR EE A KES eau eA bo 102 Selecta Pe QIR oe cay d HA s se ya teen r aie ta eee seers eee nines a ates da O 102 Alignment pane gt t 5sal ye de de eb e ue ea kan dep h ka ul en te 102 Select lele J RMMDDMEMEDDMMNMNHNHnRnEnNnNnREEHnEnENHnENnEEEH HnEnEHHJHnEHmTa 102 Dol n AO IR e rt r de a to e Ad 102 Displaythe Dot Plot at e 103 CHAPTER 9 3D Molecule Viewer 4 kk kk kk kk kk kk kk kk kk kk kk k 105 Download 3D Structure Files a Sg e X g Ea w k b ka naka kk a w ab dka Bl ink Zu dika i a W el 105 Open a molecule in 3D Molecule Viewer JWA kk kk kk kk kk kk kK kk kK kK KK KK KK KK kK KK KK kK kk kk 105 Elements of the 3D Molecule Viewer WINdOW KK 02 kK kK KK KK KK KK KK KK KK KK KK kk kk kk k 106 Magnify and rotate the molecule M M WA kk kk kk kk KK kK kK KK KK kK KK KK KK kK kK kk kk kK kK kk kk 106 Highlight an amino acid or a chain kk kk kk kk kk kK kk kk KK KK KK KK KK KK KK KK KK KK KK KK KK KK KK R 107 Additional menu operations kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk 107 CHAPTER 10 Sim4 and Spidey Analysis ee ee co 109 SIA aa 0 c g ween tog Ae BAe Liars e tia aoe aes hn wa eet baleen Geert rare le 109 Launch Sim4 analysis tool 06000 cece e k kk kk kk kk ka 109 Analysis Tels Ile cs 244 Site nd pao nd pho n h KA soem E Ar ds ats tas 110 Submitthe lel JEN DD ER as en ae dos do de Seale Deel 110 VMiewanalysis results ft E od edad
173. o select the second molecule Note Click on Clear Fragment to remove a molecule from the pane Vector NTI Express Software User Guide 115 Clone2Seq Molecule requirements Display restriction sites in molecules Generate molecule fragments 116 Note The molecule in the left hand pane will always be the first fragment of the clone and the molecule in the right hand pane will always be the second fragment of the clone This is done to maintain the directionality of the resulting construct Note the following molecule requirements for Clone2Seq assembly Two linear molecules with blunt ends may be cloned as is Two linear molecules with overhangs must have matching overhangs This can be accomplished via restriction digestion as described in Generating molecule fragments below or by modifying the fragment ends as described in Modifying fragment ends e Circular molecules must be linearized on a cut site as described in Generating Molecule Fragments below Click on Left Molecule Properties or Right Molecule Properties below the Fragment List to display or hide selected restriction sites in the molecules The selected restriction sites will be displayed in the molecule panes Left Molecule Properties Enzymes name number Restriction String MES 1 IZ ael 1 Y Aari 1 Y Acil 10 F Acct 1 lt li gt Fragment List Right Molecule Properties Note The only restriction
174. o selection to analyze the entire sequence 2 Click on the Silent Mutations Analysis button to open the tool T AAA 3 Click on Add Enzyme from Database to select from a list of restriction enzymes in the database Use Ctrl click and Shift click commands to select multiple enzymes in the Enzyme in Database dialog 4 Click on OK to add the selections to the Available Enzymes list 5 Use the gt gt All gt gt lt lt and lt lt All buttons to move enzymes from the Available to the Use list Vector NTI Express Software User Guide 49 2 Molecule Editor Web analyses Web analyses 50 6 Click on Run to initiate the mutagenesis search Vector NTI Express analyzes the sequence or selected region and attempts to generate suitable silent mutations The reading frame for amino acids is defined by the start of the selected region so that the first three nucleotides of the selected region form the first codon The folder contains a list of mutation options that result in the appearing and or disappearing of at least one restriction site The options are sorted by the position of the first altered nucleotide If you selected the complementary strand option mutation coordinates on both complementary and direct strands are listed Note The program is able to find both single just one nucleotide altered and multiple several neighbor nucleotides altered mutations for any elementary event appearing and or disappearin
175. ocal database subsets page 25 e Delete the contents of a local database subset page 25 View asummary of a local database subset page 25 Vector NTI Express Software User Guide 23 1 Database Explorer Manage data 24 To manage Local Database subsets 1 In the Explorer Viewer click Local Database then expand a database 2 Right click a subset then select a managerial operation Add a subset To add a subset to a Local Database 1 In the Explorer Viewer click Local Database 2 Right click a database then select Add subset to open the Create Subset window 3 Enter a subset name and description then click OK Search a local database or subset To search a local database or subset in a local database 1 In the Explorer Viewer click Local Database 2 Right click a database then select Search to open the Search window 3 Enter text To search for the exact text check Exact match only Click OK to begin the search Edit the properties of a local database subset To edit the properties of a Local Database subset 1 In the Explorer Viewer click Local Database then expand a database 2 Right click a database then select Edit properties to open the Edit Subset window 3 Enter anew name for and or description of the subset then click OK Rename a local database subset To rename a Local Database subset 1 In the Explorer Viewer click Local Database then select a database 2 In the Records Viewer right
176. of AD Patmatmotifs ADCY7 Gi Remote Database Gu Database HE Projects General Description Motif Finder Motif Finder uses a local version of the InterProScan sequence search engine to scan a protein sequence for protein domains and functional sites This search tool integrates analysis engines from multiple protein signature databases Using this tool you can analyze a sequence using all InterPro analysis engines or a subset InterProScan sequence search For more information about InterProScan and the databases analytical tools it includes visit www ebi ac uk Tools pfa iprscan A local version of the InterProScan search engine is provided as part of the Vector NTI Express installation 1 To begin the analysis with a protein molecule open click on the Motif Finder button in the Analysis toolbar of the Molecule Editor window 2 In the Analysis Jobs window the name of the job will appear listed in the left hand pane and the status will be New submit SERA MN Name 2 AnalysisType Description Status Modified Date GLinterProscananalysis oFADRAJA Int EMBL EBI Protein Funct InterProScan JN PatmatmotifsAnalysis of ADCY7 Patmatmotifs Scan a protein sequen Completed JN PatmatmotifsAnalysis of ADRA1A Patmatmotifs Scan a protein sequen Completed Mon Dec 05 08 38 15 PST 2 Name ADRA1A AR PscanAnalysis o
177. of a search will limit the search to all proteases except those in HIV 1 biomol_mrna PROP AND brain this form of a search can be used to limit searches to a particular molecule type Mus musculus Organism this form of a search will limit the search to a specific organism Enter the name of the organism in the Entrez Query field with the Organism qualifier General Parameters The parameters here are almost identical to parameters for the various BLAST searches at the NCBI website For more information regarding these parameters visit http www ncbi nlm nih gov blast html blastcgihelp html Max target sequences The maximum number of aligned sequences to display Expect threshold The statistical significance threshold for reporting matches against database sequences The default value of 10 means that in a database of the current size 10 matches would be expected merely by chance stochastic model of Karlin and Altschul 1990 Hits showing a statistical significance greater than the Expect threshold are not reported Increasing the E value above 10 produces a larger list with more low scoring hits chance matches Lower expectation value thresholds are more stringent leading to fewer chance matches being reported Vector NTIO Express Software User Guide 83 6 BLAST and Entrez Searches BLAST search Perform the BLAST search 84 If your query peptide or nucleotide sequence is short you might want to incr
178. oject El General Info ADRAIA TOPO_Project SE The PCR Product of ADRAIA_500_2306_T A E FindPCRPrimers S Product of Length 1809 E Sense Primer Start 1 GC 38 89 Length 18 Tm 45 17 C dG 29 41 kcal mol GH 141 0 kcal mol dS 368 3 cal mol E Antisense Primer Start 1792 GC 50 0 Length 18 Tm 48 34 C dG 31 12 kcal mol dH 145 3 kcal mol dS 377 0 cal mol Sequence TAACATTTCCAAGGCCAT Sequence TAACCAATGGCTATGGGC gt v Vector NTI Express Software User Guide TOPO Cloning workflow Create TOPO In the Create TOPO Clones task pane you can modify the list of fragments and Clones select a vector or vectors with which to create TOPO clones Inserts Name Accession Type Division Length Form Description The PCR Product of AD The PCR Product of A TA PRI 1809 Linear Homo sapiens adrenergic alpha 1A r The PCR Product of BR The PCR Product of B TA PRI 2512 Linear Homo sapiens v raf murine sarcoma vi Vectors Name Accession Type Division Length Form Description Inserts The fragments you amplified are listed in the Inserts list at the top of the pane e To add a previously amplified fragment or a fragment designed with the necessary overhangs by another means click on the Add button and select the molecule from the database e To remove a molecule from list select it and click on Remove To clear the entire list click on Clear Al
