user manual pdf - ATCGbio Life Technology
Contents
1. a AW LA lt xN Za Si N i hae lt I gt Biren rN A pSLIC PuroP2A Lentivirus Plasmid Construction Kit LT2002 ATCGbio Life Technology Inc Ra N w References 1 Y Ido et al Acute Activation of AMP Activated Protein Kinase Prevents H O Induced Premature Senescence in Primary Human Keratinocytes PLoS ONE 2012 Apr 07 4 e35092 2 Mamie Z Li amp Stephen J Elledge Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC Nature Methods 2007 4 251 256 3 Gibson DG Enzymatic assembly of overlapping DNA fragments Methods Enzymol 2011 498 349 61 4 Jin Hee Kim et al High Cleavage Efficiency of a 2A Peptide Derived from Porcine Teschovirus 1 in Human Cell Lines Zebrafish and Mice PLoS ONE 2011 Apr 06 4 e18556 5 Georgios Trichas et al Use of the viral 2A peptide for bicistronic expression in transgenic mice BMC Biology 2008 6 40 Contact Information Laboratory 3938 North Fraser Way Burnaby BC V5J 5H6 Canada Tel 01 778 321 9336 order only Fax 01 617 566 1092 order only Email info atcgbio com Business Hours Monday to Friday 9am 5pm GMT 8 00 Pacific US Ordering information All of your orders are available on line at https atcgbio com Technical Support Please send email to us tech atcgbio com Or click Contact Us to fill the form for enquires We will response within 1 2 business days www atcgbio com 92. www atcgbio com 1 pSLIC PuroP2A Lentivirus Plasmid Construction Kit LT2002 ATCGbio Life Technology Inc lt 7 pSLIC PuroP2A Lentivirus Plasmid Construction kit LT2002 Introduction ATCGbio Life Technology Inc provides pSLIC PuroP2A lentivirus construction kit to let user create the lentivirus plasmid expressing the gene of interest This kit comes with SLIC enzyme and a lentivirus plasmid which contains puromycin resistance gene and P2A sequence SLIC sequence and ligation independent cloning allows users to insert PCR product into the plasmid without ligation This technique has been developed last 10 years for example see Nature Methods 4 251 256 2007 and we created our proprietary SLIC enzyme system which has superb performance and temperature stability stable even at room temperature for a few days P2A peptide sequence allows to express both puromycin resistance gene and user s gene of interest by a single CMV promoter bicistronic To make the ligation effective a staffer sequence was inserted between EcoR V User first digests the plasmid with EcoR V and then inserts the PCR product by SLIC enzyme reaction User performs PCR gene of interest with primers having 15bp homologous to the ends of EcoR V sequence In 30 min reaction with SLIC enzyme the PCR product is inserted downstream of P2A sequence P2A like peptide sequence was discovered in various virus genomes and found to self cleave near the end of sequ
3. pSLIC PuroP2A Lentivirus Plasmid Construction Kit Cat LT2002 ATCGbio Life Technology Inc provides pSLI C PuroP2A lentivirus plasmid construction kit to let user create the lentivirus plasmid expressing the gene of interest This kit comes with SLIC enzyme and a lentivirus plasmid which contains puromycin resistance gene and P2A sequence SLIC sequence and ligation independent cloning allows users to insert PCR product into the plasmid without ligation P2A peptide sequence allows to express both puromycin resistance gene and user s gene of interest by a single CMV promoter bicistronic Our proprietary SLI C enzyme system which has superb performance and temperature stability stable even at room temperature for a few days ATCGbio Life Technology Inc www atcgbio com pSLIC PuroP2A Lentivirus Plasmid