Home

"Overview of Receptors from Combinatorial Nucleic Acid and Protein

1. pJG4 5 pcaL em Soo Aero Taon pJM 1 vox A ae a pJM 2 pGAL1 Ne a ae TADH1 pJM 3 nuclear HA epitope TxA pGAL1 TADH1 localization tag Figure 24 4 1 Expression vectors for interaction trap and genetic selection pJG4 5 is the prey vector used in the interaction trap UNIT 20 1 pJM 1 is the peptide aptamer prey vector pJM 2 and pJM 3 are used in yeast genetic selections These yeast E coli shuttle vectors are derivatives of pJG4 4 Gyuris et al 1993 and contain one of the following expression cassettes pJG4 5 yeast GAL1 promoter Pga_i SV40 nuclear localization signal B42 activation domain haemagglutinnin epitope tag EcoRI and Xhol cloning site and yeast ADH1 transcription terminator Tapy4 Gyuris et al 1993 See Figure 20 1 3 for a more detailed map of pJUG4 5 pUM 1 Pear SV40 nuclear localization signal B42 activation domain haemagglutinnin epitope tag E coli thioredoxin TrxA and Tapp1 Colas et al 1996 pJM 2 Pea 1 haemagglutinnin epitope tag TrxA and Tapp Geyer et al 1999 pUM 3 Paar SV40 nuclear localization signal haemagglutinnin epitope tag TrxA and TapHi Geyer et al 1999 Current Protocols in Molecular Biology stringent lacZ reporter The stringency of the lacZ is increased by reducing the number of LexA operators upstream of the lacZ reporter gene Basic Protocol 5 describes a method to use peptide aptamers for the forward ana
2. selection experiments that have previously been successfully executed with different types and sizes of pools Type of selection and degree of randomization Most researchers who carry out in vitro selection experiments wish either to better define or optimize a known binding site binding site selection or to identify a novel binding site aptamer selection Each of these tasks requires the synthesis of different types of pools The sequences and structures that contribute to known binding sites are frequently best defined by selections that start from partially randomized pools One example of binding site definition that started from a partially randomized pool was a selection that defined critical residues of the Rev responsive element RRE of HIV 1 Rev Bartel et al 1991 This experiment is also described in more detail below Biased pools can also be used for the optimization of a previously isolated motif For example aptamers that could bind to the Rex protein of HTLV 1 were selected from a partially randomized pool based on the wild type Rex binding element XBE but in the end bound Rex 9 fold better than the XBE Baskerville et al 1995 Doped sequence selections can also be used to better define the functional sequences and structures of aptamers obtained from completely random pools as described below Hessleberth et al 2000 Doped sequence pools for aptamers typically retain from 70 to 95 sequence identity 5 to 30 mu
3. 7 8 9 are actually binding to the target and not to the filter a parallel binding reaction in the absence of protein can be carried out intermittently The authors strongly suggest that no protein controls be scrutinized before the selection begins and then after every three additional rounds of selection i e rounds 3 6 and 9 The choice of selection conditions is probably the second most important factor following the choice of target for determining the success of a selection experiment While general guidelines for modulating the stringency of selection can be recommended see Critical Parameters for comments on the stringency of selection every target and every selection is different and no precise guidelines for success can be provided In general the stringency of selection should be lower in early rounds of selection and higher in later rounds This will give binding species an opportunity to establish themselves in the population relative to filter binding species It should be noted that there is some danger of cross contaminating the selected pool with the no protein control Basically executing the no protein control is identical to selecting for protein independent filter binding species hence DNA arising from the no protein control should be handled with care During the equilibration assemble a second filter disk into a holder see step 3 Load the equilibrated binding reaction on
4. J frameshift free and reverse transcribed mRNA display templates dsDNA cassette s that are in frame at both their 3 and 5 ends and free of stop codons Full length DNA library encoding an open econ reading frame substantially free of stop Se ee ae codons deletions and insertions os KEY ae Sen pees eae DNA protein Ltda dt RNA gt puromycin Figure 24 5 3 Continued Translation enhancer sequence The library will need a translation enhancer before the initiating methionine codon the truncated 5 UTR from the Tobacco Mosaic Virus sequence ACAATTACTATTTA CAATTACA has been used successfully Initiating methionine The initiating methionine ATG immediately follows the translation enhancer sequence N terminal constant ORF sequence It is extremely helpful to have amino acid sequences within the protein that can act as affinity tags These are invaluable when purifying the displayed proteins If two different affinity tags are used and these are located close to each of the termini of the expressed Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 5 5 Supplement 53 Step Product Synthesis and denaturing Full length ssDNA library 9 PAGE purification of full length DNA library skip this step if library is already dsDNA PCR amplification of DNA dsDNA library gt library skip thi
5. Trp Leu Glu CM His Ura Trp Xgal Gal Raf CM His Ura Trp Xgal 9 Analyze plates for mating Mating occurs at the intersection of the Mata and Mata strains Diploid colonies should grow on the Xgal plates Interactions between the peptide aptamer preys and protein target baits produce blue color on the galactose Xgal plates and growth on the galactose Leu plates at the intersection of the strains AFFINITY MATURATION OF PEPTIDE APTAMERS The binding affinity between a peptide aptamer and its protein target can be improved by mutating the peptide aptamer variable region and reselecting for aptamers that bind the target protein using a more stringent interaction trap In this protocol peptide aptamers are mutated by random PCR mutagenesis as described by Cadwell and Joyce 1994 Alternatively degenerate oligonucleotides that code for the variable region and have varying degrees of randomness can be synthesized using an automated DNA synthesizer UNIT 2 11 The stringency of the interaction trap selection is enhanced by decreasing the number of LexA operators upstream of the lacZ reporter gene A series of lacZ reporter genes containing eight two and one LexA operator s Brent and Ptashne 1985 are used to select aptamers with increased affinity toward their targets Materials 5 U ul Taq polymerase and 10x buffer Life Technologies 1M MgCl 100 mM dATP 100 mM dGTP 100 mM dCTP 100 mM dTTP 20 uM p
6. 1989 used spiked oligos to select for second site suppressor mutations that could rescue the catalytic activity of triosephos phate isomerase while Oliphant and Struhl 1989 carried out similar selections with B lactamase It also became apparent that func tional nucleic acids could be selected from random sequence pools and the Struhl lab also selected double stranded oligonucleotide binding sites for the yeast DNA binding pro tein GCN4 Oliphant et al 1990 This work set the stage for many of the directed evolution experiments that are carried out to this day Critical Parameters Synthesis Depending on the size of the pool to be synthesized the operation of the DNA syn thesizer may first need to be optimized Short Current Protocols in Molecular Biology pools lt 80 total nucleotides in length can be synthesized using standard protocols see e g PerSeptive Biosystems 1998 In order to synthesize longer pools gt 80 total nucleotides in length all reagents should be fresh and special care should be taken to exclude water from the synthesis see UNIT 2 1A To ensure equimolar base incorporation in the random region of longer pools the phosphoramidites must be mixed in a skewed ratio see Strate gic Planning Coupling efficiency should be monitored throughout the synthesis by follow ing the trityl cation output see UNIT 2 11 Amplification Optimization of PCR conditions according to establis
7. Additional reagents and equipment for PCR amplification UNIT 15 1 see Support Protocol 3 for determination of conditions on a small scale and phenol chloroform and chloroform extraction of DNA UNIT 2 14 Plan the reaction Since large scale reactions are quite expensive in terms of nucleotides and enzyme preparedness and planning for the large scale amplification cannot be overemphasized Primers lt 20 bases in length usually do not need to be gel purified and can instead be purified by precipitation 1 After identifying the optimal PCR conditions on a small scale see Support Protocol 3 prepare reagents for the large scale reaction Set aside time for the large scale amplification which will probably consume an entire day The size of the large scale reaction will be determined in part by the amount of DNA pool to be amplified and by the number of copies of the library that are desired For example one copy of a dsDNA pool with a complexity of 1x 10 weighs 100 ug Assuming a 16 fold amplification in which the typical amount of DNA recovered from a 100 ul PCR reaction is I ug then each 100 ul reaction should have 1 1g 16 60 ng of DNA 100 ue total 60 ng 100 ul 1667 x 100 ul or a 167 ml reaction The authors normally start with a complexity to 1x 10 sequences and carry out a 10 fold amplification These parameters are ideally suited for one to two 96 well PCR plates that will be inoculated with 20 to 50 ul total of the po
8. Kramer F R Mills D R Cole P E Nishihara T and Spiegelman S 1974 Evolution of in vitro sequence and phenotype of a mutant RNA resis tant to ethidium bromide J Mol Biol 89 719 736 Kulbachinskiy A V 2007 Methods for selection of aptamers to protein targets Biochemistry Mosc 72 1505 1518 Lato S M Boles A R and Ellington A D 1995 In vitro selection of RNA lectins Using combi natorial chemistry to interpret ribozyme evolu tion Chem Biol 2 291 303 Lehman N and Joyce G F 1993 Evolution in vitro of an RNA enzyme with altered metal depen dence Nature 361 182 185 Levisohn R and Spiegelman S 1969 Further ex tracellular Darwinian experiments with replicat ing RNA molecules Diverse variants isolated under different selective conditions Proc Natl Acad Sci U S A 63 805 811 Mills D R Peterson R L and Spiegelman S 1967 An extracellular Darwinian experiment with a self duplicating nucleic acid molecule Proc Natl Acad Sci U S A 58 217 224 Current Protocols in Molecular Biology Shamah S M Healy J M and Cload S T 2008 Complex target SELEX Acc Chem Res 41 130 138 Stoltenburg R Reinemann C and Strehlitz B 2007 SELEX A r evolutionary method to gen erate high affinity nucleic acid ligands Biomol Eng 24 381 403 Tuerk C and Gold L 1990 Systematic evolu tion of ligands by exponential enrichment RNA ligands to bacteriophage T4 DNA po
9. One library equivalent equals the total number of transformants containing the peptide aptamer library as determined in step 1 Centrifuge culture 4 min at 3000 x g room temperature Remove supernatant with a pipet and resuspend the yeast pellet in sterile water Plate yeast on 10 cm Gal Raf CM Trp selection plates and incubate under selection conditions Streak positive colonies on Glu CM Trp master plates Confirm galactose dependent phenotype by replicating master plate onto Glu CM Trp and Gal Raf CM Trp plates and incubate under selection conditions Isolate peptide aptamer expression plasmids pJM 2 or pJM 3 from the yeast colonies that show the galactose dependent phenotype UNIT 3 1 Reconfirm the peptide aptamer phenotype by transforming the isolated plasmid into the selection strain and testing for galactose dependent phenotype Isolate the peptide aptamer expression plasmids UNIT 13 11 for sequencing UNIT 7 3 and target identification see Support Protocol Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 4 15 Supplement 52 SUPPORT PROTOCOL Peptide Aptamers 24 4 16 Supplement 52 IDENTIFICATION OF PEPTIDE APTAMER TARGETS The protein targets of the genetically selected peptide aptamers Basic Protocol 5 can be identified using the interaction mating assay see Basic Protocol 3 or by interaction hunts against
10. Supplement 87 Directed Evolution of Proteins In Vitro 24 6 8 Supplement 87 REAGENTS AND SOLUTIONS Use deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 Elution buffer 7M urea 300 mM sodium acetate add from stock of 3 M sodium acetate pH 5 2 e g Sigma Filter through 0 2 um filter Store up to 6 months at room temperature COMMENTARY Background Information Selections for binding proteins are only one of several different types of selections that can be carried out using the emulsion technique described in this unit Binding proteins have been selected using two different methods In the method described above the binding tar get is covalently linked to the DNA template Recovery of each template is dependent upon the ability of the protein it encodes to capture its gene through the target Besides strepta vidin other binding proteins that have been selected by this method include zinc finger or p53 binding to DNA Sepp and Choo 2005 Fen et al 2007 In a second approach the emulsion is used to create template protein linkages which are subsequently selected for binding following de emulsification Doi and Yanagawa 1999 Yonezawa et al 2003 2004 Bertschinger and Neri 2004 For example a fusion protein between a zinc finger and UIA binds to its template Following de emulsification these DNA protein
11. Typically a 1 umol scale column random sequence pool synthesis contains 1 x 10 molecules and thus can potentially sample on the order of all possible 25 mers 4 1 1 x 10 5 In fact since different 25 mers can be found in different reading frames a slightly larger sequence space will likely be sampled Because of this physical restriction it is sometimes thought that random sequence pools should be no more than 25 residues in length any longer and only a fractional sampling would be possible and many potential sequences would be lost While this is true it should be realized that longer pools do not lose any of the numerical complexity of smaller pools except in those instances where long syntheses are extremely inefficient and in fact gain access to some fraction of longer sequence and structural motifs as well For example tRNA molecules are roughly 76 nucleotides in length It might prove more difficult to select tRNA mimics from a random sequence population containing 30 randomized residues than from a pool spanning 80 randomized residues However any short functional tRNA mimics present in the shorter population should also be present in equal or greater number in the longer population In most instances the relative completeness of the pool is not a consideration in the success of a selection Indeed it has been shown that functional nucleic acids are not extremely rare for reviews see Gold et al 1995 and Fitzwater
12. formation efficiency in E coli To reduce the current flow the conducting species must be removed from the DNA using affinity purifica tion columns The number of peptide aptamers that can be screened is generally limited by the transfor mation efficiencies of the organism used in the selection In yeast the highest transformation efficiencies are obtained using the lithium ace tate transformation protocol developed by Geitz and Schiestl 1995 The diversity of peptide aptamer libraries in yeast are limited to 10 to 107 unique aptamers This is much lower than the 10 to 10 libraries typically obtained in E coli Particular care should be taken to optimize the transformation efficien cies in yeast or other selected organisms To obtain optimal transformation in yeast it is important to perform trial transformations to optimize parameters such as heat shock time and cell density Screening peptide aptamers A second critical parameter is the spontane ous reversion rate in the screen used to isolate the peptide aptamers unr 20 1 discusses critical parameters that should be taken into account when selecting peptide aptamers against spe cific proteins using the interaction trap False positives that occur in either the interaction trap or other genetic screens can be eliminated more efficiently using peptide aptamers that are ex pressed under the control of an inducible pro moter Identifying protein targets A thir
13. gen primers and pools can now be custom ordered Because of reagent costs the need for specialized synthetic expertise and equipment overhead it is frequently better to order a pool than to synthesize it in the lab While the yield of homemade and outsourced pools is often similar the quality of randomization and the overall synthetic integrity number of extendable sequences are typically much higher from synthesis companies see Table 24 2 2 for a comparison In determining the costs for outsourcing the length of the overall pool and the type of random region desired are the primary considerations Many commercial supply houses with businesses focused on primer production set price ranges based on size and thus longer pools are forced into higher price ranges Most pools should be synthesized on either a 100 nmol scale up to 90 nt or a 250 nmol scale 90 to 100 nt That said there is a substantial difference in price between these two scales 0 55 and 0 95 per nucleotide respectively There is also frequently a separate setup fee for mixing an N bottle of phosphoramidites The yield and quality of pools should also be considered when deciding between com mercial and in house synthesis In the authors experience yields were similar for both a longer and shorter pool around 10 of the synthesis could be recovered as full length products a coupling efficiency of 97 6 0 2 see Table 24 2 2 Pool complex ity is also a
14. monovalent ion concentrations can be used to increase the stringency of a selection experiments Higher concentrations of divalent cations such as mag nesium help to maintain the structural integrity of RNA molecules and potentially facilitate the formation of salt bridges between acidic residues and the phosphate backbone Equilibration time Longer equilibration times give stronger binding species a greater chance to bind to the target since weaker binding species more quickly dissociate from the target In general though species with nanomolar dissociation constants or lower can be readily selected by allowing the reaction to equilibrate for 5 min or more The authors usu ally allow up to 30 min for the binding reaction in order to permit slow folding or refolding steps in the presence of the target However longer equilibration times may not be possi ble for proteins that are inherently unstable or that themselves undergo slow buffer or temperature induced conformational changes Dilution of binding buffer Similarly dilut ing the binding reaction by 10 to 20 fold just prior to filtration will favor the selection of RNA protein complexes with low dissociation constants over RNA protein complexes with higher dissociation constants Baskerville et al 1995 have successfully used this technique to select high affinity anti Rex aptamers Amount and composition of wash Increas ing the number of times a filter is washed and
15. no protein negative control selection was performed the relative appearance of bands during the cycle course can be used to help determine if partitioning of binding species from nonbinders has occurred 5 With the ssDNA from the reverse transcriptase reaction set up the PCR reaction as follows 10 ul 10x PCR buffer 5 ul 4 mM dNTP mix 2 ul 20 uM 5 end primer 2 ul 20 uM 3 end primer 2 ul pool ssDNA from step 4 0 5 ul 5 U ul Taq DNA polymerase 77 5 ul nuclease free water 6 Incubate the reaction under the following conditions 1 cycle 5 min 95 C initial denaturation 20 cycles 45 sec 92 C denaturation 45 sec 50 C annealing 1 min 72 C extension 1 cycle indefinitely 4 C hold It should be noted that the listed conditions have been optimized for the pool design methods described in UNIT 24 2 However different pools and primers may require very different amplification conditions See UNIT 15 4 for comments on primer selection and for the experimental parameters that govern reverse transcription and PCR 7 Within the last 10 sec of the 72 C extension step in cycle 6 remove a 5 ul sample and combine it with 1 ul of 6x non denaturing dye in a separate PCR tube To prevent cross contamination within the thermal cycler remove the tube when aliquot ting each sample 8 Repeat step 7 at the end of the 72 C extension step of cycles 8 10 12 and 14 Allow the PCR to progress to cycle 20 and remove a f
16. Biol 354 212 219 Sepp A Tawfik D S and Griffiths A D 2002 Microbead display by in vitro compartmentali sation Selection for binding using flow cytom etry FEBS Lett 532 455 458 Shimizu Y Kanamori T and Ueda T 2005 Protein synthesis by pure translation systems Methods 36 299 304 Tawfik D S and Griffiths A D 1998 Man made cell like compartments for molecular evolution Nat Biotechnol 16 652 656 Yonezawa M Doi N Kawahashi Y Higashinakagawa T and Yanagawa H 2003 DNA display for in vitro selection of diverse peptide libraries Nucleic Acids Res 31 e118 Yonezawa M Doi N Higashinakagawa T and Yanagawa H 2004 DNA display of biologi cally active proteins for in vitro protein selec tion J Biochem 135 285 288 Zaher H S and Unrau P J 2007 Selection of an improved RNA polymerase ribozyme with superior extension and fidelity RNA 13 1017 1026 Zheng Y and Roberts R J 2007 Selection of restriction endonucleases using artificial cells Nucleic Acids Res 35 83 Current Protocols in Molecular Biology
17. Compartments are formed containing no more than 1 gene The templates are transcribed and translated to produce proteins Some proteins will bind the target molecule conjugated to their templates The translated proteins must retain their templates throughout the recovery and wash process While nonbinding proteins will also be captured they will not carry their corresponding templates with them Captured templates will be amplified by PCR and used in subsequent rounds of selection Current Protocols in Molecular Biology f RBS tag protein coding sequence E RBS 6xhHis streptavidin A promoter RBS Ef tag protein coding sequence m Ang promoter RBS transcription and translation tag PCR to regenerate captured genes Angi promoter Qk H wash to remove non bound gene AA a nes A gt p tag POR aE RBS aftag protein coding sequence iL protein coding sequence j Anor RBS Eftag protein coding sequence z Figure 24 6 1 Current Protocols in Molecular Biology legend appears on preceding page Generation and Use of Combinatorial Libraries 24 6 3 Supplement 87 Directed Evolution of Proteins In Vitro 24 6 4 Su
18. Des Sel 17 201 204 Ghadessy F J Ong J L and Holliger P 2001 Directed evolution of polymerase function by compartmentalized self replication Proc Natl Acad Sci U S A 98 4552 4557 Ghadessy F J Ramsay N Boudsocq F Loakes D Brown A Iwai S Vaisman A Woodgate R and Holliger P 2004 Generic expansion of the substrate spectrum of a DNA polymerase by directed evolution Nat Biotechnol 22 755 759 Griffiths A D and Tawfik D S 2003 Directed evo lution of an extremely fast phosphotriesterase by in vitro compartmentalization EMBO J 22 24 35 Levy M and Ellington A D 2008 Directed evo lution of streptavidin variants using in vitro compartmentalization Chem Biol 15 979 989 Levy M Griswold K E and Ellington A D 2005 Direct selection of trans acting ligase ri bozymes by in vitro compartmentalization RNA 11 1555 1562 Mastrobattista E Taly V Chanudet E Treacy P Kelly B T and Griffiths A D 2005 High throughput screening of enzyme libraries In vitro evolution of a beta galactosidase by fluorescence activated sorting of double emul sions Chem Biol 12 1291 1300 Roberts R W and Szostak J W 1997 RNA peptide fusions for the in vitro selection of pep tides and proteins Proc Natl Acad Sci U S A 94 12297 12302 Sepp A and Choo Y 2005 Cell free selection of zinc finger DNA binding proteins using in vitro compartmentalization J Mol
19. His Ura Glu CM His Ura Trp Leu Gal Raf CM His Ura Trp Leu YPD plates UNIT 13 1 Xgal plates UNIT 13 1 Glu CM His Ura Trp Xgal Gal Raf CM His Ura Trp Xgal Current Protocols in Molecular Biology 30 C incubator Additional reagents and equipment for lithium acetate yeast transformation UNIT 13 7 and replica plating UNITS 1 3 amp 13 2 1 Transform individual peptide aptamer prey plasmids and a control plasmid pJG4 5 into EGY48 Mata using lithium acetate transformation Umi 13 7 Select transfor mants on 10 cm Glu CM Trp plates peptide aptamer preys target baits in EGY48 Mata in EGY42 Mata replica plate mate on YPD a diploid epics plate on an k gE GE Gal Raf CM His Ura Trp Leu Gal Raf CM His Ura Trp Xgal Figure 24 4 3 Mating interaction assay Finley and Brent 1994 Peptide aptamer preys in the yeast strain EGY48 Mata are streaked vertically on Glu CM Trp plates Target protein baits and lacZ reporter pSH18 34 in the yeast strain EGY42 Mata are streaked horizontally on Glu CM His Ura plates The yeast strains are replica plated perpendicular to each other on YPD plates The haploid strains carrying the baits and preys mate where the two strains intersect forming a c diploids that contain the bait prey and lacZ reporter The YPD plates are replica plated onto the following interaction detection plates Glu C
20. Isolation of peptide ap tamers that inhibit intracellular processes Proc Natl Acad Sci U S A 97 2241 2246 Bramlage B Luzi E and Eckstein F 1998 De signing ribozymes for the inhibition of gene expression Trends Biotech 16 434 438 Branch A D 1998 A good antisense molecule is hard to find Trends Biochem Sci 23 45 50 Brent R and Ptashne M 1985 A eukaryotic tran scriptional activator bearing the DNA specificity of a prokaryotic repressor Cell 43 729 736 Cadwell R C and Joyce G F 1994 Mutagenic PCR PCR Methods Appl 3 S136 S140 Caponigro G Abedi M R Hurlburt A P Max field A Judd W and Kamb A 1998 Transdominant genetic analysis of a growth con trol pathway Proc Natl Acad Sci U S A 95 7508 7513 Chien C T Bartel P L Sternglanz R and Fields S 1991 The two hybrid system A method to identify and clone genes for proteins that interact with a protein of interest Proc Natl Acad Sci U S A 88 9578 9582 Generation and Use of Combinatorial Libraries 24 4 23 Supplement 52 Peptide Aptamers 24 4 24 Supplement 52 Cho G Keefe A D Liu R Wilson D S and Szostak J W 2000 Constructing high complex ity synthetic libraries of long ORFs using in vitro selection J Mol Biol 297 309 391 Cohen B 1998 Selection of peptide aptamers that recognize and inhibit intracellular proteins Ph D Thesis Harvard University Cohen
21. Moreover since amplifying a pool is costly in terms of both time and money any optimization of the PCR should first take place on a small scale The more involved large scale amplification can then be carried out with confidence Materials Purified ssDNA pool PCR primers PCR amplification buffer see recipe containing 1 5 mM Mg dNTP mix dATP dCTP dGTP dTTP UNIT 3 4 Taq DNA polymerase e g New England Biolabs 3 8 NuSieve 3 1 agarose gel Cambrex also see UNIT 2 5 1x TBE buffer APPENDIX 2 dsDNA mass markers e g Invitrogen Thermal cycler Densitometer Additional reagents and equipment for PCR Chapter 15 and agarose gel electrophoresis e g UNIT 2 5 1 Carry out a 100 ul PCR reaction using a 1 50 dilution of synthetic pool oligonu cleotide as template 2 uM primers and PCR buffer with 1 5 mM magnesium Use the manufacturer s suggested quantity of Taq polymerase e g 2 5 U of New England Biolabs Taq in a reaction containing 200 uM each dNTP A suggested temperature regime is 1 cycle 5 min 95 C denaturation 1 min 50 C annealing 20 min 72 C extension 1 to 10 additional cycles 30 sec 95 C denaturation 1 min 55 C annealing 1 min 72 C extension After 4 to 8 cycles of amplification check the length and purity of the amplified DNA on a 3 8 Nu Sieve agarose gel in 1 x TBE buffer e g UNIT 2 5 using dsDNA mass markers Conditions for the initial extension step should mimic
22. Synthetic DNA is of low quality and or stop codons appear in random region as a consequence of library design 3 end of mRNA and or splint have self structure arising from internal complementarity Puromycin terminated linker was not sufficiently 5 phosphorylated Too much salt in the ligation reaction mixture RNA is degraded Ligation failed mRNA display template is degraded No methionines present in library except initiating methionine which is degraded away in lysate Elution buffer not sufficiently denaturing His tag not accessible Product precipitates EDTA EGTA DTT or other chelating agents present in the binding buffer PCR amplification components contaminated with library DNA Library DNA has not been purified away from mRNA displayed proteins or mRNA displayed protein purification buffers are contaminated There are no functional sequences in library Selection step not designed appropriately Repeat synthesis and or careful denaturing PAGE purification to resolve n from n 1 and n 1 oligonucleotides Perform preselection in which mRNA displayed proteins are synthesized at the cassette stage these are purified upon the basis of the presence of both terminal tags and the resulting cDNA is used to construct the full length library see Fig 24 5 3 Redesign mRNA and or splint sequences Repeat 5 phosphorylation optionally with extra enzyme Desalt mRNA splint and linker R
23. This step forces the finest particles through the frit and is especially important with the use of larger amounts of oligo dT cellulose 2 Dilute the 1 3 ml translation reaction containing the mRNA displayed proteins with added KCl and MgCl from Basic Protocol 1 into 8 7 ml of oligo dT binding buffer and incubate with the washed oligo dT cellulose for 15 min at 4 C with rotation Retain an aliquot of the undiluted translation reaction for SDS PAGE and scintillation counting analyses Current Protocols in Molecular Biology 3 Allow the diluted translation reaction mixture and the oligo dT cellulose to pass through a chromatography column so that the oligo dT cellulose is retained on the frit and retain the flowthrough Wash three times with 1 ml oligo dT binding buffer Wash once with 1 ml oligo dT wash buffer Elute three times with 0 5 ml deionized water Sol ON Os oS Analyze the undiluted translation reaction mixture the flowthrough and all of the washes and elutions using Tris tricine SDS PAGE as described in unit 10 2A Alternate Protocol 1 and by scintillation counting The volume of the oligo dT eluate may be reduced by lyophilization by up to a factor of 5 The oligo dT cellulose purification step anneals the poly dA region of the mRNA display template to immobilized oligo dT cellulose Consequently mRNA display templates not displaying protein and other mRNA molecules present in the lysate will co purif
24. collecting tube Since there will still be some amount of liquid retained by the filter and filter holder it is necessary to wash the filter with an equal amount of binding buffer to maximize the collection of non filter binding species Discard the filter Add the protein target and any competitors specific and or nonspecific to the filtrate Allow the binding reaction to equilibrate typically 30 min initially however this time can be reduced when selecting for enhanced binding kinetics In selection experiments that targeted the cytokine bFGF the authors used an equimolar protein to RNA ratio for the first two rounds of selection and decreased it 10 fold after two rounds and 60 fold after another two yielding a functionally enriched pool after six rounds of selection and amplification Table 24 3 1 The final volume of the binding reaction should be from 100 to 200 ul In addition to ensure that the selected RNAs Current Protocols in Molecular Biology Table 24 3 1 Progress of N30 Selection Against bFGF2 Input RNA Input bFGF Round nM nM RNA bFGF bound to protein bound to filter 1 800 760 1 05 2 1 2 3 2 800 760 1 05 3 800 76 10 5 4 800 76 10 5 6 0 4 0 5 800 13 61 5 6 800 13 61 5 17 0 0 4 Pools were assayed in a 50 ul reaction at a concentration of 75 nM in the presence and absence of equimolar protein N30 is a RNA pool with 30 random sequence positions Lato et al 1995
25. it is helpful to hydrate the Centri Sep desalting columns Heat inactivate the kinase in the reaction mixture at 70 C for 10 min and increase the volume to 20 ul with water Apply the diluted kinase reaction directly to the middle of the Centri Sep gel bed and centrifuge 2 min at 450 x g room temperature collecting the flowthrough Perform a phenol chloroform extraction see Basic Protocol 2 steps 13 and 14 Ethanol precipitate the RNA by adding one tenth volume of 3 M sodium acetate 0 3 M final 3 ul of 1 mg ml blue dyed glycogen and 2 5 volumes of 95 ethanol microcentrifuging and washing the pellet with 70 ethanol see Basic Protocol 1 steps 9 and 10 Allow pellet to dry completely Optional To fully purify the radiolabeled RNA pool isolate the transcript by poly acrylamide gel electrophoresis as described in Basic Protocol 1 steps 3 to 8 If this is done the phenol chloroform extractions and the final precipitation of the RNA steps 12 to 13 of this protocol can be omitted While unincorporated radioactive triphosphates can also be removed by gel electrophoresis the authors recommend utilizing the desalting Centri Sep column to limit opportunities for radioactive contamination The chief disadvantages of gel isolation are the time required for sample preparation and the relatively low efficiency of recovery of the radiolabeled RNA pool However since only a small amount of RNA pool is required for the binding assa
26. it is important to have it se quenced in order to ascertain the proportion of the library which is error free and appropriate for the selection If the proportion of library members with insertions deletions or stop codons is too high the library may have to be resynthesized with extra purification steps in corporated at the DNA cassette stage pre se lection see Fig 24 5 3 Alternatively consid erable library quality improvement may result from the careful denaturing PAGE purification of small amounts of the DNA cassettes The various purification steps performed after the initial synthesis of the mRNA dis played proteins should be individually opti mized with assays performed by SDS PAGE to ascertain that the mRNA displayed proteins are still attached to full length mRNA Sub sequent to this a pilot round zero purifica tion should be performed in which the various optimized purification steps are applied se quentially to the same sample Only upon the satisfactory completion of round zero should the large scale translation reaction be made up for the first round of selection round one The various purification steps that form part of each cycle of the selection of mRNA dis played proteins must be assayed by SDS PAGE in order to confirm that the mRNA display template has not become degraded at any stage in the process Both positive and negative controls need to be used to assay the selection step this
27. the volume of the buffer used for the washes should preferentially increase the retention of high affinity binding species relative to low affinity and nonspecific binding species It is generally recommended that the same buffer be used for selection and for wash steps in order to avoid changing the conditions un der which aptamers are selected However the stringency of the selection can potentially be manipulated by changing the buffer used for the wash steps For example if monovalent cation concentrations are limited in the bind ing buffer due to requirements for the stabil ity or activity of a protein target a separate wash buffer that contains a higher salt con centration can be used to challenge captured RNA protein complexes Amplification kits While the authors routinely utilize the kits described in this protocol it goes without say ing that many commercial kits are available for reverse transcription the polymerase chain reaction and in vitro transcription However the kits mentioned specifically in the proto cols above have been found to be very useful in the Aptamer Selection Research Stream of the Freshman Research Initiative at the Uni versity of Texas at Austin The students in this Stream have systematically assessed a variety of commercial kits with a variety of selection conditions The kits were also evaluated with respect to cost ease of use robustness and quality of results For instance the autho
28. tial sequence space Pools that contain fewer than 1 x 10 possible sequences should not be used The most likely sources of low yields and coupling efficiencies are old i e water contaminated synthesis reagents Thus in stead of attempting to amplify an incomplete pool the pool should be resynthesized with Current Protocols in Molecular Biology fresh reagents the old and new pools can then be combined if desired If fresh synthesis reagents do not significantly raise yields then more serious problems such as line or valve blockage may be the cause and the instrument service representative should be contacted The second most common problem is that the base composition of a partially or com pletely random region is skewed Unfortu nately skewing cannot be detected until af ter completion of a large scale amplification Fortunately unless the degree of skewing is extreme it should not seriously affect the out come of a selection Moreover if the degree of skewing is known in advance of a selec tion it can be taken into account when ana lyzing the results of the selection For exam ple Baskerville et al 1995 selected func tional Rex binding elements from a partially randomized pool Despite the fact that the ini tial pool did not contain equimolar represen tation of non wild type bases at partially ran domized positions these authors were able to determine the relative importance of individ ual residue
29. 1 Quantitate DNA by UV absorption assuming that A260 of 1 0 indicates 37 ug ml of single stranded DNA Generation and Use of Also see APPENDIX 3D Combinatorial Libraries 24 2 15 Current Protocols in Molecular Biology Supplement 88 2 Label the 5 end of the 3 PCR primer with y P ATP by preparing the following reaction mixture For a 20 l reaction 2 ul 10x NEB T4 polynucleotide kinase buffer 80 pmol dephosphorylated DNA 5 ends 20 pmol 150 Ci y P ATP 10 U T4 polynucleotide kinase Incubate 60 min at 37 C then stop the reaction by adding 1 ul of 0 5 M EDTA Phenol chloroform and chloroform extract the labeled oligonucleotide see UNIT 2 1A and precipitate by adding one tenth volume of 3 M sodium acetate for a final concentration of 0 3 M and 2 5 volumes of 95 ethanol to precipitate the RNA Mix and incubate at 80 C for 15 min Microcentrifuge 10 to 15 min at maximum speed 4 C to recover the precipitate Wash the pellet with cold 70 ethanol and dry the pellet completely Redissolve the labeled DNA pellet in 20 ul of TE buffer pH 8 0 Also see UNIT 3 10 The authors frequently include 3 ul of a 1 mg ml blue dyed glycogen solution to increase the yield of nucleic acid precipitation and to better visualize the pellet If glycogen would prevent binding to a given target transfer RNA can also be used as a carrier but will obfuscate the quantification of the pool RNA see below The primer concentration
30. 1 g of phosphoramidite be dissolved in 20 ml of acetonitrile to be used in the coupling reaction Applying this constraint along with the combined mass coupling overall correction factor gives the volumes shown in Table 24 2 4 to dissolve 1 g of each phosphoramidite Therefore if equal volumes of each of these solutions are mixed equal molar coupling should occur since the molar concentrations have been adjusted to account for both the mass and coupling differentials This bottle will be referred to as an equiactive N bottle To simplify the mixing of the four doped phosphoramidites bottles it is customary to first resuspend each of the phosphoramidites in the corrected volumes of acetonitrile shown in Table 24 2 4 Equal volumes of these solutions are then mixed to create an equiactive N bottle The doped bottles are then generated by mixing appropriate ratios of the equiactive N solution with individual phosphoramidites solution according to Table 24 2 5 As in the example above if a 10 doped pool is to be synthesized in which non wild type residues are included then for each degenerate nucleotide 1 volume of the equiactive N bottle should be mixed with 6 5 volumes of a given phosphoramidite In addition to varying nucleotide composition it is also possible to vary the length of random sequence that is synthesized Deletions can be stochastically incorporated during a synthesis by replacing the capping step with an a
31. 2 ul 2 ul 2 ul 2 5 M KCl 100 mM lul 1 ul lul lul lul lul 25 mM magnesium acetate 500 uM 0 5 ul 0 5 ul 0 5 ul 0 5 ul 0 5 ul 0 5 ul Water 8 5 ul 9 5 ul 7 5 ul 8 5 ul 7 5 ul 5 5 ul 2 5x rabbit reticulocyte lysate 1x 10 ul 10 ul 10 ul 10 ul 10 ul 10 ul Total 25 ul 25 ul 25 ul 25 ul 25 ul 25 ul Ensure that the rabbit reticulocyte lysate is added last Protein Selection Using mRNA Display 24 5 16 Supplement 53 16 Gel purify ligated mRNA display template by denaturing PAGE uwir 2 12 extract from gel see step 3 and precipitate as in step 4 except use 3 M potassium acetate pH 5 3 in place of 3 M sodium chloride 17 Dissolve the purified ligated mRNA display template in deionized water and measure the concentration by UV visible spectroscopy at 260 nm If the template is lt 500 nucleotides long it should be possible to resolve the ligated and unligated RNA on the PAGE gel which will give some idea of the yield of the ligation reaction Otherwise the unresolved bands will have to be co excised from the gel and optionally further purified using oligo dT cellulose as described below It is important to perform this gel purification even if it is not possible to resolve the ligated and unligated RNA since the presence of the splint in the translation reaction will greatly reduce the yield of displayed proteins and RNase H in the reticulocyte lysate will cause degradation of the mRNA display template if it is an
32. 4 6 and 8 cycles Time Considerations The amount of time required for the proto cols described in this unit should not be under estimated Pool design will take at least 1 day depending on the degree of background re search required It is strongly recommended that pool design be discussed with one or more colleagues prior to synthesis The synthesis of oligonucleotides lt 150 bases in length can be easily accomplished in 1 day allowing 1 hr to ensure proper instrument setup Com mercial synthesis companies are frequently al most as fast but in some cases may take up to two weeks to deliver the pool Pool pu rification and optimization of PCR conditions should take 1 to 2 additional weeks Finally the actual large scale amplification and sub sequent isolation of the dsDNA pool will re quire the researcher s undivided attention for 2 days Acknowledgements The authors would like to thank the initial contributors Jack Pollard and Sabine Bell for their original work We would like to thank the Welch Foundation for their continued sup port Bradley Hall was partially supported by the National Institute of Health and the Freshman Research Initiative at the University of Texas at Austin In addition these meth ods were refined by undergraduate students from the Freshman Research Institute based on generous funding from the National Science Foundation and the Howard Hughes Medical Institute Literature Cited Abd
33. 50 nM final concentration 35 ul 1 M MgCl 50 ul each 100 mM nucleotide triphosphate final 5 mM each NTP 100 ul 10x transcription buffer final 1x Up to 980 ul deionized ultrafiltered water 20 ul 10 U ul T7 RNA polymerase final 200 U ml Incubate the transcription reaction for 3 to 16 hr at 37 C Halt the reaction by cooling on ice or by adding solid EDTA to a final concentration of 50 mM The size of the transcription reaction can be adjusted to give an appropriate amount of RNA but care should be taken to ensure that the diversity of the DNA used is several times larger than the diversity of the displayed proteins that will ultimately result The effect of varying the concentration of MgCl should be explored in pilot transcriptions Purify RNA 2 Purify resultant RNA using denaturing PAGE uwir 2 12 Add solid urea to the transcription reaction to give a final concentration of 5 M and solid EDTA to give a final concentration of 50 mM heat for 2 min at 90 C and load onto a denaturing PAGE gel 3 After the gel has been run visualize by UV shadowing and excise the band containing the purified RNA Extract the RNA into 300 mM NaC by passive elution or into 0 5x TBE buffer in an electroeluter according to the manufacturer s instructions 4 Precipitate the RNA by adding 3 M NaCl final concentration 300 mM and 2 5 volumes of 100 ethanol Cool for 20 min at 80 C or overnight at 20 C 5 Centrifuge for 10 min
34. B A Colas P and Brent R 1998 An artificial cell cycle inhibitor isolated from a com binatorial library Proc Natl Acad Sci U S A 95 14272 14277 Colas P Cohen B Jessen T Grishina I McCoy J and Brent R 1996 Genetic selection of pep tide aptamers that recognize and inhibit cyclin dependent kinase 2 Nature 380 548 550 Colas P Cohen B Ferrigno P Silver P and Brent R 2000 Targeted modification and trans portation of cellular proteins Proc Natl Acad Sci U S A In press Dalton S and Treisman R 1992 Characterization of SAP 1 a protein recruited by serum response factor to the C FOS serum response element Cell 68 597 612 Davidson A R and Sauer R T 1994 Folded protein sequences occur frequently in libraries of ran dom amino acid sequences Proc Natl Acad Sci U S A 91 2146 2150 Durfee T Becherer K Chen P L Yeh S H Yang Y Kilburn A E Lee W H and Elledge S J 1993 The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit Genes Dev 7 555 569 Ellington A D and Szostak J W 1990 In vitro selection of RNA molecules that bind specific ligands Nature 346 818 822 Estojak J Brent R and Golemis E A 1995 Correlation of two hybrid affinity data with in vitro measurements Mol Cell Biol 15 5820 5829 Fabbrizio E Le Cam L Polanowski J Kaczorek M Lamb N Brent R and Sardet C 1999
35. C is usually impractical since this greatly reduces Taq s half life While other thermostable polymerases can be more resistant to higher temperatures they usually have a lower extension efficiency and are more ex pensive than Taq Annealing temperatures are dependent upon both primer sequence and length The primer annealing temperatures should already be known from the primer design process or may be calculated via an algorithm that can be found at http idtdna com analyzer Applications OligoAnalyzer This algorithm takes into ac count nucleotide composition stacking energies according to Turner s rules and em pirical data An annealing temperature 5 C less than the calculated annealing tem perature is a good place to begin optimization The amplification is more efficient at a lower annealing temperature but mispriming and secondary structure problems are more pronounced Higher temperatures improve the specificity but decrease the over all yield of the reaction To determine the optimum annealing temperature for a given primer and magnesium concentration one should scan in both directions around the annealing temperature in 5 C increments Finally extension temperatures are modulated by the properties of Taq which will extend although inefficiently at temperatures as low as 65 C When extending at temperatures above Taq s optimum temperature 70 to 75 C somewhat more polymerase may be required scanning of the enzyme q
36. DNA recognition sequences New Biol 3 1005 1013 Katti S K LeMaster D M and Eklund H 1990 Crystal structure of thioredoxin from Es cherichia coli at 1 68A resolution J Mol Biol 212 167 184 Kolonin M G and Finley R L Jr 1998 Targeting cyclin dependent kinases in Drosophila with peptide aptamers Proc Natl Acad Sci U S A 95 14266 14271 Lam K S Salmon S E Hersch E N Hruby V J Katzmierski W M and Knapp R J 1991 Anew type of synthetic peptide library for identifying ligand binding activity Nature 354 82 84 LaVallie E R Diblasio E A Kovacic S Grant K L Schendel P F and McCoy J M 1993 A thioredoxin gene fusion expression system that circumvents inclusion body formation in the E coli cytoplasm Bio Technology 11 187 193 Lu Z Murray K S Van Cleave V LaVallie E R Stahl M L and McCoy J M 1995 Expression of thioredoxin random peptide libraries on the Escherichia Coli cell surface as functional fu sions to flagellin a system designed for explor ing protein protein interactions Biotechnology 13 366 372 Mitchison T J 1994 Towards a pharmacological genetics Chem Biol 1 3 6 Neuner P Cortese R and Monaci P 1998 Co don based mutagenesis using dimer phos phoramidites Nucl Acids Res 26 1223 1227 Norman T C Smith D L Sorger P K Drees B L O Rourke S M Hughes T R Roberts C J Friend S H Fields S and Murray A
37. DNA templates Nucl Acids Res 15 8783 8798 Oliphant A R and Struhl S 1989 An effi cient method for generating proteins with al tered enzymatic properties application to beta lactamase Proc Natl Acad Sci 86 9094 9098 Oliphant A R Brandl C J and Struhl K 1990 Defining the sequence specificity of DNA binding proteins by selecting binding sites from random sequence oligonucleotides Analysis of yeast GCN4 protein Mol Cell Biol 9 2944 2949 Pan W and Clawson G A 2008 Catalytic DNAzymes Derivations and functions Expert Opin Biol Ther 8 1071 1085 Current Protocols in Molecular Biology Pan W and Clawson G A 2009 The shorter the better Reducing fixed primer regions of oligonucleotide libraries for aptamer selection Molecules 14 1353 1369 PerSeptive Biosystems 1998 Expedite Nucleic Acid Synthesis System User s Guide PerSep tive Biosystems Framingham Mass Piasecki S K Hall B and Ellington A D 2009 Nucleic acid pool preparation and characteriza tion Methods Mol Biol 535 3 18 Piganeau N 2009 In vitro selection of allosteric ribozymes Methods Mol Biol 535 45 57 Reese C B 2005 Oligo and poly nucleotides 50 years of chemical synthesis Org Biomol Chem 3 3851 3868 Sabeti P C Unrau P J and Bartel D P 1997 Accessing rare activities from random RNA sequences The importance of the length of molecules in the starting pool Chem Biol 4 767 7
38. Fig 24 5 3 FLAG and His tag sequences are obvious choices Protein Selection Some constant amino acid sequence is likely to result from the ligation junctions used to Using mRNA construct libraries from synthetic DNA with long random regions the identity of these Display 24 5 6 Supplement 53 Current Protocols in Molecular Biology Step Product Oligo dT cellulose Protein library displayed onr purification upon mRNA display ANASA o oO yi templates Free mRNA display ORF ind aes templates PSS AS AS Ny Any As Ay Ay Ag Reticulocyte lysate mRNA Protein affinity tag such as Protein library displayed ORF FLAG or Hisg purification upon mRNA display A N SASANN e templates Reverse transcription with Protein library displayed ORF the splint as primer upon reverse transcribed AAAA mRNA display templates 7 Selection step Selected members of the ald 3 ORF protein library displayed gt f ADDAADAS upon reverse transcribed gt TlH mRNA display templates PCR amplification of selected fraction of library Repeat procedure from the start until the proportion of the library detected in the selected fraction has peaked or reached a plateau at which point the library should be sequenced and individual members should be assayed for activity Input dsDNA library for the next cycle of selection and amplification Individual functional proteins that pass the selection tes
39. Glu CM His Ura Trp Leu 10 cm plates Gal Raf CM His Ura Trp liquid medium Gal Raf CM His Ura Trp Leu 10 and 15 cm plates 100 mM and 1 M lithium acetate pH 7 5 filter sterilized 50 w v polyethylene glycol mol wt 3350 PEG 3350 Sigma 2 mg ml single stranded carrier DNA sodium salt Type III from salmon testes Sigma TE buffer APPENDIX 2 40 ug ml peptide aptamer library DNA pJM 1 aptamer plasmid see Basic Protocol 1 Current Protocols in Molecular Biology 2x glycerol storage solution 65 v v glycerol 0 1 M MgSO 25 mM Tris Cl pH 7 4 APPENDIX 2 10 cm Xgal plates UNIT 13 1 Glu CM His Ura Trp Xgal Gal Raf CM His Ura Trp Xgal PCR primers for thioredoxin 30 and 42 C incubators or water baths Additional reagents and equipment for subcloning DNA unrT 3 16 manipulating yeast UNIT 13 2 lithium acetate yeast transformation UNIT 13 7 characterizing bait plasmids UNIT 20 1 determination of cell density UNIT 13 2 and plating efficiency UNIT 20 1 replica plating UNITS 1 3 amp 13 2 yeast plasmid preparation UNIT 13 11 plasmid sequencing UNIT 7 3 E coli transformation UNIT 1 8 agarose gel electrophoresis UNIT 2 54 and PCR UNIT 15 1 Construct bait plasmid pBait 1 Using standard subcloning techniques UNIT 3 16 insert DNA that codes for the bait protein into the polylinker of pEG202 to create the bait plasmid pBait 2 T