179. open in the Molecule Editor select the region to be sequenced then select Primer Design gt PCR Using Existing Oligos from the Molecule Editor toolbar lt z B bnga 6 ls Primer Design PCR Using Existing Oligos 2 R H PCR Using Existing Oligos A Region of Analysis F From 1022 bp To 1039 bp gt d D Product Length E G Min 18 bp Max 18 bp fea Sense and Antisense Primersin Database pai sense Primers Antisense Primers ga Selected 0 Selected 0 1 Analysis Conditions Ie gt Attach to S Terminus T AAA Advanced lest ave Default These settings are similar to the Find PCR Primers settings with a few exceptions The following are the unique settings for PCR Using Existing Oligos These are also available under the Primers tab if you click on the Advanced button PCR Using Existing ae Oligos setting Description Sense Primers Click the Sense Primers button and select the desired primerls from the Oligo Database Antisense Primers Click the Antisense Primers button and select the desired primer s from the Oligo Database Note Since you can choose the number of 3 and 5 primers these settings effectively enable you to analyze one 3 primer against an array of 5 primers or vice versa Analysis Conditions settings For information about the Analysis Conditions settings see page 60 Attach to 5 Terminus settings For informat
180. options Description KTUP Word size Change the K tuple value to limit the word length the search should use A word length of 2 is sensitive enough for most protein database searches The general rule is that the larger the word length the less sensitive but faster the search will be Window Length The number of diagonals around each of the best diagonals used Score Type Percent or absolute TOPDIAG Number of the k tuple matches on each diagonal used in the alignment PAIRGAP Penalty for the existence of a gap Multiple sequence These parameters control the final multiple alignment options Option Description DNA Protein Weight Matrix All algorithms designed to evaluate pairwise sequence alignment are based on systems which rank aligned residues Nucleotides or amino acids that are identical or similar in alignment score higher than those less similar Matrices generated with these assigned scores are used to detect similarities between differing sequences The most common of many different scoring systems are based on substitutions of amino acids in related proteins Gap Open The penalty for the first residue in a gap Gap Extension The penalty for additional residues in a gap Gap Distance Tries to decrease the distances between gaps No End Gaps Does not penalize for gaps introduced at the end of a sequence Iteration None default tree or alignment N
181. or descending order 1 In the Explorer Viewer click Local Database then expand a database 2 Inthe Records Viewer click a column header Add an object to a subset To add an object to a subset 1 In the Explorer Viewer click Local Database then expand a database 2 In the Records Viewer right click an object then select Add to subset to open the Subset Management window 3 Select the subset you want to add the object to then click OK Rename an object To rename an object 1 In the Explorer Viewer click Local Database then expand a database 2 In the Records Viewer right click an object then select Rename to open the Rename window 3 Enter anew name then click OK Exclude an object from a subset Note Excluding an object from a subset does not permanently delete it from the database To exclude an object from a subset 1 In the Explorer Viewer click Local Database then expand a database 2 In the Records Viewer right click an object select Exclude from subset to open the Vector NTI Express window then click OK 26 Vector NTI Express Software User Guide Manage data Delete an object To permanently delete an object 1 In the Explorer Viewer click Local Database then expand a database 2 In the Records Viewer right click an object select Delete from Database then click OK Duplicate an object To duplicate an object 1 In the Explorer Viewer click Local Database then expand a database
182. or manipulating the graphic representation of the structure exporting molecule data in various formats and optimizing the display Magnify and rotate the molecule In the Molecule Display pane To zoom in or out rotate the wheel on your mouse or select Zoom from the right click menu To rotate the molecule in three dimensional space drag your cursor in the pane To reposition the molecule within the pane without rotation hold the Ctrl Alt keys and drag your cursor in the pane To begin spinning the molecule in three dimensional space select Spin gt On from the right click menu and adjust the settings on the Spin menu Select Spin gt Off to stop spinning 106 Vector NTI Express Software User Guide Highlight an amino acid or a chain El Highlight an amino acid or a chain Click within the structure in the Molecule Display window to highlight a particular amino acid Click on it again to un highlight it Click on an amino acid in the Outline pane to highlight it in the Molecule Display pane Click on a chain in the Outline pane to highlight that entire amino acid chain in the structure Additional menu operations The right click menu in the Molecule Display window contains all the JMol commands for viewing and manipulating the structure For additional information about these commands visit www jmol org Vector NTI Express Software User Guide 107 3D Molecule Viewer Additional menu operations
183. order in which they re listed in the GeneArt tool starting with the vector The order of the fragments is reflected in the Order column which designates the vector with a V and numbers the rest of the fragments in order To re order the numbered fragments select a fragment in the list and then click on the Up or Down button to change its position Note that you cannot move a fragment into the Vector position using the buttons select the vector as described above Fragments Vector Source DNA Order StartPosition Fragment Length Orientation Amplify Y ADRA1A v 1 2306 Forward N N BRAF 1 1 2510 Forward N N CDK2 2 1 2226 Forward N Figure 2 Clicking on the Up button to move a selected fragment up in the list Fragment orientation The orientation of each fragment in the final assembly is indicated in the Orientation column Forward or Reverse You can change the orientation by clicking in this column Remove a fragment To remove a fragment click on it in the list to select it and then click on Remove Fragment Vector NTI Express Software can automatically design PCR primers for adding homology to the ends of a fragment for GeneArt assembly In the PCR reaction each primer will add bases to the amplified fragment to create the necessary homology with the adjacent fragment Note If the fragments already have the required end homology primer design is unnecessary Vector NTI Express Software User Guide 145
184. orkgroup Shared Database Admin h2_setup double click startSharedServer and open the cmd exe window Vector NTI Express Software User Guide 35 1 Database Explorer Workgroup Shared Database ex C WINDOWS system32 cmd exe C Program Files Life Technologies Wector NTI Shared Database Admin h2_setup gt ren set JAUA_HOME C Java jdk1 6 6_25 C Program Files Life Technologies Wector NTI Shared Database Admin h2_setup pet PATH C Program F Applied Biosystems QuantStudio1l2KFlex bin d1ls C WIND WS Ns ys tem32 5C WINDOL WINDOWS S ys tem32 Whem bin C Program Files Life Technologies Wector NTI Shared Database Admin h2_setup gt set CLASSPATH Nh2 1 3 159 jar C Program Files Life Technologies Wector NTI Shared Database Admin h2_setup gt jay la org h2 tools Server tcp tcpAllowOthers tcpPort 86882 baseDir C UntiExpres Es_SharedDatabase TCP server running at tcp 7 7 167 116 197 164 8002 Cot hers can connect gt Note The cmd exe window automatically opens after the installation of Shared Database Admin Connect to the workgroup share database server 1 Open Vector NTI Express Software then e Inthe main menu click Tools Connect to workgroup shared database or Open the Database Explorer In the Explorer Viewer click Workgroup Shared Database 2 In the Connect to Workgroup Shared Database window log on Host Name localhost User Name Your user name e Password Your user password
185. ownload from www lifetechnologies com manuals and are supplied with each kit GeneArt Seamless Cloning Technology is a highly efficient vector independent system for the simultaneous and seamless assembly of up to four DNA fragments plus a vector totaling up to 13 kb in length including the vector The system allows the cloning of the DNA fragments into virtually any linearized E coli vector does not require pre existing recombination sites or any extra DNA sequences and eliminates the need for extensive enzymatic treatments of the DNA such as restriction and ligation A single proprietary enzyme mixture recognizes and precisely assembles the DNA fragments sharing a 15 base pair bp end homology that you can create by PCR amplification The GeneArt High Order Genetic Assembly System is a highly efficient vector independent system for the simultaneous assembly of up to 10 DNA fragments plus a vector totaling up to 110 kb in length including the vector The system relies on yeast s ability to take up and recombine DNA fragments with high efficiency This process termed transformation associated recombination greatly reduces in vitro handling of DNA and eliminates the need for enzymatic treatments of DNA such as restriction and ligation while allowing precise fusions of DNA sequences Vector NTI Express Software User Guide 141 7 GeneArt Cloning How GeneArt Assembly Works How GeneArto Assembly Works In GeneArt Assembly m