Construction Kit LT2002 Contents PER OGUE TOM icira aa aaa aaaea aae EANES Kit Components and Storage ConditionS s ssssssssss User Provided MatenalS isisiciissciisdiecnsdsaiinwnacaasasdvenisasaisarsanseaciansnesieieniansd Plasmid Structure and Primer Design csseseseeeeeeeeeeeeeeeeeneeeeseueeeeeeeee PSLIC PuroP2A Structure ccccccceeeeeeeeeeeeeeeeeeeeensesegecueuaeeeeeaeaeeeaeeeeueeeuaeanasanas Guideline to Design the PCR PrimerS sccsceeeeseeeeeeeeeeeeeeeeeaeeeeeeaseneueenenanaees Design primers for Creating GFP Control Plasmid cscseessseeesseeeeeeee
4. 5x buffer 10ul dNTP mix Aul 10 uM forward primer 1 5ul final concentration 0 3uM 10 uM reverse primer 1 5 ul final concentration 0 3uM 20ng ul template 1 ul amount of template should be 20 40ng nuclease free water NFW 31 5ul PrimeStar HS enzyme 0 5ul In case of Control GFP amplification add 1 5 ul mixture which contains both forward and reverse primers Processing speed of this PCR enzyme is 1 2 kb min Adjust extension time accordingly In case of GFP 40 seconds should work PCR conditions 1 98 C 2min 2 98 C 10 seconds 3 55 C 5 10 seconds 4 72 C 40 seconds repeat step 2 4 total 24 cycles 5 72 C 3 min 6 4 C Hold 3 Gel purify PCR product Run the PCR product on EthBr or SYBR safe impregnated 1 DNA gel and cut the expected size of band Gel purify by PCR gel purification kit with 20 30ul elution volume Measure DNA concentration with Nano drop or spectrophotometer 4 SLIC reaction Set thermal cycler as following parameters 1 20 C 10 min Note Molar ratio of PCR insert and pSLIC vector should be 5 1 ratio 2 70 C 10 min Digested pSLIC vector is 100ng in ipl 8 kb size 3 50 C 10 min If PCR product size is 1kb it requires 1 8 x 5 x100 63 ng 4 4 0 C hold If PCR product size is 3 kb it requires 3 8 x 5 x100 188 ng Set up one PCR tube at room temperature and add PCR product Water 8 ul PCR product volume is calculated by molar ratio with pSLIC vector pS
5. it produces 2 fixed length fragments 2 5 kb From Pvull 4516 to Pvull 7029 0 75 kb From Pvull 3740 to Pvull 4516 2 Other fragment is depended on the insert at EcoRV 2998 gt If there is no insert it will be 4 2 kb Pvull 7029 to Pvull 3740 gt If the insert size is 2 kb and does not have any Pvull digestion site it will be 4 2 kb 2kb 6 2 kb gt If the insert size is 2 kb and cut by Pvull at 0 5kb from 9 it will produce 2 fragments a 3 5 kb Pvull 7029 to EcoRV 2998 0 5 kb insert 5 4 kb b 1 5 kb insert 3 0 75 kb EcoRV 2998 to Pvull 3740 2 25 kb 3 Precise sequence can be analyzed by sequencing We use first 20bp of P2A peptide GGAAGCGGAGCTACTAACTT as a sequence primer The expected result should be www atcgbio com pSLIC PuroP2A Lentivirus Plasmid Construction Kit LT2002 ATCGbio Life Technology Inc k GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAG AACCCTGGACCTGAT 5 insert The map was created with compilation of sequences and restriction enzyme digestion Sequence analysis was not performed in entire vector 7 Amplification of plasmid Our SLIC Easy E Coli SLIC 1001 is suitable for further amplification Midi to Max as far as at 32 34 C for amplification In rare it may spontaneously produce mutation 3 5 kb size In such a case we recommend to use VP Easy E Coli VP 1001 or other E Coli suitable for viral plasmid amplification 8 Pro