40. Inhibition of mammalian cell proliferation by genetically selected peptide aptamers that func tionally antagonize E2F activity Oncogene 18 4357 4363 Finley R L Jr and Brent R 1994 Interaction mat ing reveals binary and ternary connections be tween Drosophila cell cycle regulators Proc Natl Acad Sci U S A 91 12980 12984 Finley R L and Brent R 1997 Understanding gene and allele function with two hybrid methods Annu Rev Genet 31 663 704 Geyer C R and Brent R 2000 Selection of ge netic agents from random peptide aptamer ex pression libraries Methods Enzymol 328 171 208 Geyer C R Colman Lerner A and Brent R 1999 Mutagenesis by peptide aptamers identifies genetic network members and pathway connec tions Proc Natl Acad Sci U S A 96 8567 8572 Gietz R D and Schiestl R H 1995 Transforming yeast with DNA Methods Mol Cell Biol 5 255 269 Gorbsky G J Chen R H and Murray A W 1998 Microinjection of antibody to Mad2 protein into mammalian cells in mitosis induces premature anaphase J Cell Biol 141 1193 1205 Gyuris J Golemis E Chertkov H and Brent R 1993 Cdil a human G1 and S phase protein phosphatase that associates with Cdk2 Cell 75 791 803 Herskowitz I 1987 Functional inactivation of genes by dominant negative mutations Nature 329 219 222 Kamens J and Brent R 1991 A yeast transcription assay defines distinct REL and Dorsal
41. Molecular Biology Directed Evolution of Proteins In Vitro Using Compartmentalization in Emulsions Eric A Davidson Paulina J Dlugosz Matthew Levy and Andrew D Ellington University of Texas at Austin Austin Texas Albert Einstein College of Medicine Bronx New York ABSTRACT This unit describes a protocol for the directed evolution of proteins utilizing in vitro compartmentalization This method uses a large number of independent in vitro tran scription and translation IVTT reactions in water droplets suspended in an oil emulsion to enable selection of proteins that bind a target molecule Protein variants that bind the target also bind to and allow recovery of the genes that encoded them This protocol serves as a basis for carrying out selections in emulsions and can potentially be modified to select for other functionalities including catalysis This selection method is advan tageous compared to alternative selection protocols due to the ability to screen through very large size libraries and the ability to express and screen or select for functions that would otherwise be toxic or inaccessible to in vivo selections and screens Curr Protoc Mol Biol 87 24 6 1 24 6 12 2009 by John Wiley amp Sons Inc Keywords directed evolution e in vitro compartmentalization e emulsion Directed evolution e g generation of a diverse initial library of molecules followed by selection for a desired function typicall
42. Molecular Biology Generation and Use of Combinatorial Libraries 24 2 23 Supplement 88 DNA Pools for In Vitro Selection 24 2 24 Supplement 88 REAGENTS AND SOLUTIONS Use deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 Denaturing dye 2x TBE buffer APPENDIX 2 containing 0 1 w v bromphenol blue 7 M urea Store up to 6 months at 20 C PCR amplification buffer 10x 500 mM KCl 100 mM Tris Cl pH 8 3 APPENDIX 2 x mM MgCl 0 1 w v gelatin Store in aliquots at 20 C This solution can be sterilized by autoclaving Alternatively it can be made from sterile water and stock solutions and the sterilization omitted 15 mM MgCl in the 10x buffer is the concentration x used for most PCR reactions However the optimal concentration depends on the sequence and primer of interest and may have to be determined experimentally COMMENTARY Background Information As early as 1955 researchers began de veloping methods to chemically synthesize oligonucleotides Michelson and Todd 1955 Modern synthetic procedures utilizing phos phoramidite chemistry and solid phase sup ports were developed and refined during the 1970s and early 1980s Beaucage and Caruthers 1981 The synthetic procedure has been reviewed extensively Beaucage and Tyer 1992 Brown 1993 Iyer and Beaucage 1999 Reese 2005 Curr
43. NOTE All solutions and buffers should be made with deionized water 18 2 MQ re sistivity filtered through 0 2 um polyethersulfone PES membrane and sterilized by autoclaving Use sterile disposable plasticware and micropipet tips with filter barriers where possible See Chapter 4 introduction and unr 4 1 for guidelines on standard meth ods to protect against contaminating RNases If ribonuclease contamination is found to occur it may be eliminated by treating water with diethylpyrocarbonate DEPC see UNIT 4 1 Reverse transcribe the selected binding species into ssDNA The reverse transcription RT and PCR amplification should be performed in separate steps so that the accumulation of DNA during a cycle course can be evaluated 1 Resuspend the RNA in 13 ul TE buffer or RNase free water and set up the following 20 ul RT reactions 8 5 ul RNA suspension 2 0 ul 200 uM 3 end primer 2 5 ul 4 mM dNTP mix Perform the following controls in parallel with the amplification of selected RNA species in order to detect nonspecifically bound RNA species and replication parasites see Critical Parameters for discussion of parasites a No template control To ensure that none of the stock solutions have been con taminated with exogenous RNA or DNA amplicons set up an RT PCR reaction without adding any template b No RT control To ensure that amplified products are in fact derived from selected RNA species and not from endogenous or cro
44. Protocol 1 An a 32 P Jnucleoside triphosphate e g 0 5 ul a P GTP GE Healthcare Life Sciences in a 20 ul total volume can be included in the reaction mixture in addition to all the other reagents Varying the proportion of hot to cold nucleoside triphosphates can control the specific activity of the RNA pool Since the overall yield of the transcription reaction will generally be important the specific activity of the nucleoside triphosphate mixture should be varied by increasing the amount of radioactive nucleotide added rather than by decreasing the amount of unlabeled nucleotide present Again commercial transcription kits can be obtained that are geared towards the incorporation of labeled nucleoside triphosphates RiboScribe Epicentre Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 3 3 Supplement 88 Selection of RNA Aptamers 24 3 4 Supplement 88 2 In order to remove DNA from the transcription reaction after the transcription incubation has been completed add 1 ul of RNase free DNase I from the Epicentre kit per 20 ul reaction and incubate for 25 min at 37 C Because individual members of the double stranded DNA library can potentially bind nonspecifically to either the target or to the selection matrix and subsequently be amplified the DNA template should be removed from the transcription reaction according to this step prior to proceeding
45. Protocols in Molecular Biology EGY42 and the peptide aptamer preys into EGY48 Mating EGY48 with EGY42 and scor ing interactions between the peptide aptamer preys and baits takes an additional week Basic Protocol 4 Affinity maturation of peptide aptamers takes 3 4 weeks The mu tagenesis of the peptide aptamer and sub sequent cloning into pJM 1 prey vector takes week Isolation of mutant aptamers that interact with the bait protein using the interac tion trap with a more stringent lacZ reporter takes 3 weeks as described above in Basic Protocol 2 Basic Protocol 5 Construction of the thiore doxin peptide aptamer library pJM 2 or pJM 3 takes 1 week as described in Basic Protocol 1 The time required to isolate peptide aptamers that disrupt a cellular process varies depending on the organism and selection or screen used Before the targets of the peptide aptamers can be identified it is necessary to transfer the thioredoxin peptide aptamers from the expres sion vector used in the screen pJM 2 or pJM 3 to the bait plasmid pEG202 This transfer takes 1 week Identification of the peptide aptamer target s using the interaction trap mat ing Basic Protocol 2 or cDNA or genomic library unrr 20 1 hunts takes 4 weeks References Bai C and Elledge S J M 1996 Gene identifica tion using the yeast two hybrid system Methods Enzymol 273 331 347 Blum J H Dove S L Hochschild A and Mekalanos J J 2000
46. Selection protein ae remove filter binding RNAs Basic Protocol 2 steps 3 5 aA To lt i a aH Isolation and Amplification reverse transcription PCR in vitro 2437 transcription lecti oe AA S selection Basic Protocol 3 Bonin Incubation 7 Basic Protocol 2 step 6 Km Nb l 4 o Filter Immobilize Basic Protocol 2 steps 7 8 7 my N S Elute Bound Species Basic Protocol 2 steps 10 12 B save dsDNA a on pE samples D at oN Ai assay for clone binding affinity sequence Figure 24 3 1 Selection of RNA Aptamers ee 24 3 2 Supplement 89 Steps involved in in vitro selection of RNA aptamers provided here are specific for the isolation of nucleic acid pools As is the case for the original amplification of DNA pools UNIT 24 2 many of the procedures described here can potentially lead to the cross contamination of different RNA selection experiments or different generations of the same selection experiment To avoid cross contamination it is wise to always use barrier tips and to use disposable plastic Pasteur pipets rather than automatic micropipettors for large volume transfers Materials Double stranded DNA pool UNIT 24 2 High Yield AmpliScribe T7 In Vitro Transcription Kit Epicentre 8 polyacrylamide denaturing gel see recipe and UNIT 2 12 2x denaturing dye see recipe Current Protocols in Molecular Biology TBE buffer APPENDIX
47. Ura Trp Leu plates 30 Incubate at 30 C and monitor plates daily for growth 31 Streak colonies onto 10 cm Glu CM His Ura Trp master plates Incubate 1 to 2 days at 30 C Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 4 9 Supplement 52 BASIC PROTOCOL 3 Peptide Aptamers 24 4 10 Supplement 52 32 Replica plate the master plates on the following indicator plates Glu CM His Ura Trp Leu Gal Raf CM His Ura Trp Leu Glu CM His Ura Trp Xgal Gal Raf CM His Ura Trp Xgal 33 Identify colonies that show galactose dependent growth on Leu plates and galac tose dependent blue color on Xgal plates Isolate peptide aptamers 34 Isolate the desired peptide aptamer expression plasmid UNIT 13 11 The plasmid preparation will contain a mixture of the three plasmids used in the interaction trap pJM 1 aptamer plasmid pSH18 34 and pBait 35 Use plasmids as templates for sequencing the peptide aptamer variable regions UNIT 7 3 36 To separate the aptamer plasmid from pBait and pSH18 34 transform E coli UNIT 1 8 and identify the appropriate transformants by PCR unir 15 1 using primers that amplify thioredoxin Colonies that contain the peptide aptamer will appear as a bright band on an ethidium bromide agarose gel UNIT 2 5A after 20 cycles of PCR Colonies that do not contain the peptide apta
48. W 1999 Genetic selection of peptide inhibitors of biological pathways Science 285 591 595 Scott J K and Smith G P 1990 Searching for peptide ligands with an epitope library Science 249 386 390 Sidhu S S and Weiss G A 2000 Constructing phage display libraries by oligonucleotide di rected mutagenesis In Phage Display A Practi cal Approach T Clackson and H B Lowman eds In press Oxford University Press Oxford Current Protocols in Molecular Biology Thomas M Chedin S Carles C Riva M Fa mulaok M and Sentenac A 1997 Selective targeting and inhibition of yeast RNA polym erase II by RNA aptamers J Biol Chem 272 27980 27986 Virnekas B Ge L Pluckthun A Schneider K C Wellnhofer G and Moroney S E 1994 Trinu cleotide phosphoramidites Ideal reagents for the synthesis of mixed oligonucleotides for ran dom mutagenesis Nucl Acids Res 23 5600 5607 Vojtek A B Hollenberg S M and Cooper J A 1993 Mammalian Ras interacts directly with the serine threonine kinase Raf Cell 74 205 214 West R W Jr Yocum R R and Ptashne M 1984 Saccharomyces cerevisiae GAL1 GAL10 diver gent promoter region Location and function of the upstream activator sequence UASG Mol Cell Biol 4 2467 2478 Wetterauer B Veron M Miginiac Maslow M Decottignies P and Jacquot J P 1992 Bio chemical characterization of thioredoxin 1 from Dictyostelium discoideum Eur J
49. after this step should be 4 uM The volume of the reaction and the concentration of DNA and y P ATP will vary depending on application This procedure ensures that most of the unincorporated label remains in the supernatant In addition a desalting column can be employed to ensure complete removal of unincor porated label prior to the phenol chloroform extraction 3 In two separate reactions incubate 10 pmol of labeled primer with or without a 10 fold molar excess of pool in a 30 1 extension reaction in 1 x PCR amplification buffer under the same conditions that will be used in the final amplification in a thermal cycler as follows see e g UNIT 15 1 for PCR a Denature and anneal the primer and template DNA in 1x PCR amplification buffer Typical thermal cycling conditions include denaturation at 94 C for 5 min annealing at 50 C for 1 min and extension at 72 C for 20 min More commonly referred to as a Taq extension assay this procedure is one cycle of PCR with a long extension step b Finally terminate the reaction by the addition of an equal volume of 2 x denaturing dye 4 Heat the extension reaction to 90 C for 3 min and load the reaction on a 15 cm x 17 cm x 0 75 mm denaturing polyacrylamide gel Electrophorese until the dye is at or near the bottom of the gel but do not let the radiolabeled primers run off Also see UNIT 2 12 It is also useful to load a separate well with an aliquot of the primer alone to
50. and assembly of filter holder used during selection Pop top graphic adapted with permission from Whatman product sheet 4 Load the binding buffer onto the filter Place the micropipet tip just above the filter to avoid the formation of any bubbles Lock a 5 ml syringe to the top of the filter holder and apply gentle pressure to force the liquid out of the filter holder and into a collecting tube If the syringe plunger does not regain position when pressure is removed there is likely a leak in the filter It should be removed and replaced with another filter Prior to filtering the RNA it is important to wash the nitrocellulose filter disk with binding buffer and check for leaks in the assembled filter holder The syringe should form a tight seal with the filter holder The pressure applied should be just enough to force the liquid through without rupturing the membrane Formation of foam at the bottom of the filter holder or the presence of a hissing sound when pressure is applied indicates that the pressure is too high and the integrity of the seal or the membrane may have been breached Test for leaks every time the filter holder is assembled to avoid substantial loss of sample Load the RNA solution onto the filter Place the micropipet tip just above the filter to avoid the formation of any bubbles Lock a 5 ml syringe to the top of the filter holder and apply gentle pressure to force the liquid out of the filter holder and into a
51. are the same Within nucleic acid selections large libraries i e up to 10 different molecules are sub Current Protocols in Molecular Biology jected to successive cycles of selection and amplification until functional sequences domi nate the library at which point they may be identified by cloning and sequencing The idea of extending the in vitro selection approach to proteins was an obvious one what was not obvious however was how to extract the se quence information from selected proteins in order to permit their amplification and ulti mately their identification One way to extract the sequence information from selected proteins is to covalently attach each of them to the mRNA sequence that en codes it Roberts and Szostak 1997 Roberts Generation and Use of Combinatorial Libraries 24 5 29 Supplement 53 Protein Selection Using mRNA Display 24 5 30 Supplement 53 1999 Roberts and Ja 1999 In this manner the function phenotype and amplifiable sequence information genotype are part of the same molecule Selection may be performed upon the basis of the function of the protein while the protein may be amplified upon the basis of the mRNA that encodes it and is attached to it The problem was how to arrange things so that proteins may be attached to the mRNA that encodes them in parallel while mixed within one reaction mixture The molecule that makes this possible is puromycin Fi
52. at 12 000 x g 4 C Decant the supernatant wash the pellet with 70 ethanol dry under reduced pressure bring up to 0 5 ml with deionized ultrafiltered water and measure the concentration by UV visible spectroscopy at 260 nm Further instructions may be found in UNIT 2 12 This purification step separates truncated RNA molecules and PCR primers from the full length RNA transcripts It is important to remove the PCR primers from the transcribed RNA since they will inhibit the formation of the mRNA displayed proteins in the translation step Synthesize linker 6 Synthesize the linker a DNA oligonucleotide 3 terminated in puromycin that is 30 nucleotides long and unstructured e g according to one of the following exam ples see unr 2 11 for oligonucleotide synthesis Example a AAAAAAAAAAAAAAAAAAAAAAAAAAACCP Poly dA is the most obvious choice Example b AAAAAAAAAAAAAAAAAAAAAS99ACCP In example b 9 is phosphoramidite spacer 9 Glen Research and P is puromycin derived from CPG puromycin Glen Research This linker may give a higher yield of displayed proteins Current Protocols in Molecular Biology 7 8 Linkers much longer or shorter than 30 nucleotides will give greatly reduced yields of displayed proteins or none at all The puromycin terminated DNA oligonucleotide is gel purified by denaturing PAGE UNIT 2 12 extracted from the gel and precipitated as described earlier Dissolve t
53. be used to successfully remove filter binding species that have begun to accumulate and overrun a selected population However once filter binding species have established themselves even a combination of pre and post selection filtrations may not allow specific binding species to regain a selective advantage If a simple regime of pre and post filtration negative selections does not succeed in drastically reducing or eliminating established filter binding species the selection should be repeated with a different RNA pool that can be amplified with different primers as recommended above 17 Resuspend the selected RNA pellet in 50 ul binding buffer 18 Assemble the filter holder with a fresh filter disk as described above 19 Filter the sample and wash as described above 20 Discard the filter disk and ethanol precipitate the RNA filtrate as described in step 12 A carrier glycogen see step 12 can be added to improve the efficiency of precipitation If the binding buffer contains a high gt 0 5 M salt concentration dilute the filtrate with an equal volume of RNase free water and precipitate with isopropanol instead see step 15 AMPLIFYING SELECTED PROTEIN BINDING RNA SPECIES In the following steps RNA species that survived the positive and negative selection steps are reverse transcribed to generate a cDNA library which is subsequently amplified by PCR The double stranded DNA resulting from these steps comprises the pool fr
54. by assaying the affinity of the radiolabeled RNA pool for the protein target after several rounds of selection see Support Protocol 3 These steps are then repeated until a significant increase in binding is observed or until the diversity of the pool has been completely plumbed The procedure is summarized in Figure 24 3 1 TRANSCRIPTION AND ISOLATION OF RNA POOLS The following protocol describes the preparation of the RNA pool to be used for selection Starting from the dsDNA pool the RNA is transcribed and purified by denaturing poly acrylamide gel electrophoresis Recovery of the RNA from the gel is followed by ethanol precipitation of the RNA Additional instructions can be found in unr 3 8 The directions Current Protocols in Molecular Biology 24 3 1 24 3 27 October 2009 Published online October 2009 in Wiley Interscience www interscience wiley com DOI 10 1002 047 1142727 mb2403s88 Copyright 2009 John Wiley amp Sons Inc UNIT 24 3 BASIC PROTOCOL 1 Generation and Use of Combinatorial Libraries Ss 24 3 1 Supplement 89 Monitor Progress after 5th and Wash every 3rd round remove unwashed pool Support Protocol 3 Basic Protocol 2 step 9 initial pool of NIT dsDNA UNIT 24 2 Transcription Gel Isolation Basic Protocol 1 pool of assay for RNA binding affinity End Labeling Support Protocol 2 Random tt Library prepare 10 S or more sequences Basic Bie steps 1 2 Negative
55. column or by phenol chloroform extraction Ligate random peptide cassette in thioredoxin expression vector 18 Combine 8 ug DNA cassette step 13 and 12 ug vector step 17 in water to a total volume of 860 ul 19 Add 100 ul of 10x T4 DNA ligase reaction buffer and 40 ul 80 000 U T4 DNA ligase Incubate 16 hr at 16 C 20 Purify ligated DNA using a QIAquick gel extraction kit according to manufacturer s instructions Elute DNA from the column using 30 ul ultrapure water It is important to remove as much salt buffer and protein from the ligated DNA as possible prior to electroporation Electroporate ligated DNA 21 Thaw 350 ul electroporation competent E coli MC1061 on ice and add 30 ul purified ligated plasmid Transfer mixture to a 0 2 cm gap electroporation cell 22 Electroporate using the following conditions 2 5 kV 200 Q and 25 UF 23 Recover cells in 25 ml prewarmed SOC medium and incubate 1 5 hr at 37 C with gentle rocking 24 Determine transformation efficiency by plating serial dilutions on LB plates contain ing 50 ug ml ampicillin 25 Transfer remaining cells to 1 liter LB liquid medium containing 50 ug ml ampicillin and incubate overnight at 37 C 26 Purify plasmid DNA using a commercially available large scale plasmid preparation kit or using successive ethidium bromide CsC l gradients unr 2 4 Determine con centration and bring to 40 ug ml for screening Basic Protocol 2 ISOLATION OF PEPTIDE
56. completely random pool the length of the random region While this parameter is considered in detail below we must first dismiss a frequent bogey of selection neophytes the issue of complexity and representation Random sequence space is a vast landscape of possibilities of which only a vanishingly small fraction can be sampled by either nature or man Assuming a 4 monomer repertoire from which pools can be constructed there are 1 6 x 10 unique individual sequences in a sequence space bounded by a 100 residue template 41 1 6 x 10 a quantity of nucleic acid greater than an Avogadro s number of Earth masses While this grotesquely large value is clearly beyond the realm of experimental possibility modern methods of chemical nucleic acid synthesis do allow the sampling of nearly as much sequence information as may be contained in the Earth s biosphere As a back of the envelope calculation consider that there are on the order of 1 x 10 species in the biosphere each with 1 x 10 genes If each of these genes in turn is composed of 1 x 10 residues then there are 1 x 10 residues worth of information in a biosphere In contrast a typical 1 umol synthesis of a 100 residue random sequence pool would contain 1 x 10 molecules x 1 x 10 residues molecule 1 x 10 7 unique residues or roughly 1 biosphere s worth of information Obviously the connection and ordering of sequence information in organisms is important as well
57. complexes sub sequent extractions and another precipitation step take another 2 hr The amount of time needed to see a DNA product varies accord ing to the number of PCR cycles needed to amplify the pool to a certain amount and that number is inversely related to the abundance of target binding species that survived the se lection Nevertheless the RT PCR steps fol lowed by precipitation of the DNA templates that can be added to the transcription mix should consume 3 to 4 hr The amount of time it takes to carry out the entire selection is contingent upon the number of rounds needed to accumulate target binding species That number in turn varies depend ing upon the initial affinity of the unselected pool for the target and on the stringency with which each round of the selection is carried out When additional steps such as radiolabel ing and assaying unselected and selected pools are taken into account an entire selection ex periment can take up to 2 to 3 weeks It is for this reason that the authors have recently de veloped automated methods for selection ex periments Cox et al 1998 that can speed the entire process by an order of magnitude Acknowlegements The authors would like to thank the initial contributor Sulay D Jhaveri for his original work We would like to thank the Welch Foun dation for their continued support Bradley Hall was partially supported by the National Institute of Health and the Freshm
58. cycles required to purify high affinity species can be traded for the assurance that filter binding species will not accumulate and predominate A variety of parameters can be modulated to increase or decrease the stringency of a se lection experiment These parameters should initially be chosen based on the results of Sup port Protocol 2 which assays the affinity of the pool for the target and should be made pro gressively more stringent based on the results of Support Protocol 3 Current Protocols in Molecular Biology The amount of protein target The more protein there is to bind the easier it is to capture nucleic acid binding species Using low amounts of protein increases competition among binding species However the amount of protein target available to researchers is usually limited and thus it is easier to use a set amount of protein usually from 0 1 to 10 0 uM per binding reaction and to vary the RNA protein ratio RNA protein ratio By increasing the ra tio of pool to target more binding species will compete for a smaller number of targets Typically after a few initial rounds with an equimolar pool to target ratio the ratio is in creased to between 10 1 and 100 1 This in crease can be effected either by increasing the amount of RNA or by decreasing the amount of protein Because of the underlying competi tion between specifically binding species and nonspecifically binding species increasing the amount o
59. described are shown in Figure 24 2 2 Current Protocols in Molecular Biology Chemically Synthesizing the Pool While pools of genomic DNA sequences have been used for selection Singer et al 1997 partially or completely random sequence pools must be chemically synthesized Mod ern DNA synthesizers utilize phosphoramidite chemistry UNIT 2 11 or H phosphonate chemistry Stromberg and Stawinski 2004 and can routinely produce usable amounts of DNA up to 150 nucleotides in length Longer oligonucleotides can also be synthesized but products of side reactions such as branching and depurination accumulate throughout the synthesis and the amount of final usable product recovered can be vanishingly small Since stepwise coupling efficiencies for a long oligonucleotide are on average gt 98 the typical yield of a 100 base synthesis that starts with a 1 umol column is 13 5 or 13 5 nmol or 1 x 10 different molecules of which 10 to 30 can be enzymat ically elongated or amplified Several strategies can be used to enhance the synthetic yield of oligonucleotides that are longer than 100 bases see unr 2 11 Further if a pool longer than 150 nucleotides is desired smaller pools can be modularly synthesized and coupled by ligation or mutually primed synthesis see discussion of completely random pool design above Deciding on commercial synthesis With the advent of oligonucleotide synthesis companies such as IDT Sigma and Invitro
60. describes methods to construct and use thioredoxin peptide aptamers as genetic agents for the analysis of cellular processes The interaction trap two hybrid system UNIT 20 1 is used to isolate peptide aptamers that interact with specific proteins reverse analysis and to identify the proteins targeted by aptamers forward analysis Basic Protocol 1 describes the construction of a combinatorial library of thioredoxin peptide aptamers The peptide aptamers consist of a conformationally constrained twenty amino acid peptide displayed from the active site of thioredoxin The peptide aptamers are subcloned into one of the pJM yeast expression vectors shown in Figure 24 4 1 depending on whether they are used for reverse or forward analysis Basic Protocol 2 describes a yeast based in vivo screening method to obtain peptide aptamers for reverse analysis of cellular processes Combinatorial libraries of peptide aptamers are screened for interactions with a specific protein using the interaction trap two hybrid system UNIT 20 1 The peptide aptamer is expressed as a fusion to a transcrip tion activation domain referred to as the prey The target protein is expressed as a fusion to a LexA DNA binding domain referred to as the bait DNA binding sites for the LexA fusion protein are located upstream of the two reporter genes Leu2 CD8 and lacZ Interaction between a peptide aptamer prey and the bait protein are detected by activation of th
61. e g SigmaPlot and obtain a value for the aggregate parent dissociation constant Within the SigmaPlot program fit the curve using the equation y m mo mp m2 where y the fraction of RNA bound mo concentration of unbound protein m the extrapolated activity of the RNA at an infinite protein concentration maximal value of fraction bound and mz the apparent dissociation constant The apparent K4 is equal to the concentration of unbound protein at half the maximal value of fraction bound ISOLATING A FUNCTIONALLY ENRICHED POOL OF RNA In the following protocol the RNA pool is partitioned to isolate those species that bind to the target protein and not to the filter RNAs that are coimmobilized with the target are eluted from the filter under denaturing conditions and subsequently isolated and amplified Materials RNA pool see Basic Protocol 1 Binding buffer see Critical Parameters Elution buffer see recipe 3 M sodium acetate APPENDIX 2 70 and 95 ethanol 25 24 1 phenol chloroform isoamyl alcohol saturated with 10 mM Tris Cl pH 8 0 1 mM EDTA unir 2 14 ice cold optional Chloroform optional Isopropanol optional 65 to 75 C 95 C and 100 C heat blocks with appropriate bore sizes for the microcentrifuge tube 13 mm Nuclepore Pop Top or Swin Lok Filter holders Whatman 13 mm 0 45 um HAWP nitrocellulose disk filters Millipore 5 ml syringe Vacuum manifold Sterile forceps Current Pr
62. en optimize 2 Eo amplification J composition e Figure 24 2 1 Flowchart outlining pool design synthesis and large scale amplification T7promotor T7promotor 5 GCTAATACGACTCACTATAGGGAGATCACT Styl Aval 5 GCTAATACGACTCACTATAGGGAGATCACTTACGGCACC Nx CCAAGGCTCGGGACAGCG 3 5 GATAATACGACTCACTATAGGGAATGGATCCACATCTACGA 5 GGGAATGGATCCACATCTACGAATTC N30 TTCACTGCAGACTTGACGAAGCTT 3 Banl LLID Y DIDL LD I G Pstl Hindlll BamHI EcoRI WWOLOVWODLOLOVWOLOOLLODWW S Figure 24 2 2 Two examples of pools used in in vitro selection Primers are shown above and below the sequence of the pool The T7 promoter is delineated in bold Restriction sites are underlined with their enzymes listed DNA Pools for In Vitro Selection 24 2 2 Supplement 88 Current Protocols in Molecular Biology Table 24 2 1 Selection Experiments with Different Types and Sizes of Pools Target DNA RNA Length of random region Reference Bacteriophage T4 RNA 8 Tuerk and Gold 1990 DNA polymerase HIV 1 Rev RNA 66 doped 65 wild type Bartel et al 1991 30 non wild type 5 deleted Ribozyme RNA 120 Bartel and Szostak 1993 HIV 1 Rev RNA 30 Tuerk and MacDougal Waugh 1993 HIV 1 Rev RNA 4 and 6 segmental 6 9 and Giver et al 1993 6 9 segmental PKCB RNA 120 Conrad et al 1994 HTLV 1 Rex RNA 43 doped 70 wild type Baskerville et al 1995 30 non wild type
63. entire pathway from DNA template containing a protein coding gene and the necessary regu latory sequences to initiate transcription and translation to protein can be recapitulated ex vivo These methods have served as the basis for selecting proteins from libraries one of which is described in this unit In addition emulsion methods can be used for Current Protocols in Molecular Biology 24 6 1 24 6 12 July 2009 Published online July 2009 in Wiley Interscience www interscience wiley com DOI 10 1002 047 1142727 mb2406s87 Copyright 2009 John Wiley amp Sons Inc UNIT 24 6 BASIC PROTOCOL Generation and Use of Combinatorial Libraries 24 6 1 Supplement 87 Directed Evolution of Proteins In Vitro 24 6 2 Supplement 87 the selection of functional ribozymes Agresti et al 2005 Levy et al 2005 Zaher and Unrau 2007 In general individual proteins or ribozymes can be expressed in individual com partments by distributing genes within stable aqueous microdroplets such that the gene microdroplet ratio is less than 1 1 While this method is functionally similar to traditional bacterial cloning schemes with the aqueous compartments serving as artificial cells there can be around 10 unique compartments per milliliter of oil phase which is larger than is often possible for libraries expressed in E coli Because emulsion selections are carried out completely in vitro it may also be possible
64. et al 1999 and in Drosophila Kolonin and Finley 1998 Specificity of peptide aptamers To be useful for genetic analysis a peptide aptamer must interact specifically with its pro tein target Peptide aptamer specificity can be evaluated by analyzing the aptamer s ability to interact with related target proteins using the interaction trap Basic Protocol 3 describes the mating interaction assay an extension of the interaction trap developed by Finley and Brent 1994 for determining the specificity of pep tide aptamers against a large panel of related proteins The interaction mating assay allows panels of individual aptamers to be simultane ously screened for interactions with panels of related target proteins Using this method Co las et al 1996 determined the specificity of aptamers isolated against cyclin dependent ki nase 2 Cdk2 The majority of aptamers tested were highly specific for Cdk2 and not other closely related kinases with one exception some of the aptamers also interacted with the closely related kinase Cdk3 Their results dem onstrate that aptamers can be generated against different epitopes on Cdk2 some of which are conserved between different members of the cyclin dependent kinases The mating interaction assay is also used to determine the specific regions and or amino acids that aptamers recognize on the target protein For example Cohen et al 1998 showed that one of the aptamers isolated aga
65. function of the number of full length sequences that can be replicated Table 24 2 2 Comparison of Synthetic Methods for Two Pools Synthesis P Coupling Extension Kool method Cost crude sens efficiency efficiency N73 IDT 277 70 74 97 7 44 N44 IDT 136 90 12 4 97 5 69 N73 Inhouse 293 8 6 97 8 6 N44 Inhouse 293 11 8 97 4 17 Costs reflect available discounts and are stated in 2009 dollars IDT Integrated DNA Technologies http www idtdna com Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 2 9 Supplement 88 DNA Pools for In Vitro Selection 24 2 10 Supplement 88 extendability In the authors experience commercial syntheses produces 4 to 7 times more replicable or extendable sequences than in house syntheses The overall random ness of pools is also a consideration In the authors experience IDT does an adequate job of producing pools with little compositional skewing When analyzing a sample of 17 variants from an N44 pool synthesized by IDT the base ratios of A C T G were 25 4 21 1 25 9 27 6 744 total bases in the random region In contrast dur ing in house synthesis coupling efficiencies of the different phosphoramidites must be painstakingly optimized to avoid skewing as discussed below under In house synthesis There are other trade offs however including the time of delivery For in house methods pools can be syn
66. in terms of the number of copies of the original synthetic pool s complexity For example if the starting pool had a complexity of 1 x 10 molecules and 8 x 10 total DNA molecules were recovered then on average copies of the original starting pool were obtained from the amplification It should be noted that skewing may arise during amplification In addition statistical skewing will occur during sampling of the amplified pool and may cause this estimation to be inaccurate nevertheless it is empirically useful 11 Following large scale amplification store at least 4 copies of the pool at 80 C Because of the aforementioned sampling errors archiving at least 4 copies worth of the pool DNA ensures the preservation of most of the pool s complexity The amount of preserved pool complexity can be calculated using the following equation of the pool complexity in a given sample 100 x 1 x y x where x is total number of pool copies and y is the number of pool copies archived Therefore in the example given above if 4 of the 8 copies of the pool generated through amplification are archived then 99 6 of the original starting pool s complexity is preserved Similarly at least 4 copies of the pool should be used whenever manipulations such as ligation transcription or biotinylation are carried out so that the original complexity is also manifest in the manipulated or synthesized copies Current Protocols in
67. inhibition by antisense RNA and ribozymes Furthermore agents that inhibit at the RNA level antisense RNA and ribozymes are affected by the stabil ity of the protein target which can affect the onset and or the extent of the phenotype Generation and Use of Combinatorial Libraries 24 4 17 Supplement 52 Peptide Aptamers 24 4 18 Supplement 52 The development of combinatorial tech nologies for obtaining biomolecules with de sired properties UNITS 24 2 amp 24 3 Ellington and Szostak 1990 Scott and Smith 1990 presents new avenues for generating genetic agents for characterizing genetically intractable or ganisms This unit describes methods to con struct combinatorial libraries of genetic agents referred to as peptide aptamers Peptide aptamer libraries consist of scaffold proteins that display variable peptides constrained at both ends on their surface They are designed to interact and interfere with the biological function of proteins Peptide aptamers are well suited for analyzing cellular processes in dip loid organisms because they act in trans to inhibit gene products without altering their en coding DNA Moreover because they are iso lated from combinatorial libraries peptide ap tamers can in principle be generated to inacti vate almost any gene product Design of intracellular peptide aptamers Peptide aptamers are designed to interact with their protein targets through va
68. libraries are frequently screened for function although with increasingly novel methods they can be selected Biopolymer libraries include but are not limited to proteins and nucleic acids Protein libraries can be of many different forms from the partial randomization of large proteins to the segmental randomization of pieces of proteins to the complete randomization of peptides Since proteins do not encode replicable sequence information proteins and their attendant phenotypes must somehow be coupled to genetic sequence information i e RNA or DNA There are several different methods by which this can be accomplished but in all instances the key is the physical link between phenotype and genotype In one of the first and most robust instantiations of pro tein selection methods peptide libraries were adjoined to phage proteins such as pI and pVIU and thereby expressed displayed on the surface of bacteriophage Such phage libraries tend to have on the order of a billion different variants Selection for binding led to the isolation of peptides that carried with them the genes that encoded them Re infection of cells led to the amplification of phage with these desirable phenotypes Multiple cycles of selection and amplification generally led to the purification of phage peptides that could bind to a given target Oftentimes however binding required the multivalent presentation of the peptides i e researchers got
69. most of the redun dancy in the genetic code DNA templates that contain all four nucleosides in the first two positions of the codon and only G or C at the third position consist of 32 codons which code for 20 amino acids and one stop codon Codons limited to G or C at the third position are biased for amino acids that are coded by multiple codons However the frequency of a stop codon is reduced to n 32 where n is the length of the peptide The presence of stop codons in a com pletely random or third position biased library limits the complexity that is obtainable with long combinatorial peptide libraries The con struction of longer peptide libraries requires the ligation of shorter DNA templates that are pre screened to eliminate sequences that contain stop codons Cho et al 2000 Alternatively combinatorial peptide libraries can be con structed that contain no stop codons but with reduced amino acid diversity Table 24 4 1 pro vides examples of degenerate codons that can be used to design peptide libraries The sequential codon incorporation method is used to generate DNA templates that contain 20 amino acids and no stop codons Three strategies are used to generate codons The first strategy involves sequentially coupling indi vidual nucleotide phosphoramidites to gener ate 20 codons each of which is on a separate column Lam etal 1991 The beads from each column are subsequently mixed together and repacked into new
70. of selection and ampli fication will take 2 to 4 days and the initial rounds of selection may take to 2 months Mutagenesis will take 1 to 2 weeks and sub sequent rounds of selection and amplification will take 1 to 2 months Sequencing and assays of selected proteins may take 21 month Literature Cited Cadwell R C and Joyce G F 1992 Randomization of genes by PCR mutagenesis PCR Methods Appl 2 28 33 Cho G Keefe A D Liu R Wilson D S and Szostak J W 2000 Constructing high complex ity synthetic libraries of long ORFs using in vitro selection J Mol Biol In press Generation and Use of Combinatorial Libraries 24 5 31 Supplement 53 Table 24 5 2 Troubleshooting Guide to Problems That May Be Encountered In Protein Selection Using mRNA Displayed Proteins Problem Possible cause Solution Sequencing of initial library or library cassettes reveals many insertions and or deletions Sequencing of initial library or library cassettes reveals many insertions and or deletions and or stop codons mRNA DNA ligation does not yield any enough mRNA display template No mRNA displayed proteins observed on gel Oligo dT cellulose purification low yielding Ni NTA purification low yielding Library DNA observed in no template control PCR amplification Library DNA observed in no RT control PCR amplification Activity does not rise through selection Synthetic DNA is of low quality
71. originating from a multitude of uncultured organisms In all of these approaches the DNA library will ultimately need to encode terminal constant regions to permit PCR amplification These may also encode protein affinity tags that will facilitate the purification of the resulting displayed proteins It is also desirable to encode restriction sites close to the random constant sequence boundary to enable these constant regions to be changed should reengineering of the library be necessary Ifthe DNA library is to be synthesized in more than one piece then a strategy of restriction and ligation of different DNA cassettes needs to be designed This strategy ultimately TMV enhancer ORF poly dA A E ee P puromycin ribosome B gt nascent protein CC E D E E mRNA displayed protein Figure 24 5 2 mRNA displayed protein formation A The mRNA display template consists of a Tobacco Mosaic Virus TMV translation enhancer sequence followed by the open reading frame encoded in RNA This is followed by poly dA that is 3 terminated with puromycin B The ribosome initiating the translation of the mRNA display template C The ribosome pausing at the RNA DNA junction of the mRNA display template after it has translated the mRNA display template into protein D The puromycin attached to the 3 terminus of the mRNA display template entering the A site of the ribosome and forming a stable amide
72. possible of the functional displayed proteins that are present in the library while discarding the great majority of those that are not functional In this manner the diversity of the library is taken advantage of to the maximal extent but the diversity of the library is sufficiently reduced that the first amplification step is able to give several copies of the selected proteins for input into the next selection step Subsequent to the first amplification step the selection steps need to be designed to have the maximal possible reasonable discrimination between mRNA displayed proteins that exhibit the function of interest and those that do not If at all possible the extent of this discrimination should be assayed with positive and negative controls The steps within a single round of selection and amplification are shown in Figure 24 5 4 Library Design Library synthesis and preselection A synthetic DNA library encoding a short open reading frame ORF up to 35 amino acids may be synthesized as a single oligonucleotide Longer libraries of ORFs will need to be synthesized in two or more DNA cassettes that are then ligated together Synthetic DNA has a deletion rate of 0 5 and random regions will contain stop codons Deletions will cause parts of the resultant proteins to be out of frame and stop codons will prevent translated proteins from being displayed upon the mRNA that encodes them For example if the target ORF is 100 amino acids lo
73. proteins and ORF codon KEY rrr re NA untranslated mRNA display templates e DDDAAAAAA RNA Free protein cassettes tag1 tag2 we ere econo nae protein Reticulocyte lysate mRNA a puromycin Reticulocyte lysate Figure 24 5 3 The steps that comprise the preselection process A DNA cassette library that when assembled into a full length DNA library will encode a protein library is enriched in those cassettes that are free of stop codons insertions and deletions These cassettes are then used to construct the full length library that is used for protein selection using MRNA display continues on next page RNA polymerase promoter sequence The library will need a transcription promoter at the 5 end This can be added or changed by PCR The promoter sequences TAATACGACTCACTATA and TTCTAATACGACTCACTATA have both been successfully used Transcription is most efficient if the RNA transcript starts with at least two guanines To avoid pyrimidines T or C in the first few nucleotides of the transcript it is common for the transcribed RNA sequence to commence with GGG Protein Selection Using mRNA Display 24 5 4 Supplement 53 Current Protocols in Molecular Biology Step Oligo dT cellulose purification N terminal protein affinity tag Such as FLAG purification optionally repeated C terminal protein affinity tag Such as Hisg purification optionally repeated Reverse transcription with th
74. resolved from the DNA linker not displaying protein Combinatorial using SDS PAGE The ratio between these two bands gives a more direct measurement of Libraries 24 5 19 Current Protocols in Molecular Biology Supplement 53 Protein Selection Using mRNA Display 24 5 20 Supplement 53 the proportion of mRNA display template that displays protein and using this the concen tration of mRNA displayed proteins in the translation reaction mixture may easily be calculated The proportion of mRNA display template that ends up displaying protein can vary from lt 1 to 40 depending upon the sequence the myc epitope sequence is at the upper end of this range Ni NTA purification The Ni NTA purification is upon the basis of the His tag and is only appropriate if this is present in the library sequence see also UNIT 10 11 9 10 11 12 13 Wash 100 ul of Ni NTA agarose three times with 1 ml deionized water Mix 0 5 ml of the oligo dT eluate with 2x Ni NTA binding buffer vortex to dissolve add 0 7 ul of 2 mercaptoethanol incubate with the washed Ni NTA agarose for 1 hr at 4 C with rotation The 2x Ni NTA binding buffer is the solid residue obtained by evaporation to dryness of 1x Ni NTA binding buffer Allow the Ni NTA binding buffer and the Ni NTA agarose to pass through a chromatography column so that the Ni NTA agarose is retained on the frit retain the flowthrough Perform the following washes on the chroma
75. test tube containing the emulsion Positive displacement pipettors e g Microman from Gilson 30 C water bath End over end rotator Additional reagents and equipment for ethanol precipitation of DNA unr 2 74 the polymerase chain reaction PCR UNIT 15 1 real time PCR optional UNIT 15 8 and agarose gel purification of DNA UNIT 2 6 Create DNA library 1 Create a gene construct that can undergo selection for binding An example is given here using the gene for the streptavidin protein which is modified to contain a T7 RNA polymerase promoter and a ribosome binding site RBS In addition the amino terminus of the protein contains a hexahistidine tag that will allow subsequent recovery of the translated protein The entire expression construct is amplified with a primer containing a biotin so that the translated streptavidin protein can bind to its biotinylated template For examples of other schemes in which proteins directly capture their own genes see Background Information Current Protocols in Molecular Biology Table 24 6 1 Cell Free Translation Mixtures in Emulsions Lysate Emulsion composition References S30 E coli lysate Mineral oil Tawfik and Griffiths 1998 4 5 Span 80 0 5 Tween 80 Mineral oil Levy 2008 4 5 Span 80 0 5 Tween 80 0 1 Triton X 100 Mineral oil Griffiths 2003 4 5 Span 80 0 5 Triton X 100 Mineral oil 4 Chen 2008 Abil EM90 PURE E coli lysate Mineral oil Zh
76. the RNA solution should be adequate If the specific activity of the RNA is not high enough a higher concentration of RNA may be used however that will complicate the assumption that RNA is limiting and hence make the calculation of the Ky more difficult 2 To ensure that each species in the RNA pool folds into the most accessible or most stable conformation heat the RNA pool in 25 ul binding buffer to 65 to 75 C for 3 min and then allow the sample to cool to room temperature over 10 min Current Protocols in Molecular Biology 3 Add 25 ul of the protein target in binding buffer to the thermally equilibrated RNA from step 2 Use ten different protein concentrations in triplicate ranging from 1 uM to 50 pM Also include one data point with no protein to measure the filter binding ability of the pool itself The original protein solution should be sufficiently concentrated for all of the dilutions To ensure consistency between samples serial dilutions of the 1 uM sample can be made The authors suggest the following final concentrations i e 1 uM and subsequent 1 3 dilutions 1 uM 333 nM 111 nM 37 nM 12 nM 4 1 nM 1 4 nM 460 pM 152 pM 51 pM and a no protein control For statistically significant results perform the binding assay in triplicate 4 Incubate the binding reaction at room temperature for 15 min to 1 hr see Critical Parameters Perform filter binding 5 Assemble the Minifold 1 Dot Blot apparatus F
77. those in step 3 of Support Protocol 1 to maintain pool complexity The annealing step should be modified to reflect predicted primer melting temperatures and conditions Annealing temperature may need to be adjusted to as low as 45 C depending on primer composition e g for a small or AU rich primer A gradient PCR can be carried out to assay different annealing temperatures simultaneously and thereby optimize the amplifi cation procedure see Fig 24 2 5 for expected results A 100 1 reaction typically yields 1 ug but the amount can vary from 0 1 to 10 ug A fuzzy band may indicate that too many cycles of PCR have been carried out In this case set up the reaction again and perform fewer cycles 2 Dilute the double stranded PCR DNA product 1 128 and repeat the PCR reaction removing a 5 to 10 l aliquot during the last 10 sec of the cycle 7 extension step Current Protocols in Molecular Biology 3 ks ks ks ks annealing E annealing E annealing E annealing E annealing E annealing 41 7 C Q 45 5 C 2 48 4 C e 51 7 C Q 54 6 C Q 58 4 C PCR cycles amp PCR cycles 4 PCR cycles 4 PCR cycles amp PCR cycles 4 PCR cycles 024682 024689024689 02468902468902468 synthesis at IDT synthesis in house 1 5 GATAATACGACTCACTATAQGGAGAGAACTGTATGTCACG 3 AGAGAACTGTATGTCACGEN7 3 JGTAGAACTGTGTCTAGTAGC 3 gt WLILLSVIVIVOVLIIVLI9NG Figure 24 2 5 A PCR cycle course and optimization of annealing tempe