186. p lifetechnologies vectornti To obtain personalized technical support by telephone or email you must have a paid annual software maintenance and support contract To purchase a contract email bioinfosales dlifetech com or contact your local Life Technologies office If you have a paid annual support contract Email your question to bioinfosalesfalifetech com Or phone 800 955 6288 North America 44 0 141 814 6318 Europe Middle East Africa For additional technical support visit www lifetechnologies com support Contents ADOULTMIS OUIGGE gt c Ker nak bh oc l Aran ka y E ay WE kane a W aye y any 11 Note on screen captures M M k kk kk kk kk kk kk kk KK kK kk KK kK kk kk kk kk kk kk kk kk kk kk kk kk kek 11 CHAPTER 1 Database Explorer 44 Ku kk kk kk kK kk kK RR KK KK KK KK kk 13 ze e A ulna adele 13 Aboubthis chapter 7 st Anse A e ea le e al BA Akan ula HR BAS euch aa 13 APChIVES zn zmnmymmmyaon rm nm 14 Open the Database Explorer WW kk kk kk kk kk kk kk kk KK kk kk kK kK kk kk kk kk kk kk kk kk kk kk kk kk k 14 Components of the Database Explorer 00000 KK KK KK KK KK KK KK KK KK KK kK n 15 Ee te Melle S N MD HRH HHHH Ur EH HH HH HHH ec 15 SUSE n sen walk gan se ase iw eles bkn Kalak ka A AAA 16 Open files De i vee A HH Sew HHHH HHHH m 16 Database Explorer operations kk kk kk kk kk kk cece k kk kk kk kK kk kk kk kk kk kk kk kk kK kk kk kk 17 Create DNA
187. p lala invitrogen by L fe technologies Vector NTI Express Software Publication Part Number MAN0006009 Revision Date 15 January 2012 technologies For Research Use Only Not for use in diagnostic procedures For research use only Not intended for any animal or human therapeutic or diagnostic use Copyright 2012 Life Technologies Corporation All rights reserved No part of this publication may be reproduced transmitted transcribed stored in retrieval systems or translated into any language or computer language in any form or by any means electronic mechanical magnetic optical chemical manual or otherwise without prior written permission from Life Technologies Corporation hereinafter Life Technologies The information in this guide is subject to change without notice Life Technologies and or its affiliates reserve the right to change products and services at any time to incorporate the latest technological developments Although this guide has been prepared with every precaution to ensure accuracy Life Technologies and or its affiliates assume no liability for any errors or omissions nor for any damages resulting from the application or use of this information Life Technologies welcomes customer input on corrections and suggestions for improvement Trademarks BioBrick is a trademark of the BioBricks Foundation Inc The BioBrick trademark is used herein merely for the purpose of fair use The BioBricks Fou
188. probe design options in Vector NTI Express Design Tool Purpose Find PCR Primers Inside Specify limits for PCR primer search such as length of target Selection sequence output options attach restriction sites etc Amplify Selection Similar to Find PCR Primers except that primer hybridization domains upstream and downstream from the target sequence can be specified Primers will be generated anywhere within the designated upstream and downstream domains Sequencing primers Set parameters for sequencing and primer regions and primer analyze primers Hybridization Probes Set parameters for target region output options analyze probes PCR Using Existing Oligos Similar to Find PCR Primers but for the selected amplification region allows you to search for suitable PCR primers from among those selected from the Vector NTIO Express oligo list Open the primer probe design tools The design tools are located on the Molecule Editor toolbar 1 With a molecule loaded in the Molecule Editor you can design oligos for the entire molecule sequence or a selected region To design primers probes for the entire molecule make no sequence selection before you open the design tool To design primers probes for a specific region of the sequence select the region e g by dragging or clicking on a feature in the Graphics or Sequence pane and then open the tool Vector NTI Express Software User Guide 57 Primer Design Sav
189. quality and similarity is an essential step in the overlap computation and assembly process and ensures validity and correctness You can control and fine tune the clipping process through adjusting the parameters on the Clipping tab Vector NTIO Express Software User Guide 161 162 Contig Assembly using ContigExpress Assembly settings Note The clipping is irreversible and iterative within each project When multiple assemblies are made within a project each round of clipping applies to the sequences that had been clipped in the last round of assembly This implies that a later attempt to assemble may affect the existing assemblies In such cases ContigExpress generates a warning message If you choose to proceed click on the Yes button The affected contigs will be dissolved If you choose not to proceed click on the No button and the current assembly will be stopped Use Automatic Clipping Ends of sequencing reads are usually unreliable and low in QV values CAP3 comes with a mechanism to detect and clip these poor end regions based on sequence similarities with or without QVs Clipping is done before the computation of overlaps Note trimming is available in ContigExpress in addition to CAP3 clipping and can be carried out before loading input sequences into assembly projects Default ON Match Score Factor Also used in calculating Similarity Score for computing overlaps but only editable in the Clipping Tab Match Score Facto
190. r is a positive integer to award each match between two bases from the pair of sequences being compared during the banded Smith Waterman alignment Default 2 Mismatch Score Factor Also used in calculating Similarity Score for computing overlaps but only editable in the Clipping Tab Mismatch Score Factor is a negative integer to penalize each mismatch between two bases from the pair of sequences being compared during the banded Smith Waterman alignment Default 5 Gap Penalty Factor Also used in the computation of overlaps but only editable in the Clipping Tab Gap Penalty Factor is a positive integer to penalize each gap extended during the banded Smith Waterman alignment Default 6 Quality Cutoff for Clipping Quality Cutoff for Clipping applies to the clipping of a poor end region for each read when QVs are provided It is not used when QVs are not available The specified value is used to find the low quality ends of reads where the quality value of a base is considered low if it is less than this value Default 12 Clipping Range Clipping Range applies to the clipping of a poor end region for each read regardless of whether QVs are available The value is used to extend the ranges for clipping further away from the ends based on the low quality positions at each end as determined with the Quality Cutoff for Clipping value The larger the value of Clipping Range the more extensive the clipping for poor end regions Default 250
191. r show chromatograms Chromatograms are displayed for each fragment in the contig The colored peaks in the chromatogram correspond the colored bases below the editable sequence in the Alignment Pane To hide the chromatogram for a fragment in the Alignment Pane right click on the fragment sequence and select Hide lt fragment name gt To re display the chromatogram right click and select Show lt fragment name gt To hide or show all chromatograms right click in the Alignment Pane and select Hide all chromatograms or Show all chromatograms Translate the consensus sequence 168 To translate the consensus sequence right click on the sequence and select Translation or click on the Translation button on the toolbar to the right of the Graph Pane The translated sequence appears below the consensus sequence in the Alignment Pane Note Ambiguous positions in the consensus are translated as a single defined amino acid if codon degeneracy permits i e GGN Gly Gaps in the consensus are ignored in the translations Vector NTI Express Software User Guide Edit the contig sequence Edit the contig sequence Insertions Deletions Saving sequence changes You can edit the contig sequence in the Alignment Pane by clicking within the black text sequence of a particular fragment above the colored text or clicking in the consensus sequence and typing IUB characters or pressing the Delete or Backspace keys All editing
192. re User Guide 39 Molecule Editor Molecule Editor window Molecule Editor window The Molecule Editor window consists of five main panes as well as various tools and analysis functions Properties E General Description DNA pDESTR4B WTtrogen Vector Copy of pDESTR4 R3 Length 4555 bp Form Circular E Standard Fields Accession Number pDESTR4 R3WWecto Modified Date 17 Mar 2008 References E Author Invitrogen Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 U S A TEL 800 955 6288 EMAIL bioinfosalesQinvitrogen com E Original Author Invitrogen Display tools Properties pane Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 U S A TEL 800 955 6288 EMAIL bioinfosalesGinvitrogen com E Comments This file is created by Vector NTI http www invitrozen com E vrossw BLOCK4T Polll ni nt 3 ES pCR lunt j TOPO rst amp amp he la M13 reverse primer Ali ewa Graphi raphics pane n attR4 E e I NU Analysis tool Ka nalys s tools ngs DESTR4 R3 Vector E 4555bp e Ez Feature Map bla promoter GATTTTGCAT CETCGTATCC GITACGGCAT 1 CAGGAAACAG GICCTITGIC CTATGACCAT GATACTGGTA GATTACGCCA CTAATGCGGT AGCTATCAAC TCGATAGITG TITGTATAGA ARACATATCT ARAGTTGAAC TTTCAACTTG GAGAA A crcr AAAAAACAGA