6. Tm This is one of websites to do calculation http www promega com techserv tools biomath calc11 html In the calculator a Enter primer sequence not include the red colored sequence above in Step 1 b Check Adjust Mg Concentration in Optional of Step 2 c Get the result from the base stacking calculated Tm Parameters K Na 50mM Mg 1 5mM Click Adjust Mg Concentration 2 Forward primer www atcgbio com 3 pSLIC PuroP2A Lentivirus Plasmid Construction Kit LT2002 ATCGbio Life Technology Inc AW N AACCCTGGACCTGAT gene specific 5 sequence ATG can be removed Tm of gene specific 5 sequence should be around 60 65 C 3 Reverse primer Firstly design like this Gene specific 3 sequence stop codon should be included ATCCAGCACAGTGGC Tm of gene specific 3 sequence should be around 60 65 C Then order antiparallel reverse complement of this sequence Design primers for Creating GFP Control Plasmid The control GFP primers and template come with the kit Here is the example to insert GFP sequence in primers see declaimer in page 8 The control PCR primers which come with kit were designed as follows GFP sequence is 5 ATGGTGAGCAAGGGCGAGGAGCTGT TGGACGAGCTGTACAAGTAA 3 1 Choose 15nt skip ATG and 20nt in the GFP sequences for forward and reverse primers respectively and calculate Tm 5 15nt GTGAGCAAGGGCGAG Tm 60 C 3 20nt TGGACGAGCTGTACAA
7. GTAA Tm 62 C 2 Design PCR primers for SLIC reaction Forward primer AACCCTGGACCTGAT GTGAGCAAGGGCGAG Reverse primer TGGACGAGCTGTACAAGTAA ATCCAGCACAGTGGC Before antiparallel Reverse primer GCCACTGTGCTGGATTTACTTGTACAGCTCGTCCA After antiparallel Step By Step Protocol 1 Preparation of digested pSLIC PuroP2A plasmid by EcoR V Before doing SLIC reaction the pSLIC PuroP2A needs to be linearized by EcoR V This step can do conveniently on thermal cycler e Take pSLIC PuroP2A plasmid 15ul 3g for EcoR V digestion in 30ul final volume and then heat inactivated e After digestion check digested products 3 4 ul by running NDA gel It should produce 2 fragments in size of 2kb staffer and 7 8kb e The final concentration of digested pSLIC PuroP2A plasmid is 100ng jl e Keep it at 20 C until use Repeated freeze thaw does not affect performance Note read the instruction coming with the enzyme for conditions of digestion and inactivation In case of New England Biolab s EcoR V reaction should be 15ul pSLIC PuroP2A plasmid 11 ul water www atcgbio com 4 pSLIC PuroP2A Lentivirus Plasmid Construction Kit LT2002 ATCGbio Life Technology Inc lt y7 3 ul Digestion Buffer 1 20 U EcoRV at 37 C for 1hr and inactivation at 80 C for 20min 2 PCR and SLIC reaction PCR for the target sequence with designed primers In case of Takara PrimeStar HS Cat RO10A 50 ul volume of PCR will be
8. LIC plasmid EcoRV digested 1 ul 10x SLIC enzyme 1 ul the enzyme should be added lastly Pipet up down to mix www atcgbio com 5 i _ Vv a lt SS P et lt gt _ ap Ag _f NAN pSLIC PuroP2A Lentivirus Plasmid Construction Kit LT2002 ATCGbio Life Technology Inc YW N Start the thermocycler and confirm temperature to have reached at 20 C Then immediately put the tube on the thermocycler 5 Transform E Coli and preparation of plasmid mini prep After SLIC reaction finish centrifuge briefly Transform chemically competent E Coli we recommend our SLIC Easy E Coli SLIC 1001 with 34l reaction After heat shock incubate with SOC medium for 1hr spread entire content on Ampicillin 100 ug ml agar plate and incubate it for overnight ideally 32 34 C Pick up 3 colonies and incubate in each 2ml LB overnight ideally 32 34 C Lentivirus plasmid is most stable in E Coli growing at 32 34 C Higher temperature frequently results mutation see FAQ of Amplify Viral Plasmid in our website 6 Confirm insert by Pvull digestion First confirmation can be done by Pvull digestion we recommend Pvull HF from New England Biolab Typically at least one in 3 colonies is the right plasmid If not pick up more colonies Pvull 7029 5 LTR 1 181 AmpR 5374 6033 1715 2241 Pvull4516 EcoRV 2998 5 LTR 3835 4015 Pyull 3740 pSLIC PuroP2A CMV 7 5 kbp promoter 1 As seen the plasmid map above