78. to specify reaction conditions that would otherwise be unattainable in or toxic to cells Once a protein or ribozyme is produced from its DNA template functional variants can be selected after further modification and or amplification of the template either before or after de emulsification Tawfik and Griffiths 1998 Ghadessy et al 2001 2004 Doi et al 2004 Zheng and Roberts 2007 For example Taq polymerase variants have been selected based on the selective amplification of the Taq gene by translated polymerases within individual emulsion bubbles Ghadessy et al 2001 Alternatively it has proven possible to selectively capture a protein phenotype and the genotype that encodes it Sepp et al 2002 Griffiths and Tawfik 2003 Aharoni et al 2005 Levy et al 2005 Mastrobattista et al 2005 For example functional B galactosidase enzymes have been selected by sorting emulsion bubbles containing larger amounts of fluorescent reaction products from emulsion bubbles containing smaller amounts of these products and then subsequently amplifying the genes that were captured along with the fluorescence Mastrobattista et al 2005 Instead of sorting emulsion bubbles it is also possible to sort beads that hold both gene and phenotype For example genes encoding a ribozyme ligase were immobilized on beads and emulsified Those templates that encoded functional ribozymes were able to ligate fluorescent tags to the beads which could be sort
79. verify that the band is of the correct size Appropriately radiolabeled size markers can also be used to gauge size Choose an acrylamide percentage that allows efficient separation of small primers from larger extended products 5 Dry and expose the gel to a phosphor imager plate Using a phosphor imager APPENDIX 3A quantify the control primer band and the extended product band see Fig 24 2 4 for expected results DNA Pools for In Vitro Selection 24 2 16 Supplement 88 Current Protocols in Molecular Biology fully extended pool gt W aborted extension products jE LOLVWILISLLOVISVSLLI lt G unextended primer E nif LA 5 GATAATACGACTCAC TATAGGTTGACCAGACCCAGCACAGA 3 5 TTGACCAGACCCAGCACAGAENS 9 ACATTCACCAACTCCTCAAG 3 primer template primer only Figure 24 2 4 Typical extension reaction The pool used N59 is shown to the right next to the figure of the gel Lane 1 shows the fully extended product and a large number of extensions on incomplete or damaged templates Lane 2 is a control reaction containing only the primer The extension reaction was incubated for 30 min There may be a smear leading up to the extended band Determining how much near full length material to include in the quantitation is a somewhat subjective decision Calculate the percent extension by dividing counts of labeled extended product by counts of labeled primer Percent extension for a gel purifi
80. water Heat denature the calf alkaline phosphatase for 10 min at 75 C Perform a phenol chloroform extraction see Basic Protocol 2 steps 13 and 14 If the sample will be gel isolated this step can be omitted If the radiolabeled sample will merely be precipitated prior to use this step should be included Ethanol precipitate the RNA by adding one tenth volume of 3 M sodium acetate 0 3 M final 3 ul of 1 mg ml blue dyed glycogen and 2 5 volumes of 95 ethanol microcentrifuging and washing the pellet with 70 ethanol see Basic Protocol 1 steps 9 and 10 Allow pellet to dry completely Avoid precipitating RNA in the presence of ammonium acetate since ammonium ions inhibit the T4 polynucleotide kinase used in the next step Resuspend the dried pellet in a minimal volume 3 to 10 ul of RNase free water Perform kinase reaction 8 10 11 12 13 14 Set up the kinase reaction as follows 0 5 to 3 ul dephosphorylated RNA pool from step 7 0 5 ul 10x PNK buffer 1 ul 10 U T4 polynucleotide kinase PNK 0 5 ul 83 Ci y 2P ATP 7000 Ci mmol x ul RNase free H2O for a total volume of 5 ul Only a very small amount of RNA will be used in the binding assay 50 pM ina 100 ul reaction Unless multiple experiments are contemplated the specific activity of the sample can be kept quite high by using a very small amount of RNA in the kinase reaction Incubate for 1 hr at 37 C During this step
81. with a library of genomic or cDNA preys Follow the protocol in unr 20 1 for transforming cDNA and genomic prey libraries 6b Select peptide aptamer target s using the interaction trap hunt protocol described in UNIT 20 1 REAGENTS AND SOLUTIONS Use deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 DNA elution buffer 10 mM Tris Cl pH 7 5 APPENDIX 2 1 mM EDTA pH 8 APPENDIX 2 50 mM NaCl Store up to 1 year at room temperature Nondenaturing loading buffer 50 mM Tris Cl pH 8 APPENDIX 2 50 mM EDTA pH 8 APPENDIX 2 50 v v glycerol Store up to 1 year at 4 C COMMENTARY Background Information Understanding cellular processes within or ganisms relies on forward and reverse genetic approaches to identify genetic network mem bers and connections In forward genetic analy sis genes are identified by isolating randomly generated mutants and mapping the genes re sponsible for their mutant phenotypes Reverse genetic analysis by contrast involves mutating individual genes and monitoring the resulting phenotype While both approaches are effec tive they are difficult to perform especially in diploid organisms In diploid organisms the identification of recessive mutations requires two generations of breeding to generate ho mozygotes Consequently genetic approaches requiring homozygous recessive mutations can only be fu
82. with the selection The effectiveness of this step can be evaluated by PCR analysis of reverse transcription in the absence of reverse transcriptase It is essential that RNase free DNase such as that provided with the kit be used otherwise contaminating ribonucleases may destroy the newly transcribed RNA An alternative would be to add RNase inhibitors to impure DNases but such inhibitors themselves frequently contain endogenous ribonucleases that can be released during the incubation Purify the RNA pool The RNA pool should generally be purified by denaturing gel electrophoresis 3 Prepare a 0 75 mm thick denaturing 8 acrylamide gel see Reagents and Solutions and e g UNIT 2 12 An 8 acrylamide concentration is convenient for the purification of RNA molecules from 60 to 150 nucleotides in length However the concentration of acrylamide used to separate the full length transcript from incomplete transcripts is ultimately contingent upon the size of the RNA and should be chosen so that the RNA will migrate approximately half way through the gel when the loading dye has reached the bottom see UNIT 2 12 If the RNA sample contains a significant amount of nascent structure for example a doped sequence population that is based on a tightly folded secondary structure it may not fully denature Thus it may be advisable to warm the gel to 55 C by first pre running the gel at a higher voltage 300 to 400 V The temperature of t
83. 0 ul 100 mM dATP 10 ul 100 mM dGTP 50 ul 100 mM dCTP 50 ul 100 mM dTTP 125 ul 20 UM primer 1 125 ul 20 UM primer 2 2 9 ml water 2 For each sample add the following reagents to a PCR tube 12 ul water 1 ul peptide aptamer expression vector 10 ul Mg Mn solution 76 ul PCR premixture 1 pl Taq polymerase 5 U 3 Amplify the reaction using the following PCR reaction program 4 cycles 30 sec 95 C denaturation 1 min 55 C annealing 1 min 72 C extension 4 Remove 13 ul reaction mixture and add to a new PCR tube containing 10 ul Mg Mn solution 76 ul PCR premixture 1 ul Taq polymerase Amplify using the same PCR program Generation and Use of 5 Repeat for a total of ten rounds of amplification Combinatorial Libraries 24 4 13 Current Protocols in Molecular Biology Supplement 52 BASIC PROTOCOL 5 Peptide Aptamers 24 4 14 Supplement 52 6 Purify the PCR product with a commercially available PCR purification column or by agarose gel electrophoresis UNIT 2 5A Construct mutagenized peptide aptamer expression vector 7 Digest purified PCR product with Avall and subclone it into RsrIl cut pJM 1 using standard subcloning techniques UNIT 3 16 Electroporate the ligated product as described above see Basic Protocol 1 steps 20 to 26 Select mutagenized aptamers by the interaction trap 8 Transform EGY48 with pBait and pRB1840 by standard lithium acetate yeast transformation UNI
84. 000 or locations in the cell Peptide aptamers are particularly useful for the analysis of genetic networks since they can disrupt specific interactions with protein targets Current Protocols in Molecular Biology that have multiple protein interactions Geyer et al 1999 This allows phenotypes caused by the disruption of individual interactions in a network to be observed while leaving other interactions in the same network intact Peptide aptamers can be isolated against allelic variants of proteins Xu et al 1997 Their high speci ficity can be used to functionally characterize variants of polymorphic proteins In addition controlling their expression using inducible promoters allows the penetrance and timing of the aptamer induced phenotype to be varied Finally performing genetic selections with peptide aptamers targeted to different locations in the cell can provide information on the cel lular location of the target protein Together these properties point to the many ways in which peptide aptamers can be used to analyze cellular processes The successful use of peptide aptamers in the reverse analysis of processes in cell cultures and in Drosophila and in the forward analysis of processes in yeast illustrates their potential as genetic agents in the analysis of genetically intractable organisms Critical Parameters and Troubleshooting Peptide aptamer libraries The first critical parameter to consider is
85. 2 TE buffer pH 8 0 see recipe 3 M sodium acetate APPENDIX 2 70 and 95 ethanol Thermal cycler incubators or heat blocks set at 37 or 42 C for transcription and 65 to 75 C for denaturation UV light source Fluorescent TLC plate VWR wrapped in plastic wrap Sharp razor blade fresh or thoroughly cleaned Spectrophotometer such as a NanoDrop Thermo Scientific Additional reagents and equipment for denaturing polyacrylamide gel electrophoresis UNIT 2 12 NOTE All solutions and buffers should be made with deionized water 18 2 MQ resis tivity filtered through a 0 2 um polyethersulfone PES membrane and sterilized by autoclaving Use sterile disposable plasticware and micropipet tips with filter barriers where possible See Chapter 4 introduction and unr 4 1 for guidelines on standard meth ods to protect against contaminating RNases If ribonuclease contamination is found to occur it may be eliminated by treating water with diethylpyrocarbonate DEPC see UNIT Perform initial round of transcription Use the double stranded DNA pool generated in UNIT 24 2 which should contain a T7 RNA polymerase promoter as a template for in vitro transcription with T7 RNA polymerase 1 Following the protocol provided with the kit add 1 ug of double stranded DNA template generated as in UNIT 24 2 to the transcription mix for a 20 ul total reaction volume Incubate reaction at 42 C for 4 hr or overnight at 37 C Dependi
86. 5 ul 100 mM MnCl final 0 5 mM 150 ul 100 mM Tris Cl pH 8 3 final 10 mM 943 ul water 15 ul 5U ul Tag DNA polymerase Total 1500 pl Current Protocols in Molecular Biology 2 Pipet 16 90 ul aliquots of PCR reaction mixture into 100 1 PCR tubes and label them 1 to 16 These may be stored for up to a few hours at 4 C 3 Add the DNA library or sequence to tube 1 to give 10 nM make up to 100 ul with PCR reaction mix 4 Perform 4 cycles of PCR amplification During the final extension incubation place the next numbered tube alongside the current one in the PCR block Before the final extension is complete but ensuring that the next numbered tube is at the extension temperature transfer 10 ul of PCR reaction mixture Retain the amplified PCR reaction mixture at 4 C 5 Repeat step 4 fourteen times Every four transfers analyze the PCR reaction using agarose gel electrophoresis UNIT 15 1 quantitate the bands in successive PCR amplifications and adjust the transfer volume in order to maintain the concentration of amplified DNA at a constant level It is important not to over PCR the DNA If PCR amplification ceases before a concentra tion of 100 nM is reached then the initial DNA concentration should be reduced accord ingly If the initial DNA was of one or a small number of known sequences then it is possible to directly measure the average mutagenic rate by sequencing some of the individual library members from the fin
87. 51 67 Nimjee S M Rusconi C P and Sullenger B A 2005 Aptamers An emerging class of thera peutics Annu Rev Med 56 555 583 Rothe A Surjadi R N and Power B E 2006 Novel proteins in emulsions using in vitro com partmentalization Trends Biotechnol 24 587 592 Scheuermann J Dumelin C E Meikko S and Neri D 2006 DNA encoded chemical libraries J Biotechnol 126 566 581 Yan A Bell K M Breeden M M and Ellington A D 2005 Aptamers Prospects in therapeutics and biomedicine Front Biosci 10 1802 1827 Generation and Use of Combinatorial Libraries 24 1 3 Supplement 80 Design Synthesis and Amplification of DNA Pools for In Vitro Selection Bradley Hall John M Micheletti Pooja Satya Krystal Ogle Jack Pollard and Andrew D Ellington Department of Chemistry and Biochemistry University of Texas Austin Texas 2Freshman Research Initiative University of Texas Austin Texas 33rd Millennium Corporation Cambridge Massachusetts ABSTRACT Preparation of a random sequence DNA pool is presented The degree of randomization and the length of the random sequence are discussed as is synthesis of the pool using a DNA synthesizer or via commercial synthesis companies Purification of a single stranded pool and conversion to a double stranded pool are presented as step by step protocols Support protocols describe determination of the complexity and skewing of the p
88. 74 Scott W G 2007 Ribozymes Curr Opin Struct Biol 17 280 286 Singer B S Shtatland T Brown D and Gold L 1997 Libraries for genomic SELEX Nucl Acids Res 25 781 786 Singh V K and Kumar A 2001 PCR Primer De sign Mol Biol Today 2 27 32 Stoltenburg R Reinemann C and Strehlitz B 2007 SELEX A r evolutionary method to gen erate high affinity nucleic acid ligands Biomol Eng 24 381 403 Stromberg R and Stawinski J 2004 Synthetic strategies and parameters involved in the synthe sis of oligodeoxyribo and oligoribonucleotides according to the H phosphonate method Curr Protoc Nucl Acid Chem 19 3 4 1 3 4 15 Tuerk C and Gold L 1990 Systematic evolu tion of ligands by exponential enrichment RNA ligands to bacteriophage T4 DNA polymerase Science 249 505 510 Tuerk C and MacDougal Waugh S 1993 In vitro evolution of functional nucleic acids High affinity RNA ligands of HIV 1 proteins Gene 137 33 39 Unrau P J and Bartel D P 1998 RNA catalysed nucleotide synthesis Nature 395 260 263 Vieux E F Kwok P Y and Miller R D 2002 Primer design for PCR and sequencing in high throughput analysis of SNPs Biotechniques 32 S28 S32 Zon G Gallo K A Samson C J Shao K Summers M F and Byrd R A 1985 Analyt ical studies of mixed sequence oligodeoxyri bonucleotides synthesized by competitive coupling of either methyl or B cyanoethyl N N dii
89. A D 2000 In vitro selection of RNA molecules that inhibit the activity of ricin a chain J Biol Chem 275 4937 4942 Iyer R P and Beaucage S L 1999 Oligonucleotide synthesis In Comprehensive Natural Products Chemistry Vol 7 DNA and Aspects of Molec ular Biology E T Kool ed pp 105 152 Elsevier London Jaeger J A Turner D H and Zuker M 1989 Pre dicting optimal and suboptimal secondary struc ture for RNA Methods Enzymol 183 281 306 Jaeger L 1997 The new world of ribozymes Curr Opin Struct Biol 7 324 335 Kim N Gan H H and Schlick T 2007 A compu tational proposal for designing structured RNA pools for in vitro selection of RNAs RNA 13 478 492 Legiewicz M Lozupone C Knight R and Yarus M 2005 Size constant sequences and optimal selection RNA 11 1701 1709 Lorsch J R and Szostak J W 1994 In vitro evolu tion of new ribozymes with polynucleotide ki nase activity Nature 371 31 36 Lyamichev V Brow M A and Dahlberg J E 1993 Structure specific endonucleolytic cleav age of nucleic acids by eubacterial DNA poly merases Science 260 778 783 Michelson A M and Todd A R 1955 Nu cleotides XXXII Synthesis of a dithymidine dinucleotide containing a 3 5 internucleotidic linkage J Chem Soc 2632 2638 Milligan J F Groebe D R Witherell G W and Uhlenbeck O C 1987 Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic
90. APTAMERS FOR SPECIFIC PROTEINS USING THE INTERACTION TRAP TWO HYBRID SYSTEM The interaction trap two hybrid system Gyuris et al 1993 UNIT 20 1 is an established method for screening proteins for interactions with genomic and cDNA libraries re viewed by Bai and Elledge 1996 Finley and Brent 1997 The interaction trap can also be extended to screen combinatorial libraries of peptide aptamers for interactions with specific proteins Yang et al 1995 Colas et al 1996 The interaction trap consists of the following parts 1 a constitutively expressed target protein fused to a LexA DNA binding domain referred to as the bait 2 a galactose induced combinatorial library of thioredoxin peptide aptamers fused to an activation domain referred to as the prey and 3 LexA operator leu2 and LexA operator lacZ reporter genes for detecting interac tions between the peptide aptamer prey and target protein bait The bait protein binds to the LexA operators upstream of the reporters but does not activate transcription of the reporters Interaction between a peptide aptamer prey and target protein bait is detected by activation of reporter genes in the presence of galactose and not in the presence of Current Protocols in Molecular Biology BASIC PROTOCOL 2 Generation and Use of Combinatorial Libraries 24 4 5 Supplement 52 Peptide Aptamers 24 4 6 Supplement 52 glucose Figure 20 1 2 illustrates the isola
91. Biochem 209 643 649 Xu C W Mendelsohn A and Brent R 1997 Cells that register logical relationships among pro teins Proc Natl Acad Sci U S A 94 12473 12478 Yang M Wu Z and Fields S 1995 Protein pep tide interactions analyzed with the yeast two hy brid system Nucl Acids Res 23 1152 1156 Yocum R R Hanley S West R J and Ptashne M 1984 Use of LacZ fusions to delimit regula tory elements of the inducible divergent GAL1 GAL10 promoter in Saccharomyces cerevisiae Mol Cell Biol 4 1985 1998 Key References Colas et al 1996 See above First article to describe the interaction trap as a method to isolate thioredoxin peptide aptamers against a specific protein Cdk2 Geyer et al 1999 See above Describes the use of thioredoxin peptide aptamers for the forward analysis of the pheromone response pathway in yeast Peptide aptamers were isolated Current Protocols in Molecular Biology that disrupt the pathway Peptide aptamer targets were identified using mating interaction assays that contained panels of known proteins and by using interaction trap hunts against a yeast genomic li brary Gyuris et al 1993 See above Initial description of the interaction trap Finley and Brent 1994 See above Initial description of the mating interaction assay Kolonin and Finley 1998 See above Describes the reverse analysis of a cellular process in Drosophila using peptide ap
92. DNA selection Biotechnol Prog 14 845 850 Ellington A D and Szostak J W 1990 In vitro selection of RNA molecules that bind specific ligands Nature 346 818 822 Giver L Bartel D Zapp M Green M and Ellington A D 1993 Selective optimization of the Rev binding element of HIV 1 Nucleic Acids Res 23 5509 5516 Gold L Polisky B Uhlenbeck O and Yarus M 1995 Diversity of oligonucleotide functions Annu Rev Biochem 64 763 797 Gopinath S C 2007 Methods developed for SELEX Anal Bioanal Chem 387 171 182 Current Protocols in Molecular Biology Guatelli J Whitfield K Kwoh D Barringer K J Richman D and Gingeras T R 1990 Isothermal in vitro amplification of nucleic acids by a multienzyme reaction modeled af ter retroviral replication Proc Natl Acad Sci U S A 87 1874 1878 Irvine D Tuerk C and Gold L 1991 SELEX ION Systematic evolution of ligands by expo nential enrichment with integrated optimization by non linear analysis J Mol Biol 222 739 761 Jellinek D Lynott C Riata D and Janjic N 1993 High affinity RNA ligands to basic fibrob last growth factor inhibit receptor binding Proc Natl Acad Sci U S A 90 11227 11231 Jhaveri S Olwin B and Ellington A D 1998 In vitro selection of phosphorothiolated aptamers Bioorg Med Chem Lett 8 2285 2290 Keene J D 1996 RNA surfaces as mimetics of proteins Chem Biol 3 505 513
93. ENDIX 2 containing 8 v v 19 1 acrylamide bisacrylamide 7 M urea See UNIT 2 12 for full details on pouring and running the gel Elution buffer 4 to 7 M urea 25 mM disodium EDTA Store up to 3 months at 20 C Prepare with RNase free water Current Protocols in Molecular Biology PCR buffer 10x 100 mM Tris Cl pH 8 4 APPENDIX 2 500 mM KCl 20 mM MgCl PCR buffer can be stored at room temperature or can be refrigerated or frozen If it is frozen care should be taken to mix the buffer after thawing TE buffer pH 8 0 10 mM Tris Cl pH 8 0 APPENDIX 2 1 mM EDTA pH 8 0 APPENDIX 2 Store up to 6 months at 20 C COMMENTARY Background Information Sol Spiegelman and co workers developed a working system for the in vitro replication and evolution of small RNA molecules over 35 years ago Mills et al 1967 Levisohn and Spiegelman 1969 Kramer et al 1974 The development of more advanced although con ceptually identical methods for in vitro evo lution as described in this unit was poten tiated by advances in the chemical synthesis of oligonucleotides and the amplification of nucleic acids such as PCR in vitro transcrip tion and self sustained sequence replication 3SR Guatelli et al 1990 The adaptation of these methods to in vitro evolution of RNA molecules was partially due to the recogni tion that early evolutionary events such as the genesis of ribozymes could be recapitu lated in a
94. Elsalam K A 2003 Bioinformatic tools and guideline for PCR primer design Afr J Biotech 2 91 95 Bartel D P and Szostak J W 1993 Isolation of new ribozymes from a large pool of random se quences Science 261 1411 1418 Bartel D P Zapp M L Green M R and Szostak J W 1991 HIV 1 Rev regulation involves recog nition of non Watson Crick base pairs in viral RNA Cell 67 529 536 Baskerville S Zapp M and Ellington A D 1995 High resolution mapping of the human T cell leukemia virus type 1 rex binding element by in vitro selection J Virol 69 7559 7569 Beaucage S L and Caruthers M H 1981 De oxynucleoside phosphoramidites A new class of key intermediates for deoxypolynucleotide synthesis Tetrahedron Lett 22 1859 1862 Beaucage S L and Caruthers M 2000 Synthetic strategies and parameters involved in the syn thesis of oligodeoxyribonucleotides according to the phosphoramidite method Curr Protoc Nucl Acid Chem 00 3 3 1 3 3 20 Beaucage S L and Iyer R P 1992 Advances in the synthesis of oligonucleotides by the phos phoramidite approach Tetrahedron 48 2223 2311 Boutros R Stokes N Bekaert M and Teeling E C 2009 UniPrime2 A web service providing easier Universal Primer design Nucl Acids Res 37 w209 w213 Breaker R R 1997 In vitro selection of catalytic polynucleotides Chem Rev 97 371 390 Brown D M 1993 A brief history of oligonu cleotide synthesis Me
95. Figure 24 2 1 outlines the procedure STRATEGIC PLANNING Designing the Initial DNA Pool The nucleic acid pools used for in vitro selection experiments typically contain a ran domized central core flanked by constant sequences that are required for enzymatic manipulations such as PCR amplification in vitro transcription or restriction digestion see also Fig 24 2 2 Since a pool is relatively expensive to synthesize both in terms of time and cost some effort should be devoted to pool design There are many subtle parameters to consider that can greatly influence the outcome of a selection experiment including the degree of randomization pool length and pool modularity see Table 24 2 1 for references to Current Protocols in Molecular Biology 24 2 1 24 2 27 October 2009 Published online October 2009 in Wiley Interscience www interscience wiley com DOI 10 1002 047 1142727 mb2402s88 Copyright 2009 John Wiley amp Sons Inc UNIT 24 2 Generation and Use of Combinatorial Libraries St 24 2 1 Supplement 88 add promoter gt yes RNA pool binding binding ste no N CON v partial segmental complete add optional E Ei Ea GCATTTAGGTGACACT ATAAAGNG gt features SCAATTANCCCTCACTANMMGAGA restriction sites 7 of random region randomization combine pool parts __ Y synthesize pool PAGE purify o j 9 2 v aeni
96. M His Ura Trp Leu Gal Raf CM His Ura Trp Leu Glu CM His Ura Trp Xgal Gal Raf CM His Ura Trp Xgal Interacting baits and prey display galactose dependent growth and blue color on Leu and Xgal plates respectively Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 4 11 Supplement 52 BASIC PROTOCOL 4 Peptide Aptamers 24 4 12 Supplement 52 2 Transform individual target protein baits pBaits with pSH18 34 lacZ reporter and a control plasmid pEG202 with pSH18 34 into EGY42 Marta Select transfor mants on 10 cm Glu CM His Ura plates 3 Streak in parallel lines individual peptide aptamers and their control prey strains on 10 cm Glu CM Trp plates 4 Streak in parallel lines individual protein targets and their control bait strains on 10 cm Glu CM His Ura plates 5 Incubate all plates overnight at 30 C 6 Replica plate the protein target bait and peptide aptamer prey strains on the same replica velvet by first replica plating the bait strains and then replica plating the prey strains perpendicular to the baits see Figure 24 4 3 for schematic 7 Transfer the yeast imprint to a 10 cm YPD plate and incubate overnight at 30 C 8 Replica plate the YPD plate onto a replica velvet Transfer the yeast imprint to the following indicator plates Glu CM His Ura Trp Leu Gal Raf CM His Ura
97. ON An aptamer is a selected nucleic acid binding species Typically aptamers are selected from random sequence pools and form three dimensional structures with binding pockets comparable to those formed by proteins While there are multiple ways that aptamers can be selected in vitro for current reviews see Chandra and Gopinath 2007 Kulbachinskiy 2007 Stoltenburg et al 2007 this unit will describe one of the most common selection of aptamers that bind to a protein target from a single stranded RNA pool Aptamers generated from these types of selection experiments can potentially function as protein inhibitors and may find applications as therapeutic or diagnostic reagents In short a double stranded DNA pool see UNIT 24 2 will be transcribed to generate a single stranded RNA pool Basic Protocol 1 in this unit The initial concentration of protein target to be used is determined by labeling an aliquot of the pool see Support Protocol 1 and perform ing the binding assay as described in Support Protocol 2 Following purification the pool is mixed with the protein target Binding species are separated from nonbinding species by nitrocellulose filtration see Basic Protocol 2 RNA protein complexes are then eluted from the filter and binding species are amplified by a combination of reverse transcription the polymerase chain reaction PCR and in vitro transcription see Basic Protocol 3 The progress of the selection will be monitored
98. Overview of Receptors from Combinatorial Nucleic Acid and Protein Libraries Andrew D Ellington University of Texas at Austin Austin Texas ABSTRACT This unit provides a brief description of the different approaches that can be used to identify functional peptides proteins and nucleic acids from combinatorial libraries Curr Protoc Mol Biol 80 24 1 1 24 1 3 2007 by John Wiley amp Sons Inc Keywords combinatorial library e protein e nucleic acid e aptamer e selection e SELX e phage display e directed evolution Biopolymer receptors are used in a wide variety of molecular biology techniques from ELISAs to immunoprecipitations to proteomic arrays Receptors that are of particular interest or utilty for these applications can be generated by either selection or by screening combinato rial libraries Combinatorial library methods can be roughly classified according to the type of molecules being examined and to the decon volution methods being used In particular one large division is between biopolymer and chemical libraries while a second division is between selections and screens for function Selections rely on the amplification of tem plates encoding functional receptors while screens rely on the identification and subse quent resynthesis of functional receptors As a rough generalization biopolymer libraries are frequently selected for function although they can also be screened while chemical
99. T 13 7 Select transformants on 10 cm Glu CM His Ura plates 9 Using the high efficiency lithium acetate procedure see Basic Protocol 2 steps 6 to 22 transform 10 to 50 ug of mutagenized peptide aptamer library into EGY48 containing pBait and pRB1840 Select transformants on 10 cm Glu CM His Ura Trp plates 10 Pool transformants and determine plating efficiency as described in UNIT 20 1 11 Inoculate approximately five library equivalents in 1 ml Gal Raf CM His Ura Trp liquid medium Incubate 4 hr at 30 C with shaking One library equivalent equals the total number of yeast transformants containing the peptide aptamer library as determined in step 9 12 Centrifuge 4 min at 3000 x g room temperature Remove supernatant and resuspend yeast pellet in 1 ml sterile water 13 Spread yeast on 15 cm Gal Raf CM His Ura Trp Xgal plates and incubate at 30 C until colonies appear 2 days 14 Streak blue colonies onto a 10 cm Glu CM His Ura Trp master plate and incubate 1 day at 30 C 15 Replica plate the master plate onto 10 cm Gal Raf CM His Ura Trp Xgal and Glu CM His Ura Trp Xgal plates 16 Rescue plasmids UNIT 13 11 from the galactose dependent blue colonies and reintro duce UNIT 13 7 the plasmids into the yeast strain EGY48 that contains pBait and pRB1840 to reconfirm the phenotype 17 Rescue the plasmids from the galactose dependent blue colonies and s
100. The effect of a range of concentrations typically from micromolar to millimolar of quencher can be tested prior to the first round of selection to more accurately determine the effect on a round of selection As the selection progresses through multiple rounds of selection recovery and reamplification with functional genes being enriched within the library it may be desirable to increase the stringency of selection see discussion of Selection enrichment and stringency under Troubleshooting Increasing the concentration of quencher in this step is a way in which the selection stringency can be increased 9 Add 1 ml of water saturated diethyl ether Vortex the reaction then microcentrifuge 5 min at 13 000 x g room temperature Remove and discard the solvent upper phase Repeat ether extraction two more times The ether is used to break the emulsion and remove the surfactants Since ether is a denaturant for some proteins the robustness of the binding protein to de emulsification should be assayed in advance Current Protocols in Molecular Biology 10 Remove any excess ether by vacuum centrifugation for 5 min at room temperature Recover translated proteins and bound genes 11 12 13 14 15 16 17 18 19 Add 500 ul of TTBS containing 100 pl of an anti polyhistidine antibody agarose resin The beads are listed as capable of binding 5 nmol of polyhistidine tagged protein per Iml of settled resin Th
101. Using mRNA Display 24 5 24 Supplement 53 8 Allow 25 ml of deionized water to flow through the column 9 Add 200 ul of 10 mg ml salmon sperm DNA and 20 ul of 1 mg ml BSA to 1780 ul of deionized water vortex and allow this to flow through column 10 Wash with 25 ml of deionized water and allow water to flow through the gel filtration column 11 Measure the sample volume and pass through column then adda volume of deionized water to the column such that the total volume added to the column is 2 5 ml 12 Add 3 5 ml of deionized water to the top of the gel filtration column and collect the 3 5 ml eluate issued from the bottom of column With the exception of the hydrolysis step this buffer exchange procedure may be optionally repeated after the volume of the sample has been reduced to lt 2 5 ml by evaporation under reduced pressure Amplify selected sequences by PCR 13 Amplify selected sequences by PCR see also unt 15 1 Make up a PCR reaction mixture on ice as follows 3500 ul selected cDNA library from step 12 100 ul 100 uM 3 primer final 2 uM 100 ul 100 uM 5 primer final 2 UM 40 ul each 25 mM deoxynucleotide triphosphates final 0 2 mM 500 ul 10x PCR buffer containing 15 mM MgCl final 1x 735 ul water 25 ul 5 U ul Tag DNA polymerase Total 5000 ul The number of cycles temperatures and durations of the incubation periods within each cycle need to be determined for the specific library bei
102. X 100 0 25 w v final 701 ul 2 mercaptoethanol mol wt 78 1 10 mM final Adjust the pH to 8 0 with NaOH HC1 Bring up to 100 ml with water Store at 20 C In order to prepare 2x Ni NTA binding buffer the 1x Ni NTA binding buffer should be evaporated to dryness under reduced pressure Upon using the resultant 2x Ni NTA binding buffer the 2 mercaptoethanol will have to be added again Ni NTA elution buffer 2 93 g NaCl mol wt 58 4 500 mM final 121 mg 10 mM Tris hydroxymethyl aminomethane mol wt 121 10 mM final 0 25 g Triton X 100 0 25 w v final 1 70 g imidazole mol wt 68 1 250 mM final 701 ul 2 mercaptoethanol mol wt 78 1 10 mM final Adjust pH to 8 0 with NaOH HC1 Bring up to 100 ml with water Store at 20 C Ni NTA wash buffer 1 48 1 g urea mol wt 60 1 8 M final 2 93 g NaCl mol wt 58 4 500 mM final 1 20 g NaH PO mol wt 120 100 mM final 121 mg Tris hydroxymethyl aminomethane mol wt 121 10 mM final 0 25 g Triton X 100 0 25 w v final continued Current Protocols in Molecular Biology 701 ul 2 mercaptoethanol mol wt 78 1 10 mM final Adjust the pH to 6 3 with NaOH HCI1 Bring up to 100 ml with water Store at 20 C Ni NTA wash buffer 2 2 93 g NaCl mol wt 58 4 500 mM 121 mg Tris hydroxymethyl aminomethane mol wt 121 10 mM final 0 25 g Triton X 100 0 25 w v final 701 ul 2 mercaptoethanol mol wt 78 1 10 mM final Adjust the pH to 8 0 with NaOH HCI1 Bring
103. a bait plasmid Interactions between the bait protein and the peptide aptamer prey are initially detected on galactose plates that lack leucine Galactose induces the expression of the peptide aptamer and the absence of leucine selects for peptide ap tamer bait protein interactions that activate the leu2 reporter Interactions are verified by subsequently testing for galactose dependent growth on Leu plates and galactose de pendent blue color on Xgal plates The lithium acetate transformation procedure used here typically yields 10 to 10 transformants per ug of plasmid DNA The protocol should be optimized for individual strains to achieve maximum transformation efficiency In particular variables such as cell concentration and heat shock time need to be optimized The highest transformation efficiencies are obtained with 1 ug plasmid DNA per 50 ul competent yeast cells and generally do not scale up with similar efficiencies The protocol below is designed for the transformation of 50 ug of peptide aptamer library Materials DNA encoding bait protein of interest Plasmid DNA pEG202 Fig 20 1 3 pSH18 34 Fig 24 4 2 Yeast strain EGY48 ura3 trp1 his3 3LexA operator leu2 Complete minimal CM dropout medium unr 13 1 and plates supplemented with either 2 w v glucose Glu or 2 w v galactose and 1 w v raffinose Gal Raf Glu CM His Ura 10 cm plates and liquid medium Glu CM His Ura Trp 10 and 15 cm plates
104. ake up the following reverse transcription reaction mixture on ice Mix mRNA displayed proteins and DNA splint functions as the RT primer together first before adding RT buffer and add reverse transcriptase last 900 ul mRNA displayed proteins 15 ul 200 uM DNA splint final 2 uM 300 ul 5x reverse transcription buffer final 1x 150 ul 100 mM DTT final 10 mM 30 ul each 25 mM deoxynucleotide triphosphates final 0 5 mM 5 ul water 10 ul 200 U ul Superscript II reverse transcriptase final 1333 U ml Total 1500 ul Incubate the reverse transcription reaction for 50 min at 42 C Analyze the starting material and the product of the reverse transcription using Tris tricine SDS PAGE as described in UMIT 10 24 Alternate Protocol 1 and by scintillation counting Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 5 21 Supplement 53 BASIC PROTOCOL 3 Protein Selection Using mRNA Display 24 5 22 Supplement 53 The volume of the eluate may be reduced by lyophilization by up to a factor of 5 The reverse transcribed mRNA displayed proteins have greater mobility on the SDS PAGE gel compared to those that have not been reverse transcribed This difference in mobility provides a simple method for the accurate assay of the proportion of the mRNA displayed proteins which have been reverse transcribed However this change in mobility may only be observed if the cDNA RNA ass
105. al mutagenic PCR amplification sample Assuming that the mutagenic rate is constant throughout the procedure allows for the direct control of the extent of mutagenesis by choosing one or a mixture of more than one of the successive mutagenic PCR amplification mixtures to serve as the source of the new DNA library This sample may then be further amplified with PCR optionally with further mutation It is expected that the mutagenic rate will be about 0 2 per nucleotide per transfer ten fold amplifica tion REAGENTS AND SOLUTIONS The water used to make the following buffers should be deionized ultrafiltered and subsequently tested for the absence of RNase by incubation with 32 P labeled RNA and denaturing PAGE analysis All buffers should be analyzed similarly For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 ATP aptamer selection binding buffer 39 0 mg MgCl mol wt 95 2 4 1 mM final 2 92 g KCI mol wt 74 6 392 mM final 476 mg HEPES mol wt 238 20 mM final 3 07 mg glutathione mol wt 307 2 mM final 3 06 mg glutathione disulfide mol wt 612 1 mM final 3 72 mg EDTA 2Na mol wt 372 100 uM final 250 ul Triton X 100 0 25 final Bring up to 100 ml with water Store at 20 C Deoxygenate the buffer before the addition of the glutathione by bubbling an oxygen free grade of an inert gas such as argon or nitrogen through it and adjust the pH to 7 4 ATP aptamer selection elution buff
106. an Research Initiative at the University of Texas at Austin In addition these methods were refined by un dergraduate students from the Freshman Re search Institute based on generous funding from the National Science Foundation and the Howard Hughes Medical Institute Literature Cited Baskerville S Zapp M and Ellington A D 1995 High resolution mapping of the human T cell leukemia virus type 1 rex binding element by in vitro selection J Virol 69 7559 7569 Bell S D Denu J Dixon J E and Ellington A D 1998 RNA molecules that bind to and inhibit the active site of a tyrosine phosphatase J Biol Chem 273 14309 14314 Breaker R and Joyce G F 1994 Emergence of a replicating species from an in vitro RNA evo lution reaction Proc Natl Acad Sci U S A 91 6093 6097 Breaker R Banerji A and Joyce G F 1994 Con tinuous in vitro evolution of bacteriophage RNA polymerase promoters Biochemistry 33 11980 11986 Brody E N Willis M C Smith J D Jayasena S Zichi D and Gold L 1999 The use of ap tamers in large arrays for molecular diagnostics Mol Diagn 4 381 388 Chandra S and Gopinath B 2007 Methods developed for SELEX Anal Bioanal Chem 387 171 182 Conrad R C Giver L Tian Y and Ellington A D 1996 In vitro selection of nucleic acid aptamers that bind proteins Methods Enzymol 267 336 367 Cox J C Rudolph P and Ellington A D 1998 Automated
107. ance at 260 nm Use an extinction coefficient of 0 025 ml cm ug see e g APPENDIX 3D In practical terms measure the A250 of a 1 10 dilution of the sample on a NanoDrop spectrophotometer or cuvette based spectrophotometer The A260 A280 and A260 A239 ratio should be between 1 8 and 2 2 If ratios are outside of these ranges the purity of the original RNA sample may be suspect with residual acrylamide or salt being the most likely contaminants and the sample should be reprecipitated prior to use RADIOLABELING RNA FOR USE IN AN INITIAL AFFINITY ASSAY Radioactive RNA can be generated either by incorporation of an c P nucleoside triphosphate during transcription or by transfer of the terminal phosphate of y P ATP to the 5 terminus of a dephosphorylated RNA molecule The authors tend to prefer the latter method despite the additional labor involved in preparation because the specific activity of the sample is higher less RNA is required for assays and dissociation constants are correspondingly easier to compute Materials RNA pool Basic Protocol 1 10x alkaline phosphatase buffer New England Biolabs Calf alkaline phosphatase New England Biolabs 25 24 1 phenol chloroform isoamyl alcohol saturated with 10 mM Tris Cl pH 8 0 1 mM EDTA unrr 2 14 Chloroform 3 M sodium acetate APPENDIX 2 70 and 95 ethanol 1 mg ml blue dyed glycogen GlycoBlue Ambion 10x PNK buffer New England Biolabs 10 U l T4 polynucleot
108. and Polisky 1996 and can be isolated both from complete pools that span 20 random sequence positions and from very incomplete pools that span 90 random sequence positions Having dismissed considerations of complexity and representation the one guiding principle that emerges from this analysis is that longer pools are more generally useful for selection experiments than shorter pools However this principle must be applied with appropriate caveats First aptamers derived from shorter pools are easier to analyze Sequence and structural motifs embedded within a 30 nucleotide random sequence region are much more readily apparent than sequence and structural motifs embedded within a 90 nucleotide random sequence region especially if the motifs are not colinear Second Current Protocols in Molecular Biology longer pools are more difficult and costly to synthesize than shorter pools Finally longer pools are more likely to yield amplification or other selection artifacts than shorter pools For example pools that contain random regions greater than 90 nucleotides in length can form self aggregates that precipitate from solution upon prolonged incubation and thus require immobilization on a solid support prior to selection Bartel and Szostak 1993 Lorsch and Szostak 1994 Because of these considerations pools used for the in vitro selection of aptamers typically contain from 20 to 80 random sequence positions Longer pools are no
109. aqueous compartments generated Unfor tunately it is unclear what the optimum size of an aqueous bubble is for the production and activity of a given protein A general mea sure for determining the activity of the tran scription and translation reaction within an aqueous compartment is to translate a fluores cent protein such as eGFP and verify protein production by fluorescence microscopy or a fluorimeter Selection enrichment and stringency The identification of functional variants from a large and diverse starting library by di rected evolution can be a powerful method but specific implementations inherently differ due to differences in function selected for Because of this testing the selection procedure prior to attempting selection with a randomized library is important both to ensure that the designed scheme works as intended and to determine the likely enrichment per cycle of selection and to evaluate the stringency of selection To verify that protein activity in emulsion leads to an Current Protocols in Molecular Biology enrichment of active variants in a population it is common to perform a mock selection using a population of only two variants one variant with normal activity and one truncated or mutated variant with low or nonexistent activity The active variant is mixed with the inactive variant at various ratios e g 1 10 1 100 1 1 000 and a single cycle of selection is carried out The level o
110. are many sequences in the selected library that are active Not enough cycles of selection and amplification performed There are no functional sequences in library Assay does not treat free proteins in exactly the same mannner as mRNA displayed proteins Selected mRNA displayed proteins have mRNA dependent conformations Adjust conditions so that biases are reduced especially in low yielding steps e g reduce mRNA display template concentration in translation Repeat selection with different matrix and or linker and or target linkage point Continue with cycles of selection and amplification Assay individual selected sequences Continue with cycles of selection and amplification Redesign or mutagenize library and reselect Repeat assay treating free proteins in the same manner as mRNA displayed proteins for example include the reverse transcription step Redesign or mutagenize library and reselect Table 24 5 3 Results Obtained During mRNA Displayed Protein Selection Procedure Step Range of acceptable yields 5 phosphorylation of DNA linker 90 100 Splinted RNA DNA ligation 20 60 Proportion of mRNA display template displaying protein 1 40 Oligo dT cellulose purification 30 90 Denaturing Ni NTA purification 30 90 Anti FLAG purification 50 80 Gel filtration chromatography NAP column 85 100 Reverse transcription 80 100 Proportion of mRNA displayed proteins in initial
111. at nor mally bind nucleic acids will also be able to ex tract aptamers from a random sequence pool The notion of a nucleic acid binding protein can to some extent be expanded to include proteins that bind nucleotides For example kinases and dehydrogenases bind nucleotide cofactors and have proven to be good selec tion targets Second proteins that for whatever rea son contain basic patches in their primary sequences or on their surfaces also fre quently yield high affinity aptamers For ex ample many cytokines and other signal transduction proteins bind heparin or other sul fated oligosaccharides and can also be used to select aptamers from random sequence popu lations The anti cytokine aptamers frequently bind to the same sites as heparin Jellinek et al 1993 Similarly proteins that bind phosphate or phosphomonoester or phosphodiester bonds frequently have positively charged active sites and can be used to elicit aptamers For exam ple anti phosphatase aptamers have been se lected from random sequence pools Bell et al 1998 This is not to say that proteins that do not fall into these categories will necessarily be poor selection targets but merely that they are not guaranteed selection targets For ex ample antibodies have frequently proven to be excellent selection targets irrespective of whether they bind negatively charged anti gens Keene 1996 This likely implies that proteins with large pockets or
112. ated cell sort ing for enzymatic activity Comb Chem High Throughput Screen 9 321 328 Galanis M Irving R A and Hudson P J 1999 Bacteriophage library construction and selec tion of recombinant antibodies Curr Protoc Immunol 34 17 1 1 17 1 48 Gartner Z J Tse B N Grubina R Doyon J B Snyder T M and Liu D R 2004 DNA templated organic synthesis and selection of a library of macrocycles Science 305 1601 1605 Griffiths A D and Tawfik D S 2006 Miniaturis ing the laboratory in emulsion droplets Trends Biotechnol 24 395 402 Hall B G 2003 The EBG system of E coli Origin and evolution of a novel beta galactosidase for the metabolism of lactose Genetica 118 143 156 Halpin D R and Harbury P B 2004 DNA dis play II Genetic manipulation of combinatorial chemistry libraries for small molecular evolu tion PLoS Biol 2 E174 Hoppe Seyler F Crnkovic Mertens I Tomai E and Butz K 2004 Peptide aptamers Specific inhibitors of protein function Curr Mol Med 4 529 538 Kay B K and Castagnoli L 2003 Map ping protein protein interactions with phage displayed combinatorial peptide libraries Curr Protoc Cell Biol 17 17 4 1 17 4 9 Kehoe J W and Kay B K 2005 Filamentous phage display in the new millennium Chem Rev 105 4056 4072 Lipovsek D and Pluckthun A 2004 In vitro pro tein evolution by ribosome display and mRNA display J Immunol Methods 290
113. average number of doublings per cycle against the total reaction volume A pool of 1 x 10 molecules 1 7 x 10 mol at a starting template concentration of 2 nM will require 0 85 liters for amplification Therefore it is greatly desirable to amplify the pool at the highest template concentration that still gives a reasonable number of doublings per cycle The amplification should generate at least 8 copies of pool DNA if the pool complexity is to be archived and preserved see Basic Protocol 2 LARGE SCALE PCR AMPLIFICATION OF POOL DNA Very long and complex pools often require PCR amplification on a multiple milliliter scale Large scale PCR differs from conventional PCR in that it is typically conducted in water baths using 15 ml 17 x 120 mm screw capped Sarstedt thermostable tubes to accommodate the larger volumes Amplification reactions of up to 2 5 liters have been carried out in this way Medium scale amplifications can sometimes be carried out in thermal cyclers that can accommodate multiple samples e g 96 well PCR plates Materials Purified ssDNA pool and primers 0 5 M EDTA pH 8 0 APPENDIX 2 2 butanol for larger volumes 3 M sodium acetate Ethanol TE buffer pH 8 0 APPENDIX 2 containing 50 mM of a salt such as KC Thermal cycler or three water baths one must be a circulating water bath 96 well PCR plate or 13 ml thermostable tubes Sarstedt Thermometer Styrofoam racks Spectrophotometer or fluorimeter
114. bacteria peptide aptamers were iso lated that specifically inhibited thymidylate synthase or that caused growth inhibition Blum et al 2000 The peptide aptamer targets for forward analysis in yeast were identified using yeast two hybrid systems Mating inter action assays identified protein targets from panels of proteins known to be involved in the yeast pheromone response pathway Caponi groetal 1998 Geyer et al 1999 or from large Current Protocols in Molecular Biology panels of proteins containing almost all of the proteins in the yeast genome Norman et al 1999 Peptide aptamer targets were also iden tified using interaction trap hunts against a partial coverage yeast genomic library Geyer et al 1999 Interestingly the peptide aptamer targets identified with the mating interaction assay were not obtained with the interaction trap hunt using the partial coverage yeast genomic library Geyer et al 1999 The in ability of the genomic library screen to identify aptamer targets is partly due to the repre sentation of targets in the partial coverage li brary Nevertheless the results demonstrate a better success rate for identifying aptamer tar gets using mating interaction assays with ar rayed panels of protein targets Mating interac tion assays have the following advantages 1 they present protein targets as fully normalized libraries 2 they allow reporter outputs that result from interactions to be dir
115. be confirmed by comparing the effects of the aptamer expression plasmid in the presence or absence of the inducer The protocol described below for a genetic selection using yeast may be adapted to a variety of organisms Materials 10 Yeast strain for genetic selection Peptide aptamer library pJM 2 or pJM 3 Basic Protocol 1 Fig 24 4 1 Complete minimal CM dropout liquid medium unrr 13 1 and plates supplemented with either 2 w v glucose Glu or 2 w v galactose and 1 w v raffinose Gal Raf Glu CM Trp 10 cm plates Gal Raf CM Trp 10 cm plates and liquid medium 30 C incubator Additional reagents and equipment for high efficiency lithium acetate yeast transformation see Basic Protocol 2 determination of plating efficiency UNIT 20 1 isolation of plasmids UNIT 13 11 plasmid DNA sequencing UNIT 7 3 and target identification see Support Protocol Transform 50 to 100 ug of the peptide aptamer library in pJM 2 or pJM 3 into a yeast selection strain 10 to 10 transformants using the high efficiency lithium acetate transformation procedure see Basic Protocol 2 steps 6 to 22 Plate trans formants on 10 cm Glu CM Trp plates and incubate at 30 C until colonies are 1 mm in diameter 2 to 3 days Pool yeast cells and determine the plating efficiency as described in UNIT 20 1 Inoculate ten library equivalents in 1 ml Gal Raf CM Trp liquid medium Incubate 4 hr at 30 C with shaking