193. re parsed and stored in an internal format You can add molecules to the database by importing or creating basic molecules Projects including Alignment Contig Assembly and Cloning projects Restriction enzymes RENs imported from the REBASE database Data for restriction enzymes are parsed and stored in an internal format You can add other RENs from the REBASE file included in the Vector NTI Express Software Oligonucleotides these can be created by the user or generated by primer design tools in Vector NTI Express Several example oligos are included in the software for demonstration purposes Gel markers these can be created by the user Commonly used gel markers are included with the Vector NTI Express installation BLAST results these are generated by BLAST searches run Vector NTI Express and can be stored as results files in the database Analysis results such as PCR analysis or PFAM analysis of molecules can be stored as results files in the database About this chapter This chapter covers Archives on page 14 Open the Database Explorer on page 14 Open files on page 16 Database Explorer operations on page 17 Vector NTI Express Software User Guide 13 1 Database Explorer Archives Archives Create DNA RNA and protein molecules on page 17 Create gel markers oligos and enzymes on page 19 Tmport data on page 21 Manage data on page 23 Edit d
194. ree To save all the contig assemblies as separate DNA RNA molecules in the database click on Save Contig below the Contig Fragments List e To save the contig assemblies as part of the project click on Save Project at the top of the Contig Project pane To delete a particular contig assembly select the checkbox for the contig in the Contig Fragment List and click on Delete You can select fragments in contigs and re assemble them Select the checkboxes next to the desired fragments in the Contig Fragment List and click on Assemble The existing assemblies will be deleted and replaced with the new ones Vector NTI Express Software User Guide 165 Contig Assembly using ContigExpress View the assembly Rename a contig To rename a contig right click on the contig name in the list and select Edit Enter a new name in the dialog box View the assembly Click on contig name in the Contig Fragment List to display the assembly in the Contig Viewer Contig Viewer Graph Pane Y Contig Project ONE 16F 1733 lt lt 2422 amp General Info DemoProject ONE1IR 1601 gt gt 2299 ONE15F 1140 lt lt 1706 ONE13R 541 gt gt 1271 New Project Edit Project save Project Load Project Export Project Close Project D gt view Fragments D gt Trim enas gt Trim vector contaminations p gt assemble contig ONE17R 1 gt gt 737
195. res Select a sequence Cut or copy a sequence Paste a sequence Replace a sequence Delete a sequence Reverse a sequence To select part or all of a sequence Drag your cursor over the desired portion sequence in the Sequence pane or Graphics pane Click on a feature in the Graphics pane or Feature Map that encompasses that sequence Click Ctrl a or right click and select Select all to select the entire sequence To cut a sequence select it in the Sequence or Graphics pane and click Ctrl x or right click and select Cut or select the command from the Edit menu You will be prompted to remove the sequence To copy a sequence select it and click Ctrl c or right click in the Sequence or Graphics pane and select Copy or select the command from the Edit menu 1 To paste a sequence from the clipboard click on a particular insertion point in the Sequence or Graphics pane and click Ctrl v or select Edit gt Paste 2 The Edit Sequence dialog will open displaying your pasted sequence Click on OK to complete the action To replace part or all of a sequence select it in the Sequence Pane and type or paste as described above To delete all or part of a sequence select it in the Sequence or Graphics pane and click the Delete key or right click and select Delete You can reverse all or part of a sequence 1 Select all or part of the sequence in the Sequence or Graphics pane 2 Right click and select Reverse
196. ruct using the workflow described above and for creating and managing Gateway Cloning projects There are several ways to open the tool Click on the Gateway Cloning button on the main toolbar gt e Select File gt New gt Gateway Cloning Project from the main menu e With a molecule open in Molecule Editor right click in the Graphics or Sequence pane and select Launch Gateway e Load an existing Gateway Cloning project as described in Create save and load projects on page 124 The tool window is composed of the following panes This pane displays the name of the current project and includes controls for editing saving and closing projects It also lists any generated molecules for the current project Vector NTI Express Software User Guide Gateway Cloning Tool Click on the Gateway Project button to display this pane Gateway Project E General Info New Gateway Cloning Project GI PCR Analysis The PCR Product of GNGS_attB3_attB4 z 5 H Task This pane displays the list of tasks in the selected project Click on the Task button to Task List pane display this list E task gt Amplify Fragments to use in BP Reaction gt Recombine Entry Clones by BP e Preview Entry Clones Add Entry Clones to use in LR Reaction e Create Expression Clones by LR Preview Expression Clones Eg Gateway Project As you navigate through the Gatew
197. ry window Manage database objects in the Records Viewer You can Group database objects page 25 Sort database objects page 26 Add an object to a subset page 26 e Rename an object page 26 e Exclude an object from a subset page 26 Delete an object page 27 Duplicate an object page 27 View object properties page 27 e Export data page 27 Show or hide columns page 28 To manage database objects 1 In the Explorer Viewer click Local Database then expand a database 2 In the Records Viewer right click a database object then select a managerial operation Group database objects You can group database objects in subsets Vector NTI Express Software User Guide 25 1 Database Explorer Manage data To group database objects 1 In the Explorer Viewer click Local Database then expand a database 2 In the Records Viewer select several objects Note To select specific objects press the Ctrl key and click objects To select a block of objects click the first object in the block press the Shift key then click the last object 3 Add the objects to a subset s Right click the selected objects then select Add to subset to open the Subset Management window Select a subset then click OK or Drag the selected objects into the subset in the Explorer Viewer Note The objects you grouped were not moved out of the parent subset Sort database objects To sort database objects in ascending
198. s 2 3 or 4 possible nucleotides For example Ns have a score of 0 25 Rs of 0 5 Bs of 0 33 etc Therefore for the 20mer described above the Average Similarity is 85 Baldino Jr F Chesselet M F and Lewis M E 1989 High resolution in situ hybridization histochemistry Methods Enzymol 168 761 777 Breslauer K J Frank R Blocker H and Marky L A 1986 Predicting DNA duplex stability from the base sequence Proc Natl Acad Sci USA 83 3746 3750 Rychlik W Spencer W J and Rhoads R E 1990 Optimization of the annealing temperature for DNA amplification in vitro Nucleic Acids Res 18 6409 6412 Sugimoto N Nakano S Yoneyama M and Honda K 1996 Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes Nucleic Acids Res 24 4501 4505 Freier S M Kierzek R Jaeger J A Sugimoto N Caruthers M H Nielson T and Turner D H 1986 Improved free energy parameters for predictions of RNA duplex stability Proc Natl Acad Sci USA 83 9373 9377 Vector NTI Express Software User Guide Numerics 3D Molecule Viewer 105 A Align multiple sequences See AlignX AlignX Algorithms 99 Alignment pane 102 Alignment settings 99 Clustal W options 99 Complexity graph 101 Dot Plot 102 Graphs pane 101 Managing projects 96 Multiple sequence alignment options 100 Opening 95 Pairwise alignment options 99 Selecting fragments to align 97 Similarity graph 10
199. s an arbitrary setting that may be based upon the fact that your primers have tails Post trim settings e Maximum remaining length bases sets the maximum length of the fragment that must be left after trimming e Remove leading and trailing ambiguities removes poorly resolved nucleotides that may be left after trimming s Remove poly A T more than consecutive removes these nucleotides that may be present if the sequence was flipped producing a poly T 5 end Vector NTI Express Software User Guide 157 Contig Assembly using ContigExpress Fragment trimming Preview the trimmed ends 1 With the fragments to be trimmed selected in the Contig Fragment Tree click on Calculate to preview the trimming results 2 Click on a fragment name in the Contig Fragment Tree to display the fragment in the Fragment pane with the trimmed regions highlighted Trim locations are displayed as red nucleotides in the Fragment pane O Assembly 23 gt Nd N L J lle NL eee J eee ele NACNN NNNNN NNNNN NNNNN NNNNN NNNNN NNNNN NNNNA GNNNN NNNNN 51 JJ TCACA TTCTN CGCNG ATGGT TGAGA TGTGT ATAAG AGACA GTTAG NNNN 101 GIGAC ACTAT AGAAT ACAAG CITGC TIGIT CITIT TGCAG AAGCT CAGAA 151 TAAAC GCTCA ACTIT GGCAG ATCCG CGGCC GCAGA TCTGA ATICC GGAGA 201 TITGT CCNNG CAGAT GCTGC TGGCC TICTG GGAAT CCTGG ACTGT GATTA 251 CTGCG CIGGA GAGCT GITAT CIGTA ACTGG AAGAC TCTCC ATTAA CCTGC Trim vector If you are sequencing inserts in cloning vectors vec
200. s to 20 25 recommended for TOPO Primers DNA RNA button Select the type of nucleotide sequence Add generated primers to oligo list Select this checkbox to add the primers you generate to the oligo list Cloning termini In the options under Cloning termini Choose Blunt to generate an amplicon with 2 blunt ends These will be the exact boundaries of the selection These amplicons are best used with Zero Blunt TOPO vectors Vector NTI Express Software User Guide 137 138 TOPO Cloning TOPO Cloning workflow Advanced Choose T A to generate an amplicon as would be produced by amplification with a Taq polymerase The primers in such a case will anneal to the exact boundaries of the selection However terminal transferase activity in the enzyme will add 3 A overhangs to each end of the amplicon Choose directional for cloning in TOPO directional vectors e g pENTR D TOPO The amplicon will be generated using primers one of which includes a 5 CACC extension For additional amplification settings click on Advanced The advanced amplification settings are identical for all PCR primers and are described in Chapter 3 Primer Design Amplify When you have made your selections click on the Amplify button The next task pane will be displayed and the generated PCR product s will appear listed in the Inserts subpane and also listed in the TOPO Project pane E Topo Pr