9. can be skipped Length of 5 sequence of gene of interest will be between 17 25nt The entire length of primer becomes 53 61nt If this length of primer is ordered it is typically recommend to do PAGE purification procedure which is very expensive www atcgbio com 7 pSLIC PuroP2A Lentivirus Plasmid Construction Kit LT2002 We can avoid this problem by splitting entire sequence into two primers Forward 1 GATGACGACGATAAG last 15nt of flag sequence 5 gene of interest Forward 2 AACCCTGGACCTGATTACAAGGATGACGACGATAAG 6nt of 5 gene of interest Forward 1 will be about 40nt and forward 2 will be 42nt which can be ordered de salt or one more higher grade Two sequences are overlapped by 21nt whose Tm becomes more than 55 C In PCR reaction do 2 step continuous PCR showing as the follows First add forward 1 primer at 0 03uM and reverse primer 0 3uM in 50ul reaction Then program thermal cycler like this 98 C 10 sec 55 C 5sec 72 C 1min kb Repeat 8 cycles Hold at 80 C lt add forward 2 primer at 0 3 uM then resume to next PCR 98 C 10 sec 55 C 5sec 72 C 1min kb Repeat 20 cycles 72 C 3 min clean up By doing this flag tag containing gene of interest is ready for SLIC reaction Disclaimer We provide GFP sequence as PCR template Because of nature of PCR we do not guarantee the function of the sequence www atcgbio com Ye VA lt l ATCGbio Life Technology Inc
10. duction of lentivirus We recommend to use our lentiviral production kit LT1001 to produce lentivirus Although precise virus titer depends on the insert length and structure in case of 1kb or 3kb insert 200 ul or 500 ul of crude virus is sufficient to infect more than 90 of Human endothelial cells seeded at 30 See detailed information in the kit manual 9 Expected results In most of cells it takes 1 3 days to express proteins Expression by CMV promoter is typically high and fast in human cells but low and slow in mouse cells Therefore puromycin should be added at the day 3 after infection Concentration should be determined empirically Better start with lower concentration in mouse cells If expression is high fastest way to choose resistance cells is to add puromycin 0 5ug 1ug ml overnight and re plate the cells next day in presence of 1ug ml puromycin By doing so non infected cells do not attach on the plate and almost all the proliferating cells are resistant Appendix Creation of N terminus Flag tagged Gene of Interest Our P2A sequence end CCTGAT PD in amino acid is going to attach to 5 of gene of interest Typical flag sequence is GATTACAAGGATGACGACGATAAG DYKDDDDK and the first GAT of flag sequence is the same as the last P2A sequence Thus Forward primer to create N terminus flag tagged gene of interest with SLIC reaction will be AACCCTGGACCTGATTACAAGGATGACGACGATAAG 36nt 5 sequence of gene of interest ATG
11. eading PCR kit We recommend Takara PrimeStar HS Cat RO10A Non proofreading PCR enzyme such as Taq should not be used 4 PCR gel purification kit Such a kit is available from Qiagen Clontech and others 5 PCR primers It will be 35 40nt in length De salt grade or higher quality is satisfactory Plasmid Structure and Primer Design Gene of interest should be subcloned by PCR from other vector by primers containing 15bp homologous to end of EcoR V digestion site see below figure Red colored sequences need to be incorporated into PCR product The PCR product should be gel purified By SLIC enzyme reaction PCR fragments can be inserted to pSLIC PuroP2A plasmid