116. bond with the nascent protein E The mRNA display template displaying the protein that it encodes after the ribosome has been released during purification Current Protocols in Molecular Biology yields the full length library and additionally offers the opportunities of purification and amplification of the individual DNA cassettes before they are ligated together Amplifi cation of the cassettes at this stage can greatly increase the library diversity in a combinatorial sense Purification of the cassettes at this stage can decrease the proportion of cassettes that contain deletions insertions and stop codons This preselection strategy can greatly increase the effective diversity of the DNA library since the proportion of resultant mRNA display templates which are able to display frameshift free proteins will also increase in a combinatorial fashion once the DNA cassettes are ligated together The steps in a preselection strategy are shown in Figure 24 5 3 and a detailed description is given in Cho et al 2000 Once the library has been designed and synthesized the translation conditions need to be optimized for the formation of displayed proteins and the purification strategy also needs to be optimized and subsequently piloted in a serial manner However the most important part of the strategic planning phase of the project is the design of the selection strategy The first selection step needs to be designed to retain as many as
117. buffers including the binding buffer using such a native Ni NTA agarose purification procedure is likely to result in decreased yields compared to the denaturing Ni NTA agarose purification procedure described above The Ni NTA agarose purification is upon the basis of the His tag Alternatively other protein affinity tags may be encoded within the protein sequence and used as a basis for Current Protocols in Molecular Biology purification such as the FLAG tag see Support Protocol 1 The Ni NTA purification will separate the mRNA displayed proteins from the mRNA display templates not displaying proteins and other mRNA molecules that were not purified away in the oligo dT purifica tion The Ni NTA agarose eluate will however contain contaminating free library protein if this is present in the input mixture in this protocol this is removed in the preceding oligo dT purification If it is desired to purify the free library protein then it is best to purify the translation mixture initially upon the basis of a FLAG tag with the Ni NTA agarose purification subsequent to this Additionally a denaturing His tag purification may be used to purify selected mRNA displayed proteins away from the selection binding buffer if more than one selection step is to be used between amplification steps and the denaturing and renaturing of the mRNA displayed proteins is desired Strong chelating agents such as EDTA EGTA and DTT must be avoided in Ni NTA b
118. c PCR or by synthe sizing degenerate oligonucleotides with vary ing degrees of randomness see UNIT 2 11 for a discussion on the construction of degenerate oligonucleotides The stringency of the inter action trap is enhanced by reducing the number of LexA operators upstream of the reporters The interaction trap in unr 20 1 contains eight LexA operators in the LexA lacZ pJG4 5 and LexA leu2 EGY48 strain reporters These re porters are capable of detecting interactions with dissociation constants of lt 1 uM Estojak et al 1995 Other lacZ reporters developed by Brent and Ptashne 1985 contain only one pRB1840 or two pJK103 LexA operators Fig 24 4 2 These operators have lower affin ity for the LexA DNA binding domain and detect interactions with dissociation constants between 20 nM and lt 1 UM Estojak et al 1995 The affinity maturation described in Basic Protocol 4 has been successfully used to en hance the affinity of aptamers isolated against Cdk2 Cohen 1998 Colas et al 2000 The variable region of the anti Cdk2 aptamer was mutated by PCR and reselected for binding to a LexA Cdk2 fusion using the 1 LexA operator lacZ reporter pRB 1840 Isolated aptamers all contained the same two amino acid substitu tions The dissociation constant of the mature aptamer was reduced to 5 nM a 20 fold de crease from the starting aptamer Kg 0 1 UM Forward genetic analysis with peptide aptamers Combinator
119. cDNA or genomic libraries UNIT 20 1 Genomic and cDNA libraries are con structed as preys since they contain many sequences capable of activating transcription in the bait configuration As such the peptide aptamers need to be transferred to the bait plasmid pEG202 to identify their targets in these libraries Protocols for constructing cDNA and genomic libraries can be found in UNITS 5 7 5 8A amp 5 8B Putative peptide aptamer targets identified with either mating interaction panels or hunts should be verified using genetic tests such as 1 immunoprecipitation to confirm the aptamer interactions in vivo 2 epistasis analysis to confirm that the aptamer functions in the same area as the target protein or 3 comparison of the phenotype s caused by deletion and overexpression of target protein with the phenotype caused by the aptamer Materials DNA encoding thioredoxin peptide aptamer Basic Protocol 5 Plasmid DNA pEG202 Fig 20 1 3 pSH18 34 Fig 24 4 2 pJG4 5 Fig 24 4 1 Yeast strains EGY42 Mata ura3 trp his3 leu2 EGY48 Mata ura3 trpl his3 3LexA operator leu2 Complete minimal CM dropout liquid medium unrr 73 1 and plates supplemented with either 2 w v glucose Glu or 2 w v galactose and 1 w v raffinose Gal Raf Glu CM His Ura 10 cm plates Glu CM Trp 10 cm plates Prey library see Table 20 1 3 Additional reagents and equipment for PCR unr 15 1 standard subcloning UNIT 3 16 standard lith
120. ces an en zyme that fluorescently labels the bead which is in turn captured via FACS Amplification of the gene allows further cycles of selection for those enzymes that are most active and those beads that are most fluorescent While these methods are quite different from one another in the libraries that can be sieved are in gen eral larger gt 10 than is the case with phage display Griffiths and Tawfik 2006 Functional nucleic acids can also be se lected from random sequence libraries In these instances the coupling between geno type and phenotype is natural since functional nucleic acids overcome the chicken and egg problem the genotype is the phenotype and vice versa Individual single stranded nucleic acids DNA or RNA can be generated by ei ther chemical or enzymatic methods The cur rent volume contains a detailed description of how to prepare a nucleic acid pool UNIT 24 1 Each single stranded nucleic acid will fold into a unique three dimensional conformation These conformations can be sieved for either binding or catalytic activity ribozymes Nu cleic acid variants that survive a round of se lection can be amplified by a combination of reverse transcription PCR and in vitro tran scription One of the more common and use ful types of in vitro selection experiments is the identification of anti protein aptamers via filter binding selection a procedure that is de scribed in UNIT 24 3 The disad
121. cetonitrile wash Bartel et al 1991 It is more difficult to stochastically incorporate insertions but the lengths of segmental random sequences in a pool can be mixed For example in Giver et al Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 2 11 Supplement 88 Table 24 2 5 Amidite Mixtures for a Given Level of Mutagenesis in a Doped Pool Equiactive phosphoramidite volume ratio Equiactive N volume ratio 0 25 1 2 3 4 5 6 7 8 15 0 375 50 0 56 3 60 0 62 5 64 3 65 6 66 7 8 3 25 0 37 5 45 0 50 0 53 6 56 3 58 3 60 0 5 8 18 8 30 0 375 42 9 46 9 50 0 52 5 54 5 5 0 16 7 27 3 34 6 40 0 44 1 474 50 0 52 2 4 4 15 0 25 0 32 1 37 5 41 7 45 0 47 7 50 0 3 6 125 214 28 1 33 3 375 40 9 43 8 46 2 3 0 10 7 188 25 0 30 0 34 1 37 5 40 4 42 9 2 8 10 0 17 6 23 7 28 6 32 6 36 0 38 9 41 4 2 6 9 4 16 7 22 5 27 3 31 3 346 37 5 40 0 2 3 8 3 15 0 20 5 25 0 28 8 32 1 35 0 37 5 Bold values represent common doping percentages per position gt The equiactive N bottle should contain equal volumes of each of the resuspended phosphoramidites see Table 24 2 4 Each of the phosphoramidites should be resuspended according to Table 24 2 4 BASIC PROTOCOL 1 DNA Pools for In Vitro Selection 24 2 12 Supplement 88 1993 four columns were used to generate a pool with two random r
122. ch can be determined by sequencing However in the absence of a decrease in real time PCR signal such a narrowing of the pool is suspect Time Considerations Because each new emulsion selection gen erally requires the development of new proto cols the time required for initial optimization and troubleshooting is generally quite large on the order of months However once the selection scheme has been optimized each round of selection can be performed in less than 2 days The number of rounds of selection necessary will depend on the relative abun dance of the desired protein phenotype the size of the pool the enrichment per round and the stringency of selection Literature Cited Agresti J J Kelly B T Jaschke A and Griffiths A D 2005 Selection of ribozymes that catal yse multiple turnover Diels Alder cycloaddi tions by using in vitro compartmentalization Proc Natl Acad Sci U S A 102 16170 16175 Aharoni A Amitai G Bernath K Magdassi S and Tawfik D S 2005 High throughput screening of enzyme libraries Thiolactonases evolved by fluorescence activated sorting of sin gle cells in emulsion compartments Chem Biol 12 1255 1257 Bershtein S Goldin K and Tawfik D S 2008 Intense neutral drifts yield robust and evolv able consensus proteins J Mol Biol 379 1029 1044 Bertschinger J and Neri D 2004 Covalent DNA display as a novel tool for directed evolution of proteins in v
123. chastic distribution can be obtained by including larger amounts of A and C phosphoramidites in the mix to compensate for the faster coupling times of G and T phosphoramidites Zon et al 1985 Suggested ratios include a 1 5 1 5 1 0 1 2 molar ratio of A C G T phosphoramidites D P Bartel pers comm a 1 30 1 25 1 45 1 00 molar ratio of A C G T Unrau and Bartel 1998 and a 1 50 1 25 1 15 1 00 molar ratio of A C G T see User s Manual for PE Biosystems Models 392 and 394 DNA RNA Synthesis Doped pools are among the most difficult to synthesize Hermes et al 1989 Bartel et al 1991 Doping can be accomplished by using phosphoramidite mixtures that have been adjusted to ensure the proper level of partial randomization of a given nucleotide For example a 10 doped pool would contain 90 of the wild type nucleotide at each doped position and 3 3 of each of the non wild type nucleotides If a doped pool is to be synthesized in which non wild type residues are included at a rate of 10 position then for the 2 deoxyadenosine bottle a molar ratio of 33 43 1 50 1 00 1 21 of A C G T phosphoramidites should be used These ratios were derived by first adjusting for the relative molecular mass and coupling differentials of the individual phosphoramidites then mixing the phosphoramidite solutions on a percent volume basis to yield the desired extent of doping This process is described in greater detail below To normalize the coupling of diffe
124. chimeras were selected for their ability to bind to the U1A RNA hairpin Chen et al 2008 This lat ter method is conceptually similar to the evolu tion of functional proteins via mRNA display Roberts and Szostak 1997 Critical Parameters Choice of binding protein Not all proteins are amenable to selection in emulsions in large measure because not all proteins acquire function following translation in vitro but also because both the emulsion and the procedures used for de emulsification may lead to denaturation Therefore it is important to ensure that the wild type protein is func tional following in vitro translation and that the protein retains function following emulsi fication If a protein proves to not be particu larly robust to emulsion selections it may be possible to produce a more robust variant that is more suitable for selection by neutral drift Bershtein et al 2008 Translation yield Even when a protein can be actively trans lated the yield may be too low for selection This will be especially true for longer pro teins as cell free translation is relatively inef ficient and mRNAs can degrade in many cell lysates While many of the critical parame ters described below suggest how the amount of translation product can be improved most successful selections will of necessity involve shorter stable proteins It is strongly suggested that an entire cycle of selection be carried out with the wild t
125. cit instructions may be found in UNIT 2 12 The dsDNA library will not re anneal if denatured so care should be taken not to expose it to low salt or high temperature conditions 22 Transcribe the DNA into RNA see Basic Protocol 1 and repeat the entire procedure see Basic Protocols 1 2 and 3 FLAG TAG PURIFICATION The FLAG tag purification may optionally be used in place of or in addition to the His tag purification in the purification of mRNA displayed proteins The FLAG tag purifica tion is usually performed in addition to the His tag purification during the preselection of individual cassettes during the library construction process In this instance the FLAG tag and His tag are placed at opposite protein termini purification upon the basis of the presence of both tags ensures that the protein is full length and in frame at both termini This in turn ensures that the mRNA cassette that encodes the protein is free of insertions deletions and stop codons and is suitable for the preparation of the full length library by restriction and ligation of the resulting PCR amplified cDNA sequences In addition FLAG tag purification may be used to purify selected mRNA displayed proteins away from the selection binding buffer if more than one selection step is to be used between amplification steps and the denaturing and renaturing of the mRNA displayed proteins is not desired Alternatively FLAG tag purification may be used to purify f
126. clear localization signal Transform peptide aptamer library into pBait containing yeast 6 Inoculate 20 ml Glu CM His Ura liquid medium with transformed EGY48 step 3 and incubate overnight at 30 C with shaking 7 Take an OD o9 measurement and dilute to a concentration of 5 x 10 cells ml in 250 ml Glu CM His Ura An OD go of 0 1 corresponds to 3 X 1 0 cells ml This value should be confirmed for each yeast strain used UNIT 13 2 8 Incubate cells at 30 C with shaking until they reach an OD o9 of 0 6 to 0 8 5 to 6 hr This will yield enough yeast for 50 transformations coe and se o Combinatorial Libraries 24 4 7 Current Protocols in Molecular Biology Supplement 52 Peptide Aptamers 24 4 8 Supplement 52 2 um ori LacZ Reporters GAL1 lacZ lexA80p GAL1 lacZ pSH18 34 lexA2o0p GAL1 lacZ pJK103 lexA1op GAL1 lacZ pRB1840 Figure 24 4 2 acZreporter plasmids The acZ reporter plasmids are derived from a plasmid that contains a wild type GAL1 promoter fused to the lacZ gene Yocum et al 1984 lacZ reporters with different sensitivities are constructed by inserting different numbers of exA operators into a plasmid pLR1A1 that has the GAL1 upstream activating sequences UAS deleted West et al 1984 The lacZ reporters pSH18 34 Gyuris et al 1993 pJK103 Kamens and Brent 1991 and pRB1840 Brent and Ptashne 1985 contain eight two o
127. clefts on their Generation and Use of Combinatorial Libraries 24 3 21 Supplement 88 Selection of RNA Aptamers 24 3 22 Supplement 88 surface are good selection targets This hy pothesis is further bolstered by another line of reasoning Aptamers selected to bind pro teins frequently inhibit protein function That is anti antibody aptamers block interactions with antigens anti enzyme aptamers inhibit enzymatic activities and so forth This so called homing principle may be due to the fact that aptamers not only have to form a sur face that is chemically complementary to a tar get but they also must fold into a structure that properly presents the chemically complemen tary surface The most informationally parsi monious way to achieve both functions is to fit into a pocket on a target rather than to form a grasping structure that can enfold a surface protrusion of a target Thus the most common and most highly represented aptamers may be those that fit into surface crevices In con trast antibodies have a preformed structure for the presentation of chemically complementary surfaces and thus can more easily grasp pro truding epitopes and less easily fit into surface crevices Overall researchers should be guided not so much by these considerations as by the re sults of initial binding assays with their par ticular protein target If the target binds to the filter not a given since sma
128. cleic acids to vary greatly between rounds Direct binding assays of the RNA pool Support Protocol 3 are a much more accurate and useful gauge of the progress of a selection experiment 10 Once the optimum PCR cycle has been determined set up eight 100 11 PCR reactions as described below and perform the cycling conditions listed above in parallel for the optimum number of cycles 80 ul 10x PCR buffer 40 ul 4 mM dNTP mix 16 ul 20 uM 5 end primer Current Protocols in Molecular Biology 16 ul 20 uM 3 end primer 16 ul pool ssDNA 4 ul 5 U ul Tag DNA polymerase 628 ul nuclease free water 11 Ethanol precipitate the RNA by adding one tenth volume of 3 M sodium acetate 0 3 M final 3 ul of 1 mg ml blue dyed glycogen and 2 5 volumes of 95 ethanol microcentrifuging and washing the pellet with 70 ethanol see Basic Protocol 1 steps 9 and 10 Use amplified DNA template for the next round of selection 12 Resuspend the pellet in 20 ul TE buffer or nuclease free deionized water Proceed with the next round of selection starting with step 1 of Basic Protocol 1 A 100 1 PCR reaction yields 1 ug dsDNA so approximately one quarter of the resus pended DNA will equate to 2 ug sample and should be used for the next transcription reaction The remaining dsDNA and potentially the remaining RNA after transcription can serve as a long term archival sample ASSAYING THE ACCUMULATION OF PROTEIN BINDING RNA SPECIES To verify that t
129. columns for the synthesis of the next codon The second strategy involves the synthesis of 20 trinucleotide phos phoramidite codons Virnekas et al 1994 Combinatorial peptide libraries are synthesized by coupling random or biased mixtures of the codon phosphoramidites The third strategy combines aspects of the first two strategies and involves sequentially coupling either an A G C or T phosphoramidite followed by a specific dinucleotide phosphoramidite to complete the codon Neuner et al 1998 After the comple tion of each codon the beads from the columns are mixed and repacked into new columns for the synthesis of the next codon The advantage of the codon incorporation method is that it generates unbiased libraries without stop co dons However there are drawbacks to this method For example the bead splitting can become extremely laborious for long peptides Also the synthesis of dinucleotide and trinu cleotide phosphoramidites is not trivial and these phosphoramidites are not currently com mercially available Once the combinatorial peptide libraries are constructed and inserted into the scaffold pro tein they need to be transformed into E coli and amplified Electroporation is the most effi cient method for transforming high diversity libraries into E coli DNA uptake by E coli is maximized under conditions of high field strength and low current flow see Sidhu and Weiss 2000 for conditions to maximize trans
130. common sequence that can be substituted for the hexahistidine tag Both sys tems rely on commercially available affinity purification reagents During selections not in volving the directed evolution of streptavidin the streptavidin biotin couple can potentially be used to affinity purify proteins following de emulsification in place of the His tag For each of these systems the key will be to ensure that the capture and retention of the protein product is efficient The procedure should be performed with the wild type protein prior to setting up a selection experiment Cell free translation There are a variety of translation lysates available that are compatible with protein pro duction in emulsions The most commonly used lysates are extracts from E coli so called Current Protocols in Molecular Biology S30 extracts from rabbit reticulocytes and from wheat germ The PURE system Protein synthesis Using Recombinant Elements con tains individually purified transcription and translation components from E coli Shimizu et al 2005 and has also been used to syn thesize proteins in emulsions Zheng 2007 However it is critically important that each lysate be used with an emulsion protocol that is appropriate for it Table 24 6 1 The protocol described in this unit is very specific for E coli Other literature should be consulted for emul sion selections in rabbit reticulocyte lysate Ghadessy and Hollinger 2004 or i
131. cts If product bands in the control lanes are as prominent as product bands in the experi mental lanes then it is necessary to check or remake reagents and go back and repeat the previous round of selection There is one exception to this rule in the initial rounds it is common to see a band in the no protein control lane because the proportion of the population that binds to the filter is typically greater than the proportion that binds specifically to the target However subsequent rounds of selection should result in the diminution or disappearance of the no protein band Observing the number of cycles needed to visualize a double stranded DNA band can loosely monitor the progress of the selection The number of cycles should be roughly proportional to the amount of RNA pool that originally binds to the protein Therefore if the RNA eluted from the no protein control requires more cycles for full amplification than does the RNA selected in the presence of protein it can be tentatively assumed that the selected RNA is binding to the protein Occasionally in the early rounds of selection this may not be true since a very small fraction of the pool will bind to the protein relative to the small fraction of the pool that adheres to the filter Counting PCR cycles is however only a very rough and frequently inconsistent measure of success In fact it is common for the number of cycles required to fully amplify selected nu
132. d critical parameter is the identifica tion of proteins targeted by peptide aptamers that have been isolated based on their ability to disrupt cellular processes In general peptide aptamer targets are more reliably obtained from panels of known proteins rather than from genomic or cDNA libraries Once putative pep tide aptamer targets have been identified using interaction trap hunts and mating interaction assays it is important to verify these targets Current Protocols in Molecular Biology using other means For example immunopre cipitation can be used to confirm that aptamers form complexes with their targets under in vivo conditions Genetic tests such as epistasis analysis can be used to identify the location of the aptamers relative to a known protein Pep tide aptamer targets can be deleted or overex pressed and the resulting phenotype compared to the aptamer induced phenotype Similarly whole genome transcript arrays can test whether aptamers cause the same response as known inhibitors or mutations Anticipated Results In general approximately one out of every 10 peptide aptamers screened using the inter action trap interacts with a given target protein Colas et al 1996 Xu et al 1997 Fabbrizio et al 1999 Based on results using the yeast pheromone response pathway as a model proc ess approximately one out of every 10 to 106 peptide aptamers can inhibit a cellular process Geyer et al 1999 These resu
133. e amount of resin required may have to be optimized based on how much protein is produced in the reaction and on the capacity of the resin While the guidelines provided by suppliers are a reasonable starting point preliminary capture experiments should always be carried out Incubate at room temperature for 30 min on an end over end rotator End over end rotation may facilitate the binding of the His tag to the anti polyhistidine antibody Stringency can be increased at this step by increasing the incubation time and thus the time during which each protein must continuously bind the target molecule at tached to its template Release and rebinding is reduced by the presence of a competitor in this case excess biotin Microcentrifuge the reaction 5 min at 13 000 x g room temperature Carefully remove and discard the supernatant without disturbing the agarose resin pellet Add 1 ml of TTBS to the resin Wash the resin by gently inverting or flicking the tube Microcentrifuge the reaction 5 min at 13 000 x g room temperature Carefully remove and discard the supernatant without disturbing the agarose resin Repeat this wash step three times Add 400 ul of elution buffer to the agarose resin pellet Vortex the reaction Mi crocentrifuge the reaction 5 min at 13 000 x g room temperature Remove the supernatant and place it in a clean 1 5 ml microcentrifuge tube Repeat this step once and combine the two elution fractions This step denat
134. e equally hard to vanquish once established It is for this reason that the authors strongly recom mend the sometimes tedious but inherently faithful regime of reverse transcription PCR and in vitro transcription for the amplification of RNA pools However successful selections have been carried out that have relied upon isothermal amplification see for example Breaker et al 1994 Wright and Joyce 1997 Wlotzka and McCaskill 1997 and this ad monition can most confidently be challenged if the starting pool is a partially randomized binding site or ribozyme The reason is that isothermal amplification parasites are more likely to be found in or derived from a deep random pool than in a pool that centers on a given functional sequence Anticipated Results Table 24 3 1 shows the progression of a selection carried out in the authors lab against bFGF using an RNA pool with a 30 nucleotide long randomized region In order to evaluate the success of a selection experi ment it was necessary to compare the affinity of the selected pool versus the affinity of the unselected pool for the protein target Support Protocol 3 When assaying the pool after a round of selection it was necessary to val idate the fraction of the pool that bound to the protein by including a no protein control If the accumulation of matrix binding species had been evident more stringent negative se lections could have potentially been used to c
135. e following equations Typically a 1 umol synthesis of a 100 residue template yields a pool of 10 5 amplifiable molecules Regardless of the degree of partial randomization or the precise doping strategy employed the number of different mutational combinations is given by 3 LV n L n where n is the number of sequence substitutions template in a template of length L For example in the case of the 66 nucleotide RRE pool discussed earlier there were 2 17 x 10 possible 5 residue substitutions and 1 25 x 10 possible 10 residue substitutions To calculate the fraction of a given set of substitutions that are actually contained in a doped pool the binomial probability distribution can be used POL LAL my POd f where P is the fraction of the template population when fis the probability of substitution position If primarily single base substitutions are desired then f should be maximized for n 1 if multiple mutations e g double or triple substitutions are desired then f should be correspondingly higher If the doping strategy is optimized for n substitutions then this number of substitutions will occur most frequently n 1 and n 1 substitutions will occur less frequently but in roughly equal numbers and so forth Higher levels of sequence substitution skew the mutant frequency distribution allowing the sampling of some regions of sequence space to the exclusion of others Fig 24 2 3 There
136. e splint as primer PCR amplification Restriction native PAGE purification ligation native PAGE purification optionally repeated one or more times Product Protein cassettes with both affinity tags ORF tag1 tag2 displayed upon their stop codon free and Pon R ARR l 1 frameshift free mRNA display templates Misinitiated protein cassettes without an ORF tag 2 N terminal affinity tag displayed upon i cecees P i partly untranslated mRNA display templates frame Frameshifted protein cassettes without a ORF shifting tag 1 C terminal affinity tag displayed upon mRNA Ae Ws display templates with deletions deletion or mRNA display templates with stop codons Se not displaying proteins and untranslated ORF codon mRNA display templates H Reticulocyte lysate mRNA Protein cassettes with both affinity tags ORF tagi Boe displayed upon their stop codon free and A nid ADRK a aiihalscande frameshift free mRNA display templates frame Frameshifted protein cassettes without a ORF shitting tag 1 C terminal affinity tag displayed upon mRNA ng l display templates with deletions deletion or Protein cassettes with both affinity tags insertion displayed upon their stop codon free and or tagi tag2 frameshift free mRNA display templates AAt 1 Protein cassettes with both affinity tags Saj tag1 tag2 displayed upon their stop codon free and DMA
137. e used to gener ate libraries in which phenotype is connected with genotype There are several popular vari ants of in vitro display technologies ribo some or mRNA display Lipovsek and Pluck thun 2004 and in vitro compartmentalization Rothe et al 2006 In ribosome display the elimination of a stop codon or release factor leads to mRNAs being noncovalently linked to peptides or proteins extruded through the exit pore of the ribosome The entire complex can be selected for binding or other functions In mRNA display the antibiotic puromycin which normally covalently adds to growing peptide chains is linked to a nucleic acid caus ing the nucleic acid to be covalently added to a growing peptide or protein chain Again an mRNA is connected to its translated protein counterpart except in this instance the con nection is via a covalent linkage rather than a noncovalent one An excellent description of mRNA display can be found in UNIT 24 5 Finally in vitro compartmentalization meth ods utilize in vitro transcription and transla tion mixes in water in oil emulsions to gen erate literally billions of separate cell like compartments where individual proteins in a library can be made In this instance the con nection between genotype and phenotype is initially enforced by the compartment itself Clever schemes to further enforce the linkage have also been devised e g a gene that is covalently coupled to a bead produ
138. ectly compared with outputs caused by the bait alone and 3 they allow the detection of interaction strengths independent of the differences in plating effi ciencies caused by differential reporter activa tion Estojak et al 1995 Currently protein panels that cover an organism s entire proteome are not commercially available Consequently the identification of targets for peptide ap tamers isolated using genetic screens will con sist of limited panels of known proteins com plimented with cDNA or genomic libraries Inhibitory mechanisms of peptide aptamers Peptide aptamers inhibit protein function by a variety of mechanisms For example peptide aptamers can bind to protein targets and disrupt their interactions with other proteins They can disrupt protein interactions within cells Xu et al pers comm and in two hybrid assays Geyer et al 1999 and they can inhibit en zymes by competing with their substrates for active site binding Cohen et al 1998 In addition to disrupting protein interactions pep tide aptamers can also inhibit protein function by mislocalizing protein targets Peptide ap tamers modified with a localization signal can transport their target proteins into various cel lular compartments Colas et al 2000 Peptide aptamers fused to catalytic domains can also direct the substrate specificity of enzymes They can be used to localize enzyme activities to specific protein targets Colas et al 2
139. ed down to hold the filters in place then attached to a vacuum for filtration Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 3 9 Supplement 88 BASIC PROTOCOL 2 Selection of RNA Aptamers 24 3 10 Supplement 88 Utilization of a multichannel micropipettor Pipet Lite with LTS Rainin for the prewash and wash steps is recommended Alternatively the entire wash volume can be added to the blot at once 7 Disassemble the manifold apparatus and transfer the membranes to a clean paper towel Dry for 5 min at room temperature or in an 80 C oven Handle membranes with a clean pair of forceps or tweezers 8 Cover membranes with plastic wrap and expose to a phosphor screen e g PhosphorImager or X ray film for 4 to 12 hr also see APPENDIX 3A If the samples have a very high specific activity the exposure time can be reduced to between 5 and 60 min 9 Measure the radioactivity using the PhosphorImager or a densitometer if X ray film was used to develop the image and calculate the binding percentages as follows Fraction bound cpm on nitrocellulose cpm on nitrocellulose cpm on nylon If X ray film was used to develop the image then a digitizer densitometer should yield similar results to those obtained with a PhosphorImager 10 Plot the fraction bound as a function of the concentration of unbound protein Fit the points to a curve using graphing software
140. ed from one another following de emulsification Levy et al 2005 In the method described herein a binding target is covalently attached to each DNA template Following transcription and translation the reaction is de emulsified and the translated protein is captured Functional protein variants mediate recovery of their DNA templates by binding the target molecule through the protein capture step The ultimate goal of this protocol is the identification of protein sequences that bind the target molecule For example functional streptavidin variants that bind their biotinylated templates can be selected Levy and Ellington 2008 Fig 24 6 1 Figure 24 6 1 figure appears on next page Scheme for binding selections in in vitro com partments A A generic template for binding selections top and the template for streptavidin selections bottom as further described in Levy and Ellington 2008 The leftmost triangle repre sents the target molecule attached to the template e g biotin The promoter T7 RNA polymerase promoter is required for transcription initiation while the ribosome binding site RBS enhances translation initiation The tag is part of the protein sequence a hexahistidine or Hisg tag in the current example and enables affinity purification of the translated protein B Selection schema showing recovery of a desired template and protein light gray and removal of inactive template dark gray From top to bottom
141. ed ssDNA pool can range from 10 to 30 for in house syntheses to as high as 75 for commercial syntheses The complexity of the pool is then the yield determined in step 1 multiplied by the extension efficiency percent extension determined above If the complexity of the pool is insufficient for planned experiments then the pool must be resynthesized DETERMINING THE POOL BIAS Following extension the reaction should be repeated using a cold primer and the non radioactive double stranded DNA pool should be amplified in a PCR reaction cloned e g using a TA cloning kit from Invitrogen and individual members sequenced to de termine the degree of randomness The cloning step could also be carried out following PCR optimization see Support Protocol 3 From 20 to 30 clones should be sequenced to determine the base composition of the starting pool The random region should be composed of roughly 25 of each base A pool with the random region skewed toward one or more bases gt 30 should be resynthesized Current Protocols in Molecular Biology SUPPORT PROTOCOL 2 Generation and Use of Combinatorial Libraries 24 2 17 Supplement 88 SUPPORT PROTOCOL 3 DNA Pools for In Vitro Selection 24 2 18 Supplement 88 SMALL SCALE PCR OPTIMIZATION OF POOL AMPLIFICATION To enhance yield and further avoid bias the amplification conditions for a pool should be optimized prior to carrying out a large scale amplification
142. efficiency If the pool s average number of doublings per cycle is lt 1 8 then the PCR conditions chosen may skew the representation of the pool In that case PCR conditions should be modulated to enhance PCR efficiency The following parameters or variables are most amenable to modification It is best to begin the optimization with a single set of reaction conditions modify individual parameters relative to this one reference reaction and then combine all advantageous alterations into a single reaction For more information on PCR see UNIT 15 1 Theoretically PCR can proceed until the primers or dNTPs are depleted Therefore primer and dNTP concentrations should be well above those used for the amplification of small amounts of DNA Primer concentrations from I uM to as high as 5 uM have been used Generation and although concentrations gt 5 uM are generally not helpful It may be useful to scan both Use of above and below 2 5 uM in 0 5 uM increments Combinatorial Libraries 24 2 19 Supplement 88 Current Protocols in Molecular Biology DNA Pools for In Vitro Selection 24 2 20 Supplement 88 Magnesium concentration affects both primer annealing and the fidelity of Taq which decreases with increasing magnesium concentration Starting at the magnesium concen tration supplied in the PCR buffer usually 1 5 mM scan in 1 mM increments toward 5 mM as a maximal concentration DNA denaturation at temperatures above 95
143. egions of 6 to 9 positions separated by a constant domain The first column was synthesized with 6 random positions the second with 7 random positions etc Following the addition of the intervening constant sequence the synthesis was stopped the four columns were opened and the resins from the four columns were mixed The mixed resins were then equally redivided into four new columns and the synthesis was resumed The first column incorporated 6 positions the second column 7 positions etc Thus the first column contained oligonucleotides in which the first random segment was 6 7 8 or 9 residues long and a second random segment that was uniformly 6 residues long The second column contained oligonucleotides in which the first random segment was 6 7 8 or 9 residues long and a second random segment was uniformly 7 residues long and so forth Following the completion of all four syntheses the reactions were combined to generate the final random sequence pool PURIFICATION OF A RANDOM SEQUENCE POOL A newly synthesized oligonucleotide pool should be deprotected in accordance with the instructions provided for a given phosphoramidite reagent see for example step 1 below then lyophilized and purified on a denaturing polyacrylamide gel UNIT 2 12 prior to amplification Oligonucleotides can also be purified using HPLC or commercially available spin columns but HPLC purification is not recommended for ssDNA pools due to concerns about cro
144. elution 0 01 1 phase of aptamer selection Proportion of mRNA displayed proteins in final elution 3 60 phase of aptamer selection Other statistics relating to mRNA display protein selections Number of rounds of selection until activity peaks or plateaus 8 12 Initial diversity of mRNA display library 102 1013 ea ies Final diversity of mRNA display library gt 1 104 Combinatorial Libraries 24 5 33 Current Protocols in Molecular Biology Supplement 53 Protein Selection Using mRNA Display 24 5 34 Supplement 53 Colas P Cohen B Jessen T Grishina I McCoy J and Brent R 1996 Genetic selection of pep tide aptamers that recognize and inhibit cyclin dependent kinase 2 Nature 380 548 550 Fields S and Song O 1989 A novel genetic system to detect protein protein interactions Nature 340 245 246 Gold L Allen P Binkley J Brown D Schneider D Eddy S R Tuerk C Green L MacDougal S and Tasset D 1993 The shape of things to come In The RNA World R F Gesteland and J F Atkins eds pp 497 509 Cold Spring Harbor New York Jermutus L Ryabova L and Pl ckthun A 1998 Recent advances in producing and selecting functional proteins by using cell free translation Curr Opin Biotechnol 9 391 410 Joyce G F 1993 Evolution of catalytic function Pure amp Appl Chem 65 1205 1212 LaBean T H and Kauffman S A 1993 Design of synthetic gene libraries encodin
145. eng 2007 4 5 Span 80 0 1 Triton X 100 Rabbit reticulocyte lysate Mineral oil 4 Ghadessy et al 2004 Abil EM90 Wheat germ extract Mineral oil Yonezawa 2003 4 4 Span 85 0 6 Tween 20 A summary of the lysates used in in vitro compartmentalization experiments and the reagents used to emulsify them Evonik Degussa North America http vww degussa nafta com Protein synthesis Using Recombinant Elements New England Biolabs 2 Create a sequence library for the protein of interest This is commonly done through mutagenic PCR e g UNIT 8 3 but can also be done by synthesizing a gene or primer with randomized sequence positions For example in Fig 24 6 1A particular positions within a streptavidin gene were randomized via PCR with a primer containing a randomized region The extent of mutagenesis should be confirmed by sequencing random clones from the unselected population Approximately ten random clones is a good starting point More or fewer can be sequenced at the user s discretion Set up the emulsion 3 Foreach emulsion reaction set up a Sarstedt tube containing 1 ml of the oil surfactant mixture described below with a Spinplus stir bar and place on ice 949 5 ul mineral oil 45 ul Span 80 5 ul Tween 80 0 5 ul Triton X 100 This oil surfactant mixture is optimized for an E coli S30 transcription translation lysate for other lysates refer to Critical Parameters and Table 24 6 1 Because of the vi
146. ent oligonucleotide synthetic methods involve a stepwise addi tion of nucleoside phosphoramidites to the 5 hydroxyl of an oligonucleotide immobilized on Controlled Pore Glass CPG resin The dimethoxytrityl DMTr protecting group of the oligonucleotide is first de blocked with trichloroacetic acid TCA This step pro duces a free trityl that can be monitored spec trophotometrically to assess extension effi ciency Then the phosphoramidite is activated by tetrazole and nucleophilic attack of the free 5 hydroxyl results in the formation of a phosphite bond This process is very fast lt 30 sec and typically goes to near com pletion 97 to 100 Uncoupled oligonu cleotides are capped with acetic anhydride and 1 methylimidazole to prevent further elonga tion The capped sequences account for re duced yields during longer syntheses During the last step of the synthesis cycle the phos phite bond is oxidized with iodine and pyridine to yield the more familiar phosphotriester The DMTr group on the newly incorporated phos phoramidite is then deprotected and the cycle starts over Variations on this cycle allow for the incorporation of phosphorothioates unnat ural C 5 C3 linkages and other more chem ically challenging nucleosides With the development of de novo oligonu cleotide synthesis it became possible to not only carry out site specific mutagenesis but also to create random sequence pools Hermes et al
147. epeat transcription and gel purification See above Repeat ligation Redesign protein library with more methionines Further deionized water washes are needed to wash away residual salt Use more denaturing conditions for the binding step or redesign library Add denaturant to the wash and elution buffers Redesign protocol to exclude chelating agent Determine which PCR amplification components are contaminated and replace them Increase the stringency of the mRNA displayed protein purification protocol or determine which mRNA displayed protein purification components are contaminated and replace them Redesign or mutagenize library and reselect Test selection step with positive and negative controls redesign to maximize distinction 24 5 32 Supplement 53 continued Current Protocols in Molecular Biology Table 24 5 2 Troubleshooting Guide to Problems That May Be Encountered In Protein Selection Using mRNA Displayed Proteins continued Problem Possible cause Solution No families observed in sequencing data at end of selection Selected sequences not active as mRNA displayed proteins Selected sequences active as mRNA displayed proteins but not as free proteins Biases in PCR transcription translation or protein display overwhelming selection bias Immobilized target not accessible to mRNA displayed proteins Not enough cycles of selection and amplification performed There
148. eptide aptamers The gal promoter induces aptamer expression in the presence of galactose and represses expres sion in the presence of glucose The resulting aptamer thioredoxin vector is transformed into E coli by electroporation also see UNIT 9 3 for electroporation techniques Materials 5 U ul Klenow DNA polymerase and 10x reaction buffer New England Biolabs 5 mM 4dNTP mixture 5 mM each dTTP dATP dGTP and dCTP 10 U ul Aval and 2 U ul RsrII restriction enzymes and 10x reaction buffers New England Biolabs 10 mM Tris Cl pH 8 APPENDIX 2 Nondenaturing loading buffer see recipe DNA elution buffer see recipe Thioredoxin expression vector plasmid pJM 1 pJM 2 or pJM 3 Fig 24 4 1 10 U ul calf intestinal alkaline phosphatase CIP and 10x reaction buffer New England Biolabs 2000 U ul T4 DNA ligase and 10x reaction buffer New England Biolabs Ql Aquick gel extraction kit Qiagen Ultrapure water sterile water for irrigation preferred Fisher Scientific E coli MC 1061 Bio Rad electroporation competent UNIT 9 3 SOC medium UNIT 1 8 prewarmed to 37 C LB plates and liquid medium um 1 1 containing 50 ug ml ampicillin Large scale plasmid preparation kit various commercial sources e g Qiagen optional DNA synthesizer 16 and 95 C water baths PCR purification column e g Qiagen optional Electroporator e g Bio Rad Gene Pulser with 0 2 cm gap electroporation cells Current Protocols in Mo
149. equence UNIT 7 3 the variable regions FORWARD ANALYSIS OF CELLULAR PROCESSES USING PEPTIDE APTAMERS Combinatorial libraries of peptide aptamers can function as dominant agents for the forward analysis of cellular processes Peptide aptamers function as mutagens ran domly inhibiting gene function and altering the phenotype of an organism Forward analysis with peptide aptamers involves expressing combinatorial libraries in organisms and screening or selecting for aptamer induced changes in their phenotypes The peptide aptamer targets are subsequently identified using the interaction trap The protein targets can be identified from panels of proteins using a mating interaction assay Finley and Brent 1994 or by screening for aptamer interactions against genomic or cDNA libraries using the interaction trap UNIT 20 1 Currently complete panels of proteins are not available for any organisms except yeast As a result panels of known proteins will need Current Protocols in Molecular Biology to be combined with cDNA and genomic libraries of proteins to identify peptide aptamer targets The design of a genetic selection is beyond the scope of this protocol A typical genetic selection requires the transformation of an organism selection strain with a peptide aptamer expression library containing 10 to 10 members Peptide aptamers are ex pressed under the control of an inducible promoter allowing the aptamer induced phenotype to
150. er 285 mg ATP 2Na mol wt 569 5 mM final 84 7 mg MgCl mol wt 95 2 8 9 mM final 2 92 g KCI mol wt 74 6 392 mM 476 mg HEPES mol wt 238 20 mM final continued Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 5 27 Supplement 53 Protein Selection Using mRNA Display 24 5 28 Supplement 53 3 07 mg glutathione mol wt 307 2 mM final 3 06 mg glutathione disulfide mol wt 612 1 mM final 3 72 mg EDTA 2Na mol wt 372 100 uM final 0 25 g Triton X 100 0 25 w v final Bring up to 100 ml with water Store at 20 C Deoxygenate the buffer before the addition of the glutathione by bubbling an oxygen free grade of an inert gas such as argon or nitrogen through it and adjust the pH to 7 4 FLAG binding buffer 877 mg NaCl mol wt 58 4 150 mM final 1 19 g 50 mM HEPES mol wt 238 50 mM final 0 25 g Triton X 100 0 25 w v final Adjust the pH to 7 4 with NaOH HC1 Bring up to 100 ml with water Store at 20 C FLAG clean buffer 751 mg glycine mol wt 75 1 100 mM final 0 25 g Triton X 100 0 25 w v final Bring up to 100 ml with water Store at 20 C Adjust pH to 3 5 with NaOH HCI1 Ni NTA binding buffer 57 4 g guanidine hydrochloride mol wt 95 5 6 M final 2 93 g NaCl mol wt 58 4 500 mM final 1 42 g Na HPO mol wt 142 100 mM final 121 mg Tris hydroxymethyl aminomethane mol wt 121 10 mM final 0 25 g Triton
151. er binding sequences the authors have filtered RNA samples multi ple times in the absence of protein and in some cases filtered samples following selection but prior to the RT PCR step Matrix binding se quences can also be avoided by altering the matrices used for selection For example tech niques such as gel mobility shifts immunopre cipitation and affinity chromatography have all been successfully used to sieve pools and select target binding aptamers Conrad et al 1996 If filter binding species predominate in a population even after appropriate precau tions are taken these alternative selection tech niques can be used either to rid the selected population of the filter binding species or bet ter yet to restart the selection For example if the immunoprecipitation of RNA protein com plexes has been worked out in advance then Current Protocols in Molecular Biology immunoprecipitation can be interspersed with rounds of filter binding Even though the selection of filter binding sequences can be a problem filter binding is still generally recommended as the technique of choice for most selections Gel mobility shift experiments tend to be much more sen sitive to parameters such as sample prepara tion ionic strength pH and electrophoresis conditions than are filter binding experiments Moreover just as filter binding species can be inadvertently selected during filtration selec tion RNA species with altered e
152. er the number of residues that are randomized the more likely it will be that a novel aptamer sequence or structure will be discovered Recently computational models and simulations have been developed that might help in the design of smart pools Chen 2007 Primer design When designing pools the constant sequences at the 5 and 3 ends of a pool func tion as primer binding sites and can be almost any sequence or length Primers of 20 nucleotides in length are convenient because their melting temperatures are convenient Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 2 7 Supplement 88 DNA Pools for In Vitro Selection 24 2 8 Supplement 88 for PCR and they can easily be synthesized in high yields In designing constant se quences and complementary primers obvious artifacts associated with the PCR such as secondary structure formation or self association that could lead to the production of primer dimers should be avoided Web based programs such as Integrated DNA Tech nologies OligoAnalyzer http www idtdna com analyzer Applications OligoAnalyzer or MIT s PRIMER3 http frodo wi mit edu can assist in designing constant primer binding regions Each of these programs has initial variables that must be set Utilizing the values that mimic reaction conditions such as salt and dNTP concentrations in PCR is suggested As a rule of thumb one should try to a
153. ese reporter genes Basic Protocol 3 describes the use of the yeast mating interaction assay to evaluate the specificity of peptide aptamers Haploid yeast exist in two mating types a or a where Opposite mating types can mate to form diploids a a The mating interaction assay detects aptamer protein interactions by generating panels of aptamer preys in one mating type and panels of target bait proteins in the opposite mating type Mating of the haploid strains forms diploid strains that carry both the bait and prey Interactions between baits and preys are detected using the interaction trap reporters The mating interaction assay Contributed by C Ronald Geyer Current Protocols in Molecular Biology 2000 24 4 1 24 4 25 Copyright 2000 by John Wiley amp Sons Inc UNIT 24 4 Generation and Use of Combinatorial Libraries 24 4 1 Supplement 52 Peptide Aptamers 24 4 2 Supplement 52 allows aptamer specificity to be assessed against large arrays of different but related proteins and against mutants of the same protein Basic Protocol 4 describes an affinity maturation strategy for enhancing the affinity of peptide aptamers to their target proteins PCR mutagenesis is used to introduce random mutations into the variable region of a peptide aptamer Peptide aptamers with enhanced affinity are isolated using a modified version of the interaction trap that contains a more pJG4 4 2 um ori PGaLt TADH1 A