201. s to open the tool Vector NTI Express Software User Guide 133 13 TOPO Cloning TOPO Cloning Tool TOPO Project pane 134 Click on the TOPO Cloning button on the main toolbar e Select File gt New gt TOPO Cloning Project from the main menu With a molecule open in Molecule Editor right click in the Graphics or Sequence pane and select Launch TOPO Cloning s Load an existing TOPO Cloning project as described in Create save and load projects on page 136 The tool window is composed of the following panes The TOPO Project pane displays the name of the current project and includes controls for editing saving and closing projects It also lists any generated molecules for the current project Click on the TOPO Project button to display this pane E ToPo Project E General Info TOPOCloningADRA1A El The PCR Product of ADRA1A_587_1414 TA FindPCRPrimers E Product of Length 830 W Sense Primer Antisense Primer 9 Primer Pair Data Time 10 12 2011 20 42 18 Vector NTI Express Software User Guide Task List pane button to display this list TOPO Cloning Tool The Task List pane displays the list of tasks in the selected project Click on the Task E Task gt Amplify Fragments to use in TOPO Reaction ma Create TOPO Clones Preview Clones al a AA A Ly Topo Project As you navigate through the TOPO Clonin
202. se WWW kk kk kk kk kk kK kK KK KK KK KK KK KK KK kk 35 Add users to a workgroup shared database kk kk kk kk kk kK KK KK KK KK KK KK ees 36 A user name should be one word without spaces Edit users in a workgroup shared database 37 Delete users from a workgroup shared database kk kk kk kk kk kK kK KK KK KK KK KK 37 Upload data to a workgroup shared database WWW kk kk kk kk kk kK KK KK KK KK KK KK KK KK 37 Download data from a workgroup shared database 0000 KK KK KK KK KK 37 Disconnect from a workgroup shared database 0000 kk KK KK KK ee KK KK KK KK 37 Set preterences xre cc mies cient Ao ee Cee dd EE eth Ra E te il A a R 37 Set display preferences for molecules 0 0c ccc eect eee KK KK kk 37 Set display preferences for sequences cece cece KK kk kK KK KK KK kK KK kk kk k 38 Register with the NCBI asig Sana a ak kim tend ARR R wand A BANA Go doe eames eg 38 CHAPTER 2 Molecule Editor JWA kk kk kk kk kk kK KK KK KK KK kk kk kk kk kk 39 Create or open a molecule WW kk kk kk kK kk kk kk kK KK kk kk kK kk kk kk kk kk kk kk kk kk kk kk kk kk k 39 Create a new Molecule ks Z E LT e Ek dU Ra Deane As 39 Open an existing molecule oc hein ga eed kk kk kk kk kk kk kk kk kk kk kk kk 39 Molecule Editor WindOW saraet diker a la old d v DEL a VRE ARANE ekl 40 Molecule display tools nn kk kk kk kk kK KK kK kk kk kK kk kk kk kk kk kk kk kk kk kk kk kk kk 41 Enteroredita Sequence 22 4 ein bah hana n
203. segments This system is based on the well characterized bacteriophage lambda based site specific recombination system attL x attR lt gt attB x attP Gateway Cloning is a 2 step process In the first step a sequence of interest containing attB sites is recombined with a donor vector containing attP sites into an entry clone creating attL sites in the process The second step recombines the attL containing entry clone with a destination vector containing attR sites generating an expression clone that can be propagated and expressed in a range of host cells for a given experiment For detailed information on Gateway Cloning see the Gateway Technology User Guide or the Gateway Technology with Clonase II User Guide available for download from www lifetechnologies com manuals Workflow diagram BP Reaction attB attB attP attP attL attL attR att R Tm jm wa attB flanked donor gt entry By product PCR product or vector clone expression clone LR Reaction attL attL att R att R attB attB attP attP r destination gt vector expression clone By product Step 1 Create an entry clone The standard method for creating an entry clone in the Vector NTI Express Gateway Cloning Tool involves amplifying a sequence or molecule of interest with attB containing primers designed by the software then performing BP recombination with a donor pDONR vector to generate an entry clone PCR product
204. settingS kk kk kk kk kk kK kK KK kk kK kK kK kK kk kk kk kk kk kk kk kk kk kk kk kk kk ka 61 PCR Using Existing Oligos settings MAK kk kk kk kK kK KK KK KK KK kK kk kk kk kk kk kk kk kk kk 63 Sequencing Primers settingS s an kk kk kk kk kK kk kK kk kk kK kk kk kk kK kk kk kk kk kk kk kk kk kk kk ka 64 Hybridization Probes lt Ji ceres nele aba Ha ale aki e re la akele bee deiediery bee eeGe rier ewer res 65 Shared Advanced settingS WW kk kk kk kK kk kk kk KK kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk ka 6 CHAPTER 4 BioAnnotator 0 00 c kk kk kk kk kk kk kk kk kk kk kk 71 Deledtlltg anana y SIS catar ds dedat XIR AA Gide ee 71 Graph and Sequence panes WW kk kk kk kk kk kk kK kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk 72 Highlight sequence region in the graph cece eee eee eee eee kk kk 72 NISHI GRS T ta ae Sk ald 72 Determine the value at a point in the graph 0 kk kK kK kK KK KK KK KK KK KK KK KK KK K 72 Analysis parameters M M kk kk kk kk kk kk kK kK KK KK kK kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk kk lk kk 72 WINdOWISIZE al nae a Awka pee ag Ka 2h ee kel galak SAWA Suka gaia tee RR etre 73 Vector NTI Express Software User Guide 5 Contents Analyses descriptions and parameters kk kk kk kk cee KK KK KK KK KK KK KK KK KK kk kk 73 CHAPTER 5 R g R PALOF 5 ss ase ces Wis 9 Tar b n xwee da 0 e diri ees 75 Regenerator Workflow cocina k
205. similarity between the sequences would occur by chance when searching a database of a particular size A zero or extremely low number suggests that the match is so perfect that it is extremely unlikely that the similarity would occur randomly Name The NCBI sequence identifier of the query hit e Accession The GenBank Accession number of the hit Bit Score A measure of how close the identity of the match is to the query sequence Identity The ratio and percentage of matching residues in the hit elements The numbers n n refer to the number of identical residues out of the number of matches in the hit element This is important to consider when determining the significance of this statistic A high identity percentage may mean nothing if a low number of nucleotides is being compared Vector NTI Express Software User Guide 85 6 BLAST and Entrez Searches Entrez Search Entrez Search Open Entrez search tool 86 e Positives the ratio and percentage of similar residues in the hit elements e Query From To Orientation The start and end position numbers in the query sequence matching that of the hit element and the strand that corresponds to the hit element Hit From To Orientation The start and end position numbers in the hit sequence matching that of the query element and the strand that corresponds to the query element Download sequence features and save them as molecules In the Table pane click on the link
206. sites listed will be those identified by Restriction Analysis in the Molecule Editor If the desired restriction sites are not listed open the molecules in the Molecule Editor perform Restriction Analysis with the desired restriction enzymes and then re load the molecules in Clone2Seq See Chapter 2 Molecule Editor on page 39 for more information on Restriction Analysis To generate a molecule fragment from a linear or circular molecule in Clone2Seq 1 Click on a restriction site in the desired molecule to generate a single cut site or shift click on two restriction sites to select the region between them the region will appear selected in the window as shown below Vector NTI Express Software User Guide EA ADRAIA Acil 484 ADRAIA Acel 465 ADRAIA Gene Aci 376 Acil 826 AccI 1054 Acil 1519 Acil 370 Aci 804 Acil 1050 Acil 1473 Acil 285 Acil 767 ADRALASoUrce ADRAIA Atul 1859 Acil 198 Alur 466 Acil 683 aoraza Aci 1137 ADRAIA Alul 812 mn Ac l 362 darl 601 Alul 820 ADRAIA Alur 1390 Ac l 4 Alul 2062 aaa li L l ADRA1A vi EE U Note When selecting restriction enzymes that generate overhangs be sure to select enzymes in both molecules that will generate complementary overhangs Alternatively you can modify the fragment ends as described below 2 Click on Cut amp Add to Fragment below the molecule pane 3 Th
207. st Nucleotides Must Have 100 Similarity Check and specify the number of nucleotides necessary to have 100 complementarity with the target sequence at the 3 end Vector NTI Express Software User Guide 67 3 Primer Design Shared Advanced settings Similarity setting Description Similarity Between Specifies acceptable similarity between ambiguous nucleotides if Ambiguous any The Average Minimum and Maximum buttons indicate that Nucleotides the average minimum and maximum possible similarity will be calculated respectively for any nucleotide pair For instance if you are calculating similarity between N and A then the average similarity is 25 the minimum similarity is 0 and the maximum similarity is 100 In case of R and A they are 50 0 and 100 in case of R and T 0 0 and 0 The similarity table used by Vector NTI Express is as follows 68 N N N R N A R W R A R T Maximum 100 100 100 100 100 0 Average 25 25 25 25 50 0 Minimum 0 0 0 0 0 0 3 End tab Click the 3 End tab to set specifications for the 3 end of the primers generated by Vector NTI Express Parameters such as dG and specific nucleotide content for the 3 end of both sense and antisense primers can be set here 3 End setting Description dG lt Specify the maximum permitted value of 3 end free energy Length for Analysis Enter the len