in 30 minute Our pSLICs plasmid size is 6 8kb containing 3 4 kb basic lentivirus components between 2 LTRs Original 5 LTR promoter activity will be self inactivated during virus production pSLIC PuroP2A plasmid has puromycin resistance gene with P2A sequence total 0 7 kB followed by a staffer sequence flanked by EcoR V sites pSLIC PuroP2A Structure LTR CMV LTR p promoter puro p24 Staffer EcoRV EcoRV 5 TGGAGGAGAACCCTGGACCTGAT Staffer ATCCAGCACAGTGGCGGCCGCTCGAC 3 Guideline to Design the PCR Primers By PCR subcloning PCR product gene of interest contains15bp plasmid homologous sequences red colored sequence above The following steps are the guideline for primers design 1 To design gene specific part of the primers use base stacking calculated
12. eeneenee Step BY Step Proto Ol sists ienstnceenciess cu cecavannuaiwcdecewndaneusuactedauueeanunieneceuiy p Vols als b MMeeMerrereerererrerererrrrerrrrererrerriremerrrrererreirerr errr er ereTi Teer reer reer rer errr ere Creation of N terminus Flag tagged Gene of Interest ss eseseeeeeeeeeeeeees DisclaiMer issons cas acccsuceescecacecsauuesseceecee ch cetuceGecsesansstsceuecsanse References COUPEE OO AN N PRWWWDN DN SN Contact Information iisisinnscescisacaccnasaccsadadsatasciiesnsasaiasnnecassantasaieaduiedieansenaase FOR RESEARCH USE ONLY Not for use in clinical or diagnosis purpose Important Notice Laboratory workers handling pathogenic lentiviruses recombinant lentiviral vectors naturally or experimentally infected laboratory animals or clinical specimens potentially infected with lentiviruses Diagnostic specimens that contain human blood body fluids or tissues can be handled and manipulated at the BSL 2 level BSL 2 is also appropriate for generating and using lentiviral vectors and handling animals and animal tissues blood body fluids and cell lines that are infected with lentivirus vectors When you practice recombinant lentiviral vectors please following the requirements outlined in http oba od nih gov rdna _rac rac_guidance _lentivirus html and CDC Biosafety in Microbiological and Biomedical Laboratories 5th edition the NIH Guidelines for Research Involving Recombinant DNA Molecules latest edition
13. ence during translation P2A sequence in our plasmid is GSGATNFSLLKQAGDVEENPG PD The first part before slash GSGATNFSLLKQAGDVEEMNPG is attached to puromycin resistance gene product and the second part after slash PD is attached to the gene of interest users insert Start codon of gene of interest ATG may be removed Alternatively user can put flag tag DYKDDDDK sequence at the N terminus gene of interest just by a single PCR as shown in this manual The kit contains enough plasmids and reagents to perform at least 20 reactions for creating lentiviral vector plasmids Kit Components and Storage Conditions shipped at RT and stored at following temperature Components Size and Storage conditions 20ul 200ng ul 4 C This plasmid is not intended to amplify pSLIC PuroP2A plasmid i 25ul 20 C 10 x SLIC enzyme Solution i enzyme is stable at least 4 days at room temperature GFP template DNA Control 10 ul 10ng ul 4 C GFP forward and reverse primer mixture 10 ul 10 uM each 4 C User Provided Materials 1 Chemically Competent E Coli We recommend to use our SLIC easy E Coli SLIC 1001 to obtain the best result We also confirmed that Top10 cell Invitrogen works well We don t recommend DH5alpha 2 EcoRV endonuclease We used New England Biolab product www atcgbio com 2 pSLIC PuroP2A Lentivirus Plasmid Construction Kit LT2002 ATCGbio Life Technology Inc W 3 Proof r
Download Pdf Manuals
Related Search