154. eviations D A G T K G T N A G C T R A G S C G V A C G W A T Numbers in parentheses indicate the number of codons for each amino acid Peptide Aptamers inactivate gene products without altering their genetic material The forward analysis of cel lular processes using peptide aptamers involves expressing libraries of peptide aptamers within cells and screening for aptamer induced phe notypes The protein s and protein interactions disrupted by the aptamers are then identified Basic Protocol 5 describes methods for per forming forward analysis of cellular processes in yeast Methods are also described for iden tifying peptide aptamer target s using interac tion trap hunts with genomic or cDNA libraries or by mating interaction assays using protein panels Support Protocol Combining aptamer library screening with interaction trap hunts and mating interaction assays provides a new strategy for analyzing processes in diploid or ganisms and in multicopy gene phenotypes 24 4 20 Supplement 52 Peptide aptamers have been used for the forward analysis of phenotypes in yeast Caponigro et al 1998 Geyer et al 1999 Norman et al 1999 and bacteria Blum et al 2000 In yeast peptide aptamers were isolated that inhibited mating pheromone response Caponigro et al 1998 Geyer et al 1999 Norman et al 1999 and spindle checkpoint Norman et al 1999 signal transduction path ways In
155. exactly what they selected for the peptides were presented in several copies and the best binding phage used these several copies to interact with a target Since these first demonstrations phage display methods have been devised for the selection of antibodies enzyme substrates and enzymes themselves Phage display selection is the subject of proto cols in other Current Protocols volumes e g Bradbury 1999 Galanis et al 1999 Benhar and Reiter 2002 Bradbury et al 2002 Enshell Seijffers and Gershoni 2002 Kay and Castagnoli 2003 and has been reviewed many times in the literature Kehoe and Kay 2005 In addition other viruses and entire cells have been used as vehicles for the display of protein libraries see for example Farinas 2006 Current Protocols in Molecular Biology 24 1 1 24 1 3 October 2007 Published online October 2007 in Wiley Interscience www interscience wiley com DOI 10 1002 047 1142727 mb2401s80 Copyright 2007 John Wiley amp Sons Inc UNIT 24 1 Generation and Use of Combinatorial Libraries 24 1 1 Supplement 80 Receptors from Combinatorial Nucleic Acid and Protein Libraries 24 1 2 Supplement 80 In addition to selecting peptides or proteins displayed on the outside of a cell or phage pep tides or proteins can be selected within cells There is a long history of carrying out directed evolution experiments with whole cells based in large measure on cel
156. expressed preparation should be fully tested for activity with controls and then the same sample or aliquot should be utilized throughout the selection Parasites Replication parasites differ from matrix binding aptamers but can interfere with the se lection of target binding aptamers in the same way Reverse transcriptase Taq polymerase and T7 RNA polymerase all have some pref erence for which sequences they will copy or reproduce These preferences are generally not obvious when constant sequence nucleic acids are being synthesized However in selection experiments many cycles of ampli fication are carried out and differences in the rates of synthesis are also proportionately am plified leading to the selection of sequences that have no function other than to replicate optimally For example during the polymerase chain reaction if a primer designed to bind to a constant sequence region instead recognizes a partially complementary sequence within a random sequence region it can bind and gen erate a smaller amplicon The smaller ampli con will generally be amplified more quickly than the larger amplicon and thus can poten tially out compete full length species selected for binding function Depending on the rela tive advantage of the replication parasite rela tive to an aptamer even if the replication par asite is partially removed from the population during each selection step enough molecules may remain to over ru
157. f RNA is preferable to decreasing the amount of protein For a more detailed treat ment of this subject see Irvine et al 1991 However the general conclusions of these mathematical models are similar to the em pirical advice given here Competitors High concentrations of non specific non amplifiable competitors such as tRNA or bulk cellular RNA will compete with low affinity binding species that adhere to ba sic patches on the surface of a protein Typi cally a 100 fold excess of tRNA is used Simi larly specific competitors can be used to block the access of low affinity binding species to a preferred site Wild type nucleic acid ligands can be used to block the binding sites of nu cleic acid binding proteins For example dur ing the selection of anti Rev aptamers Giver et al 1993 included a 10 fold excess of the wild type Rev binding element The anti Rev aptamers that were obtained could bind with high affinity to the RNA binding domain of Rev and could effectively compete with the wild type Rev binding element Other ligands or substrates can also be used to block the binding or catalytic sites of non nucleic acid binding proteins For example during the se lection of anti bFGF aptamers Jellinek et al 1993 included heparin a natural ligand for bFGF The anti bFGF aptamers that were ob tained could bind with high affinity to the hep arin binding site and could effectively compete with heparin Cation concen
158. f enrichment relative to standards is determined by real time PCR or by cloning and sequencing If substantial gt 10 fold enrichment is not readily apparent and active protein is being produced in emul sion see above individual steps of the recov ery and reamplification procedure should be investigated for either false negative signals through unintended loss of active variants or false positive signals through the nonspecific retention or amplification of inactive variants For example to test whether the recovery of genes following de emulsification is efficient a wild type protein can be added prior to emul sification and the fraction of genes recovered can be quantified by real time PCR A lack of enrichment could also be due to initially overloading aqueous compartments with mul tiple variants most of which may be inactive Therefore it is prudent to verify whether that there are only a small number of genes 0 to 2 per compartment The stringency of a selection refers to the level of function required for an individ ual member of the library to be propagated through the selection cycle for characterization and or further cycles or rounds of selection If a round of selection cannot separate func tional from nonfunctional variants it is not suf ficiently stringent and there cannot be enrich ment If a functional variant cannot be propa gated through a round of selection the selec tion is too stringent The app
159. f there is concern about sequence dependent bias in translation and protein display efficiencies affecting the distribution of different sequences in the library As the concentration of the mRNA display template is reduced the proportion of this template that ends up displaying protein increases with a concomitant increase in the fidelity with which the mRNA library sequence distribution is represented in mRNA displayed protein sequence distribution This is an advisable precaution at all stages in which the library is of relatively low diversity Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 5 17 Supplement 53 BASIC PROTOCOL 2 Protein Selection Using mRNA Display 24 5 18 Supplement 53 PURIFICATION AND REVERSE TRANSCRIPTION OF THE mRNA DISPLAYED PROTEINS It is extremely advisable to pilot each of the following protocol steps before attempting the large scale treatment of translation reaction mixture containing mRNA displayed proteins In order to separate the mRNA display templates that display proteins from those that do not it is necessary to use a purification step upon the basis of a protein affinity tag In this protocol the His tag is used although other protein affinity tags may be utilized Materials Oligo dT cellulose Amersham Pharmacia Biotech Oligo dT binding buffer see recipe 1 3 ml translation reaction mRNA displayed proteins see Basic Pr
160. ffered saline was used even though it lacked divalent cations Jhaveri 1998 Similarly ribozyme selections have been carried out in which a variety of divalent metal ions are mixed and nascent ribozyme species decide which combination of metals most enhance their ac tivities Lehman and Joyce 1993 An equiva lent strategy could be used for the selection of aptamers Selection matrices Due to the tremendous ratio of matrix surface area to protein surface area matrix binding aptamers can quickly and easily eclipse target binding aptamers Proteins are likely captured on nitrocellulose or modified cellulose filters via hydrophobic interactions Nucleic acids are by and large too hydrophilic or charged to be similarly captured This dis tinction is the basis for most filter binding assays However the nucleobases of nucleic acids obviously contain large hydrophobic sur face areas and it is easy to select nucleic acids that can present nucleobases and be cap tured by the filter Selected filter binding se quences frequently contain purine especially guanosine tracts presented as single stranded loops or bulges Interestingly hydrophobic binding sequences selected on one hydropho bic matrix are frequently cross reactive with other hydrophobic matrices i e microtiter plate binding species can bind tubes and fil ters filter binding species can bind tubes and microtiter plates and so forth In order to avoid filt
161. ffinity tag Should they result in misinitiation then the resultant proteins will not contain either of the protein affinity tags and will not copurify with the mRNA displayed full length proteins Placing out of frame stop codons close to the C terminus either before or after the tag in both the 1 and 1 frames will prevent those members of the library that are out of frame at the C terminus from forming mRNA displayed proteins This is especially useful in the context of a preselection see Fig 24 5 3 Incorporating a protein kinase phosphorylation site to allow P labeling of the protein may assist in assaying the free proteins Statistical appearance of different amino acids within the random region Most DNA libraries designed for protein selection encode a wide range of amino acids in their random regions Using a mixture of all four nucleotides at each of the three positions in the library codons will ensure that all 20 amino acids have some probability of appearing in every position of the resulting protein sequence During the library design process it is helpful to consider the average composition of amino acids that will result from the chosen nucleotide distribution the consequent average proportions of hydropho bic and charged amino acids and whether these proportions are suitable for the library and its intended target Additionally it is useful to consider the frequency with which certain individual amino acids will appear in t
162. fication is to be followed by a denaturing His tag purification then the elution fraction may be added directly to the 2x Ni NTA binding buffer MUTAGENIC PCR Mutagenic PCR may be used to increase the diversity of the DNA library that encodes the protein library Mutagenic PCR may be used to generate the initial library or to explore parts of sequence space proximate to the starting sequence s A broader discussion of the use of mutagenic PCR may be found in Cadwell and Joyce 1992 Before the entire mutagenic protocol is enacted it is important to pilot the PCR conditions to ensure that primer dimers are not taking over and that the amplification per cycle is at least 1 7 to 1 8 The optimum PCR amplification conditions may be different from non mutagenic PCR amplification performed upon the same library One may wish to redesign the primers since the part of the template sequence they anneal to will not be mutagenized Additional Materials also see Basic Protocol 3 2 5 M KCl 100 mM MnCl solution 100 mM Tris Cl pH 8 3 APPENDIX 2 100 ul PCR tubes Sarstedt Additional reagents and equipment for agarose gel electrophoresis UNIT 15 1 1 Make up the following PCR reaction mixture on ice 100 ul 100 uM 3 primer final 2 UM 100 ul 100 uM 5 primer final 2 UM 60 ul each 25 mM dCTP and dTTP final 1 mM 12 ul each 25 mM dATP and dGTP final 0 2 mM 30 ul 2 5 M KCl final 50 mM 10 5 ul 1 M MgCl final 7 mM 7
163. for good separation of near full length from non full length products the acry lamide concentration should be chosen so that the full length oligonucleotide will migrate approximately one half to three fourths of the way into the gel by the time the loading dye reaches the bottom For a pool between 80 and 130 nt this corresponds to an 8 to 10 gel It is recommended that pools be sieved on a medium format gel 15 cm x 17 cm with 1 6 mm spacers to ensure good separation and to prevent overloading 3 Resuspend the lyophilized or precipitated pellet in 100 ul of water or buffer i e TE buffer pH 8 0 per 250 nmol scale synthesis and add an equal volume of 2x denaturing dye Heat denature samples at 75 C for 5 min prior to loading Load the Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 2 13 Supplement 88 DNA Pools for In Vitro Selection 24 2 14 Supplement 88 entire 250 nmol scale synthesis or up to 1 3 of a 1 umol synthesis per polymerized gel and perform electrophoretic separation UNIT 2 12 It is often convenient to load several six wells in the gel in parallel although a single well that extends the breadth of the gel can also be loaded Place gel on a fluorescent TLC plate that has been wrapped in plastic wrap and excise the oligonucleotide product from the gel with the aid of a UV lamp using razor blades The desired oligonucleotide product is general
164. for intracellular applications Structural studies on thioredoxin reveal that its active site contains a 4 amino acid loop CGPC that is constrained by the two termi nal cysteines Katti et al 1990 This loop is tolerant to peptide insertion LaVallie et al 1993 and provides a site for displaying vari able peptides Thioredoxin is a small 12 Kd cytoplasmic protein that is nontoxic when ex pressed at high levels LaVallie et al 1993 Thioredoxin is often fused to proteins to en hance their solubility LaVallie et al 1993 This is a useful property for expressing random sequence libraries where many of the se quences may aggregate Thioredoxin interacts with a variety of disulfide containing protein substrates Wetterauer et al 1992 suggesting that it may also contribute to the binding inter actions between peptide aptamers and their protein targets Reverse genetic analysis using peptide aptamers Reverse genetic analysis using peptide ap tamers involves isolating aptamers that interact with a specific gene product and monitoring the aptamer induced phenotype Peptide aptamers that interact with a chosen protein are selected using yeast two hybrid systems or a variation thereof Chien et al 1991 Dalton and Treis man 1992 Durfee et al 1993 Gyuris et al 1993 Vojtek et al 1993 These systems share the following features 1 a DNA binding do main target protein fusion 2 a transcription act
165. fore in the RRE example already cited a pool of 1 x 10 3 molecules doped at a frequency of 35 would contain few 5 residue substitutions 1 x 10 x P 5 66 0 35 1 82 x 10 5 residue substitutions out of 2 17 x 10 possible 5 residue substitutions In contrast if the pool were doped at a frequency of 18 all 5 residue substitutions would almost certainly be included 1 x 10 x P 5 66 0 18 9 3 x 10 5 residue 14 a 18 substitution position Sec D9 cz 10 55 ES REE on oo 8 35 substitution position a5 SE es Cc Q Oc p L A 5 4 4 2 N T T T T T T T 0 2 4 6 8 101214 16 18 20 22 24 26 28 30 32 34 36 3840 42 44 46 48 50 52 54 56 58 60 62 64 66 Number of substitutions Figure 24 2 3 Comparison of substitution distributions for a 66 nucleotide pool doped to either 18 or 35 Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 2 5 Supplement 88 DNA Pools for In Vitro Selection 24 2 6 Supplement 88 substitutions Note that in a pool of only 1 x 10 total molecules neither doping scheme would yield all possible 10 residue substitutions Completely random pool design aptamer selection Completely random sequence pools are used to initiate selection experiments when no functional nucleic acid sequence or structural motif is known in advance There is really only one parameter to consider when designing a
166. fore the high salt incubation and N is the average number of methionines in a single displayed protein This calculation assumes that the initiating methionine is still present on the protein and that the concentration of methionine in the reticulocyte lysate is known 5 uM before addition to the translation reaction this last error can be reduced by adding a known amount of cold methionine to the translation reaction mixture A potentially more accurate method for the direct measurement of the concentration of mRNA displayed proteins is to construct the mRNA display template using a mixture of DNA linker that has been kinased 5 phosphorylated with labeled ATP as well as the cold kinased 5 phosphorylated linker This labeled template can then be translated in the presence of only cold methionine It is generally not possible to observe the difference in mobility on a SDS PAGE gel between the mRNA display template displaying protein and the mRNA display template alone The addition of a DNA oligonucleotide complementary to a region of the RNA part of the mRNA display template close to but not right at the 3 end of the RNA to the translation reaction mixture as well as magnesium chloride to 10 mM will cause the RNA part of the mRNA displayed proteins to be digested away by RNase G niratidnani H which contaminates reticulocyte lysate leaving proteins displayed upon the P labeled Use of DNA linker only These may easily be
167. g 24 5 1 Puromycin is an antibiotic that functions by inhibiting translation It sufficiently closely re sembles a charged tRNA that it is able to enter the A site of the ribosome and react with the activated C terminal of the nascent peptide Since this reaction results in the formation of a stable amide bond rather than the hydrolyzable ester bond that connects the tRNA to the amino acid in an amino acyl tRNA translation is halted If the puromycin is already attached to the mRNA that is being translated a stable covalent linkage results between a protein and the mRNA that encodes it and the ribosome may be purified away In a conceptual sense the most similar sys tems to mRNA display are phage display Smith and Petrenko 1997 and ribosome dis play Jermutus et al 1998 All three systems may be used to search nucleic acid libraries for the functional proteins or peptides they encode In phage display the protein library is encoded within the phage genome and is expressed upon the surface of the phage as a fusion with the phage coat protein Phage may be selected upon the basis of the functionality of their surface proteins and the protein may then be amplified by allowing the selected phage to replicate The diversity of phage display selection experi ments is limited to the numbers of phage that may reasonably be transformed or packaged which is 108 to 10 Recent advances have shown that it is possible to display libra
168. g lock down the filter holder top until it fits snugly Fig 24 3 3 Negative selection to remove filter binding species is an extremely important step in the selection procedure Filter binding species are typically more numerous in a naive RNA population than are aptamers If filter binding species are not efficiently sieved from the population they will quickly accumulate to the point where it may be difficult and likely impossible to select protein binding species If the potential for accumulating filter binding species is large i e the target has a low initial affinity for a pool or selections with DNA or modified RNA pools then repeat the preselection filtration to remove any filter binding species that may persist or carry out a post selection filtration see optional steps 17 through 20 below If filter binding species accumulate during a selection experiment it is usually best to repeat the selection starting with a different pool that can be amplified with different primers In addition to filter binding species replication parasites see Critical Parameters for discussion on parasites can accumulate in and over run a Selected population A separate regime is required to avoid these selection predators Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 3 11 Supplement 88 Selection of RNA Aptamers 24 3 12 Supplement 88 Figure 24 3 3 Components
169. g random se quence proteins with desired ensemble charac teristics Protein Sci 2 1249 1254 Liu R Barrick J Szostak J W and Roberts R W 2000 Optimized synthesis of RNA protein fu sions for in vitro protein selection Methods En zymol 317 268 293 Roberts R W 1999 Totally in vitro protein selec tion using mRNA protein fusions and ribosome display Curr Opin Chem Biol 3 268 273 Roberts R W and Ja W W 1999 In vitro selection of nucleic acids and proteins What are we learn ing Curr Opin Struct Biol 9 521 529 Roberts R W and Szostak J W 1997 RNA peptide fusions for the in vitro selection of peptides and proteins Proc Natl Acad Sci U S A 94 12297 12302 Sche P P McKenzie K M White J D and Austin D J 1999 Display cloning functional identifi cation of natural product receptors using cDNA phage cloning Chem Biol 6 707 716 Smith G P and Petrenko V A 1997 Phage display Chem Rev 9171 391 410 Stemmer W P C 1994 Rapid evolution of a protein in vitro by DNA shuffling Nature 370 389 391 Szostak J W and Ellington A D 1993 In vitro selection of functional RNA sequences In The RNA World R F Gesteland and J F Atkins eds pp 551 533 Cold Spring Harbor New York Wilson D S and Szostak J W 1999 In vitro selec tion of functional nucleic acids Annu Rev Bio chem 68 611 647 Wolf E and Kim P S 1999 Combinatorial Co dons A computer pro
170. gram to approximate amino acid probablilities with biased nucleotide usage Protein Sci 8 680 688 Key References Roberts and Szostak 1997 See above The first demonstration of the formation of mRNA displayed proteins RNA protein fusions Liu et al 2000 See above Describes the optimization of the synthesis and pu rification of mRNA displayed proteins RNA protein fusions Cho et al 2000 See above Describes the use of mRNA display and in vitro selection to construct various types of high quality library for use in mRNA display protein selections Internet Resources http gaiberg wi mit edu cgi bin CombinatorialCodons Combinatorial Codons is an extremely useful tool for the design of protein libraries it generates a nucleotide distribution that iteratively approaches an input amino acid distribution http xanadu mgh harvard edu szostakweb orf html This site is a database of exact oligonucleotide sequences that have been successfully used in the construction of random patterned and structure based mRNA displayed protein libraries http paris chem yale edu extinct html The Biopolymer Calculator is a very useful general tool for molecular biology http sun2 science wayne edu 7Ejslsun2 servers seqanal A nucleic acid secondary structure prediction algo rithm is given by mfold Contributed by Anthony D Keefe Massachusetts General Hospital Boston Massachusetts Current Protocols in
171. h 1000 ul ATP aptamer selection binding buffer at 4 C allow to stand 10 min between washes Elute six times with 250 ul ATP aptamer selection elution buffer at 4 C allow to stand 10 min between elutions Assay all fractions using scintillation counting If the proportion of mRNA displayed proteins in the elution fraction is high gt 5 it may be helpful to perform more than one selection step between amplification steps In the case of an aptamer selection this will necessitate the purification of the selected mRNA dis played proteins away from the elution buffer This purification can be performed while preserving native conditions and often directly in the selection buffer upon the basis of the FLAG tag as described in Support Protocol 1 Alternatively this purification can be performed with a denaturing and renaturing step optionally upon the basis of the His tag under denaturing conditions as described above Purify selected cDNA sequences that encode selected mRNA displayed proteins 6 To 1 5 ml of eluted mRNA displayed proteins add 200 ul of 100 mM EDTA and 200 ul of 1 M NaOH heat for 10 min at 90 C cool on ice and add 200 ul of 1 M HCI 7 Exchange the buffer into deionized water on a NAP 25 gel filtration column accord ing to the manufacturer s instructions Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 5 23 Supplement 53 Protein Selection
172. he DNA linker in deionized water and measure the concentration using UV visible spectroscopy at 260 nm Each of the spacer 9 units result in the incorporation of a triethylene glycol phosphate ester this adds extra flexibility to the region of the template close to the puromycin and may result in a higher proportion of the resultant mRNA display templates displaying protein Kinase 5 phosphorylate the DNA linker using polynucleotide kinase by making up the following 1 ml kinase reaction mixture 300 ul 100 UM DNA linker final 30 uM 10 ul 100 mM ATP final 1 mM 100 ul 10x T4 polynucleotide kinase buffer final 1x 490 ul water 100 ul 10 U ul T4 polynucleotide kinase final 200 U ml Incubate the reaction mixture for 2 hr at 37 C add 200 ul of 100 mM EDTA heat for 5 min at 90 C and desalt on a gel filtration column It is important to heat denature the polynucleotide kinase to prevent it from acting in the subsequent ligation reaction The size of the kinase reaction should be adjusted to give an appropriate amount of 5 phosphorylated DNA linker Synthesize splint 9 10 11 Synthesize the splint a DNA oligonucleotide with a sequence reading from the 5 end of 10 nucleotides complementary to the 3 end of the RNA library and 210 nucleotides complementary to the 5 end of the linker usually T see UNIT 2 11 for oligonucleotide synthesis methods Purify by denaturing PAGE UNIT 2 12 Extract DNA f
173. he RNA pool has been or is being winnowed to those few sequences that bind the protein target with high affinity and specificity the selected RNA pool should periodically be assayed for its ability to bind the target protein The authors recommend an initial binding assay after five rounds of selection and amplification then again every three additional rounds the same recommendation that was made with regard to checking for filter binding species the two tests can be carried out in parallel While the initial binding assay is carried out at a series of protein concentrations to gauge the amount of protein that should be used in the selection the progress of the selection can be most simply monitored by internally radiolabeling the RNA and determining how much binds to a single convenient concentration of the protein target Materials Pool of dsDNA after n rounds of selection Basic Protocol 3 Binding buffer see Critical Parameters Target protein 167 mCi ml x 32P ATP 7000 Ci mmol ICN Biomedical Inc or GE Healthcare Life Sciences Additional reagents and equipment for purifying a radiolabeled RNA pool see Basic Protocol 1 and performing the filter binding assay see Support Protocol 2 1 Generate radiolabeled RNA pool via a hot transcription with labeled nucleoside triphosphate typically x P GTP or ATP and purify as described previously Basic Protocol 1 The transcription is carried out as described in Basic P
174. he authors frequently find this rough estimate to be accurate The accumulation of double stranded DNA is closely monitored in order to avoid over amplification of the sample and the concomitant accumulation of high molecular weight species DNA that has been over amplified will look blurry and dispersed following analysis by gel electrophoresis These large DNA molecules are often the result of the 3 end of a single stranded DNA folding back and internally priming its own extension resulting in a long stem loop that can be amplified by a single PCR primer also known as single primer artifacts Over amplified DNA templates can also yield RNA molecules of the incorrect size following transcription If one primer is more abundant or efficient than the other a smaller single stranded DNA band or bands may also be present The various controls no protein no template no reverse transcriptase should be am plified in parallel with the actual sample If specifically bound RNA is acting as a template for the accumulating amplicons then the no RT sample should lag the pool PCR reac tion by at least three cycles It is desirable that no bands be observed in the no template control but if they do arise they should lag the RT PCR reaction by at least five cycles If bands do arise a distinction should be made between full length PCR products indicat ing contaminating replicons and smaller products likely primer amplification artifa
175. he gel can be monitored using adherent thermometers VWR In some cases very large amounts of RNA may need to be purified for example the initial transcription of an extremely complex DNA library may yield upwards of a milligram or more of an RNA library In these instances it may be desirable to purify the RNA library by either gel filtration or ion exchange chromatography e g Qiagen RNA kit However the purification of the initial or subsequent pools should never be neglected as foreshortened amplicons can arise and overtake selected populations 4 Fully denature the RNA pool by adding an equal volume of 2x denaturing dye and heat the RNA dye mix for 3 min at 65 to 75 C Although each species in the pool has a different sequence and shape they should migrate similarly when fully elongated Using a higher temperature or longer denaturing time risks hydrolysis of the RNA into smaller fragments given the high concentration of Mg present in the transcription buffer Thoroughly rinse each well of the gel prepared in step 3 with TBE buffer using a plastic Pasteur pipet 1000 11 micropipettor tip or syringe prior to loading to remove urea which will otherwise leach into the wells and form a barrier between the loaded sample and the gel Load samples directly on the gel a single 20 l transcription reaction will typically fit into a 1 cm wide lane Run electrophoresis for 45 min to 1 hr at 400 V until the bromphenol b
176. he random region Cysteines can coordinate transition metal ions or form disulfide bonds histidines can accept or donate protons or coordinate transition metal ions and prolines may disrupt secondary structure Other specific amino acids may be suitable for interacting with intended substrates Frequency of stop codon appearance in random libraries Using a mixture of all four nucleotides at each of the three positions in the library codons in the DNA encoding the protein library will also introduce stop codons This will reduce the proportion of expressed protein that is displayed because stop codons will cause the ribosome to release the mRNA before the terminating puromycin is able to react with the nascent peptide By altering the proportions of the nucleotides in the DNA synthesis mixtures the frequency of stop codons can be reduced although this will also influence Current Protocols in Molecular Biology the proportions of other amino acids in the library Alternatively the DNA cassettes used to construct the library can be synthesized from mixtures of nucleotides chosen only with regard to the average amino acid composition they encode The resultant cassettes can then be preselected as described above in order to enrich the resultant library with those that do not contain stop codons As shown in Fig 24 5 3 if this procedure is done using two different affinity tags at the different termini of the ORF then the resultant library wil
177. hed protocols is vital to the success of the large scale amplification Cycle temper atures and times as well as the concentrations of polymerase primers and dNTPs see e g UNIT 15 1 Should be addressed prior to the large scale workup Most importantly since extremely large quantities of relatively expen sive reagents e g Taq polymerase may be re quired care should be taken to make sure that all reagents and procedures are in readiness Different priming sequences often require dis tinct PCR buffers for optimal extension effi ciency the best buffer for a given pool and primer combination can be easily and system atically identified through the use of a PCR optimization kit e g the PCR Optimizer Kit from Invitrogen Troubleshooting The most common problem with the syn thesis of a random sequence pool is the overall synthetic yield However researchers should carefully decide how many sequences are re ally necessary for their selection experiments In selection experiments from a pool with a rel atively limited potential diversity i e a seg mentally random pool with only 1 x 10 pos sible sequences or less even a low synthetic yield should be sufficient However in vitro se lection from a pool with a very high potential diversity i e a completely random pool with 1 x 10 gt possible sequences or more should use at least 1 x 10 4 different sequences ini tially in order to adequately sample the poten
178. how long it will take for the reaction mixture in a tube to come to thermal equilibrium by constructing a temperature probe placing a thermometer through the top of a 13 ml Sarstedt tube filled with 10 ml of water Place the probe in a rack with other similar tubes Typical equilibration times range from 2 to 8 min depending on the temperature differen tial Annealing and extension times of 5 6 and 7 min are typical It should be noted that these ramping temperature profiles are very slow relative to a commercial PCR machine and can yield more amplification artifacts To ensure that the reaction conditions actually work as planned fill the rack with tubes of water a single amplification reaction and the temperature probe Denature the sample for 30 min and then add Taq after the first annealing step Take aliquots at each cycle to monitor the progress of the reaction When reaction conditions have been confirmed proceed with the remaining ampli fication reactions Allow the final extension step to proceed for at least 20 min to ensure that all templates are completely double stranded Do not be alarmed if the solution becomes cloudy the detergent in the buffer causes the turbidity Amplification efficiencies of 3 to 4 doublings in 5 cycles can typically be achieved using this method Following the amplification pool the reactions from the individual wells or tubes Chelate the magnesium in the buffer by adding 1 1 molar equiva
179. ial libraries of peptide aptamers can function as dominant agents to randomly Generation and Use of Combinatorial Libraries 24 4 19 Supplement 52 Table 24 4 1 Degenerate Codons for Designing Combinatorial Peptide Libraries Codon Properties Amino acids ee Stop codons NNN All 20 amino acids A 4 C 2 D 2 E 2 F 2 G 4 H 2 64 TAA 1 TAG 1 TGA 1 IG K 2 L 6 MC N 2 P 4 QC R 6 S 6 T 4 VA W0 Y 2 NNS All 20 amino acids A 2 C 1 DC EC FC G 2 HC 32 TAG 1 10 K 1 L 3 MO NG PQ QU RG SG T2 VQ WL YO NNC 15 amino acids A 1 C 1 D 1 FC G 1 H 1 I 1 16 None Ld NO PO RC S 2 TA VA YQ NWW Charged hydrophobic D 1 E 1 F 1 H 1 I 2 K 1 L 3 16 TAA 1 NG QC V 2 YQ RVK Charged hydrophilic A 2 D 1 E 1 G 2 K 1 N 1 R 1 12 None S 1 T 2 DVT Hydrophilic A 1 C 1 D 1 GQ NC S 2 TC 9 None YQ NVT Charged hydrophilic A 1 C 1 D 1 GQ H 1 N 1 PC 12 None R 1 S TA YC NNT Mixed A 1 C 1 DC FC G 1 HC I 1 16 None Ld NO PO RC S 2 TU VC YQ VVC Hydrophilic A 1 D 1 G 1 H 1 N 1 PC RC 9 None S 1 TA NTT Hydrophobic F 1 I 1 L 1 VG 4 None RST Small side chains A 1 G 1 S 1 TC 4 None TDK Hydrophobic C 1 F 1 L 1 Wd YC 6 TAG 1 Based on a table described by Sidhu and Weiss 2000 b Abbr
180. ide kinase PNK New England Biolabs 167 mCi ml y P ATP 7000 Ci mmol ICN Biomedical or GE Healthcare Life Sciences 42 and 75 C water baths Centri Sep Spin Columns Princeton Separations NOTE All solutions and buffers should be made with deionized water 18 2 MQ re sistivity filtered through 0 2 um polyethersulfone PES membrane and sterilized by autoclaving Use sterile disposable plasticware and micropipet tips with filter barriers where possible See Chapter 4 introduction and unr 4 1 for guidelines on standard meth ods to protect against contaminating RNases If ribonuclease contamination is found to occur it may be eliminated by treating water with diethylpyrocarbonate DEPC see UNIT 4 1 Dephosphorylate the 5 triphosphate termini of the isolated RNA pool 1 Mix the following components 1 ug RNA in lt 3 5 ul volume 0 5 ul 10x alkaline phosphatase buffer 1 ul 1 U calf alkaline phosphatase x ul RNase free water for a total reaction volume of 5 ul The RNA sample may need to be reprecipitated to obtain an adequately concentrated sample If so the precipitate can be resuspended directly in the reaction buffer or mixture Calf alkaline phosphatase is preferred over bacterial alkaline phosphatase because the activity can be heat killed see step 4 prior to the addition of the radiolabel Current Protocols in Molecular Biology na A WO N 7 Incubate at 42 C for 20 min to 2 hr Add 95 ul RNase free
181. iderations described with regard to the N terminal constant ORF sequence also apply to the C terminal constant ORF sequence There are also additional considera tions that are specific to the C terminal sequence In the synthesis of the mRNA display template see Fig 24 5 4 the 3 terminus of the mRNA encoding the ORF is ligated to a short DNA oligonucleotide which is itself 3 terminated with puromycin the linker The 3 terminus of the mRNA and the 5 terminus of the DNA linker are coannealed to a short DNA oligonucleotide the splint which is complementary to both of them and presents the junction to be ligated as a nicked double stranded nucleic acid Consequently the secondary structure of the splint the mRNA and the linker should be checked for self structure likely to interfere with the assembly of the splinted nicked double stranded complex This can most easily be done using a computer algorithm such as MFOLD hittp Avww ibc wustl edu zuker ma form cgi The mRNA displayed protein is attached to the mRNA via its C terminus It seems appropriate therefore to make the last few amino acids at the C terminus structureless i e a stretch of glycines and serines Incorporating extra methionines into the constant sequence will increase the signal resulting from the incorporation of S methionine into the protein Extra methionines are best placed in the C terminal constant region down stream of the C terminal protein a
182. ig 24 3 2 Lay the nylon transfer membrane on top of the perforations in the middle section Moisten the nylon membrane and lay the nitrocellulose membrane on top of the nylon membrane taking care to avoid the formation of bubbles between the two membranes Cover and tighten the brackets Prior to filtering the binding reactions prewash the wells with binding buffer and check for leaks When the manifold is used in conjunction with a water aspirator turn the water faucet to a level that causes liquid to pass slowly through the membranes i e 100 ul every 3 sec Since there are so many binding reactions it is more convenient to use a manifold apparatus that can accommodate multiple filtrations up to 96 slots than to assemble 33 individual filter holders 6 Filter the binding reactions and wash three times each time with 1 volume of binding buffer When pipetting onto the manifold dispense the liquid slowly and evenly Try to keep the membrane constantly hydrated during each wash step Keep the micropipet tip close to the membrane to avoid bubble formation but not so close as to risk damaging the membrane nitrocellulose I T em gaet nylon j ste i t I to vacuum Figure 24 3 2 Assembly of the Minifold 1 Dot Blot Milliblot apparatus used for binding assays The nitrocellulose sheet collects binding species whereas the nylon collects all remaining RNA The apparatus is assembled clamp
183. ill be a DNA sequence in which some or many of the positions CH CH ed 3 nN Co HO O N N HN OH O puromycin LNH OCH Figure 24 5 1 Puromycin is an antibiotic that functions by inhibiting translation The molecular structure of puromycin resembles the acceptor arm of an amino acylated tRNA Puromycin is a nucleotide amino acid chimera and ultimately forms the nucleic acid protein junction in the mRNA displayed protein Contributed by Anthony D Keefe Current Protocols in Molecular Biology 2001 24 5 1 24 5 34 Copyright 2001 by John Wiley amp Sons Inc UNIT 24 5 Generation and Use of Combinatorial Libraries 24 5 1 Supplement 53 Protein Selection Using mRNA Display 24 5 2 Supplement 53 are randomized In either case the DNA library may originate from a fixed natural sequence clone and subsequently be randomized by some process such as mutagenic PCR Cadwell and Joyce 1992 or DNA shuffling Stemmer 1994 Alternatively the DNA library may be synthetic in which case it can be synthesized as a fixed sequence and treated as above or it may be synthesized in a high diversity form directly using mixtures of nucleotide phosphoramidites on a DNA synthesizer In a third approach the DNA may be isolated from a natural high diversity source either cDNA derived from biological mRNA or genomic DNA using a diverse mixture of PCR primers or DNA sampled directly from the environment
184. ill obfuscate the quantification of the pool RNA see below 10 Wash the RNA pellet with cold 70 ethanol and allow the pellet to dry completely The pellet can be air dried dried under a nitrogen or argon stream or dried in a SpeedVac evaporator The first method is least likely to result in cross contamination of nucleic acid species the last method is least likely to lead to degradation In any event keep the tube covered with Parafilm to avoid inadvertent nuclease contamination poke holes in the Parafilm with a sterile pipet tip to allow evaporation to occur If the RNA pool is particularly short lt 50 nucleotides use cold 95 ethanol for the wash step 11 Resuspend the RNA pellet in 25 ul TE buffer pH 8 0 To avoid disturbing the composition of the selection buffer the pellet can also be resus pended in RNase free water The small amount of EDTA present in TE buffer however will limit ribonuclease degradation of the pool since ribonucleases frequently require a diva lent metal to function In some instances e g small volume PCR reactions the presence of EDTA may have to be compensated for by adding more magnesium to the reaction Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 3 5 Supplement 88 SUPPORT PROTOCOL 1 Selection of RNA Aptamers 24 3 6 Supplement 88 12 Estimate the quantity of the RNA spectrophotometrically by measuring the absorb
185. in these parameters In other words even if steps are not performed perfectly the selection can be carried forward Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 3 13 Supplement 88 Selection of RNA Aptamers 24 3 14 Supplement 88 It should be noted that the vacuum manifold attachment must be thoroughly cleaned after each round or target Nonbinding RNAs can stick to the manifold and transfer to the filter holder base in alternating selection experiments thereby contaminating them during elution The authors recommend using a green Scotch Bright pad 3M Company to scrub the manifold with Alconox Precision Cleaner and water The manifold should then be rinsed with water and dried by spraying with ethanol Elute RNA off the filter 10 11 12 Remove the filter containing RNA protein complexes from the filter holder using sterile forceps and place it in a 0 5 ml microcentrifuge tube Transfer the filter quickly to avoid ribonuclease contamination from the surrounding environment The authors strongly recommend changing gloves after this step to prevent the accumu lation of contaminating RNAs in solutions and on equipment Add 200 ul of elution buffer and heat for 5 min at 95 C followed by agitation vortexing to elute RNA molecules from the protein and filter Transfer the eluate to a separate tube and repeat elution with fresh elution buffer Two shorter smal
186. inal 5 ul sample aliquot within the last 10 sec of the 72 C extension step of that cycle Check for the presence of amplified double stranded DNA 9 Make a 3 8 NuSieve agarose gel solution that contains 0 1 ug ml ethidium bromide Pour an agarose gel with this solution Load the samples and run the gel in TBE at 125 V for 30 min see unir 2 6 Look for products with a UV transilluminator see Fig 24 3 4 Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 3 17 Supplement 88 Selection of RNA Aptamers 24 3 18 Supplement 88 An estimate of the minimal number of cycles needed to visualize a product band on the agarose gel can be roughly calculated Consider that of the 5 ug of RNA added to the selection 3 likely binds to the filter and is lost during the negative selection step Approximately 0 1 to 1 of the population may bind to the target When the selected RNA is precipitated two thirds of the sample are used for the reverse transcription and one tenth for the PCR Therefore 5 0 ug 0 97 0 01 2 3 0 1 3 2 ng RNA Assuming that every cycle doubles the amount of DNA a minimum of nine cycles would be necessary to obtain 1 to 2 ug of DNA This would imply that 0 05 to 0 1 ug could be loaded and readily visualized on the ethidium bromide stained agarose gel Thus from 10 to 12 cycles should initially be carried out and the products analyzed by gel electrophoresis T
187. inding and wash buffers since they will compete with the immobilized NTA for complexation of the Ni and may elute it from the agarose Purify on gel filtration column 14 15 16 17 18 19 On a NAP 5 gel filtration column exchange the elution buffer into water by allowing 10 ml of deionized water to flow through the gel filtration column Add 100 ul of 10 mg ml salmon sperm DNA and 10 ul of 1 mg ml BSA to 890 ul of deionized water vortex and allow this to flow through the gel filtration column Allow 10 ml of deionized water flow through the gel filtration column Allow 0 5 ml of sample to flow through the gel filtration column Add 1 ml of deionized water to the column and collect the 1 ml eluate issued from bottom of column Analyze the starting material and the elution fraction using Tris tricine SDS PAGE as described in UNIT 10 2A Alternate Protocol 1 and by scintillation counting Imidazole does not inhibit reverse transcription so this buffer exchange is optional it may be possible to reverse transcribe the mRNA display templates by diluting the Ni NTA eluate directly into the reverse transcription reaction mixture Reverse transcription may not proceed if denaturants are present in the reaction mixture Reverse transcribe mRNA displayed proteins 20 21 22 Set aside a small sample of the mRNA displayed proteins that are not reverse tran scribed for use in the no RT control PCR amplification M
188. inst Cdk2 Colas et al 1996 acts as a competitive inhibitor of the Cdk2 dependent phosphorylation of histone H1 Interaction mating with a panel of mutant Cdk2 proteins revealed that specific active site residues are required for aptamer binding supporting the competitive inhibition mechanism In sum mary interaction mating assays using panels of related and mutated proteins can be used to classify both the specificity and binding inter actions of different aptamers targeted to the same protein Current Protocols in Molecular Biology Affinity maturation Peptide aptamer selections using the inter action trap are limited to screening 10 to 107 unique aptamers per experiment This is a small representation 9 x 10 of the entire se quence space available to aptamers containing 20 mer variable regions 207 possible se quences In addition to the small sample size many of the aptamers will contain stop codons within the variable region As aresult itis likely that aptamers isolated using the interaction trap do not contain the optimal binding sequences for their target proteins Basic Protocol 4 describes a method to ob tain aptamers with increased binding affinity The protocol involves mutating the aptamer variable region and reselecting for binding to its target protein using an interaction trap that contains a more stringent reporter gene Cohen 1998 Colas et al 2000 Mutations can be introduced using mutageni
189. ion is increased as the number of genes per compartment is de creased the overall enrichment may be syner gistically enhanced Troubleshooting The success of emulsion protein selections can be affected by a variety of problems but assuming that the experiment has been Generation and Use of Combinatorial Libraries 24 6 9 Supplement 87 Directed Evolution of Proteins In Vitro 24 6 10 Supplement 87 designed properly see Critical Parameters these are almost always related to problems with either translation or emulsion For ex ample it is not possible to select for activity if there is a problem with protein expression or if the expressed protein is inactive Therefore it is critical to not only verify expression and ac tivity prior to initiating a selection experiment but also during the course of the selection in order to ensure that futile cycles are not be ing performed Selections can also fail when there is inefficient or nonspecific recovery of genes Real time PCR assays The only signal that will generally be appar ent following a round of selection is the PCR product that arises In order to ensure that this PCR product is indeed due to the selection it is always recommended to carry out control re actions A negative control might be a template encoding a nonfunctional truncated protein while a positive control might be a template encoding the wild type protein Protein prod
190. ion of DNA cassette s which when ligated together will encode the complete library ssDNA cassette s PCR amplification of DNA cassette s ds DNA cassette s SSS gt S gt gt Transcription of DNA cassette s mRNA cassette s ORF DDADDL A AAA Denaturing PAGE purification of Purified mRNA cassette s ORF RNA cassette s DALAL AAA Synthesis and denaturing PAGE of DNA splint eae DNA splint that anneals to and aligns 3 end of RNA and 5 end of DNA linker to encourage ligation Synthesis and denaturing PAGE of DNA linker DNA linker that terminates in puromycin Kinase 5 phosphorylation of DNA linker Kinased DNA linker e Splinted ligation of RNA cassette s to mRNA display template s ag DNA linker terminated in puromycin of cassette s Att tds Translation of mRNA display template s Protein cassettes with both affinity ag tag1 tag2 of cassettes and high salt incubation tags displayed upon their stop DADA AAA ANAS o Boner e ee and or incubation at 20 C codon free and frameshift free mRNA display templates Misinitiated protein cassettes without ORF 2o 2 a DDADADAAA ote an N terminal affinity tag displayed upon partly untranslated MRNA display templates frame ORF shifting tag 1 Frameshifted protein cassettes without EET o a C terminal affinity tagdisplayed upon deletion mRNA display templates with deletions or insertion mRNA display templates with stop stop codons not displaying
191. it is frozen solid d Quickly thaw the tube in a hot water bath and then let it soak at 90 C for 5 min Elute the DNA overnight at 37 C or room temperature on a rotary shaker This freeze rapid thaw approach Chen and Ruffner 1996 allows ice crystals to break apart the acrylamide matrix increasing yield and decreasing elution time Typically 80 of a 20 mer oligonucleotide can be recovered after 3 hr of rotary shaking making this technique comparable to electroelution see e g UNIT 2 7 Because elution is a diffusion controlled process higher elution volumes or serial elu tions from the same gel slice can increase the amount of DNA recovered Longer oligonu cleotides diffuse from the gel more slowly than shorter sequences Samples of especially long synthetic DNAs and RNAs that are particularly resistant to elution with aqueous buffers may be eluted more easily in 6 vol of formamide gt 5 hr at room temperature followed by a brief elution with an aqueous buffer 1 hr Isoamyl alcohol extraction e g UNIT 2 12 can be used to bring the extracts to a convenient volume for subsequent precipitation Filter the eluted oligonucleotide through a conical tube vacuum filter unit to remove the remaining polyacrylamide gel fragments Precipitate the eluted oligonucleotide pool by adjusting the salt concentration to 0 3 M adding from a 3 M sodium acetate stock solution then adding 2 5 vol of ethanol Keep at 20 C for 3 hr