208. t 100 base pairs in length Add fragments To add a fragment click on the Add Fragment button and select a molecule from the database Ka Open Molecule Database DNA RNAs Name Identifier Length Form ADCY7 4557254 6196 linear ADCY7 6196 linear Adeno2 35937 linear ADRAIA 15451758 2306 linear ADRAIA 2306 linear BaculoDirect Linear DNA 139370 linear BaculoDirect Linear DN 5770 linear BaculoDirect Linear DN 139370 circul BaculoDirect Linear DNA 139370 linear BaculoDirect Linear DN 139370 circul M lt gt The molecule will appear added to the list in the tool Fragments Vector Source DNA Order Start Position FragmentLength Orientation Amplify Y ADRA1A v 1 2306 Forward N N CDK2 1 1 2226 Forward N Select the vector One fragment in each GeneArt assembly must designated as the vector The vector forms the base fragment onto which other fragments are added The vector is always the first fragment listed in the Wizard and is flagged with a V in the Order column Vector NTI Express Software User Guide Design PCR primers to create end homology GeneArt Assembly Wizard To change the fragment designated as the vector click inside the Vector column and that fragment will be moved to the top of the list Vector Source DNA Order StartPosition FragmentLength Orientation Amplify Vector icon a ADRA1A v 1 2306 Forward N Re order fragments The fragments will be assembled in the
209. t will always be the Reverse Complement of the sequence displayed in the attachments dialog box Add Attachment to In Silico DNA Sequence Add to 5 Terminus O Add to 3 Terminus Restriction Site Aarl cacctgc v Gateway Site attB1 ACAAGTTTGTACAAAAAAGCAGGCTTA v Add Attachment s Note Attachments are not optimized for expression e Select the Restriction Sites checkbox and then select from the dropdown list to add a restriction site to the selected end s of the in silico DNA sequence The selected Restriction Site appears in the DNA sequence pane at the 5 and 3 end based on your selection s Select the Gateway Sites checkbox to add attB sites for Gateway cloning to the back translated molecule In the Choose attB Extension dialog box that appears based on the terminus you have selected 5 or 3 select a fragment from the list and click OK The selected Gateway site appears in the DNA sequence pane at the 5 or 3 end based on your selection e Select the User Defined checkbox to add special sequences promoter tags etc to the back translated molecule Enter the sequence in the field the The sequence will appear in the DNA sequence pane at the 5 or 3 end based on your selection Note The attachments made to the DNA sequence will not appear in the protein sequence pane Clear attachments Click on Clear All Mutations and Attachments to clear all attachments and restore the original sequence
210. tabases in the Database Explorer Database includes data associated with DNA and RNA records protein records and enzymes oligos and gel markers Projects include data and results associated with alignment projects contig assembly projects and cloning projects s Results include BLAST and analysis results Vector NTIO Express Software User Guide 15 1 Database Explorer Open files Subsets A subset is a group of objects organized by a specified criteria such as common features For example you might have one subset for each of your molecule families and one for each taxonomic group Subsets are shown as folders in the Database Projects and Results panes You can search for records by name and create and store data in subsets Open files You can open assembly projects molecules and BLAST results The following file formats are recognized by Vector NTI Express Software File Format DNA RNA molecules All nucleotide files gb gbwithparts fasta fas fa mpfa fna fsa seq embl gcg ma4 ddbj Genbank gb gbwithparts DDBJ ddbj Fasta fasta fas mpfa fna fsa seq EMBL embl GCG gcg Vector NTI Archive ma4 Protein molecules All protein files Y asta fas fa mpfa fna fra fsa seq gp gpwithparts swp pa4 trembl Fasta fasta fas mpfa fna fsa seq
211. ted in addition to the following Advanced Primers Ka Description setting User Defined Enter user defined primer sequences or a primer from the oligo Primers database The search engine checks the compatibility of the primers according to primer parameters Additional advanced settings are described in Shared Advanced settings on page 66 Amplify Selection settings Select the Amplify Selection primer design tool to amplify an entire selected region of a molecule With the molecule open in the Molecule Editor select the region to be sequenced then select Primer Design gt Amplify Selection from the Molecule Editor toolbar Vector NTI Express Software User Guide 61 Z Primer Design Amplify Selection settings These settings are similar to the Find PCR Primers settings except that you can specify primer hybridization regions upstream and downstream of the target sequence Amplify Selection picks primers to amplify the entire selection If suitable primers cannot be found inside the selected region the search will expand within the specified upstream and downstream flanking regions 157 A Primer Design Amplify Selection 9 J Wera en A e Amplify Selection OF Amplicon must include region of molecule From 929 bp To saa bp tal l LA E Maxbp before selection 5 Ed Maxbp after selection 5 sma Max No ofPrimers 5 E Spitey Analysis Conditions l
212. tor NTI Archive ga4 Assembly Project Contig Project cepx cep MSA projects Alignment Project apr aprx BLAST results Vector NTI Archive ba6 Import files There are two ways to import files by dragging and dropping files in Windows Explorer or by using the main menu in the Vector NTI Express Software Drag and drop files into a subset To drag and drop files into a subset Highlight the file names in Windows Explorer Select the files then drag and drop them onto a subset in the Local Database folder in the Explorer Viewer Import files via the main menu To import objects via the main menu 1 Click File gt Import 2 In the drop down list select the type of file you want to import 3 In the Import into Database window navigate to the file select it then click Open 22 Vector NTI Express Software User Guide Manage data Manage Database Projects and Results databases Manage Database Projects and Results subsets Manage data This section describes how to Manage Database Projects and Results databases page 23 Manage Database Projects and Results subsets page 23 Manage data in the Database Projects and Results databases by creating subsets of subsets subfolders of folders grouping data within subsets and organizing subsets Subsets can be hierarchically organized down to six levels You can Create DNA and protein molecules g
213. tor contamination trimming allows contaminations you to trim the vector residues that have been amplified as part the sequencing process leaving only the sequence of interest in the resulting contig assembly Click on Trim vector contaminations in the Task list of the Contig Project pane to select the settings that determine how vector residues are trimmed and the vector file containing the sequence to be trimmed contig Project Assembly 22 Common Settings E General Info s Kere DemoProject Penalty 5 Expect Value 700 Gap Open 3 Gap Extend v Vector List New Project Edit Project Save Project Import l Database Remove D gt View Fragments Sais anida Vector Name Length Description Y 2 782 e Ty eae ee pcDNA2 1_backbone 1782 pcDNA2 1_backbone w Assemble contig View Contig Load Project Export Project close Project J Note When vector trimming is performed the vector sequence and its reverse complement is automatically used so that forward and reverse sequencing reads can be trimmed using one setup Vector trimming settings The Common Settings in this pane are as follows e Minimum vector overlap is the minimum number of bases in the fragment that overlap with those on the clone This setting must be 5 or greater e Minimum vector overlap with ambiguities includes poorly resolved residues e Vector match threshold is the
214. tware can access common databases Workgroup shared databases can be located on a wide range of file servers Vector NTI Express Software can use not only services native to each system Microsoft Network or AppleTalk but also various Unix NFS or Samba and NetWare services The workgroup shared database capability is a purchased addition to Vector NTI Express Software When you purchase the workgroup shared database capability you are issued a Vector NTI Express Software workgroup shared database license that enables you to create workgroup shared databases A workgroup shared database license is a special type of static license that enables you to create numerous workgroup shared databases But the license also limits the number of users for each database you create You do not need a workgroup shared database license to access workgroup shared databases Note Workgroup shared databases can be accessed from Vector NTI Express Software using a license that is shared through a network server Dynamic License You can connect to a workgroup shared database through only a hostname and IP address not via the World Wide Web When the network directory for a new workgroup shared database is arranged connect to a workgroup shared database Before you can connect to a workgroup shared database the workgroup shared database server must be started Start the workgroup shared database server In C Program Files Life Technologies Vector NTI W
215. ule you can Open the molecule in the Molecule Editor and click on Analysis Results Open the Analysis Monitor and double click on the particular analysis Vector NTI Express Software User Guide 113 1 0 Sim4 and Spidey Analysis Spidey 114 Vector NTI Express Software User Guide Launch Clone2Seq Clone2Seq window Select molecules Clone2Seq Clone2Seq simplifies the two fragment restriction and ligation cloning process Using Clone2Seq you will be able to clone a single DNA or RNA insert into a vector without having to go through multiple steps of the molecule construction wizard To launch Clone2Seq 1 4 e Click on the Clone2Seq button 9 on the main toolbar e Select File gt New gt Clone2Seq Project from the main menu The Clone2Seq window consists of two molecule panes and a left pane containing the Fragment List and Molecule Properties lists The left most molecule pane contains the DNA RNA molecule that is first fragment in the clone and the right hand pane contains the second fragment For each molecule the restriction sites selected by Restriction Analysis in the Molecule Editor will be displayed in the molecule pane and sequence ends of linear molecules will be shown in the View Sequence field below the pane Figure 1 Clone2Seq Window Fragment List 1 Click on Open Molecule below the left hand pane to select the first molecule 2 Repeat this operation in the right hand pane t
216. ultiple DNA fragments plus a vector can be joined using overlapping sequence homology between fragment ends to splice the fragments together If homology does not already exist between fragment ends Vector NTI Express will automatically design PCR primers that you can use to add homology to the fragments via PCR amplification Alternatively for High Order Assembly up to three sets of stitching oligos may be designed to create splices across fragments without homology When the fragments and vector are assembled in Vector NTI Express the software performs a homology check based on the rules for the GeneArt Assembly method you are using The homology of the sequence ends will be analyzed and in High Order Assembly the internal sequences of the fragments will also be analyzed to ensure that any internal homologies will not interfere with fragment splicing Then any required PCR primers and or in the case of High Order Assembly stitching oligos will be designed The rules for homology are described in detail in the GeneArt Seamless Cloning and Assembly Kit User Guide and GeneArt High Order Genetic Assembly System User Guide Seamless Cloning Workflow diagram and an example of PCR primers designed to generate a 15 bp fragment end homology EH E xan a Assembled Linear vector Recombine DNA fragments j circular construct DNA fragments and linear vector 15 bp homology f 1 5 GTG AAT TCG GGC TCG TTA GGA
217. ults displays analyses that have been performed on the molecule Analysis Results E E Restriction Map 2azI CACCTGC 0 sites AatII GACGIC 1 sites Acc6SI GGTACC 0 sites AccI GICGAC 2 sites ISSO AceIII CAGCIC 4 sites Acil CCGC 35 sites l AclI AACGIT 3 sites Acul CTGAAG 2 sites AfeI AGCGCT 0 sites AflII CTTAAG sites A TA Properties Feature Map The Analysis tools toolbar contains analysis functions specific to the Molecule Editor The Display tools toolbar contains tools to magnify the molecule or display a DNA sequence as linear or circular Molecule display Use the tools at the top of the window to zoom in and out on the molecule fit the tools molecule within the window or display DNA RNA molecules as linear or circular ARR L Enter or edit a sequence The molecule sequence is displayed in the Sequence pane and a graphical representation of the sequence is displayed in the Graphics pane Enter a sequence 1 To enter a new sequence click on an insert point in the Sequence pane and begin typing 2 The Edit Sequence dialog will open displaying your typed sequence tse Edit Sequence Insert sequence at 235bp 235 ACGTACGGCG TAACGATCGA CCI TGCATECCCC ATTGCTAGCT 3 Continue typing and click on OK to insert the sequence Vector NTI Express Software User Guide 41 2 Molecule Editor Molecule featu
218. um of Iteration default to 10 Clustering Method used to create the Guide Tree Neighbor Joining NJ or Unweighted Pair Group Method with Arithmetic Mean UPGMA see description under Guide Tree pane below 100 Vector NTI Express Software User Guide Perform the alignment Guide Tree pane E When you have selected the alignment settings click on Submit Guide Tree pane Graphs pane Sequence similarity graph Sequence complexity graph The Guide Tree which resembles a Phylogenetic tree is displayed when three or more sequences are aligned The Guide Tree can be built using two different methods The Neighbor Joining method NJ of Saitou and Nei works on a matrix of distances between all pairs of sequence to be analyzed These distances are related to the degree of divergence between the sequences The Unweighted Pair Group Method with Arithmetic Mean UPGMA is a simple agglomerative or hierarchical clustering method in which at each step the nearest two clusters are combined into a higher level cluster The Guide Tree is calculated after the sequences are aligned AlignX displays the calculated distance values in parenthesis following the molecule name in the Guide Tree pane PDONR221 P5P2 2 1E 4 PDONR221_VERD 0 00158 PDONR221 P3P2 1 1E 4 PDONR221 P5P4 6 1E 4 PDONR221 P4RP3R 0 04619 The Graphs pane provides a graphical representation of sequence similarity and complexity among the aligned sequ
219. ure Map Pane lt Title of Publication in footer gt creating features 93 deleting features 94 GenomBench Overview Pane description 92 group data 26 Group data in subsets 25 H H3 Heading3 Clear a Local Database subset 24 Delete the contents of a Local Database subset 25 Dismiss Local Database subsets 25 View a summary of a Local Database subset 25 image capture 30 31 import file formats 28 Importing ASCII 171 Importing data 21 InterPro database analysis 54 IUB Codes 171 J JMol See 3D Molecule Viewer L Launching BLAST Search 81 Low complexity segments 84 M manage BLAST results and analysis results BLAST results manage 34 Projects database 33 Molecule feature creating 42 molecules copy 30 print data 33 save 32 Molecules creating 17 Molecules creating or opening 39 lt Title of Publication in footer gt Index Molecules importing 21 Motif Finder 54 Mutations See Regenerator N National Center for Biotechnology Information NC BI register with 38 0 Oligo Duplex Analysis 48 oligos export 27 properties edit 29 Oligos creating 19 Open applications in Database Explorer 30 open projects 33 ORF Finder 45 P Parts Assembler 149 Parts standard biological 149 PCR primers user defined 61 preferences display 37 Primer design 57 Analysis conditions 60 PCR primers 60 Results in Molecule Editor 58 Results saving 59 Settings saving and loading 58 Primers similarity
220. values 178 TaOpt 177 Tm values 177 print molecule data 33 PRINTS database analysis 52 projects create open edit 33 Projects database 33 properties database objects 27 PROSITE database analysis 52 Protein Data Bank PDB files 105 Protein Domain Analysis 52 181 Index R Regenerator 75 Remote Database 35 Rename a Local Database subset 24 Restriction Analysis 43 Restriction enzymes creating 19 Reverse Selection to Complementary 42 S save molecules 32 screenshots take 30 31 Searches BLAST and Entrez 81 Searching the database 23 Sequence alignment See AlignX Sequence analysis 71 Sequence modifications for gene synthesis 75 Sequence entering or editing 41 sequences copy 31 set display preferences 37 shared database 35 Silent Mutation Analysis 49 Sim4 analysis 109 Similarity between ambiguous nucleotides 178 snapshots take 30 31 sort data data sort 26 Spidey analysis 111 subsets add objects to 26 Subsets creating 23 T TaOpt 177 Three Dimensional Molecule Viewer See 3D Mole cule Viewer Tm GC calculation 173 ambiguous oligos 176 general information 173 primers probes 177 references 178 RNA oligos 176 TaOpt 177 Therm Tm calculation 174 182 TOPO Cloning 133 TOPO cloning generating aclone 133 Translation tool Molecule Editor 47 U use NCBI Web services 38 V viewers Database Explorer 15 W Web analyses of DNA or protein sequences 50 Web resources 38 lt T
221. ve a certain cutoff a dot is placed in the matrix in the position defined by the starting positions of the window for both sequences A diagonal line segment indicates that the two sequences match consistently over an extended region A larger window size is generally used for DNA sequences than protein sequences since the number of random matches is much greater for DNA Vector NTI Express Software User Guide Dot Plot El Display the Dot Plot With two fragments selected in the Fragments list click on View Dot Plot to open the Dot Plot Viewer and view a similarity plot of the selected molecules Vector NTIO Express Software User Guide m Dot Plot pDONR221 P3P2 vs pDONR221 Sun 11 Dec 2011 09 59 19 9 v a ES a 1 J E z G a a 103 Align Multiple Sequences Dot Plot 104 Vector NTI Express Software User Guide 3D Molecule Viewer The 3D Molecule Viewer is a tool for visualizing protein structures in three dimensions It can open Protein Data Bank PDB files with the file extension pdb The 3D Molecule Viewer uses JMol an open source Java viewer for chemical structures in 3D that has been integrated into Vector NTI Express For more information about JMol visit www jmol org Download 3D Structure Files You can search for PDB files with the pdb file extension in public databases using the Entrez query tool in Vector NTI Express Click on the Public Database Search