192. itro Protein Eng Des Sel 17 699 707 Bochkov Y A and Palmenberg A C 2006 Trans lational efficiency of EMCV IRES in bicistronic vectors is dependent upon IRES sequence and gene location Biotechniques 41 283 290 Generation and Use of Combinatorial Libraries 24 6 11 Supplement 87 Directed Evolution of Proteins In Vitro 24 6 12 Supplement 87 Chen Y Mandic J and Varani G 2008 Cell free selection of RNA binding proteins using in vitro compartmentalization Nucleic Acids Res 36 e128 Doi N and Yanagawa H 1999 STABLE Protein DNA fusion system for screening of combi natorial protein libraries in vitro FEBS Lett 457 227 230 Doi N Kumadaki S Oishi Y Matsumura N and Yanagawa H 2004 In vitro selection of restriction endonucleases by in vitro compart mentalization Nucleic Acids Res 32 e95 Fen C X Coomber D W Lane D P and Ghadessy F J 2007 Directed evolution of p53 variants with altered DNA binding specificities by in vitro compartmentalization J Mol Biol 371 1238 1248 Gallie D R Walbot V and Hershey J W 1988 The ribosomal fraction mediates the transla tional enhancement associated with the 5 leader of tobacco mosaic virus Nucleic Acids Res 16 8675 8694 Ghadessy FJ and Holliger P 2004 A novel emulsion mixture for in vitro compartmentaliza tion of transcription and translation in the rab bit reticulocyte system Protein Eng
193. ium acetate yeast transformation UNIT 13 7 interaction mating see Basic Protocol 3 interaction trap UNIT 20 1 Transfer peptide aptamers from pJM 2 or pJM 3 into pEG202 1 PCR amplify the DNA encoding the thioredoxin peptide aptamer using primers that contain restriction sites compatible with the polylinker of pEG202 and in frame with LexA Fig 20 1 3 2 Using standard subcloning techniques UNIT 3 16 insert the PCR product into pEG202 to create the peptide aptamer bait 3 Transform the individual peptide aptamer baits and pSH18 34 lacZ reporter into EGY48 Mata by standard lithium acetate yeast transformation UNIT 13 7 At the same time transform a control plasmid pEG202 and pSH18 34 into EGY48 4 Select transformants on 10 cm Glu CM His Ura plates Identify targets For mating interaction assay 5a Construct a panel of desired proteins by inserting coding regions of proteins into the polylinker of pJG4 5 prey plasmid Fig 24 4 1 6a Transform prey plasmids and a control plasmid pJG4 5 into EGY42 Mata by standard lithium acetate transformation Select transformants on 10 cm Glu CM Trp plates Current Protocols in Molecular Biology 7a Mate strains containing peptide aptamer baits and target protein preys and score interactions as described see Basic Protocol 3 steps 3 to 9 For interaction trap library hunts 5b Transform strains containing individual peptide aptamers and pSH18 34 step 3
194. ivation domain peptide aptamer fusion and 3 reporter gene s to record interactions be tween the peptide aptamer and protein target see uniT 20 1 for a detailed description of the yeast two hybrid system Basic Protocol 2 describes the interaction trap two hybrid system as a method for obtain ing peptide aptamers that interact with a se lected protein target The interaction trap is an effective method for obtaining high affinity peptide aptamers that bind specific proteins Aptamers obtained using the interaction trap have dissociation constants greater than the 1 UM detection limit required to activate the in teraction trap reporters Estojak et al 1995 To date the interaction trap has been used to isolate peptide aptamers against a variety of protein targets including Cdk2 Colas et al 1996 Ras Xu et al 1997 HIV 1 Rev Cohen 1998 and E2F Fabbrizio et al 1999 The dissociation and half inhibitory constants of these aptamers range from 10 8 to 5x 107 M Current Protocols in Molecular Biology An advantage of using the interaction trap to select peptide aptamers is that selection oc curs in an intracellular environment This in creases the probability that the aptamers will retain their function when expressed in the appropriate organism Moreover aptamers iso lated using the interaction trap function effec tively under a variety of in vivo conditions such as cell cultures Cohen et al 1998 Fabbrizio
195. k se quences which would require them to be or dered or assembled rather than simply de signed into PCR primers and in addition may be very specific for a particular extract If a Kozak sequence does not provide the protein expression levels desired the EMCV IRES has been used to increase protein production in rabbit reticulocyte lysate Bochkov and Pal menberg 2006 and the TMV IRES Gallie et al 1988 Yonezawa et al 2003 in wheat germ lysate The method used for purification of PCR products can have a pronounced effect on translation yields The authors method of choice is phenol extraction and ethanol pre cipitation with sodium acetate Other methods typically yield significantly less translation product e g gel purified PCR templates translate very poorly 0 to 10 the yield of phenol extracted templates and silica mem brane spin column DNA purification yields transcription templates with only modest translation efficiency 25 that of phenol extracted templates unpub observ While plasmids may prove to be better tem plates for translation the capture method must be appropriately modified For example a zinc finger protein could capture a plasmid contain ing a corresponding binding site Capture method Following de emulsification the protein product must be captured In the example pro tocol described in this unit capture is mediated by a hexahistidine tag on the protein A FLAG tag is another
196. l also be enriched in cassettes without deletions A nucleotide distribution encoding a target amino acid composition can be iteratively approached using computer algorithms that are available on the Internet e g http gaiberg wi mit edu cgi bin Combinatorial Codons Wolf and Kim 1999 Codon usage Statistical studies of sequenced genomes have shown that for the majority of amino acids for which more than one codon exists certain codons appear more frequently than others The more frequently used codons tend to end in G or C which may relate to the extra stability that results from having three hydrogen bonds in the wobble position of the tRNA mRNA complex Consequently it may be helpful to design the library so that G and C are the only nucleotides in the third position of each codon The symmetry of the genetic code is such that the composition of the wobble position has very little effect upon the composition of the resultant protein so this approach need not affect the amino acid composition of the protein library it encodes However this strategy will amplify the effect that frameshifts will have upon the resultant proteins Periodicity and stop codon avoidance Some mixtures of nucleotides may result in the total omission of stop codons VNN for example where V is a mixture of A G and C does not encode any stop codons Unfortunately such approaches always result in the loss of some of the 20 amino acids VNN also does not e
197. l be readily apparent when the samples are run out on a gel together and the optimal concentrations of both magnesium acetate and potassium chloride can be chosen If a preselection procedure is being used to synthesize the full length mRNA display template library the translation magnesium acetate and potassium chloride concentrations will have to be optimized separately for each cassette used in the preselection protocol and then again for the full length library Despite the fact that the 3 terminal region of each of the cassettes and the full length library are the same the optimal magnesium acetate and potassium chloride concentrations for the formation of mRNA displayed proteins are likely to be different 22 Prepare a 1 ml translation reaction on ice as follows adding the reticulocyte lysate last 80 ul 5 uM mRNA display template final 400 nM 80 ul 12 5x methionine free translation mix final 1x 20 ul 8 6 uM S methionine final 0 17 uM 2 5 M KCI as optimized 0 5 ul magnesium acetate as optimized Water to 600 ul 400 ul 2 5x rabbit reticulocyte lysate final 1x Total 1000 ul 23 Incubate for 1 hr at 30 C then add 65 ul of 1 M MgCl and 235 ul of 2 5 M KCI to each of the above reactions and allow them to stand for 5 min at room temperature The translation reaction mixtures may be optionally stored for up to a week at 20 C at this point One may wish to decrease the concentration of mRNA display template i
198. l have to be resynthesized Generation and Use of Combinatorial Libraries 24 2 25 Supplement 88 DNA Pools for In Vitro Selection 24 2 26 Supplement 88 Anticipated Results It is apparent from the discussion earlier in this unit that there is no one correct way to design and amplify a random sequence pool Piasecki et al 2009 However by following the protocols described above results similar to the following should be observed If the integrity of the nascent synthetic pool is good then the primer extension efficiency described in Support Protocol 1 should be relatively high Figure 24 2 4 shows a typical extension reaction for a pool synthesized in the authors laboratory Molecules that were incapable of full extension make up the smear leading to the full length product By deter mining the number of counts in the full length product relative to the radiolabeled primer the extension efficiency for the pool was calcu lated to be 39 Assuming that the nascent pool is intact and can serve as a template for the primer extension reaction then it should be possible to amplify the pool via PCR Figure 24 2 5 shows the results of an amplification cycle course for a different pool N73 with a 73 nucleotide random sequence core A 10 ml PCR reaction was aliquotted into multiple 96 well PCR plates and cycled on a BioRad DNA Engine thermocycler The samples in the figure were withdrawn at 0 2
199. lection elution buffers as similar as possible it may be desirable to balance the effect of the target molecule upon the elution buffer by adding a similar molecule to the binding buffer If the target molecule interacts with one of the buffer components such as a nucleotide with magnesium it may be desirable to add back an extra amount of this component to maintain the free concentration of the component in question at the concentration of that in the binding buffer It is also possible to collect the elution fraction by disrupting the binding with denaturant or extremes of pH although the background is likely to be higher Catalytic enzyme selections Catalytic enzyme selections are a little more complex in a conceptual sense although carefully designed they can have lower intrinsic background rates than aptamer selec tions and consequently be quicker and easier to perform in the laboratory Enzyme selections must be performed in such a manner that those sequences which catalyze a reaction are separated from those that do not The most obvious way to achieve this separation is to arrange the selection so that library members that catalyze the desired reaction covalently attach themselves to the substrate If the substrate is in turn covalently attached to a tag such as biotin then the attachment of the tag to library members that catalyze the reaction can be used as a basis for the separation of these library members from those that do no
200. lectrophoretic mobilities e g dimers can be selected during gel mobility shift selections Immunoprecipi tation experiments require an additional pro tein reagent and consequently anti antibody rather than anti target aptamers are frequently selected Affinity chromatography or similar techniques generally require that very large amounts of target proteins be committed to the preparation of affinity matrices If affin ity elution is to be used then even larger amounts of target proteins will be required Moreover aptamers that bind to agarose ma trices can be selected almost as easily as ap tamers that bind to nitrocellulose or modified cellulose filters although the two thankfully do not cross bind to one another s matrices Finally microtiter plate panning selections en courage the accumulation of the same sorts of matrix binding aptamers that are elicited by filter binding selections Stringency of selection Overall most selection experiments are generally competitions between specifically and nonspecifically binding nucleic acid species The authors tend to initially choose conservative binding conditions in hope of promoting the early establishment of binding species in the population While this may mean that low affinity species are isolated from the pool along with high affinity species the low affinity species can eventually be removed by increasing the stringency of selection In essence time the number of
201. lecular Biology BASIC PROTOCOL 1 Generation and Use of Combinatorial Libraries 24 4 3 Supplement 52 Peptide Aptamers 24 4 4 Supplement 52 Additional reagents and equipment for DNA synthesis phenol chloroform extraction and ethanol precipitation UNIT 2 A polyacrylamide gel electrophoresis PAGE unit 2 7 UV shadowing and elution of DNA UNIT 2 7 UV spectroscopy APPENDIX 3D or ethidium bromide dot quantitation UNIT 2 6 bacterial transformation UNIT 1 8 and ethidium bromide cesium chloride gradients optional UNIT 2 4 NOTE Activity units of enzymes are described for enzymes obtained from New England Biolabs Other commercial sources can be used but units should be confirmed Prepare random peptide DNA cassette 1 10 11 12 13 Prepare the following 91 base random oligonucleotide and 17 base primer using an automated DNA synthesizer Dissolve oligonucleotides separately in water to a final concentration of 1 ug l Oligonucleotide 5 GACTGACTGGTCCG NNK GGTCCTCAGTCAGTCAG 3 where N is A G C or T and K is Gor C Primer 5 CTGACTGACTGAGGACC 3 Add the following in order to a 1 5 ml microcentrifuge tube final 890 ul 200 ug primer 10 fold excess 100 ug random oligonucleotide 490 ul water 100 ul 10x Klenow polymerase reaction buffer Anneal primer to random oligonucleotide by heating sample to 95 C in a water bath for 5 min Slowly cool to room
202. lents of EDTA pH 8 0 from 0 5 M stock The reactions can be left at 4 C overnight If the PCR reaction volume is lt 100 ml Proceed directly to step 7 If the PCR reaction volume is gt 100 ml Add an equal volume of 2 butanol and extract to concentrate the reaction to a manageable volume usually 10 to 20 fold Mix the layers by vortexing and then separate by centrifuging 5 min at 1200 x g at room temperature then discard the upper 2 butanol layer Repeat as necessary About one fifth of the aqueous layer is extracted into the organic 2 butanol layer for each volume of butanol used Current Protocols in Molecular Biology 7 After concentrating the DNA carry out a phenol chloroform extraction followed by two successive chloroform extractions see UNIT 2 1A At this point it should be possible to easily precipitate the DNA Be sure to temporarily save all of the organic layers in case of a mishap Falcon tubes 50 ml work well for these extractions as they are conveniently sized and have a small surface area Alter natively a Teflon extraction funnel may be useful since nucleic acids will not stick to its surface 8 Precipitate the DNA by adding one tenth volume of 3 M sodium acetate final concentration 0 3 M and 2 5 vol ethanol in 13 ml Sarstedt tubes if possible If larger tubes are required prepare a set of Beckman 250 ml high speed centrifugation bottles Wash the centrifugation bottles with 15 ml of 3 hydrogen pe
203. ler volume elutions will more efficiently recover intact RNA than one long large volume elution Ethanol precipitate the RNA by adding one tenth volume of 3 M sodium acetate 0 3 M final 3 ul of 1 mg ml blue dyed glycogen and 2 5 volumes of 95 ethanol microcentrifuging and washing the pellet with 70 ethanol see Basic Protocol 1 steps 9 and 10 If the binding buffer contains a high gt 0 5 M salt concentration dilute the eluate with an equal volume of RNase free water and precipitate with one volume of isopropanol instead If a subsequent phenol chloroform extraction is necessary this precipitation can be omitted Perform a phenol chloroform extraction optional steps 13 14 15 16 To remove residual peptide fragments or proteins that may have coeluted with the RNA add an equal volume i e 400 ul of cold 25 24 1 phenol chloroform isoamyl alcohol Vortex then microcentrifuge for 1 min at maximum speed to separate the liquid phases the RNA should be in the top aqueous phase Transfer the aqueous phase to a new 1 5 ml microcentrifuge tube Avoid transferring phenol chloroform with the aqueous layer as it can interfere with subsequent enzyme reactions Nevertheless the aqueous phase will sometimes appear milky especially at low temperatures due to the presence of dissolved phenol chloroform Extract the eluate with a similar volume of chloroform to remove any residual phenol Avoid transferring chlorofo
204. ll acidic pro teins such as the Rop protein from E coli will frequently pass through the filter and shows some affinity for a random sequence pool then it is highly probable that there will be some sequences or structures within the pool with greatly enhanced affinities for the target Choosing a binding buffer The binding buffer should promote specific binding of nucleic acids to a protein target The first consideration in choosing a buffer is to identify conditions under which the pro tein is active or at least stable In addition if the selected nucleic acid species are to even tually be used in a particular environment the selection buffer should reflect this envi ronment For example if the selected nucleic acids are to be expressed in a cell then the selection buffer should be at physiological pH and contain physiological ion concentrations Second there are a variety of parameters that can be used to make the RNA pool more or less sticky These parameters are discussed in much greater detail below see Stringency of selection A typical binding reaction is built from one of the commonly used buffers such as Tris Cl phosphate or HEPES which can hold the pH near 6 to 8 together with 50 to 200 mM NaCl or KCI and 1 to 10 mM MgCl However these are merely suggestions and aptamers have in fact been selected under a variety of buffer conditions For example in the selec tion that targeted bFGF phosphate bu
205. lly applied to organisms with well developed genetics such as phage bacteria yeast C elegans and Drosophila Dominant agents that affect gene products in trans instead of genes have been developed to overcome problems associated with the analysis of recessive mutations in diploid or ganisms A variety of dominant agents exist for the reverse analysis of cellular processes These include small molecule inhibitors Mitchison Current Protocols in Molecular Biology 1994 dominant negative proteins Herskowitz 1987 antibodies Gorbsky et al 1998 antisense RNA Branch 1998 ri bozymes Bramlage et al 1998 and nucleic acid aptamers UNIT 24 3 Thomas et al 1997 These agents have improved the ability to ana lyze processes in diploid organisms however they too have limitations For example forward analysis requires large scale generation of agents that are capable of inactivating the func tion of almost any gene product but agents such as small molecule inhibitors and dominant negative proteins may not exist for all gene products Similarly although it should in the ory be possible to generate agents such as antibodies ribozymes nucleic acid aptamers and antisense RNA against almost any gene product antibodies are not membrane perme able and large scale injection is tedious and impractical for most organisms RNA agents are not very stable and it is difficult to predict sites on RNA that are exposed for
206. lts apply to 20mer combinatorial peptide libraries dis played on the surface of E coli thioredoxin Time Considerations Basic Protocol 1 Construction of the thiore doxin peptide aptamer library and its sub sequent electroporation and amplification in E coli will take 1 week Basic Protocol 2 Isolation of peptide ap tamers that interact with a specific bait protein takes 3 4 weeks The bait plasmid pBait and the pJM 1 peptide aptamer library are con structed during the first week During the sec ond week the pBait and the acZ reporter plas mid pSH18 34 are transformed into EGY48 The bait protein is also assayed to determine if it self activates the reporter genes During the third week the peptide aptamer library is trans formed into EGY48 that contains pBait and pSH18 34 The aptamers are screened for their ability to interact with the bait protein and putative interacting aptamers are obtained A fourth week is required to isolate the aptamer plasmids from the yeast and sequence their variable regions Basic Protocol 3 Determination of the pep tide aptamer specificity using interaction mat ing takes 1 2 weeks The time required to construct the bait proteins which will be used to evaluate the aptamer specificity varies de pending on the number of baits chosen and difficulty in cloning the baits Once the bait proteins are constructed it takes 1 week to transform both the baits and lacZ reporter into Current
207. lue dye front reaches the bottom of the gel If the wells are not cleaned prior to loading the resolution of the separation can be compromised especially if large amounts of RNA are being isolated Current Protocols in Molecular Biology 6 Visualize the RNA bands by UV shadowing on a fluorescent TLC plate covered with plastic wrap then excise the bands Be sure to cut with a sharp razor blade and cut only the shadowed regions that contain the bulk of the RNA There may be extra bands in the lane that correspond to incomplete transcripts or undigested DNA The use of a size standard in a neighboring lane is recommended Note however that the size standard should not itself be amplifiable as cross contamination of a single sequence with the RNA pool would drastically skew the distribution of sequences in the purified pool Similarly the razor blade used for excision should not have come into contact with other potentially amplifiable sequences and should either be fresh or be cleaned extensively Finally if multiple selections are being carried out in parallel they should be separated by at least two wells or on a different gel entirely 7 Immerse the gel slices in 1 x TE buffer pH 8 0 at 1 ml buffer cm of gel typically slices from three lanes and incubate at 37 C overnight with agitation to elute the RNA pool The TE buffer is necessary to inhibit trace quantities of ribonucleases For quicker elution use a 1 ml syringe pl
208. lular phenotypes and natural or artificially elevated mutation rates One classic example is the selection of evolved beta galactosidase ebg Hall 2003 However the ability to chemically manipulate DNA and thereby create DNA libraries drastically in creased the ability to select nucleic acids with novel phenotypes In recent years so called peptide aptamers a term originally applied to nucleic acids see below have been selected based on the ability of individual library mem bers to inhibit protein functions such as en zymatic activity or dimerization and thereby modulate key features of cell physiology such as signal transduction pathways numerous ex amples can be found in Hoppe Seyler et al 2004 Baines and Colas 2006 While almost any phenotype can be screened or selected it is frequently useful to couple peptide ap tamer function to the production of a contrived genetic marker such as an antibiotic or fluo rescent protein While the great advantage of peptide aptamers is their immediate tie to a rel evant cellular phenotype the library sizes that can be examined are limited by transformation efficiencies and cell based selection methods to generally lt 10 The production and util ity of peptide aptamers is examined in greater detailin UNIT 24 4 In all of these instances translation inside of a cell has been used to generate a protein library There are also methods where trans lation outside of a cell can b
209. ly the darkest shadowed band on the gel excluding UV absorbing material that runs at the dye front If stepwise synthetic efficiency has been low the product will appear as a smear instead of as a clear band Since many of the n 1 n 2 etc products can be converted into full length products by the polymerase chain reaction a fairly wide band of near full length products can be cut from the gel The excision should be carried out relatively quickly since unnecessarily long UV exposure can damage the oligonucleotide product The full length oligonucleotide product should be the slowest migrating band However if deprotection has been incomplete lighter bands that migrate considerably above the major fully deprotected band may be observed Unpolymerized acrylamide absorbs strongly at 211 nm and may cause shadowing at the edges and wells of the gel This can obscure the resolution or recovery of bands in the outer lanes Elute the oligonucleotide from the gel slices as follows a To aid in the diffusion of the oligonucleotide from the acrylamide matrix chop gel slabs into fine particles by forcing the gel through a small bore syringe b Place the crushed gel slabs in a 13 ml centrifuge tube capable of withstanding temperature extremes c Add 3 ml of TE buffer pH 8 0 per 0 5 ml of gel slab typically corresponding to two wells Do not exceed 13 ml of buffer for the entire gel slab Place the sample at 80 C for 30 min or until
210. lymerase Science 249 505 510 Uphoff K Bell S and Ellington A D 1996 In vitro selection of aptamers The dearth of pure reason Curr Opin Struct Biol 6 281 288 Wlotzka B and McCaskill J S 1997 A molecular predator and its prey Coupled isothermal am plification of nucleic acids Chem Biol 4 25 33 Wright C and Joyce G F 1997 Continuous in vitro evolution of catalytic function Science 276 614 617 Zichi D Eaton B Singer B and Gold L 2008 Proteomics and diagnostics Let s get specific again Curr Opin Chem Biol 12 78 85 Key References Conrad et al 1996 See above Conrad R C Bruck F M Bell S and Ellington A D 1998 In vitro selection of nucleic acid ligands Jn Nucleic Acid Protein Interactions A Practical Approach W J Christopher ed pp 285 315 Oxford University Press New York Gopinath 2007 See above Kulbachinskiy 2007 See above Fickert H Betat H and Hahn U 2004 Selec tion of Aptamers Jn Evolutionary Methods in Biotechnology Clever Tricks for Directed Evo lution S Brakmann and A Schwienhorst eds pp 65 86 Wiley VCH Weinheim Germany Stoltenburg et al 2007 See above The above papers also describe protocols for the selection of aptamers via both filter immobilization and other separation methods Generation and Use of Combinatorial Libraries 24 3 27 Supplement 88 Peptide Aptamers Dominant Genetic Age
211. lysis of cellular processes Combinatorial libraries of peptide aptamers are used as dominant genetic agents that randomly inhibit gene function Forward analysis involves 1 expressing combinatorial libraries of peptide aptamers in organisms 2 isolating organ isms that display aptamer induced phenotypes and 3 identifying peptide aptamer targets using the interaction trap CONSTRUCTION OF A COMBINATORIAL THIOREDOXIN PEPTIDE APTAMER LIBRARY Combinatorial libraries of peptide aptamers are constructed by inserting a random twenty amino acid peptide into the short disulfide constrained loop CGPC in the active site of E coli thioredoxin The active site loop contains a unique RsrII restriction site that allows the insertion of Avall cut DNA which encodes for random amino acids Random peptide libraries are constructed using twenty repeats of the codon NNK where Nis A G C or T and K is G or C Using G or C in the third position of the codon reduces the number of stop codons while maintaining codons for all twenty amino acids Depending on the application the random peptide libraries are subcloned into one of the pJM yeast expression vectors shown in Figure 24 4 1 pJM 1 is used in the interaction trap to generate peptide aptamers against specific proteins pJM 2 and pJM 3 are used in genetic selections to produce aptamers that alter an organism s phenotype All of the pJM vectors use the gal promoter to control the expression of the p
212. mal cycler water bath or heat block Minifold I Dot Blot System Whatman Nylon transfer membrane Hybond N GE Healthcare Life Sciences 0 45 um nitrocellulose transfer and immobilization membrane BA85 Protran Whatman Clean forceps or tweezers PhosphorImager GE Healthcare Life Sciences and screen or X ray film and densitometer also see APPENDIX 3A Graphing software e g SigmaPlot Systat Software or R Project Additional reagents and equipment for phosphor imaging or imaging using X ray film and densitometry APPENDIX 3A NOTE All solutions and buffers should be made with deionized water 18 2 MQ re sistivity filtered through 0 2 um polyethersulfone PES membrane and sterilized by autoclaving Use sterile disposable plasticware and micropipet tips with filter barriers where possible See Chapter 4 introduction and unr 4 1 for guidelines on standard meth ods to protect against contaminating RNases If ribonuclease contamination is found to occur it may be eliminated by treating water with diethylpyrocarbonate DEPC see UNIT 4 1 Set up binding reactions 1 Collect the RNA precipitate by centrifugation and resuspend the radiolabeled RNA in a minimal volume i e 5 to 10 ul of RNase free water Dilute the RNA sample with binding buffer to a final concentration of 100 pM The binding assay will yield 11 data points in triplicate see below Since each data point will be generated from a 50 1l binding reaction 2 ul of
213. mapped by deletion analysis to a short segment of HIV 1 Bartel and his co workers assumed that the minimal RBE was smaller even than the region identified by deletion analysis and thus decided to heavily dope a portion of a 66 nucleotide sequence at a frequency of 35 substitution position The initial RRE library contained 10 3 molecules that had an average of 23 substitutions template 0 35 probability substitution position x 66 positions 23 substitutions less than 1 in 101 molecules were completely wild type Following selection a 20 nucleotide core binding site within the 66 nucleotide pool was readily defined by sequence conservations and co varying residues A lower substitution rate might not have precisely defined the relatively small binding site while an even higher substitution rate might have created a mutational load that would have limited the selection of functional molecules or even have allowed the selection of novel non wild type anti Rev aptamers Giver et al 1993 Tuerk and MacDougal Waugh 1993 Conversely if the binding site were larger than originally hypothesized the relatively high rate of substitution might have meant that few functional molecules could have survived the selection unscathed Current Protocols in Molecular Biology The number and type of sequence substitutions as opposed to the probable target size for mutation can also be used to plan the synthesis of a doped sequence pool as described by th
214. me of the binding reaction could also be diminished to conserve protein it is difficult to uniformly apply volumes less than 30 ul to the filter To limit spurious background signal blocking agents such as nonradioactive tRNA and BSA can be added to the binding reaction or added immediately prior to filtration Filter each binding reaction and wash three times each time with 1 volume binding buffer see Support Protocol 2 steps 5 through 10 A good result at this point would be 15 to 20 fraction bound above background see Table 24 3 1 round 6 If binding to filter alone is too high then filter binders are being selected and more negative selection is needed If the desired binding is detected clone UNIT 15 4 and sequence the pool see Chapter 7 to isolate individual variants Compare aptamers with one another to identify sequence and structural similarities A typical observation is the selection of sequence families that are similar over a large por tion of the aptamer and or short sequence motifs that are common to multiple otherwise different aptamers REAGENTS AND SOLUTIONS Use RNase free deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 Denaturing dye 2x TBE buffer APPENDIX 2 containing 0 1 w v bromphenol blue 7 M urea Store up to 6 months at 20 C Denaturing polyacrylamide gel 8 TBE buffer APP
215. mer will appear as a faint band that is 20 base pairs shorter than the aptamer This shorter band is due to the presence of native E coli thioredoxin DEFINING RECOGNITION SPECIFICITY WITH INTERACTION MATING Interaction mating is a variation of the interaction trap It allows interactions between large panels of proteins to be analyzed Finley and Brent 1994 Haploid yeast exist in one of two mating types a or Haploid yeast that contain protein targets or related protein baits in one mating type and peptide aptamer preys in the opposite mating type can mate to form diploids that carry both the aptamers and their targets or related proteins Interaction between the peptide aptamer prey and protein target bait is detected by the activation of two reporter genes LexAop LEU2 and LexAop LacZ Using the mating interaction assay panels of related or mutated proteins can be assayed simultaneously for interactions with panels of peptide aptamers See Figure 24 4 3 for schematic of the interaction mating assay Materials Plasmid DNA pBait s see Basic Protocol 2 peptide aptamer preys see Basic Protocol 2 pEG202 Fig 20 1 3 pJG4 5 Fig 24 4 1 pSH18 34 Fig 24 4 2 Yeast strains EGY42 Mata ura3 trp1 his3 leu2 EGY48 Mata ura3 trp his3 3LexA operator leu2 10 cm complete minimal CM dropout plates UMIT 13 1 supplemented with either 2 w v glucose Glu or 2 w v galactose and 1 w v raffinose Gal Raf Glu CM Trp Glu CM
216. mutagenic PCR protocol described in Support Protocol 2 Mutagenic procedures such as mutagenic PCR may be used to increase library diversity by exploring parts of sequence space proximate to the starting sequence s Current Protocols in Molecular Biology Purify double stranded PCR product 15 Add 1 1 molar equivalents of 100 mM EDTA to chelate the Mg 16 Vortex the PCR reaction mixture with an equal volume of 25 24 1 v v v phe nol chloroform isoamy l alcohol centrifuge for 1 min at 10 000 x g room tempera ture remove and retain upper aqueous phase 17 Re extract aqueous phase with an equal volume of chloroform three times centrifuge to clear on each occasion remove and discard lower organic phase after each centrifugation 18 1 Butanol extract the aqueous phase to 20 of the initial volume at minimum UNIT 2 1A Support Protocol 2 remove and discard the upper 1 butanol phase Perform extraction in a polypropylene tube as butanol will damage polystyrene 19 Add 3 M NaCl to final 300 mM include the salt that originates from the PCR buffer in calculating concentration and 2 5 volumes of 100 ethanol 20 Cool for 20 min at 80 C or overnight at 20 C Centrifuge for 10 min at 12 000 x g 4 C Decant and discard the supernatant 21 Centrifuge the pellet for 1 min at 12 000 x g remove remaining supernatant with a plastic pipet tip make up in 30 mM NaCl and measure the concentration by agarose gel more expli
217. n round of screening or selection How ever more recently small chemical libraries have been synthesized based on the align ment of reactive chemical compounds on DNA templates Gartner et al 2004 Scheuermann et al 2006 By coupling DNA tagging and DNA templating methodologies it has even proven possible to directly evolve the struc tures of chemical compounds Halpin and Harbury 2004 LITERATURE CITED Baines I C and Colas P 2006 Peptide aptamers as guides for small molecule drug discovery Drug Discov Today 11 333 341 Benhar I and Reiter Y 2002 Phage display of single chain antibody constructs Curr Protoc Immunol 48 10 19B 1 10 19B 31 Bradbury A 1999 The use of phage display in neurobiology Curr Protoc Neurosci 7 5 12 1 5 12 17 Bradbury A Sblaterro D Marzari R Rem L and Hoogenboom H 2002 Using phage dis play in neurobiology Curr Protoc Neurosci 18 5 18 1 5 18 28 Brenner S and Lerner R A 1992 Encoded combi natorial chemistry Proc Natl Acad Sci U S A 89 5831 5833 Cassiday L A and Mahler L J 2003 Yeast genetic selections to optimize RNA decoys for transcrip tion factor NF kappaB Proc Natl Acad Sci U S A 100 3930 3935 Current Protocols in Molecular Biology Enshell Seijffers D and Gershonil J M 2002 Phage display selection and analysis of Ab binding epitopes Curr Protoc Immunol 50 9 8 1 9 8 27 Farinas E T 2006 Fluorescence activ
218. n the amplification re action and displace the functionally selected aptamer This is especially true if the ampli fication parasite also happens to be a filter binding species It is for this reason that DNA templates and or RNA molecules should be size selected in each round The nascent reproductive differences be tween nucleic acid species can be grossly amplified by amplification methods that al low continuous reproduction of the nucleic acids such as isothermal amplification or 3SR Current Protocols in Molecular Biology Guatelli et al 1990 For example Breaker and Joyce 1994 generated an extremely ro bust replication parasite RNA Z during a se lection designed to generate catalytic variants of a group II intron Similarly the authors have generated replication parasites of isother mal amplification reactions from completely random sequence pools K Marshall pers comm Interestingly these isothermal ampli fication parasites were actually larger than the initial RNA species and represented recombi nation events between individual members of the pool Airborne copies of these replication parasites can readily seed isothermal ampli fication reactions and overrun pool molecules that are initially present in even million fold excess In this respect the replication parasites of isothermal amplification reactions resemble the midi variants or monsters of QB repli case amplification reactions and ar
219. n wheat germ Yonezawa et al 2003 Regardless of type commercial or freshly prepared lysates should be aliquotted and stored at 80 C Freeze thaw cycles quickly cause inactivation of the lysate and should be avoided for best results Emulsion technique The procedure used to form the emulsion will greatly affect the lysate activity The vis cosity of the reagents used to create emulsions makes it difficult to pipet accurately with stan dard air displacement pipettors and thus the use of positive displacement pipettors such as the Microman series from Gilson is strongly suggested Care should be taken to set up the lysate reaction on ice and to immediately emulsify the reaction This will prevent tran scription and translation in solution prior to emulsification This is important because if functional genes are produced outside of com partments they can potentially capture tem plates that are not their own The number of genes per compartment is a variable that will affect the course of the se lection Multiple genes per compartment will allow a great population of variants at the outset but will slow the overall progress of the selection An average of one gene or less per compartment should allow for greater en richment per round Therefore a strategy in which the number of genes per compartment is progressively decreased may allow the largest number of variants to be efficiently plumbed If the stringency of select
220. ncode Cys Phe Trp and Tyr for example Mixing different such codons together can give a DNA library that encodes all 20 amino acids but no stop codons This approach however necessarily introduces an element of design into the library since the statistically different codons must be placed at specified points in the sequence most usually in a periodic fashion Periodicity can also result in an increased tendency for protein structural units to be encoded for example alternate hydrophobic and hydrophilic amino acids will encourage the formation of B sheets while alternate pairs of hydrophobic and hydrophilic amino acids will encourage the formation of a helices Alternatively there are nonperiodic nucleotide distributions that reduce the occurrence of stop codons to 1 For an example of this approach see LaBean and Kauffmann 1993 Mutagenesis Mutagenic procedures such as mutagenic PCR Cadwell and Joyce 1992 or DNA shuffling Stemmer 1994 may be used to generate a diverse DNA library from a less diverse DNA library or a single DNA sequence a minimum of two homologous sequences is required for DNA shuffling Mutagenic procedures may be used to generate the initial DNA library for an mRNA display protein selection or to increase the diversity at any stage between cycles of selection and amplification during an mRNA display protein selection In general in vitro selection proceeds by the gradual loss of diversity as functional sequence
221. nealed to the splint It should be noted that this splinted RNA DNA ligation is far less efficient than the ligation of sticky ended pieces of DNA Translate mRNA display template and prepare mRNA displayed proteins Before the mRNA display template is used for large scale translation a small scale translation should be attempted alongside various control translations to aid the identifi cation of the band on the protein gel that corresponds to the mRNA displayed proteins 18 19 20 Set up the translation reactions in Table 24 5 1 on ice adding the rabbit reticulocyte lysate last Incubate for 1 hr at 30 C then add 1 7 ul of 1 M MgCl and 7 8 ul of 2 5 M KCI to each of the reactions and allow them to stand for 5 min at room temperature The reaction mixtures may be optionally stored for up to 1 week at 20 C at this point Analyze the different translations using Tris tricine SDS PAGE as described in UNIT 10 2A Alternate Protocol 1 The SDS PAGE analysis should show a number of bands in lane A which is the control RNA supplied by the manufacturer this is the positive control and demonstrates that the translation reaction was set up correctly Lane B is the no template control and may show no bands or may show a band corresponding to tRNA charged with methionine in either case it should show no bands with mobilities equal to those assigned to the free protein and to the displayed protein Lane C should show a band of high m
222. ng has an equal distribution of all four nucleotides at every position and the deletion rate is 0 5 only 0 18 will be in frame over their entire lengths and free of stop codons Consequently unless the ORF is very short one may wish to preselect the individual cassettes for being in frame and free of stop codons This preselection strategy is most easily accomplished by encoding different protein affinity tags close to the 3 and 5 termini of the cassettes Synthesizing mRNA displayed proteins from each individual DNA cassette and purifying these upon the basis of the presence of each of these tags will enrich the resultant library in those sequences that have initiated before the 5 tag terminated after the 3 tag and do not contain stop codons These are likely to be in frame over their entire sequence The full length DNA library should then be constructed from these preselected cassettes using RT PCR followed by restriction and ligation Any reduction in diversity that results from the preselection process is regained by the combinatorial ligation of the amplified DNA cassettes during the assembly of the full length library The steps in a preselection strategy are shown in Figure 24 5 3 and a detailed description is given in Cho et al 2000 Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 5 3 Supplement 53 Step Product Synthesis and denaturing PAGE purificat
223. ng on the length and initial complexity of the pool 1 ug of double stranded DNA will represent 10 different sequences while 10 ug represents 10 different sequences The dsDNA concentration from the large scale PCR UNIT 24 2 should be determined by electrophoresis on an agarose gel and compared with a quantitation standard The initial quantity of dsDNA used for selection should be calculated based on a desired number of starting species or total pool complexity also see UNIT 24 2 It should be kept in mind that the overall complexity of the unamplified pool and the extent of amplification must be known in order to carry out these calculations also see UNIT 24 2 The authors typically seed the transcription with I to 3 copies of the amount of dsDNA pool corresponding to the desired complexity The AmpliScribe High Yield T7 kit can be used to produce between 20 and 100 ug RNA from 0 5 to I ug starting dsDNA This yield equates to between 40 and 200 copies of each sequence originally present The kit can be used with up to 8 ul of dsDNA template in a 20 ul reaction If more RNA is desired for initial or subsequent rounds of selection a proportionately larger transcription reaction should be attempted In some instances it will be desirable to radiolabel the RNA For example it is relatively easy to determine whether and how much RNA binds to a filter in the presence or absence of a protein target by radiolabeling the initial pool Support
224. ng used UNIT 15 1 The PCR amplification of DNA libraries should be piloted and care should be exercised not to over PCR amplify DNA libraries since they will not reanneal once denatured If PCR is continued upon a denatured DNA library rare sequences will be amplified to a greater extent than common sequences which will reduce the enrichment factor of the selected functional sequences 14 Perform a no RT control set aside in Basic Protocol 2 step 20 alongside this PCR reaction In this control a small amount of the mRNA display template that has not been reverse transcribed is used in place of the selected cDNA library This should not give any observable product after an equivalent amount of amplification If it does then either the buffers are contaminated or the purification of the mRNA displayed proteins is not stringent enough In either case the problem must be addressed or the selection is unlikely to give the desired result It is also often useful to perform an additional no template control in which no template reverse transcribed or otherwise is added If this gives observable product after an equivalent amount of amplification then this is usually a sign of contaminated reagents Mutations will be introduced into the DNA library during PCR amplification The mu tagenic rate can be decreased by using a high fidelity DNA polymerase such as Pfu DNA polymerase e g Stratagene The mutagenic rate can be increased by using the
225. nt mixture from step 3 into a beaker containing ice water Position the beaker so that the tube in the beaker is in the center of the magnetic stir plate and stir the mixture at 1150 rpm high setting for 1 min 6 While stirring the oil surfactant mixture slowly add drop by drop over 1 min the 50 ul in vitro transcription translation reaction from step 4 to the mixture Continue to stir for an additional 3 min Accumulate protein 7 Transfer the emulsion to a 2 ml tube and incubate at 30 C for 1 to 4 hr The emulsified translation reaction is viscous and difficult to pipet without significant loss of material when using normal air displacement pipettor For this reason we suggest using positive displacement pipettors e g Microman from Gilson to ensure complete transfer of the reaction The extent of protein accumulation should be monitored by gel electrophoresis UNIT 10 2A and staining UNIT 10 6 or immunoblot analysis UNIT 10 8 Break the emulsion 8 Add 500 ul of TBS containing 100 uM biotin for streptavidin This step should stop any further transcription and translation Addition of the biotin quenching agent will ensure that streptavidin proteins will not bind additional biotinylated genes after the emulsion has been broken The increase in the volume of the aqueous phase also makes the solution easier to work with in subsequent extraction steps 100 uM free biotin is a reasonable starting concentration
226. nts for Forward and Reverse Analysis of Cellular Processes Peptide aptamers are a new class of dominant genetic agents that facilitate the analysis of cellular processes in diploid and genetically intractable organisms They are defined as protein based recognition agents that consist of a constrained combinatorial peptide library displayed on the surface of a scaffold protein Peptide aptamers function in trans interacting with and inactivating gene products without mutating the DNA that encodes them Combinatorial libraries of peptide aptamers contain aptamers that in principle can interact with almost any gene product The dominant combinatorial nature of peptide aptamers makes them useful as genetic agents for the reverse and forward analysis of cellular processes Reverse analysis with peptide aptamers involves isolating aptamers that interact with a specific protein and monitoring the resulting aptamer induced phenotype A two hybrid system is used to screen combinatorial libraries of peptide aptamers for those aptamers that interact with a specific protein The isolated aptamers are then expressed within an organism to identify the aptamer induced phenotype Forward analysis with peptide aptamers involves ex pressing combinatorial libraries of aptamers within an organism and screening for aptamer induced variations in their phenotypes The specific protein s targeted by the aptamers are identified using a two hybrid system This unit
227. obility that can be Current Protocols in Molecular Biology assigned to the free protein Lanes D E and F should also show bands that can be assigned to the free protein but also bands of much lower mobility that can be assigned to the mRNA displayed protein If the density of the band assigned to the displayed protein in F is of equal or lesser density to the equivalent band in E then the mRNA display template is likely to be of high quality For better proof that the band assigned to the mRNA displayed proteins is done so correctly add splint final I uM and MgCl final 10 mM to an aliquot of the translation mixture before the salt incubation and incubate for 30 min at 37 C RNase H within the lysate will cause the RNA part of the mRNA displayed proteins to be digested and leave the protein displayed upon the DNA linker alone consequently the original displayed protein band will disappear and a new band will appear of intermediate mobility between the mRNA displayed protein and the free protein 21 Once the displayed proteins have been observed by SDS PAGE optimize the magnesium acetate and potassium chloride concentrations in the translation reaction Perform a succession of translations in parallel with added magnesium acetate concentrations ranging from 0 5 mM to 2 mM and added potassium chloride concentrations ranging from 50 mM to 200 mM The relative proportions of the mRNA display templates that end up displaying proteins wil
228. ociation is preserved during the treatment of the sample during gel loading which may not be the case if it is heated too strongly much above 90 C It is common practice in reverse transcription reactions to heat denature the primer and RNA template before the addition of the reverse transcriptase this may influence the conformation of the mRNA displayed proteins and depending on the project may not be advisable Mixing the primer and the mRNA display template together under low salt conditions before the addition of the buffer should promote their association The use of mRNA displayed proteins in selection experiments may yield functional RNA sequences unless the mRNA display template is reverse transcribed before the selection step This will also reduce the likelihood that the mRNA display template will disrupt the structure of the protein that it displays Free proteins originally selected using mRNA display may need to be incubated under reverse transcription conditions in order to achieve their active conformations Purify RT products 23 24 25 20 27 28 Exchange the buffer into selection buffer on a NAP 5 gel filtration column according to the manufacturer s instructions Allow 10 ml of selection binding buffer to flow through the gel filtration column Add 100 ul of 10 mg ml salmon sperm DNA and 10 ul of 1 mg ml BSA to 890 ul of selection binding buffer vortex and allow this to flow through the gel filt