222. will appear in the Selected Oligos Primers list Select from the following additional analysis parameters dG Temperature enter the temperature in degrees Celsius to be used for calculating free energy values Stem Length enter the minimum acceptable number of base pairs in a hairpin or dimer stem Click on Analyze to run the analysis Analysis results are displayed at the bottom of the window Click on Save Results to save the analysis as a separate text file Analysis Results 6Total GGCGACAAGTTIGTACAAAAAAGCAGGCINN Hit I NNTICGGACGAAAAAACATGCTITGAACAGGGE Stem Length Dimer dG 6 9 kcal mol GGGGACAAGTTTGTACAAAAAAGCAGGCINN Itt Hl NNTCGGACGAAAAAACATGTTITGAACAGGEE Stem Length 6 Dimer de 2 1 keal mnl ES Note In the graphical depiction of duplexes vertical lines indicate the primary interaction based on the stem length set and plus symbols indicate secondary interactions The greater the dG value the weaker the interaction secondary interactions are not considered in the dG calculation Silent Mutation Analysis In the Molecule Editor you can search for silent mutations in a DNA RNA sequence or selected region of a sequence that do not affect amino acid translation but result in the creation or disappearance of one or more restriction sites Note You do not need to perform restriction analysis before running Silent Mutation Analysis 1 Select a region of the sequence or make n
223. with attB sites by another means e g restriction ligation click on the Add button and select the molecule from the database e Toremove a molecule from list select it and click on Remove e To clear the entire list click on Clear All Vector NTIO Express Software User Guide 127 128 Gateway Cloning Gateway Cloning workflow pDONR Vector The pDONR vector is a type of Gateway Cloning vector that contains attP sites which are recombined with the fragments containing attB sites to create entry clones attB attB attP attP attL attL attR attR BE 1 a TmU nm attB flanked PCR donor gt entry by product product or attB vector clone expression clone A variety of pDONR vectors are sold by Life Technologies and in silico sequences for these are installed as part of the default Vector NTI Express installation IMPORTANT To be recognized as a pDONR vector in Vector NTI Express a molecule must contain the correct attP1 and attP2 sequences and these sites must be labeled as features in the molecule with the feature names attP1 and attP2 See Chapter 2 Molecule Editor on page 39 for information on identifying and naming features To select a pDONR vector e Click on the Add button and select the pDONR vector from the database e To remove a vector from list select it and click on Remove e To clear the entire list click on Clear All Create the Entry Clone When you have made your selections c
224. wn features are listed along with relevant feature information in the Genome Features pane The associated GenBank accession number is derived from the Target Accession number of the feature Magnifying tools Use the magnifying tools to the right of the Feature Map to magnify features in the pane horizontally e Q The Genome Features pane lists the features in the map by name and indicates their type location orientation and feature category Name Type Start Length Orientation Category DC854910 chr3 9 xenoEst 1000300 40 UNKNOWN transcription EZ159107 chr3 9 xenoMrna 974496 20 UNKNOWN transcription FC129225 chr3 8 xenoEst 1000165 31 UNKNOWN transcription CB308280 chr3 9 xenoEst 999965 89 UNKNOWN transcription GE874806 chr3 9 xenoEst 999701 261 UNKNOWN transcription 3 The Genome Sequence pane displays the entire downloaded sequence Editing features In the Feature Map and Genome Features list the right click menu allows you to create edit or delete features Right click on a feature in the map or list and select Edit the selected feature Edit basic settings and information for the feature including feature name type orientation and position in the segment or multiple segments ES Edit Feature EZ159107 chr3 974495 Name E2159107 chr3 974495 Type v Orientation Direct O Complementary Notoriented Position O Single Segment Start 57 End Multiple Segments 97
225. xport data in the following file formats File Format DNA RNA Genbank gb gbwithparts molecule DDBJ ddbj Fasta fasta fas fa mpfa fna fsa seq EMBL embl GCG gcg ASCII txt Protein molecule Fasta fasta fas fa mpfa fna fsa seq GenPept gp gpwithparts SWISS PROT swp TrEMBL trembl ASCII txt Enzyme REBASE rebase Oligo CSV Y Cav BLAST results Tab delimited txt Contig Assembly Contig Project cepx Project Show or hide columns For all databases in the Local Database you can show or hide columns in the Records Viewer To show or hide columns 1 In the Explorer Viewer click Local Database then expand a database 2 In the Records Viewer right click anywhere in the records table then select Column 3 In the drop down list check or uncheck the columns that you want shown or hidden Edit data The operations described in this section apply to the Enzymes Oligos and Gel Markers databases in the Local Database This section describes how to e Edit enzyme properties page 28 Edit oligo properties page 29 Edit gel marker properties page 29 Edit enzyme To edit an enzyme properties 1 In the Explorer Viewer click Local Database then select Enzymes 28 Vector NTI Express Software User Guide Edit data 2 In the Records Viewer right click an enzyme
226. xpress displays a graphical representation of a DNA or protein molecule the molecule sequence information about the molecule and the results of any analysis performed on the molecule Using the Molecule Editor you can Create or opena Create a new 1 molecule Create and edit a molecule sequence Annotate the molecule Analyze the molecule For DNA RNA molecules you can perform restriction analysis design primers from the sequence find ORFs translate the sequence into amino acids and other functions For protein molecules you can scan for motifs perform web searches on the sequence perform back translation and other functions Molecule sequences may also be analyzed using a variety of web tools and publicly available analysis engines Display the analysis results molecule To create a new molecule click on File gt New and select DNA or Protein as the molecule type Note For DNA or RNA molecules specify Linear or Circular 2 The blank molecule will be displayed in the Molecule Editor but will not yet be saved in the database Open an existing To open an existing molecule molecule e For molecules in the database double click on the molecule name in the Database Explorer window For molecules that are not in the database select File gt Open and select a molecule of the appropriate file type gb fasta etc The molecule will be displayed in the Molecule Editor Vector NTI Express Softwa
227. y downloadable Annotated sequences can be aligned with the genomic backbone simply by dragging and dropping into an alignment window Proprietary DNA sequences stored in the Vector NTI Express local database can also be positioned along genomic backbones using Spidey or Sim4 alignment algorithms to determine the intron exon structure of genes of interest Genomic sequences in GenomeBench can be exported to Vector NTI Express for further sequence analysis such as PCR primer design or the creation of spliced transcripts GenomeBench also provides the capability to query public databases and perform sequence and feature searches Download data from public DAS servers Vector NTI Express has preconfigured DAS servers To launch GenomeBench and download data 1 Click on the GenomeBench button on the main toolbar 2 When you first open the application an empty project will be displayed 3 In the GenomeBench toolbar on the right side of the window click on the Load from DAS Server button to download genomic data from one of the pre configured public DAS servers Genome Reference Consortium human GRCh National Center for Biotechnology Information mouse genome assembly NCBIM Rat Genome Sequencing Consortium RGSC Vector NTI Express Software User Guide 89 7 GenomeBench Download data from public DAS servers NCBI s 32K BAC array BAC end sequence pairs and Fosmid clone end sequence pairs f DAS Select t
228. you want to combine Vector NTI Express Software User Guide 149 1 5 Parts Assembler Using the Parts Assembler Restrictions on Parts Assembly Settings 150 1 To select the first part that you want to assemble click on the Open Molecule button beneath the left pane and select the molecule from the database The molecule must be compatible with a defined assembly standard as described in the following section 2 Select the second molecule in the right pane Parts Assembler Workflow E General Info BBa_A340620 BBa_B0010 New Parts Assembler Project 999bp 80bp F Fragment List ES L L gt Molecule1 Molecule2 Edit Project Save Project Close Open Molecule Open Molecule The compliant assembly standard s for this part The compliant assembly standard s for this part Assembly Standard 10 Assembly Standard 12 Assembly Standard 10 Assembly Standard 12 Assemble Exit When you select a molecule its sequence will be displayed in the pane and the assembly standards that are compatible with that sequence will be listed at the bottom of the pane If the molecule does not conform to any of the standards you will receive a warning message Any molecule in the database can be selected as a part as long it conforms one of the assembly standards shown in the following table To conform to an assembly standard the molecule must not contain the restriction enzyme digestion sites listed in t

Download Pdf Manuals

Related Search

Related Contents

    PDF Nokia Bluetooth Headset BH-300 User Guide  Depósito intermedio MRS  dialogue des cultures - Centre d`études et de recherches  Belkin F5D7632UK4 User's Manual  Apollo Precision Tools Valves 4S-100 User's Manual  湿度－電圧変換モジュール TAM  Manual PDF  Búsqueda por referencia catastral  

Copyright © All rights reserved. Failed to retrieve file