229. of selection will expo nentially rise to a high value and then plateau Assuming that there are a relatively small num ber of members of the initial library with activ ity that causes them to be selected it is likely that several rounds of selection and amplifica tion will have to be performed before any sig nificant increase in activity is observed Once the selection activity has peaked or reached a plateau then the library members should be sequenced If there were relatively large numbers of members of the initial library with activity that causes them to be selected then the library at this stage may still be fairly diverse Since the cycles of selection and am plification preferentially amplify the most ac tive members a high diversity library at the end of the selection is likely to indicate a failed selection or a selection that is not yet finished Successful selections are likely to yield one or a small number of families of very closely related protein sequences each of which has diverged from a single ancestral protein se quence owing to errors accumulated during the many cycles of PCR amplification to which they have been subjected Assays of individual members of these selected families of se Current Protocols in Molecular Biology quences should yield mRNA displayed pro teins with the desired function these are also likely to be functional as free proteins unless the mRNA display template greatly interferes wi
230. ol Actual amounts will of course depend on synthetic yield extension efficiency and amplification efficiency Current Protocols in Molecular Biology BASIC PROTOCOL 2 Generation and Use of Combinatorial Libraries 24 2 21 Supplement 88 DNA Pools for In Vitro Selection 24 2 22 Supplement 88 Choose how the amplification will be carried out If the volume of the large scale amplification reaction is to be lt 100 ml 2a 3a 4a Use a commercially available thermal cycler repetitively Set the reaction mixture up in advance and pipet 100 ul aliquots into individual wells of a 96 well PCR plate Carry out several small amplification reactions in advance to ensure that the optimized conditions determined in Support Protocol 3 work with the PCR plate format and that amplification is uniform across the PCR plate Perform thermal cycling on the entire reaction using multiple PCR plates For larger volumes Reactions will be divided into aliquots in 13 ml thermostable Sarstedt tubes and am plified in a series of water baths Construct floating racks by cutting off the bottom of the tubes Styrofoam packing material Reinforce these racks by wrapping their edges with heavy tape Place the racks iteratively in three circulating or static water baths held at the denaturation annealing and elongation temperatures previously determined see Support Protocol 3 2b 3b 4b 6a 6b Determine
231. olymerases For example the rate of insertions presumably due to a DMTr group cleavage via tetrazole has been measured to be as high as 0 4 per position and the rate of deletions presumably due to incomplete capping has been found to be as high as 0 5 per position A Keefe and D Wilson pers comm The number of usable DNA molecules that are actually present in a nascent pool can be calculated by determining the fraction of the pool that can be extended by Taq polymerase Materials Purified ssDNA pool PCR primers T4 polynucleotide kinase and buffer New England Biolabs y P ATP 3000 Ci mmol 0 5 M EDTA pH 8 0 APPENDIX 2 3 M sodium acetate APPENDIX 2 25 24 1 phenol chloroform isoamyl alcohol saturated with 10 mM Tris Cl pH 8 1 1 mM EDTA see unir2 4 or purchase from Sigma 3 0 M sodium acetate 70 and 95 ethanol TE buffer pH 8 0 APPENDIX 2 1 mg ml blue dyed glycogen GlycoBlue Ambion 10x PCR amplification buffer see recipe Taq DNA polymerase 2x denaturing dye see recipe Thermal cycler 15 cm x 17 cm x 0 75 mm denaturing polyacrylamide gel UNIT 2 12 Phosphor imager plate and phosphor imager APPENDIX 3A Additional reagents and equipment for quantitation of DNA e g APPENDIX 3D end labeling of DNA e g UNIT 3 10 phenol chloroform and chloroform extraction of DNA uNiT 2 14 PCR amplification e g Chapter 15 denaturing polyacrylamide gel electrophoresis UNIT 2 12 and phosphor imaging APPENDIX 3A
232. om which the next round of selection will begin While the authors have found that reverse transcription and PCR steps can be combined for some selections this is not universally true To obtain the highest yield of RNA and DNA products it is frequently desirable to carry out separate reverse transcription and PCR reactions as described below Materials Selected RNA pool Basic Protocol 2 TE buffer pH 8 0 see recipe or RNase free water SuperScript II reverse transcription kit Invitrogen 20 and 200 uM 3 end primer 4 mM dNTP mix containing 4 mM each of dATP dCTP dGTP and dTTP 10x PCR buffer see recipe 20 uM 5 end primer 5 U ul Taq DNA polymerase New England Biolabs 6x nondenaturing dye 0 6 w v bromphenol blue and 10x ethidium bromide in TBE buffer see APPENDIX 2 for TBE buffer NuSieve agarose Cambrex 10 mg ml ethidium bromide solution APPENDIX 2 TBE buffer APPENDIX 2 3 M sodium acetate APPENDIX 2 1 mg ml blue dyed glycogen GlycoBlue Ambion Current Protocols in Molecular Biology BASIC PROTOCOL 3 Generation and Use of Combinatorial Libraries 24 3 15 Supplement 88 Selection of RNA Aptamers 24 3 16 Supplement 88 70 and 95 ethanol Thermal cycler e g BioRad DNAEngine with heated lid and PCR tubes Additional reagents and equipment for the polymerase chain reaction Chapter 15 agarose gel electrophoresis e g UNIT 2 6 and DNA sequencing Chapter 7
233. om a pool with a 220 position random region Bartel and Szostak 1993 isolated a novel ribozyme capable of RNA ligation Generally selections for catalysis require pools with a random region greater than 90 residues while binding selections use pools with a random region of less than 70 residues Intermediate between partially random and completely random sequence pools are seg mentally random sequence pools In a segmentally random pool short tracts of sequence are completely randomized Segmental randomization thus allows all possible sequences within a short region or set of residues to be examined Thus if a natural binding site is known but a portion of that binding site is suspected to be particularly important for function then a segmentally random pool can be used to identify all possible functional sequences within the wild type sequence context For example Tuerk and Gold 1990 selected aptamers that bound T4 DNA polymerase from a pool that contained 8 ran dom sequence positions flanked by wild type residues Similarly many binding sites are known to be presented within a particular structural context such as a stem loop or stem bulge structure In these cases a portion of the structure can be completely randomized and all possible functional stem loops or stem bulges can be identified For example the Rev binding element was known to form a stem internal loop stem structure Giver et al 1993 segmentally randomized only the in
234. ontrol or reduce their numbers The affinity of the RNA aptamer for the protein target cannot be anticipated Affin ity typically varies between micromolar and Generation and Use of Combinatorial Libraries 24 3 25 Supplement 88 Selection of RNA Aptamers 24 3 26 Supplement 88 sub nanomolar depending presumably on the makeup of the nucleotide pool and on the targeted protein However it might be worth mentioning that of the first 100 selections car ried out at two commercial entities using the technology Gilead Sciences and NeXstar just under 80 yield aptamers with affinities under 107 M Brody et al 1999 Recent innovations at Somalogic involving modified nucleotides have greatly increased both the rate of success and the affinities of selected aptamers Zichi et al 2008 Time Considerations The time required to go from one pool of selected DNA templates to the next is 24 to 72 hr depending on the researcher and the demands of the particular selection experiment Minimally a transcription reac tion takes 4 hr and the ensuing DNase heat denaturation and gel purification steps can take another 2 to 3 hr Elution for 8 to 10 hr yields an adequate amount of RNA to be used in the subsequent binding reaction After pre cipitation and quantification of the RNA 1 hr the preselection filtration incubation with tar get and selection steps can be performed in 2 hr Elution of protein RNA
235. ool and optimization of amplification conditions Curr Protoc Mol Biol 88 24 2 1 24 2 27 2009 by John Wiley amp Sons Inc Keywords In vitro selection e DNA pool synthesis e phosphoramidite DNA synthesis e randomization INTRODUCTION This unit describes the design synthesis purification and amplification of a random sequence DNA pool Functional nucleic acid binding or catalytic species can be selected from these random sequence pools In designing the DNA pool careful consideration should be given both to the degree of randomization and the length of the random sequence region see Strategic Planning Following pool design chemical synthesis on a commercial DNA synthesizer will yield a single stranded DNA pool The newly synthesized oligonucleotide pool can then be purified see Basic Protocol 1 Prior to amplification the initial complexity of the pool should be determined see Support Protocol 1 the skewing of the pool should be determined see Support Protocol 2 and amplification reaction conditions should be optimized Support Protocol 3 If the nascent synthetic oligonucleotide is judged to be suitable for large scale amplification it can be enzymatically converted into a double stranded DNA library see Basic Protocol 2 Multiple copies of a single stranded DNA pool can be derived from each double stranded DNA library or the library can be transcribed to yield an RNA pool or a modified RNA pool see UNIT 24 3
236. otocol 1 Oligo dT wash buffer see recipe Ni NTA agarose Qiagen Ni NTA binding buffer see recipe 2 Mercaptoethanol Ni NTA wash buffer 1 see recipe Ni NTA wash buffer 2 see recipe Ni NTA elution buffer see recipe 10 mg ml salmon sperm DNA Life Technologies 1 mg ml BSA 200 uM DNA splint 5x Superscript II reverse transcriptase buffer NEB 0 1 M DTT 30 ul each 25 mM deoxynucleotide triphosphates final 0 5 mM 200 U ml Superscript II reverse transcriptase NEB 25 mM deoxynucleotide triphosphate solutions ATP aptamer selection binding buffer see recipe ATP aptamer selection elution buffer see recipe Chromatography columns Bio Rad Gel filtration columns e g NAP 5 Amersham Pharmacia Biotech For additional reagents and equipment for preparative denaturing PAGE purification UNIT 2 12 and SDS PAGE in Tris tricine buffer systems UNIT 10 24 Purify mRNA displayed proteins 1 Wash 20 mg of oligo dT cellulose repeatedly with deionized water in the chroma tography column within which it will be used Resuspend the cellulose several times and apply positive pressure to force it to drain rapidly Finally wash once with oligo dT binding buffer Oligo dT cellulose contains fine particulate matter that can drastically reduce the flow rate of aqueous solutions These fine particles can also pass through the frit during use of the chromatography column which will result in the loss of mRNA displayed proteins
237. otocols in Molecular Biology NOTE All solutions and buffers should be made with deionized water 18 2 MQ re sistivity filtered through 0 2 um polyethersulfone PES membrane and sterilized by autoclaving Use sterile disposable plasticware and micropipet tips with filter barriers where possible See Chapter 4 introduction and unr 4 1 for guidelines on standard meth ods to protect against contaminating RNases If ribonuclease contamination is found to occur it may be eliminated by treating water with diethylpyrocarbonate DEPC see UNIT 4 1 Partition the pool 1 Use 400 pmol of the RNA pool gt 2 4 x 10 4 different sequences for selection Using significantly lower quantities of RNA may affect the diversity of the population in the initial rounds of selection Using significantly higher quantities may lead to precipitation of the nucleic acid pool Irvine et al 1991 devised a formula to determine the optimum protein and RNA concentration in order to minimize the number of rounds of selection based on the Ky of the starting pool the desired Kg and the fraction of free RNA molecules that partitions as nonspecific background versus the fraction of RNA molecules that forms specific RNA protein complexes Empirically the concentrations of many available protein targets will be in the nanomolar range and a 1 to 10 fold excess of the RNA pool should suffice for early rounds of selection If only a small amount of RNA pool is initially
238. pplement 87 While setting up and incubating biological reactions contained within emulsions is sur prisingly straightforward and only requires readily available molecular biology equip ment generating viable selection schemes takes very careful planning and troubleshoot ing Not all proteins are amenable to emulsion selections and for those that are care must be taken to ensure that the mode and stringency of selection are appropriately matched to the capabilities of the system Materials DNA of interest Mineral oil molecular biology grade RNase DNase protease free Sigma cat no M5904 Span 80 sorbitane monooleate e g Sigma cat no 6760 or Fluka cat no 85548 Tween 80 Triton X 100 Cell free transcription and translation system e g Roche RTS 100 E coli HY Kit including E coli lysate Reaction mix Amino acid mixture without methionine Methionine Reconstitution buffer Tris buffered saline TBS APPENDIX 2 Quenching agent e g 100 uM p biotin Sigma Aldrich cat no 47868 in TBS Diethyl ether H2O saturated Tris buffered saline Tween 20 TTBS APPENDIX 2 Anti polyhistidine antibody bound to agarose beads Sigma cat no A5713 Elution buffer see recipe 95 x 16 8 mm polypropylene 13 ml Sarstedt tubes 1 5 and 2 ml microcentrifuge tubes Spinplus 9 5 x 9 5 mm Teflon stir bars VWR Scientific Stir plate Corning Stirrer Hot Plate PC 420 90 x 50 mm or similarly sized glass beaker to hold the
239. protein produced In order to increase protein production it may be necessary to try different lysate sources and different emulsification techniques see Table 24 6 1 If little or no protein is car ried through the aqueous phase following ether extraction alternative methods for breaking the emulsion can be used Chloroform hex anes and other organic solvents can be used to break emulsions and their efficiency can be compared to that of ether The protein ac tivity remaining after breaking the emulsion decreases with every additional ether extrac tion and so it may be beneficial to use fewer ether extractions However residual amounts of emulsifying agents can interfere with sub sequent amplification Even if a protein is translated it is often un clear whether the protein is active especially in emulsion relative to aqueous solution Pro tein activity in emulsion can be difficult to as sess Often the most effective assay involves just testing DNA recovery and amplification in the selection scheme itself especially since real time PCR is often much more sensitive than many enzyme assays Emulsion formation While emulsions are extremely easy to prepare they can also be heterogeneous and idiosyncratic Individual published methods have variations in the emulsion composition and the mechanics of emulsion formation In specting the emulsion under a microscope can help establish the size and size distribution of the
240. protein selection experiments have been successfully performed using ribosome display Jermutus et al 1998 and most recently mRNA display A D Keefe and J W Szostak pers commun Phage display Smith and Petrenko 1997 and the 2 hybrid system Fields and Song 1989 Colas et al 1996 are similar in vivo techniques that have also been successfully used for the selection of functional peptides and proteins In vitro selections are divided into two main categories 1 selections for aptamers i e specific binding to a chosen target and 2 selections for catalysts i e enzymes This is not an appropriate place for an exhaustive overview of the various approaches that have been used to discover new aptamers and catalysts but some general points can be made Aptamer selections Aptamer specific binder selections are in general undertaken by incubating the library with the immobilized target molecule The target molecule immobilization is by way of covalent attachment to a solid matrix such as agarose usually through a spacer molecule Many immobilized target molecules are commercially available After incubation the flowthrough is drained away the immobilized target molecules are washed several times and then an elution fraction is collected by incubating the matrix and the immobilized target molecules with an elution buffer that contains the dissolved target molecule Those library members that are contained in the elution fraction a
241. r one exA operator s The sensitivity of the lacZ reporter decreases with the number of exA operators 9 Divide culture into five 50 ml conical centrifuge tubes and centrifuge 5 min at 3000 xX g room temperature 10 Decant supernatant and resuspend each yeast pellet in 25 ml sterile water Repeat centrifugation 11 Decant supernatant and resuspend each yeast pellet in 1 ml of 100 mM lithium acetate Transfer to a 1 5 ml microcentrifuge tube and pellet yeast by centrifuging 15 sec at 20 800 x g room temperature 12 Remove supernatant with a pipet and resuspend each yeast pellet in 350 ul of 100 mM lithium acetate final volume 500 ul 13 Split the contents of each tube into ten 50 1 portions and pellet yeast by centrifuging 15 sec at 20 800 x g room temperature Current Protocols in Molecular Biology 14 Remove supernatant with a pipet and add the following ingredients to each sample in the order listed 240 ul 50 w v PEG 3350 36 ul 1 M lithium acetate 50 ul 2 mg ml single stranded carrier DNA 100 ug 25 ul 40 ug ml peptide aptamer library DNA 1 ug Single strand carrier DNA needs to be heated to 95 C for 5 min and cooled on ice prior to use 15 Vortex the transformation mixture vigorously until the yeast pellet is completely resuspended and incubate 30 min at 30 C 16 Heat shock 20 min at 42 C 17 Pellet yeast by centrifuging 15 sec at 20 800 x g room temperature 18 Remove supernatant with a pipe
242. ransform pBait and pSH18 34 lacZ reporter into the interaction trap selection strain EGY48 by lithium acetate yeast transformation UNIT 13 7 3 Plate transformants on Glu CM His Ura plates and place in a 30 C incubator Characterize bait protein 4 Confirm that the bait protein does not self activate the reporter genes by performing plate assays for lacZ activation and leucine requirement UNIT 20 1 If the bait protein activates the leu2 and or lacZ reporter genes variations of the interaction trap that reduce reporter sensitivity should be tried Yeast strains and or plasmids contain ing less sensitive leu2 and lacZ reporters reduce the background reporter output to reasonable levels Yeast strains Table 20 1 2 and plasmids Fig 24 4 2 with less sensitive reporters are described in UNIT 20 1 Truncating or separating the protein target can also eliminate transcription self activation 5 Confirm bait protein synthesis using the repression assay described in UNIT 20 1 Baits that do not repress the expression of B galactosidase in the repression assay may not be expressed correctly or may be incapable of entering the nucleus Expression of full length baits can be verified by immunoblotting If full length baits are expressed their entry into the nucleus can be facilitated by adding a nuclear localization signal J Kamens unpub observ See Table 20 1 1 for description of plasmid pJK202 a bait vector that contains a nu
243. ration column Allow 10 ml of selection binding buffer to flow through column and 0 5 ml of sample to flow through column Add 1 ml of selection binding buffer to the top of the gel filtration column and collect the 1 ml eluate issued from bottom of column Analyze the starting material and the elution fraction using Tris tricine SDS PAGE as described in UNIT 10 2A Alternate Protocol 1 and by scintillation counting The selection binding buffer used here is specific to the selection being performed Alternatively a protein folding step may accompany the buffer exchange into selection buffer In this approach a denaturant such as guanidinium hydrochloride or urea is added directly to the mRNA displayed proteins after reverse transcription and this is dialyzed away over several hours into selection buffer It is important to ensure that the denaturing conditions are not so denaturing that the association between the cDNA and the mRNA display template is broken this may be assayed using SDS PAGE SELECTION AND AMPLIFICATION OF THE mRNA DISPLAYED PROTEINS Selection protocols are highly project dependent The following protocol was success fully used to select ATP binding proteins from a random sequence library and is included as an example Cycles of selection and amplification as described in this protocol should be repeated until the proportion of the resultant mRNA displayed proteins in the selected fraction is no longer increasing
244. rature The gel follows amplification of the N73 pool across a gradient of annealing temperatures Two different pool synthesis methods were analyzed Samples were removed after 0 2 4 6 and 8 cycles The pool used in the cycle course is depicted below the figure of the gel IDT Integrated DNA Technologies http www idtdna com Serially dilute the amplified product 1 2 1 4 1 128 Electrophorese all of the samples on a large agarose gel UNIT 2 5 Note that it is quite difficult to accurately pipet solutions at 72 C It may therefore be desirable to pipet an amount slightly larger than that intended for use in the serial dilution 3 Calculate the average PCR amplification efficiency by identifying to what extent the cycle 7 PCR reaction is the result of progressive doublings of the original synthetic DNA Determine which dilution lanes lack detectable DNA The largest dilution that lacks detectable DNA is also the dilution that is a minimum estimate of the number of doublings For example if the 1 64 dilution is the largest dilution without detectable DNA this implies that six doublings of the synthetic DNA yielded at least 64 fold more DNA This is expressed as follows average efficiency of theoretical doublings i e PCR cycles fold increase in DNA Thus if 7 cycles of PCR were performed then the average number of doublings per cycle is 1 81 from 1 81 64 4 Modulate PCR conditions to enhance PCR
245. re amplified and the process is repeated until functional molecules dominate the library At this stage the functional molecules are identified by cloning and sequencing It is important to realize that in the early rounds of selection the vast majority of the library members contained in the elution Current Protocols in Molecular Biology fraction are nonspecific binders or nonbinders Consequently several rounds of selection and amplification will be required before the functional specific binding sequences dominate the library The composition of the selection binding and selection elution buffers is likely to influence the aptamers that are ultimately discovered using this system It may be important to use a buffer that promotes protein folding but discourages aggregation The use of high concentrations of cosmotropic compounds such as ammonium sulfate will promote folding while the use of nonionic detergents such as Triton X 100 will discour age aggregation The oxidation potential of the buffer should also be considered The inclusion of a reducing agent such as DTT is likely to lead to the selection of protein aptamers active under reducing conditions while the inclusion of oxidizing agents such as glutathione disulfide is likely to lead to the selection of protein aptamers active under oxidizing conditions It is important to ensure that the binding and elution buffers are as similar as possible Changes in ionic strength and or pH be
246. recovered from the gel be sure to save at least some sample for the no protein control see below 2 To ensure that each species in the RNA pool folds into the most accessible or most stable conformation heat the RNA pool in 50 to 100 ul binding buffer see Critical Parameters for discussion on choosing a binding buffer between 65 and 75 C for 3 min and then allow the sample to cool to room temperature over 10 min Since ionic strength monovalent and divalent cation concentrations pH temperature and buffer concentrations can all influence interactions with the target it is usually wise to keep all of these parameters constant during the early rounds of selection when productive binding species are accumulating Hence the binding buffer equilibration time and preparation of the RNA for selection should be kept uniform until a significant interaction between pool and target is observed see Critical Parameters for discussion of stringency of selection Higher temperatures can be used for thermal equilibration but the presence of divalent metal ions in the selection buffer can lead to RNA degradation 3 Prior to the addition of the protein target perform a negative selection to remove any filter binding species that may be in the population Place a pre wetted filter into the filter holder top and lock the filter holder base into the clips protruding from the filter holder top Secure the filter holder base by passing the rin
247. rectly for the turnover rate Selection controls The importance of selection controls cannot be emphasized strongly enough mRNA display selection protocols in which functional library members are enriched much less than ten fold over nonfunctional library members are unlikely to lead to the isolation of functional library members in the laboratory Biases are present in many steps of the mRNA display amplification protocol especially translation and protein display efficien cies and these can overwhelm the enrichment in functional members that results from the selection step Suitable positive controls are molecules known to catalyze or bind to the intended substrate and need not be proteins although the best control will usually be a similar functional protein displayed upon its reverse transcribed mRNA display tem plate Current Protocols in Molecular Biology Nomenclature mRNA displayed proteins are referred to by a variety of names in the literature such as RNA protein fusions and profusions PREPARATION AND PURIFICATION OF mRNA DISPLAYED PROTEINS This protocol describes the preparation of the mRNA display template from an appropri ate DNA template DNA splint and DNA linker 3 terminated with puromycin the use of the mRNA display template to prepare mRNA displayed proteins and their subsequent purification and an example selection The protocol steps are also shown in Figure 24 5 4 For additional details see Liu e
248. ree proteins away from reticulocyte lysate The FLAG purification is upon the basis of the FLAG tag sequence DY KDDDDK and is only appropriate if this is present in the library see Strategic Planning Additional Materials also see Basic Protocol 1 Anti FLAG M2 agarose Sigma FLAG clean buffer see recipe FLAG binding buffer see recipe FLAG peptide Sigma Current Protocols in Molecular Biology SUPPORT PROTOCOL 1 Generation and Use of Combinatorial Libraries 24 5 25 Supplement 53 SUPPORT PROTOCOL 2 Protein Selection Using mRNA Display 24 5 26 Supplement 53 1 Wash 100 ul of anti FLAG M2 agarose three times with 1 ml of FLAG clean buffer and then three times with 1 ml of FLAG binding buffer 2 Exchange sample buffer into FLAG binding buffer according to the directions presented in Basic Protocol 1 for other buffer exchanges Optionally dilute the sample buffer into the FLAG binding buffer or attempt purification directly from selection elution buffer 3 Place 1 ml of the sample containing the mRNA displayed proteins onto the washed anti FLAG agarose and incubate for 1 hr at 4 C with rotation drain and retain flowthrough 4 Wash the anti FLAG agarose three times with 1 ml of FLAG binding buffer 5 Elute from the anti FLAG agarose two times with 0 5 ml FLAG binding buffer containing 10 uM of the FLAG peptide 30 min for each elution at 4 C with rotation If the FLAG tag puri
249. rent phosphoramidites relative correction factors that take into account different coupling efficiencies and molecular masses must be calculated Multiplying together these correction factors gives an overall correction fac tor to provide equal molar coupling of each phosphoramidite Table 24 2 3 displays Current Protocols in Molecular Biology Table 24 2 3 Representative Calculations Based on the Masses and Efficiencies for Couplings that Utilize the Canonical Tetrazole Activation Chemistry and Phosphoramidites Bearing Standard Protecting Groups i Oe es 5 CE dA 858 0 87 0 67 0 58 5 CE dC 834 0 89 0 67 0 60 5 CE dG 840 0 89 1 00 0 89 5 CE dT 745 1 00 0 83 0 83 CE f cyanoethyl P Ac CE dC can also be utilized for faster deprotection Table 24 2 4 Volumes of Acetonitrile Needed to Dissolve 1 g of Phosphoramidite E Volume Phosphoramidite acetonitrile ml 5 CE dA 11 6 5 CE dC 12 0 5 CE dG 17 8 5 CE dT 16 6 representative calculations based on the masses and efficiencies for couplings that utilize the canonical tetrazole activation chemistry UNIT 2 17 and Beaucage and Caruthers 2000 and phosphoramidites bearing standard protecting groups cyanoethyl for the phosphates along either isobutyryl N 2 of guanine or benzoyl N 6 of adenine and N 4 of cyto sine groups Other chemistries and protections may require the substitution of other correction factors Most modern synthesizers require that
250. riable pep tide regions displayed on the surface of a scaf fold protein To date only a limited number of scaffold proteins have been used within organ isms to display linear and constrained peptides These include E coli thioredoxin Colas et al 1996 Gal4 activation domain Yang et al 1995 green fluorescent protein Caponigro et al 1998 and staphylococcal nuclease Nor man et al 1999 A comparison of the binding constants of these aptamers shows that con strained variable regions can bind their targets between 100 and 10 000 fold better than linear peptides Geyer and Brent 2000 Uncon strained peptides are also known to be unstable in E coli Davidson and Sauer 1994 Con strained peptide libraries are therefore the pre ferred method for displaying combinatorial peptide libraries for intracellular applications When choosing aptamer scaffolds they should also be small stable soluble and expressed at high levels without toxicity The scaffold should be tolerant to the addition of protein moieties such as localization sequences epi tope tags and purification tags Basic Protocol 1 describes the construction of a peptide aptamer library using E coli thiore doxin as the scaffold protein Thioredoxin was first used as a scaffold protein for displaying peptides as fusions to flagellin on the surface of E coli Lu et al 1995 Thioredoxin pos sesses many characteristics that make it an excellent scaffold
251. ries of proteins upon the surface of phage Sche et al 1999 but phage display has yet to be used to discover a new protein from an entirely random sequence library as distinct from a library de rived from a known folded protein In ribosome display paused ribosomes display the protein library in a ternary complex with the mRNA that encodes the displayed protein In order to synthesize this ternary complex an mRNA li brary is prepared without a stop codon Upon translation of this template the ribosomes will pause at the end of the open reading frame Because the ribosome is unable to release itself from the message it displays both the nascent protein and the mRNA that encodes it These constructs may be used for in vitro selection experiments upon the basis of the function of the displayed nascent protein Selected proteins may then be amplified using RT PCR amplifi cation of the associated mRNA The ribosome display constructs are relatively large and se lections can only be performed under condi tions that preserve the ribosome mRNA nas cent protein association Also since the ribo some display constructs also display a single stranded mRNA there is a possibility that functional RNA sequences may be selected in place of the desired functional proteins This problem can be avoided by reverse transcribing the mRNA associated with the ribosome Critical Parameters After designing and synthesizing the mRNA display library
252. rimer 1 5 CCGCCGCCTGAATTCATGAGCGATAAAATTATTCAC 3 20 uM primer 2 5 CGGGGCGATCATTTTGCACGGACC 3 Plasmid DNA peptide aptamer plasmid see Basic Protocol 2 pBait see Basic Protocol 2 pJM 1 Fig 24 4 1 pRB1840 1 LexAop LacZ reporter plasmid Fig 24 4 2 and pJK103 Fig 24 4 2 Current Protocols in Molecular Biology Mg Mn solution 45 mM MgCl and 5 mM MnCl PCR purification column optional e g Qiagen Yeast strain EGY48 Mata ura3 trp1 his3 3LexA operator leu2 Complete minimal CM dropout medium unr 13 1 and plates supplemented with either 2 w v glucose Glu or 2 w v galactose and 1 w v raffinose Gal Raf Glu CM His Ura 10 cm plates Glu CM His Ura Trp 10 cm plates Gal Raf CM Ura His Trp liquid medium Xgal plates UNIT 13 1 Glu CM His Ura Trp Xgal 10 cm plates Gal Raf CM His Ura Trp Xgal 10 and 15 cm plates PCR tubes Automated thermal cycler 30 C incubator Additional reagents and equipment for agarose gel electrophoresis optional UNIT 2 54 digesting and cloning peptide aptamer mutants see Basic Protocol 1 lithium acetate yeast transformation see Basic Protocol 2 and UNIT 13 7 determination of plating efficiency UNIT 20 1 plasmid rescue UNIT 13 11 and plasmid DNA sequencing UNIT 7 3 Mutagenize peptide aptamer variable region 1 Prepare PCR premixture total 3 775 ml 500 ul 10x Tag polymerase buffer 5 wl 1 M MgCl 1
253. rm with the aqueous layer as it can interfere with subsequent enzyme reactions Dilute the eluate with an equal volume 400 ul of RNase free water and add 800 ul of isopropanol then chill 20 min at 20 C to precipitate A carrier such as glycogen see step 12 can be added to aid precipitation The elution buffer contains a high concentration of urea Dilution with 400 ul water and precipitation with isopropanol is necessary to avoid the formation of salt precipitates which appear as oily unstable droplets in the bottom of the microcentrifuge tube following centrifugation If such salt pellets appear additional water should be added to the sample the mixture should be homogenized and the precipitation repeated Microcentrifuge 30 min at maximum speed remove the supernatant and resuspend the RNA sample in 12 ml sterile RNase free water Current Protocols in Molecular Biology Perform an additional negative selection optional steps An extremely effective method for ridding the population of filter binding species is to carry out an additional negative selection following the selection for binding species but prior to amplification However at early stages of the selection an additional post selection filtration step may reduce the complexity of the selected population Therefore it is recommended that post selection filtration only be carried out following the second round of selection Post selection filtration can also
254. rom gel as in step 3 and precipitate as in step 4 Dissolve the purified splint in deionized water and measure the concentration using UV visible spectroscopy at 260 nm see step 5 Prepare mRNA display template 12 13 14 15 Ligate the linker and RNA template with T4 DNA ligase in the presence of the splint to give the mRNA display template Set up the following 1 ml ligation reaction 100 ul 100 uM 5 phosphorylated DNA linker final 10 uM 100 ul 100UM RNA library final 10 uM 100 ul 100 uM splint final 10 uM 580 ul water Heat this mixture for 2 min at 95 C then add 100 ul of 10x T4 DNA ligase buffer final 1x Vortex the resultant mixture and cool on ice for 10 minutes allow to warm to room temperature then add 20 ul of 2000 U ul T4 DNA ligase final 40 U ml Incubate the reaction for 20 min at room temperature Add 150 ul of 100 mM EDTA and 500 mg of solid urea and heat for 5 min at 90 C Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 5 15 Supplement 53 Table 24 5 1 Translation Reactions for mRNA Display Proteins Reagent Final B C D E F concentration Control RNA lul Oul Oul Oul Oul Oul 5 uM mRNA display template 2 4 800nM_ Oul Oul Oul ul 2 ul 4ul 5 uM unligated RNA 400 nM Oul Oul 2 ul Oul Oul Oul 12 5x Met free translation mix 1x 2 ul 2 ul 2 ul 2 ul 2 ul 2 ul 8 6 uM labeled methionine 0 69 uM 2ul 2 ul 2ul
255. ropriate level of stringency and the mechanisms by which strin gency can be modulated will depend on the specific selection As a selection progresses and the diverse starting library becomes less diverse and more functional it may be nec essary to increase the selection stringency to allow the variants with the highest function to be further enriched from those with moderate function In the context of streptavidin bind ing to biotin selection stringency was set by the time required after de emulsification for protein recovery prior to amplification Basic Protocol steps 11 through 14 Stringency is increased by increasing the incubation time during which binding must be maintained and through the presence of binding competitors Current Protocols in Molecular Biology Anticipated Results For the selection described in this unit where only a few amino acids were random ized Levy and Ellington 2008 the entire selection was completed within only a few two to seven rounds For rarer phenotypes or less robust selections more cycles may be required In general though it is anticipated that the real time PCR signal Ct will de crease over the course of several rounds If no decrease is seen or if the signal is highly variable then some action is likely required see Troubleshooting As has previously been seen for phage display selections another in dication of the success of the selection is win nowing of the pool whi
256. rotocol I except that I ul of a labeled ATP is added to the 20 l transcription reaction in addition to the standard NTP mix After the RNA has been separated from free nucleotides via PAGE the buffer in the bottom chamber will contain unincorporated nucleoside triphosphates and will therefore be ex tremely radioactive Care should be taken when transferring and disposing of this solution 2 Thermally equilibrate 1 ug of the radiolabeled RNA pool after a round of selection in binding buffer as described in Support Protocol 2 steps 1 and 2 Current Protocols in Molecular Biology SUPPORT PROTOCOL 3 Generation and Use of Combinatorial Libraries 24 3 19 Supplement 88 Selection of RNA Aptamers 24 3 20 Supplement 88 3 For each round tested set up reactions in triplicate with and without target Add an equimolar amount of protein to the RNA pool Incubate the binding reaction under conditions similar to those used for selection The binding reaction volume should be the same as that used for the selection If the amount of protein sample is limited or limiting less protein can be used in the binding reaction However one should be cognizant of the fact that less than 100 binding is possible Alternatively less protein and less RNA sample can be used although the diminution of both components will mean that one is assaying binding under conditions more stringent than those actually used for selection While the volu
257. roxide for 30 min and then rinse three times each time with 100 ml of distilled water to remove any residual DNases that may remain from previous use typically bacterial cell pelleting 9 Resuspend the amplified DNA in 100 to 200 ul TE buffer pH 8 0 containing 50 mM of a salt such as KCl It is unwise to resuspend a double stranded DNA pool in water since the random segments may denature reassort and become transcriptionally incompetent If it is suspected that the pool has become denatured for example if a large single stranded DNA component is seen on a nondenaturing agarose gel simply repeat one to two cycles of PCR 10 Quantitate the PCR DNA Determine the overall amplification efficiency and the final number of DNA molecules This can be done by carrying out gel electrophoresis in parallel with dilutions of a DNA ladder of known concentration The concentration can also be determined spectrophoto metrically or by monitoring the change in absorbance of an intercalated fluorescent dye Hoechst 33258 Sigma on a fluorimeter e g DyNA Quant 200 GE Healthcare These latter methods are much more quantitative although the fluorimeter method may not be accurate for sequences lt 100 nucleotides in length However these methods may not distinguish precipitated double stranded DNA from residual precipitated nucleotides or single stranded primers The amount of DNA obtained from large scale amplification is often referred to
258. rs often utilize relatively inexpensive NEB Taq polymerase due to the quantity consumed over multiple rounds of selection However Plat inum Taq Invitrogen AmpliTaq Gold ABD or Phusion NEB have been used to success fully amplify DNA when NEB Tag failed It is reasonable to assert that if competent under graduates can utilize these kits then more ex perienced researchers should be able to obtain positive results with them The authors have also compared re verse transcriptases from Invitrogen Super Script Applied Biosystems MEGAScript and Roche Transcriptor SuperScript II was found to be the most convenient to use Lastly the authors have tested a number of kits and components for transcription including over expressed and purified T7 RNA polymerase versus polymerases and kits from Invitrogen and Roche Although relatively expensive for Current Protocols in Molecular Biology our purposes the AmpliScribe High Yield kit from Epicentre was chosen because of its con sistent yield and robustness to template quality and incubation temperatures It should be noted that lot to lot varia tions are more common for in house en zyme preparations and the yields are generally lower than those obtained with commercial kits Troubleshooting homemade preparations can also be difficult relative to the technical support capabilities of a good reagent com pany If users choose to prepare their own en zymes a freshly
259. s and after subsequent selection is likely to yield improved solutions closely related to one or more of the originally selected sequences Specific directions for the preparation of a DNA library for an mRNA display selection vary greatly depending upon the source of the DNA the selection target and the precise assembly strategy chosen See UNITS 24 2 24 3 amp 24 4 for further details A more detailed discussion of both preselection and mRNA display library construction strategy is given in Cho et al 2000 A generalized library construction strategy is also shown in Fig 24 5 5 Once the DNA library has been synthesized but before the selection has com menced it is important to sequence some of the individual library members to ensure that the library sequence is as intended and that the proportion of error free sequences is appropriate for the selection strategy envisaged Selection In vitro selection strategies such as mRNA display offer a generalized method for the discovery of functional molecules only if the molecules in question can be enriched upon the basis of their function and subsequently directly amplified Enrichment upon the basis of function is termed selection The appropriate design of the selection step is absolutely crucial to the success of the project as a whole Most in vitro selection experiments have been performed upon libraries of nucleic acids rather than proteins Wilson and Szostak 1999 although some
260. s are preferentially amplified and nonfunctional sequences are lost Consequently increasing the diversity of the library at a stage after the first selection step may appear to be a retrogressive step however this is not necessarily the case Protein libraries that are generated by stochastic means such as those generated from DNA made on a DNA synthesizer using mixtures of nucleotide phosphoramidites sample protein sequence space extremely sparsely For example a member of a library of 10 proteins Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 5 9 Supplement 53 Protein Selection Using mRNA Display 24 5 10 Supplement 53 each of which is 72 amino acids long with each amino acid being equally likely to appear at each position will on average have a sequence with 26 differences mutations from the next most similar member of the library If a solution to a particular problem is chanced upon using such a library it is highly unlikely to be the optimal solution The solution in question may be a small number of mutations away from many other superior solutions but the initial library is extremely unlikely to have contained any of the sequences in question because the sampling was so sparse Once a selection strategy has given one or many such nonoptimal solutions one or more mutagenic steps will enable the exploration of the local sequence space around such solution
261. s be determined using an algorithm such as Mfold Jaeger et al 1989 Zuker 2003 If the native or wild type structure of the binding site is not among the most common folds then the primers should be redesigned Additional improvements in primer and probe design have been stimulated by the desire to carry out single nucleotide polymorphism analyses whole genome sequencing phylogenetic analyses and quantitative PCR Vieux et al 2002 Boutros et al 2009 In addition methods have begun to be developed that address the interference of constant sequences and primer binding sites during selection Legiewicz et al 2005 Pan and Clawson 2009 If an RNA pool is to be constructed runoff RNA transcripts for in vitro selection are frequently made with T7 RNA polymerase There are several known promoters for T7 RNA polymerase Milligan et al 1987 but the following minimal sequence gives good yields 17 1 5 TAA TAC GAC TCA CTA TA 3 Addition of a G and C residue at the 18 and 19 positions of the minimal promoter helps to close the DNA duplex and stabilize the 5 end of the promoter region thereby increasing transcriptional yields Transcription initiation is optimal when there are stretches of purines in the 1 and 2 positions with GG being the best initiator Milligan et al 1987 Transcriptional yields also increase if uridine does not appear in the transcript before position 6 Typical pool designs incorporating all the elements
262. s by comparing the degree of con servation or variance before and after selec tion If a researcher decides that extant skew ing of base ratios is unacceptable this can only be fixed by adjustment of the randomized phosphoramidite mixture and resynthesis of the pool The third most common problem is that the pool fails to efficiently elongate With the pro viso that the efficiency of extension may be as low as 10 of the available pool it should not be much lower i e 1 of the available pool If extension or PCR efficiency is daunt ingly low the PCR conditions should be re examined and optimized as described includ ing buffer and enzyme concentrations tem peratures and extension times Switching to a different thermostable polymerase or to a combination of polymerases will sometimes improve primer extension If all possible PCR optimization conditions have been addressed poor extension efficiency could reflect a prob lem with the synthetic DNA For example the pool may not have been completely de protected or a primer binding site may have become largely depurinated during the course of a long synthesis Although incomplete de protection is rarely a problem small aliquots of the pool can be further treated with ammo nia and extension and amplification can again be assessed If additional deprotection instead yields oligonucleotide degradation then it is likely that apurinic sites have accumulated and the pool wil
263. s step if library is already amplified ORF Transcription of DNA library mRNA library AAAA Denaturing PAGE Purified mRNA library ONF purification of mRNA library LAALADAAAA Synthesis and denaturing DNA splint bmm PAGE of DNA splint that anneals to and coaligns 3 end of RNA and 5 end of DNA linker to allow ligation Synthesis and denaturing DNA linker PAGE of DNA linker that is 5 terminated with puromycin Kinase 5 phosphorylation Kinased DNA linker of DNA linker Splinted ligation of mRNA Library of mRNA display ODF library to DNA linker templates aa Translation of mRNA Protein library displayed ONF p i ddd dhs display template and high upon mRNA display salt incubation and or templates incubation at 20 C Free proteins KEY i ORF a eee DNA Ses mhi display r gt aap RNA emplates Abshehtheihes ea protem Reticulocyte lysate mRNA puromycin Reticulocyte lysate Figure 24 5 4 The steps that comprise a single round of selection and amplification in a protein selection using mRNA display continues on next page protein then they may be used to ensure that the expressed protein mRNA displayed or not is full length and in frame at both ends This double purification may optionally be performed when the DNA library is still at the individual cassette stage in order to increase the proportion of library members that are full length in frame and do not contain stop codons see
264. scosity of the oil pipetting accuracy at this step is improved by using a positive displacement pipettor e g Microman from Gilson 4 Prepare a 50 ul in vitro transcription and translation reaction using e g the Roche RTS 100 E coli HY Kit 12 ul E coli lysate 10 ul reaction mix Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 6 5 Supplement 87 Directed Evolution of Proteins In Vitro 24 6 6 Supplement 87 12 ul amino acid mixture without methionine 1 pl methionine 5 ul reconstitution buffer Template DNA H20 to 50 ul It is common to set up one experimental sample containing the randomized library for selection plus any relevant controls as described in Troubleshooting below Keep all the reagents on ice to prevent premature initiation of transcription and translation Proceed to step 5 as soon as possible Other in vitro translation kits can also be used in each instance the amount of protein produced and the activities of proteins produced should be assayed both in solution and in emulsion see also Troubleshooting The amount of template DNA that should be added to the emulsion reactions differs depending on the experiment see Critical Parameters In general between 10 and 10 genes will be added to a I ml emulsion selection These values correspond to 0 1 to 10 templates per aqueous compartment 5 Move the tube containing the oil surfacta
265. should then be optimized to discriminate between the two controls to the maximum possible reason able extent This maximal discrimination selec tion protocol should be adopted after round two Current Protocols in Molecular Biology or three at this stage the absolute yield of the selection step is no longer a concern owing to the high copy number of selected sequences that have passed through 21 amplification step Alongside the PCR amplification that fol lows each selection step a no RT control should be performed In this control a small amount of the mRNA display template that has not been reverse transcribed is used in place of the selected cDNA library This should not give any observable product after an equivalent amount of amplification If it does then either the buffers are contaminated or the purification of the mRNA displayed proteins is not strin gent enough A no template control PCR am plification will distinguish between these two possibilities In either case the problem must be addressed or the selection is unlikely to give the desired result Troubleshooting Problems that may be encountered with this procedure are detailed in Table 24 5 2 Anticipated Results The results of a selection largely depend upon how many of the initial library members can perform the task for which they are being selected and how well they can perform it under the selected conditions Ideally the observed activity in each round
266. sopropylamino phosphoramidite reagents in cluding 2 deoxyinosine Nucl Acids Res 13 8181 8196 Zuker M 2003 Mfold web server for nucleic acid folding and hybridization prediction Nucleic Acids Res 31 3406 3415 Generation and Use of Combinatorial Libraries 24 2 27 Supplement 88 In Vitro Selection of RNA Aptamers to a Protein Target by Filter Immobilization Bradley Hall Seyed Arshad Kyunghyun Seo Catherine Bowman Meredith Corley Sulay D Jhaveri and Andrew D Ellington Department of Chemistry and Biochemistry University of Texas Austin Texas 2Freshman Research Initiative University of Texas Austin Texas 3Nova Research Inc Alexandria Virginia ABSTRACT This unit describes the selection of aptamers from a pool of single stranded RNA by binding to a protein target Aptamers generated from this selection experiment can potentially act as protein function inhibitors and may find applications as therapeutic or diagnostic reagents A pool of dsDNA is used to generate an ssRNA pool which is mixed with the protein target Bound complexes are separated from unbound reagents by filtration and the RNA protein complexes are amplified by a combination of reverse transcription PCR and in vitro transcription Curr Protoc Mol Biol 88 24 3 1 24 3 27 2009 by John Wiley amp Sons Inc Keywords aptamer e in vitro selection e affinity reagent e filter binding assay e SELEX INTRODUCTI
267. ss contaminating DNA molecules set up an RT PCR reaction without the reverse transcriptase 2 Heat denature the reaction at 65 C in a thermal cycler for 5 min and cool to room temperature over 10 min This step ensures that primer can access and anneal to the primer binding site on the pool 3 Add the following components to each reaction 4 ul 5x First Strand Buffer from SuperScript II kit 2 ul 0 1 M DTT from SuperScript II kit 1 ul SuperScript II reverse transcriptase from SuperScript II kit or RNase free water for the no reverse transcriptase control 4 Mix the reaction well by pipetting up and down then incubate the reaction at 42 C for 50 min Heat inactivate the enzyme at 70 C for 15 min Perform cycle course PCR It is important not to over amplify the selected templates especially in the first several rounds since amplification artifacts can dominate a selection To determine the optimal number of cycles for amplification in each round an initial ranging or cycle course PCR must be performed A small sample of DNA is taken from the PCR every 2 to 3 cycles and saved for gel analysis The cycle at which a strong band is present is the Current Protocols in Molecular Biology PCR cycle 4 6 8 10 12 14 16 18 20 ae OS p under amplified over amplified 100 bp ladder Figure 24 3 4 Cycle course PCR cycle that should be used to amplify the remainder of the pool see Fig 24 3 4 If a
268. ss contamination Since oligonucleotides of equivalent length but different sequence migrate at slightly varying rates see User s Guide for PE Biosystems Expedite Nucleic Acid Synthesis System a pool should appear as a broader band than a homogeneous sequence In fact because of the presence of capped failure sequences and depurinated cleaved fragments it is likely that the oligonucleotide product will appear even more heterogeneous Failure sequences will include the mixture of products that are of the length pool pool pool 3 etc Some of these foreshortened sequences can eventually be recovered by PCR As a general note since sequences exist as single copies prior to amplification individual species can be easily lost Therefore it is important to wash and elute the various filters Current Protocols in Molecular Biology tubes and tips described below one or more times The eluates can then be pooled for a final precipitation and eventual amplification Contamination of primers or other solutions with a synthesized or isolated pool should be avoided by using aerosol barrier tips Similarly gel plates used during purification should be washed thoroughly to ensure that they are free of contamination with other pools or primers Materials DNA pool Ammonium hydroxide n butanol TE buffer pH 8 0 APPENDIX 2 2x denaturing dye see recipe 3 M sodium acetate APPENDIX 2 Ethanol Lyophilizer 75 and 90 C water ba
269. t al 2000 Materials DNA library 1 M MgCl 100 mM nucleotide triphosphate solutions 10x transcription buffer see recipe Deionized ultrafiltered water 10 U ul T7 RNA polymerase Solid EDTA Urea 0 5x TBE buffer APPENDIX 2 3 M NaCl 100 and 70 ethanol 100 mM EDTA Puromycin terminated DNA linker 100 mM ATP T4 polynucleotide kinase buffer T4 polynucleotide kinase 10x T4 DNA ligase buffer 10 U ul T4 DNA ligase 3 M potassium acetate solution pH 5 3 Rabbit reticulocyte lysate translation kit e g Red Nova Lysate kit Novagen Control RNA 12 5x methionine free translation mix 2 5 M potassium chloride 25 mM magnesium acetate Nuclease free water Rabbit reticulocyte lysate 35S methionine Electroeluter VWR or Schleicher amp Schuell Denaturing PAGE gel UNIT 2 12 Gel filtration columns Pharmacia Additional reagents and equipment for preparative denaturing PAGE purification UNIT 2 12 determining nucleic acid concentration by spectrometry APPENDIX 3D synthesis of oligonucleotides unr 2 11 and SDS PAGE in Tris tricine buffer systems UNIT 10 2A Current Protocols in Molecular Biology BASIC PROTOCOL 1 Generation and Use of Combinatorial Libraries 24 5 13 Supplement 53 Protein Selection Using mRNA Display 24 5 14 Supplement 53 Transcribe DNA 1 Make up a 1 ml transcription reaction on ice as follows Add the T7 RNA polymerase last DNA library add volume sufficient for 5 to
270. t and resuspend pellet in 500 ul sterile water 19 Plate 48 transformations on individual 15 cm Glu CM His Ura Trp plates 20 Plate 400 ul of the two remaining transformations on 15 cm Glu CM His Ura Trp plates 21 Use the remaining 100 ul to determine the transformation efficiency Perform a series of 10 fold dilutions in sterile water and plate on 10 cm Glu CM His Ura Trp plates 22 Incubate 2 to 3 days at 30 C until colonies are 1 mm in diameter Pool transformants 23 Pool yeast from all 50 transformation plates steps 19 and 20 in a 50 ml centrifuge tube See UNIT 20 1 for protocol on scraping yeast from plates 24 Add an equal volume of 2x glycerol storage solution to the pooled yeast cells Divide into 1 ml aliquots and store at 70 C 25 Determine the plating efficiency of the frozen aliquots as described in UNIT 20 1 Screen for peptide aptamers that interact with target protein 26 Inoculate ten library equivalents of the peptide aptamer library in 2 ml Gal Raf CM His Ura Trp liquid medium Incubate 4 hr at 30 C with shaking One library equivalent equals the total number of yeast transformants containing the peptide aptamer library as determined in step 21 27 Centrifuge 4 min at 3000 x g room temperature 28 Remove supernatant with a pipet and resuspend yeast in 1 ml sterile water 29 Spread yeast at a density of 10 yeast cells plate on 15 cm Gal Raf CM His
271. t catalyze the reaction such as by binding to immobilized strepta vidin Alternatively the substrate may be immobilized before it is incubated with the library Since both of these approaches effectively turn the catalysis selection into a binding selection there will still be a background rate of isolation of sequences that do not catalyze the desired reaction Consequently it may still be necessary to perform several rounds of selection and amplification before functional sequences dominate the library Similar catalytic selection strategies can be envisaged in which all of the library members are immobilized and those that successfully catalyze the desired reaction cut themselves free It should be noted that since the successfully selected library members are required to modify themselves in some respect they are not acting as catalysts in the true sense of the word However molecules selected using such a procedure are usually easily reengi neered to give true catalysts by detaching the active site part of the selected construct from the substrate part One consequence of this limitation is that it is difficult to select for catalysts that act faster than the rate with which they can be manipulated in the laboratory and it is not possible to select for catalysts with high turnover rates at all Strategies in which the library member is encapsulated along with several substrate molecules may lead to systems in which the selective pressure is di
272. t only desirable but are likely required in selections for complex functions such as catalysis Pools used for the selection of ribozymes typically contain from 50 to 220 random sequence positions for recent reviews see Scott 2007 Pan and Clawson 2008 Piganeau 2009 The optimal length of the random region is an active area of research Sabeti et al 1997 where many of the fundamental parameters remain to be defined A computational analysis of structural diversity in RNA pools suggested that longer pools may not be substantially more functional than shorter pools Kim et al 2007 although our practical experience continues to suggest otherwise Practically though longer pools must be synthesized as oligonucleotides of 150 residues or fewer in length because of the constraints of DNA synthetic chemistry For this reason pools longer than 150 bases are typically generated in a modular fashion by ligating together individual synthetic oligonucleotides Bartel and Szostak 1993 Segments of shorter DNAs can be stitched together by the inclusion of unique restriction sites Bartel and Szostak 1993 Asymmetric restriction sites such as Aval CIYCGRG BanI GIGYRCC and StyI CICWWGG where Y C or T R A or G and W A to T are very useful for this task since they minimize intra pool dimerization via self ligation Also these enzymes are cost effective for digesting large amounts of DNA Alternatively an overlapping region can be incl
273. t with which they have been challenged KEY DNA ADD Aaa RNA PAEA protein puromycin Figure 24 5 4 Continued amino acids and their frame can be adjusted in order to avoid inappropriate amino acids such as several consecutive hydrophobic residues or a proline What is considered to be inappropriate will depend upon what the library is to be used for Regardless of how the library is to be constructed having different restriction sites encoded within the 3 and 5 ends of the open reading frame will allow for the changing of one or other of the protein terminal constant sequences if design considerations change or should reengineering be required for troubleshooting Long stretches of uridines in the RNA sequence should be avoided since these may anneal to the poly dA sequence of the puromycin terminated linker oligonucleotide This will interfere with the ligation used to construct the mRNA display template Also the double stranded RNA DNA which can result from the self annealing of the resulting Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 5 7 Supplement 53 Protein Selection Using mRNA Display 24 5 8 Supplement 53 mRNA display template will act as a substrate for the RNase H which is present in reticulocyte lysate resulting in degradation of the mRNA display template C terminal constant ORF sequence All of the cons
274. tamers that bind to Drosophila Cdks Lu et al 1995 See above First study to use E coli thioredoxin as a scaffold for displaying combinatorial libraries of peptides Norman et al 1999 See above Describes the use of staphylococcal nuclease pep tide aptamers for the forward analysis of the yeast pheromone response and the spindle checkpoint sig nal transduction pathways Peptide aptamers are characterized by transcript arrays and by two hy brid analysis using a protein panel containing al most all of the proteins in the yeast genome Sidhu and Weiss 2000 See above Review article that describes strategies for design ing combinatorial peptide libraries and efficient methods for transforming E coli Internet Resources http www umanitoba ca faculties medicine units biochem gietz Trafo html Web site that describes efficient protocols for trans forming yeast See UNIT 20 1 for Internet resources related to the interaction trap Contributed by C Ronald Geyer University of Florida Gainesville Florida Generation and Use of Combinatorial Libraries 24 4 25 Supplement 52 Protein Selection Using mRNA Display mRNA display is an in vitro technique that may be used to search natural or synthetic DNA libraries for the functional proteins and peptides they encode mRNA displayed proteins are constructs in which a protein is covalently attached to the RNA that encodes it This direct covalent associa
275. tation rate in order to balance the population between the original functional wild type variant large numbers of inactive sequences and structures and a relatively small number of more active sequences and structures In contrast completely random sequence pools explore a much wider swath of sequence space and are more useful for the isolation of novel binding species aptamers or catalytic species Breaker 1997 Jaeger 1997 There are many examples of the selection of novel binding sites from completely random sequence pools reviewed in Chandra and Gopinath 2007 and Stoltenburg et al 2007 Even when a natural binding site is known in advance a completely different binding site may be selected from a random sequence pool for example Tuerk and MacDougal Waugh 1993 isolated unique binders to Rev that bound better than the wild type RBE sequence in vitro Completely random sequence pools can also be used to extract aptamers that bind to proteins not normally thought to bind to nucleic acids an example of this is the selection of an RNA aptamer that bound and inhibited the 6 isoform of protein kinase C Conrad et al 1994 Completely random sequence pools can also be used for the selection of novel nucleic acid catalysts Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 2 3 Supplement 88 DNA Pools for In Vitro Selection 24 2 4 Supplement 88 For example starting fr
276. temperature 30 min Add 90 ul of 5 mM 4dNTP mixture and 20 ul 100 U Klenow polymerase and incubate 3 hr at 37 C Phenol chloroform extract the mixture UNIT 2 1A and ethanol precipitate the DNA UNIT 2 1A Dissolve DNA pellet in 0 8 ml water Add 100 wl of 10x Avall reaction buffer and 100 ul 1000 U Avall Incubate 4 hr at 37 C Repeat step 5 Dissolve DNA pellet in 150 ul of 10 mM Tris Cl pH 8 and add 50 ul vol nondenaturing loading buffer Separate DNA on a preparative 10 nondenaturing polyacrylamide gel UNIT 2 7 Locate the DNA band in the gel by UV shadowing unir 2 7 and cut out the DNA band Elute DNA from the gel by shaking in DNA elution buffer overnight UNIT 2 7 Ethanol precipitate the DNA and dissolve in 200 ul of 10 mM Tris Cl pH 8 Determine DNA concentration by UV spectroscopy APPENDIX 3D or estimate DNA concentration using ethidium bromide dot quantitation UNIT 2 6 Prepare thioredoxin expression vector 14 Choose one of the thioredoxin expression vectors pJM in Figure 24 4 1 and add 12 ug of the chosen vector to 420 ul sterile water Current Protocols in Molecular Biology 15 Add 50 ul of 10x RsrlI reaction buffer and 30 ul 60 U RsrII Incubate overnight at 37 C 16 Dephosphorylate RsrIl cut pJM vector by adding 10 ul 100 U CIP and incubating 1 hr at 37 C 17 Purify dephosphorylated RsrII cut pJM vector using a commercially available PCR purification
277. ternal loop portion of the structure and selected Rev binding species Many of the anti Rev aptamers had sequences that were significantly different than the wild type yet were still presented in the context of a stem internal loop stem structure Partially random doped pool design binding site selection The most important issue in the synthesis of a doped pool is the level of randomization the probability of sequence substitution position As a general rule the substitution frequency of a doped pool should roughly correspond to the number of positions thought to be required for function For example if 10 residues within a nucleic acid binding site are thought to be functional then the rate of substitution might be set to yield single mutants at least half the time If the substitution frequency is set too low there may be too few varying residues or combinations of residues to yield information about functional sequences or structures In contrast if the substitution frequency is set too high the sequence space nearest the wild type motif will only be sparsely sampled and many of the highly mutated molecules may be nonfunctional because their sequences will have diverged too far from the wild type For example an in vitro genetic analysis has been used to uncover the critical structural interactions between the HIV 1 Rev protein and its primary RNA binding site the Rev binding element Bartel et al 1991 The RBE had previously been
278. test tube and partially due to the recognition that the ability to tailor RNA binding species and catalysts might have nu merous biotechnological applications Follow ing the publication of key papers outlining and proving selection technologies Ellington and Szostak 1990 Tuerk and Gold 1990 a much wider array of selection experiments has been attempted To date RNA molecules that can bind targets as small as zinc and as large as viruses and organelles have been se lected reviewed in Stoltenburg et al 2007 and Shamah et al 2008 RNA molecules that in teract with both nucleic acid binding proteins and non nucleic acid binding proteins can be selected with almost equal facility from ran dom sequence populations These results have been thoroughly reviewed in numerous publi cations Gold et al 1995 Uphoff et al 1996 Kulbachinskiy 2007 Critical Parameters Choosing protein targets As briefly described above a wide vari ety of proteins have proven to be success Current Protocols in Molecular Biology ful targets for selection experiments includ ing enzymes transcription factors cytokines antibodies and viral capsids Gopinath 2007 Stoltenburg et al 2007 There is no com mon functional theme uniting these targets nor can many generalities be drawn regarding their biochemistry or structure However it is safe to say that good selection targets tend to fall into two classes First proteins th
279. th the conformation of the displayed protein that it displays Early indications are that proteins selected using mRNA display may fold into multiple conformations only some of which have the desired functionality This behavior causes the proportion of the selected library observed to demonstrate the desired activity to rise by a factor of much less than might be expected during successive rounds of selection The in dividual selected proteins behave similarly whether mRNA displayed or not Mutagenesis and reselection of such selected individual li brary members or libraries of them has given large families of related proteins with greatly improved characteristics in this respect A D Keefe G Cho and J W Szostak pers com mun It should always be borne in mind that se lections will give a solution to the problem that is set itis up to the experimenter to arrange the selection conditions sufficiently carefully to ensure that this solution is a consequence of the desired functionality The range of acceptable yields of various parts of the mRNA displayed protein selection protocol are listed in Table 24 5 3 Observed yields falling at the lower end of these ranges may or may not be increased upon optimiza tion Time Considerations The construction of the library may take anywhere between 2 weeks and 2 months Do ing pilot preparative and purifying experiments on mRNA displayed protein may take 21 month A single round
280. the method for synthesizing peptide aptamer li braries Preferably peptide aptamer libraries are constructed to minimize the amount of stop codons while maintaining amino acid diversity In general two methods of automated DNA synthesis are used to generate DNA templates that code for combinatorial peptide libraries The first method generates DNA templates by sequentially coupling mixtures of the four nu cleotide phosphoramidites The second method generates DNA templates by sequentially cou pling mixtures of codons The sequential nucleotide incorporation method uses completely random or biased mix tures of nucleosides to construct DNA tem plates DNA templates constructed using equi molar mixtures of the four nucleotide phos phoramidites contain all 64 possible codons including 41 redundant codons and three stop codons The completely random libraries are biased for amino acids encoded by multiple codons In addition the presence of stop codons produces truncated aptamers at a frequency of 3n 64 where n is the length of the peptide library The sequential nucleotide incorpora tion method is improved by restricting the nu Generation and Use of Combinatorial Libraries 24 4 21 Supplement 52 Peptide Aptamers 24 4 22 Supplement 52 cleotides that are incorporated at the third po sition in the codon see Table 24 4 1 for exam ples of degenerate codons The third position of a codon is responsible for
281. then microcentrifuge at maximum speed 4 C Lyophilize to dryness Resuspend the synthetic pool in TE buffer pH 8 0 to protect against nuclease contamination or drastic pH changes Current Protocols in Molecular Biology If the volume of the eluted oligonucleotide is too large to conveniently precipitate concen trate the sample by extracting against an equal volume of n butanol Remove the upper butanol layer and repeat until the aqueous volume is convenient for precipitation About 1 5 of the aqueous layer is extracted into the organic butanol layer for every volume of butanol used If too much butanol is used thereby completely extracting the aqueous layer into the butanol add more water and repeat the concentration DETERMINING THE POOL COMPLEXITY SUPPORT PROTOCOL 1 The number of different molecules present in a population can affect the outcome of a selection experiment see Troubleshooting If the pool complexity is too low for a given application the pool will have to be resynthesized Pool complexity is in turn a function of yield and of the number of molecules in the pool that can be fully extended by a polymerase The overall yield of the synthesis can be cal culated by determining the UV absorption of the pool However deletions incompletely deprotected residues or backbone lesions that arise during chemical synthesis decrease by 10 to 40 the fraction of molecules in a synthetic pool that can be fully extended by p
282. thesized deprotected and lyophilized in as little as one full day while upwards of 2 weeks may be required for an outsourced order In addition when synthesiz ing pools in house additional syntheses do not greatly increase the cost due to reagent quantities Therefore while synthesizing one pool in house is often cost prohibitive synthesizing multiple pools may provide a savings over commercial sources In house synthesis In certain cases such as the production of doped pools it may be desirable to perform a synthesis in house IDT and other synthesis companies typically charge 100 for each hand mixed bottle and a doped pool utilizes five such bottles for doped regions that are less than or equal to 40 nt For longer pools the cost for doping may well be over 1000 Therefore in house synthesis of doped pools may still be the best option Most synthesizers can be programmed for in line degenerate mixing of bases While this method is useful when only a few positions must be randomized because of the extremely fast reaction of the activated phosphoramidite with the newly deprotected 5 hydroxyl random sequences will be skewed towards the phosphoramidite that first enters the column Therefore for longer pools or pools that should contain a statistically random distribution of nucleotides it is better to manually mix the phosphoramidites off line and use this mixture for the synthesis of degenerate sequence positions A more sto
283. thods Mol Biol 20 1 17 Chandra S and Gopinath B 2007 Methods developed for SELEX Anal Bioanal Chem 387 171 182 Chen C K 2007 Complex SELEX against target mixture Stochastic computer model simula tion and analysis Comput Methods Programs Biomed 87 189 200 Chen Z and Ruffner D E 1996 Modified crush and soak method for recovering oligodeoxynu cleotides from polyacrylamide gel BioTech niques 21 820 822 Conrad R Keranen L M Ellington A D and Newton A C 1994 Isozyme specific inhibition of protein kinase C by RNA aptamers J Biol Chem 269 32051 32054 Crameri A and Stemmer W P C 1993 107 fold aptamer library amplification without gel purifi cation Nucl Acids Res 21 4410 Current Protocols in Molecular Biology Fitzwater T and Polisky B 1996 A SELEX primer Methods Enzymol 267 275 301 Giver L Bartel D Zapp M Pawul A Green M and Ellington A D 1993 Selective optimization of the Rev binding element of HIV 1 Nucl Acids Res 21 5509 5516 Gold L Polisky B Uhlenbeck O and Yarus M 1995 Diversity of oligonucleotide functions Annu Rev Biochem 64 763 797 Hermes J D Parekh S M Blacklow S C Koster H and Knowles J R 1989 A reliable method for random mutagenesis The generation of mu tant libraries using spiked oligodeoxyribonu cleotide primers Gene 84 143 151 Hesselberth J R Miller D Robertus J and Ellington
284. ths 50 ml Sterile Conical Tube Filter Unit Thermo Scientific Nalgene Fluorescent TLC plate VWR wrapped in plastic wrap UV lamp Razor blades Small bore syringes 13 ml centrifuge tubes capable of withstanding temperature extremes Sarstedt Rotary shaker Additional reagents and equipment for denaturing polyacrylamide gel electrophoresis e g UNIT 2 12 1 After synthesis deprotection and cleavage from the solid support lyophilize the oligonucleotide solution to dryness or precipitate with a 10 fold volume of n butanol For commercially synthesized pools the nucleic acid has already been deprotected cleaved and desalted Oftentimes a commercial supplier will also provide the option to purify the pool via HPLC or PAGE As an example when utilizing Glen Research synthesis reagents such as Sterling phospho ramidites and columns the manufacturer suggests an 8 hr incubation at room temperature with I ml of ammonium hydroxide per I umol synthesis for deprotection and cleavage The resin is then washed with 3 volumes of diH20 and lyophilized to dryness The n butanol precipitation can occur quite quickly at room temperature for longer oligonucleotides Shorter lt 20 base oligonucleotides may require longer or colder in cubations To ensure more efficient recoveries of oligonucleotides it is safest to precipitate for 1 hr at 70 C 2 Poura 15cm x 17cm x 1 6 mm denaturing polyacrylamide gel e g UNIT 2 12 To allow
285. tion of phenotype protein and genotype RNA renders the protein directly amplifiable This in turn allows successive cycles of selection enrichment and optionally mutagenesis to be performed upon libraries of displayed proteins At the end of this process functional sequences will dominate the library cloning and sequencing will reveal the identity of the selected functional proteins mRNA display allows new functional proteins to be discovered without resorting to protein design mRNA displayed proteins are generated by the in vitro translation of mRNA display templates which are mRNA molecules 3 terminated in puromycin Fig 24 5 1 Puromy cin is a translation inhibitor that is able to enter the ribosome during translation and form a stable covalent bond with the nascent protein This allows a stable covalent linkage to be formed between the mRNA display template and the protein it encodes resulting in an mRNA displayed protein Fig 24 5 2 STRATEGIC PLANNING The first issue that needs to be addressed when embarking upon protein selection using mRNA display is the design and construction of the library at the DNA level If the goal of the selection is the improvement of an existing protein aptamer or enzyme then the starting point for the selection will be the DNA sequence encoding this protein If the goal of the selection is to discover a new class of protein aptamers or enzymes then the starting point for the selection w
286. tion of proteins that interact with specific targets using the interaction trap In the first part of this protocol the bait plasmid pBait is constructed by inserting DNA that encodes for the target protein into the polylinker of pEG202 in frame with LexA The chimeric LexA bait fusion protein is constitutively expressed using the ADH1 promoter It is transformed into the appropriate yeast strain EGY48 by a standard lithium acetate transformation procedure UNIT 13 7 To be useful in the interaction trap two hybrid system the bait proteins must enter the nucleus bind to the LexA operators and not self activate the leu2 and lacZ reporters After construction pBait is characterized using protocols described elsewhere UNIT 20 1 The pJM 1 peptide aptamer library is used to select aptamers that bind specific protein targets using the interaction trap pJM 1 contains a thioredoxin aptamer fused to a nuclear localization signal a transcription activation domain and an epitope tag under the control of the gal promoter Peptide aptamer expression is induced in the presence of galactose and repressed in the presence of glucose A high efficiency lithium acetate transformation procedure Gietz and Schiestl 1995 outlined below is used rather than the standard procedure UNIT 13 7 to introduce the aptamer library into the yeast strain EGY48 which contains an integrated LexA operator leu2 reporter gene LexA operator lacZ reporter plasmid and
287. to the filter Place the micropipet tip just above the filter to avoid the formation of any bubbles Lock a 5 ml syringe to the top of the filter holder and apply gentle pressure to force the liquid out of the filter holder and into a collecting tube If the syringe plunger does not regain position when pressure is removed there is likely a leak in the filter It should be removed and replaced with another filter The solution in the collection tube can be reapplied to the new filter Wash the unbound or weakly bound pool Three washes are sufficient during early rounds Alternatively the filter holder can be attached to a vacuum manifold which is used here to maintain a constant negative pressure during filtration so that each round of selection is similar and reproducible Apply a negative pressure of 127 mm of Hg to the filter holder Pipet the binding reaction directly onto the filter with the tip just above the filter avoiding the formation of bubbles which may lead to an uneven application of the sample to the filter and impede the flow of liquid through the filter Wash the filter with 3 vol of binding buffer Varying the strength of the vacuum uneven application of the sample and formation of bubbles during wash steps may result in inefficient sieving of binding from nonbinding species and hence may reduce the efficiency of an individual round of selection However the selection as a whole is fairly robust with respect to changes
288. tography column a Wash two times with 500 ul Ni NTA wash buffer 1 b Wash once with 500 ul of a 4 1 solution of Ni NTA wash buffer 1 Ni NTA wash buffer 2 c Wash once with 500 ul of a 3 2 solution of N buffer 2 d Wash once with 500 ul of a 2 3 solution of Ni NTA wash buffer 1 Ni NTA wash buffer 2 e Wash once with 500 ul of a 1 4 solution of N buffer 2 f Wash once with 500 ul Ni NTA wash buffer 2 g Wash two times with 500 ul of a 19 1 solution of Ni NTA wash buffer 2 Ni NTA elution buffer h Elute for 30 min at 4 C with rotation two times with 250 ul Ni NTA elution buffer EDTA should be added to the eluate to give 5 mM to bind to eluted Ni i NTA wash buffer 1 Ni NTA wash a NTA wash buffer 1 Ni NTA wash E Analyze the starting material the flowthrough and all washes and elutions using Tris tricine SDS PAGE as described in UNIT 10 24 Alternate Protocol 1 and by scintillation counting The volume of the eluate may be reduced by lyophilization by up to a factor of 5 If the mRNA displayed proteins are prone to aggregation then it may be necessary to maintain denaturing conditions throughout the Ni NTA agarose purification process by the addition of urea or guanidinium hydrochloride to the wash and elution buffers in addition to that which is in the binding buffer Ifit is not desired to completely denature the mRNA displayed proteins the denaturant can be omitted from all
289. tration Monovalent cations such as Nat and divalent cations such as Mg stabilize the structure of RNA molecules and contribute to both specific Generation and Use of Combinatorial Libraries 24 3 23 Supplement 88 Selection of RNA Aptamers 24 3 24 Supplement 88 and nonspecific binding Decreasing mono valent and or divalent cation concentrations therefore can increase the stringency of the selection However it is unclear in ad vance whether specific or nonspecific binding species will be more favored by such a change Moreover since binding species that require a monovalent and or divalent cation to fold into shapes that are chemically complementary to a target may be favored in the early rounds of selection potentially high affinity binding species may be lost by changing the binding buffer late in the selection experiment It is better to attempt to change the buffer depen dency of aptamers by partial randomization and reselection following the initial selection experiment rather than to attempt to change the buffer dependency during the selection Conversely higher concentrations of monovalent cations generally Nat or Kt in crease the structural integrity of folded nucleic acids by neutralizing the close approach of nucleic acid strands However higher mono valent ion concentrations also suppress elec trostatic interactions with targets Thus para doxically both low and high
290. tween these buffers will increase the proportion of nonspecific binders in the elution fraction possibly to such an extent that the specific binders will never dominate the library and consequently will never be identified Obviously the binding and elution buffers cannot be identical since the elution buffer contains the target molecule In order to make the selection binding and Bbs Bbvl T7 TMV FLAG rancomilibrary Hisg linker O OE a TT N e l De restrict ligate Bb Va restrict ba l n ligate Figure 24 5 5 Assembly of a full length mRNA display template library from DNA cassettes that result from the RT PCR amplification of pre selected mRNA display cassette templates In this example the cassettes are divided into 2 aliquots that are restricted with either Bbvi or Bbsl subsequent ligation with T4 DNA ligase gives a new cassette in which the DNA between the restriction sites doubles in length while the flanking regions remain the same The doubling of the length of this region may be repeated any number of times by repeating the restriction and ligation process Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 5 11 Supplement 53 Protein Selection Using mRNA Display 24 5 12 Supplement 53 se
291. typically 8 to 12 cycles are required At this point the selected library sequences should be determined by cloning and sequencing see Chapters Current Protocols in Molecular Biology 1 and 7 and individual clones should be assayed for activity under the selection conditions both as mRNA displayed and free proteins Materials ATP agarose Sigma ATP aptamer selection binding buffer see recipe Purified mRNA displayed proteins see Basic Protocol 2 ATP aptamer selection elution buffer see recipe 100 mM EDTA APPENDIX 2 1 M NaOH APPENDIX 2 1M HCl 10 mg ml salmon sperm DNA 1 mg ml BSA 100 uM 3 primer specific for cDNA library 100 uM 5 primer specific for cDNA library 25 mM each deoxynucleotide triphosphates 10x PCR buffer containing 15 mM MgCl Boehringer Mannheim 5 U ul Tag DNA polymerase Boehringer Mannheim 25 24 1 v v v phenol chloroform isoamyl alcohol Chloroform 1 Butanol 3 M NaCl 100 ethanol Gel filtration columns e g NAP 25 Amersham Pharmacia Biotech Additional reagents and equipment for butanol extraction UNIT 2 14 Select for ATP binding proteins 1 Wash 10 mg of ATP agarose three times with 1 ml of deionized water followed by two times with 1 ml of ATP aptamer selection binding buffer Incubate 1 ml of the purified mRNA displayed proteins from Basic Protocol 2 with the washed ATP agarose for 1 hr at 4 C with rotation drain for flowthrough Wash six times wit
292. uantity should be done in 2 5 U increments However too much Taq may be harmful to structured single stranded nucleic acids Lyamichey et al 1993 5 Confirm the results of the extension reaction described in Support Protocol 1 by the optimization method as follows After optimizing pool PCR conditions for gt 1 8 average number of doublings per cycle determine the pool complexity by performing another 0 1 ml PCR reaction with 2 nM of the original synthetic pool oligonucleotide under the now optimized reaction conditions After 7 or more cycles of PCR perform agarose gel electrophoresis on serial dilutions of the PCR reaction adjacent to serial dilutions of dsDNA mass markers Calculate the amount of amplified DNA either using a densitometer or by estimating which dilutions are most similar Calculate the approximate pool complexity as follows gof PCR DNA after N cyclesof PCR _ g avg no of doublings per cycle see step 4 g of starting extendable ssDNA g of starting extendable ssDNA 330 g mol x no of bases in full length product mol of starting extendable ssDNA mol of starting extendable ssDNA x 6 02 x 10 molecules of starting extendable ssDNA molecules of starting extendable ssDNA _ starting molecules fraction of extendable ssDNA fraction of extendable ssDNA x no of synthetic pool molecules pool complexity Current Protocols in Molecular Biology PCR efficiency should be optimized to balance the
293. uction If little or no DNA is recovered from an emulsion as determined by real time PCR it is possible that little protein has been pro duced Unfortunately there is usually too little protein produced in the context of an emulsion selection to assay directly If a given round of selection has failed then the quality of the template should be assessed by carrying out in vitro transcription and translation in so lution i e in the absence of emulsification and confirming the presence of a protein prod uct by gel electrophoresis and staining or im munoblot analysis If very small amounts of protein are produced or if there is no tag that can be used for immunoblot analysis proteins can be labeled with radioactive amino acids such as 7 S methionine during translation If adequate protein is produced in solution but not in the emulsion it is possible that the emulsion reaction itself is poisoning pro tein production or that protein is lost during de emulsification It is possible to determine whether this is the case by performing three translation reactions in parallel The first reac tion is a standard translation in solution The second is the same as the first but emulsi fied following translation The third reaction is translation in emulsion Following ether ex traction of reactions 2 and 3 the amount of protein produced in each reaction can be com pared by immunoblotting or by comparing the amount of radiolabeled
294. uded at the 3 end of each synthetic oligonucleotide and mutually primed synthesis e g UNIT 8 2 of a longer template can be carried out After assembling pool modules the complexity yield of the new aggregate pool will need to be freshly assessed The upper boundary of the complexity of an assembled pool e g 10 100 mer modules x 10 100 mer modules will likely be much larger than its actual complexity e g 100 ug of ligated 200 mer 9 12 x 10 4 molecules Segmentally random pool design binding site and aptamer selection In general the rules governing the design of segmentally random pools are idiosyncratic depending on experimental purpose If the desire is to better define a known binding site then relatively short sequence tracts i e from four to ten residues should be completely randomized The randomization of longer sequence tracts may lead to the selection of novel binding sites rather than variants of a known binding site The residues can either be colinear as is the case for many DNA binding sites or dispersed as is the case for many RNA binding sites If the desire is to identify a binding site within the context of a known structural element then from four to twenty residues can be completely randomized In this instance the fewer the number of residues that are randomized the more likely it will be that the selected sequences will resemble a wild type binding site or retain an engineered structure The great
295. unger to crush the gel chunks into a slurry in a 1 7 ml microcentrifuge tube Resuspend the slurry in 400 ul of 1x TE buffer then incubate the slurry at 80 C for 10 min to use ice crystals to fully break up the acrylamide matrix Elute the ssRNA from the gel at 65 to 75 C for 15 min Repeat the elution with an additional 400 ul TE buffer The authors routinely recover 95 of the nucleic acid with this procedure To increase recovery additional elutions can be performed but increased incubation at elevated temperatures increases cleavage of RNA molecules 8 Decant the eluate with a micropipettor and 1000 ul tip to separate the RNA containing supernatant from the gel slice Filter the elution through a 0 45 um nitro cellulose membrane such as Millipore Ultrafree MC microcentrifuge filter tube to remove acrylamide fragments Precipitate and quantitate the RNA 9 Add one tenth volume of 3 M sodium acetate for a final concentration of 0 3 M and 2 5 volumes of 95 ethanol to precipitate the RNA Mix then incubate at 80 C for 15 min Microcentrifuge 10 to 15 min at maximum speed 4 C to recover the precipitate The authors frequently include 3 ul of a 1 mg ml blue dyed glycogen solution GlycoBlue Ambion to increase the yield of nucleic acid precipitate and to better visualize the pellet If the selection target binds to or interacts with glycogen then this step should be omitted Transfer RNA can also be used as a carrier but w
296. up to 100 ml with water Store at 20 C Oligo dT binding buffer 7 46 g KCI mol wt 74 6 1 M final 1 21 g Tris hydroxymethyl aminomethane mol wt 121 100 mM final 372 mg disodium EDTA mol wt 372 10 mM final 0 25 g Triton X 100 0 25 w v final Adjust the pH to 8 0 with NaOH HCI1 Bring up to 100 ml with water Store at 20 C Oligo dT wash buffer 746 mg KCI mol wt 74 6 100 mM final 121 mg Tris hydroxymethyl aminomethane mol wt 121 10 mM final 0 25 g Triton X 100 0 25 w v final Adjust the pH to 8 0 with NaOH HC1 Bring up to 100 ml with water Store at 20 C Transcription buffer 10x 255 mg spermidine trihydrochloride mol wt 255 10 mM final 4 84 g Tris hydroxymethyl aminomethane mol wt 121 400 mM final 770 mg DTT mol wt 154 50 mM final 0 1 g Triton X 100 0 1 w v final Adjust the pH to 8 0 with NaOH HCI1 Bring up to 100 ml with water Store at 20 C COMMENTARY Background Information In vitro selection experiments were first suc cessfully performed upon nucleic acid libraries for reviews see Szostak and Ellington 1993 Gold et al 1993 and Joyce 1993 Nucleic acids are the only molecular systems that are capable of being replicated directly in vitro and which also can contain more than trivial amounts of amplifiable information Nucleic acid selections have the advantage that the target functional entity and the information encoding the functional entity
297. ures the anti polyhistidine antibody and results in the release of the captured product Ethanol precipitate the recovered DNA as described in UNIT 2 14 and amplify the gene product by PCR as described in UNIT 15 1 In order to monitor the progress of the selection it may be useful to carry out real time PCR reactions relative to standards for details on this method see UNIT 15 8 As the selection progresses fewer cycles should be required for amplification the Ct value should be lower and or the total amount of recovered product should increase The primers for PCR amplification should re establish the promoter and other sequences required for expression i e the entire template as described under step 1 If additional rounds of selection are to be carried out the binding target should again be added to the template In the streptavidin example this is done through PCR with a biotinylated primer Gel purify the PCR products UNIT 2 6 Amplify the pool of gel purified products by PCR UNIT 15 1 Ethanol precipitate the amplified PCR products UNIT 2 14 The PCR products can be used in subsequent rounds of selection or can be cloned into vectors for sequencing and analysis While the initial library may contain only one or a few copies of each variant in subsequent rounds there should be multiple copies of successful variants Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 6 7
298. vantage of us ing nucleic acid libraries is that the chemistry is not nearly as robust as for proteins the 5 canonical nucleobases have much less chemi cal functionality than the 20 amino acids This disadvantage is being overcome by the inclu sion of modified nucleotides during enzymatic replication or transcription The advantage of using nucleic acid libraries is that they can be much larger than protein libraries on the or der of 10 5 variants and can be manipulated entirely in vitro Nucleic acid selections are in creasingly yielding aptamers with biomedical Current Protocols in Molecular Biology relevance as reviewed in Nimjee et al 2005 and Yan et al 2005 While most nucleic acid selections are carried out in vitro it has also proven possible to directly select for function in vivo as with peptide aptamers Cassidy and Mahler 2003 It is anticipated that the line between chem istry and biology will become increasingly blurred Already it has proven possible to gen erate chemical libraries with nucleic acid or peptide tags allowing the details regarding the composition and synthesis of a given com pound to be encoded in a biopolymer Brenner and Lerner 1992 While such methods can simplify the identification of active pharma cophores they do not yield replicable chem ical compounds per se as delimited chemi cal libraries must still be resynthesized based on the functional information gained from a give
299. void using the same triplet sequence more than once in either of the constant regions attempt to ensure that the GC content is between 45 and 60 and check primer sequences to avoid self dimerization the formation of hairpins and cross hybridization Singh and Kumar 2001 Abd Elsalam 2003 Beyond these basal considerations there are two schools of thought regarding the se quence of the priming site itself On the one hand designing primers to possess a 3 clamp of 5 WSS 3 IUB codes W A or T S C or G such as ACC ensures good extension by polymerases On the other hand the inclusion of A T rich regions at the 3 termini of primers reduces the frequency of mispriming and allows virtually infinite multiplication of DNA amplicons Crameri and Stemmer 1993 The inclusion of restriction sites within primer regions can facilitate cloning of selected nucleic acids into specific plasmids although palindromes adjacent to the 3 ends can also facilitate the genesis of primer dimers So called T A kits that take advantage of the propensity of Taq polymerase to incorporate untemplated adenines at the 3 end of amplicons are also frequently utilized Finally primers for partially randomized pools should be designed so that they do not conflict with the folding or accessibility of a known DNA or RNA binding site It is suggested that the secondary structure of the wild type binding site with any appended primer binding site
300. y such low yields can frequently be tolerated The authors frequently gel isolate radiolabeled RNA pools to ensure the integrity of RNA samples prior to carrying out binding assays Current Protocols in Molecular Biology Generation and Use of Combinatorial Libraries 24 3 7 Supplement 88 SUPPORT PROTOCOL 2 Selection of RNA Aptamers 24 3 8 Supplement 88 BINDING ASSAY WITH THE END LABELED RNA POOL TO DETERMINE THE OPTIMAL PROTEIN CONCENTRATION FOR SELECTION To determine the initial concentration of a protein target to be used in a selection ex periment it is necessary to measure the affinity of the unselected pool for the protein target The aggregate dissociation constant of the pool protein complex can be calculated by determining the fraction of radioactively labeled RNA that can be bound at various protein concentrations The radiolabeled RNA is incubated in the binding buffer and protein solutions are added The binding reaction is filtered through a vacuum manifold containing nitrocellulose and nylon membranes and the fraction of RNA bound to the target is calculated to obtain a value for the dissociation constant The nitrocellulose membrane will capture RNA protein complexes while the nylon membrane will capture all free RNA that flows through the nitrocellulose membrane Materials Radiolabeled RNA pool Support Protocol 1 Binding buffer see Critical Parameters Target protein 65 to 75 C ther
301. y carried out over iterative cycles or rounds of selection and amplification of DNA RNA and proteins can be carried out using many different methods The goal of a directed evolution experiment is to identify one or few members of the starting library which perform the desired function at a high level RNA and DNA selections can be performed in bulk solution by capturing molecules based on binding affinity or catalytic activity and then directly amplifying the nucleic acids Proteins on the other hand must be evolved under conditions in which genetic material is physically or spatially linked to the translated protein product This can be carried out in several different ways For example a library can be cloned into a cell and the expression of a particular functional protein can lead to selection of both the cell and the cell s DNA Similarly phage display technologies link coding DNA to proteins displayed on the phage surface Finally mRNA display Roberts and Szostak 1997 uses the antibiotic puromycin to create a physical link between genetic material and protein during in vitro translation Most recently methods have been developed for carrying out enzymatic reactions in the aqueous phase of an oil water emulsion including DNA replication via PCR transcrip tion and translation Tawfik and Griffiths 1998 Ghadessy et al 2001 Agresti et al 2005 Levy et al 2005 Transcription and translation can be coupled so that the
302. y with the displayed proteins Long stretches of adenines in the RNA region of the mRNA display template should be avoided since they will also anneal to the oligo dT and present a substrate for RNase H which is present in the reticulocyte lysate this will cause mRNA display template degradation The oligo dT cellulose purification step also presents a quick approximate method for the absolute measurement of the concentration of mRNA displayed proteins in the translation reaction mixture The scintillation counter readings give the proportion of S methionine that is contained in the oligo dT eluates by counting equal proportions of the whole translation mixture and the oligo dT eluate and dividing one by the other The ratio of the intensities of the bands corresponding to mRNA displayed proteins in these two samples on the SDS PAGE gel gives the yield of the oligo dT purification 8 Calculate the concentration of mRNA displayed proteins in the translation reaction mixture with the following equation mRNA displayed proteins Y x C x methionine x N where Y is the yield of the oligo dT cellulose purification determined by SDS PAGE C is the number of counts in the combined oligo dT elution fractions divided by the number of counts in an equal proportion of the translation reaction mixture deter mined by scintillation counting methionine is the total concentration of hot and cold methionine in the translation reaction mixture be
303. ype template and that yields be determined prior to undertaking a more ar duous selection experiment If only a small fraction lt 10 of the wild type protein is re covered then either the recovery must be op timized see Troubleshooting or the selection should not be attempted Template sequence and preparation Protein yields are greatly affected by both the template DNA sequence and the tem plate purification methods used The DNA se quences required for proper translation will vary depending on the lysate type Most lysates use a phage RNA polymerase for transcription so the incorporation of an appropriate phage promoter is required T7 is the most common RNA polymerase used in E coli based sys tems while SP6 is more common in rabbit reticulocyte and wheat germ extracts Similarly translation initiation sequences are heavily dependent on the translation sys tem used In E coli a Ribosome Binding Site RBS directs translation In rabbit retic ulocyte and wheat germ extracts a small Kozak sequence can direct moderate pro tein expression levels Fortunately RBS and Kozak sequences can coexist and thus the same template can potentially function across different translation platforms Viral derived Current Protocols in Molecular Biology Internal Ribosome Entry Sites IRES can lead to higher expression levels in eukaryotic sys tems but these sequences are typically 10 to 100 times longer than RBS and Koza

"Overview of Receptors from Combinatorial Nucleic Acid and Protein

Contents

Download Pdf Manuals

Related Search

Related Contents

&quot;Overview of Receptors from Combinatorial Nucleic Acid and Protein

Contents

Download Pdf Manuals

Related Search

Related Contents

"Overview of Receptors from Combinatorial Nucleic Acid and Protein