Pooled Lentiviral shRNA Library Screening Reference
Contents
1. ccceeeeeeeee eens ee eees 17 F Transduction Protocols and Lentiviral Titer Estimation cccceeeeeeeeeeeee teens teens 18 Fels TRANSGUCTION PP civeninidiianiesaecive civeinedsi sind T Eoi a TOi 18 F 1 1 Transduction of Adherent Cells HEK293 cells eee 18 tech cellecta com 2 of 28 vi 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual F 1 2 Alternative Transduction Protocol Spinoculation for Suspension Cells 19 F 2 Lentiviral Titer Estimation RFP assay cssessesseeseenen nemen nnn 20 G Calculating the Puromycin TIEGE iuseiso eei er rrernE v Eg PERPE vr PE WR LIiR REC DW EPIVP PE Ennn 21 H Troubleshooting cceneevoneibcesoreratkvbFE iTA E E ir o EE TEEI A enii 23 H 1 Poor Transduction Efficiency oo nennen nennen nnn nnn nnn 23 H 2 Transduction Affects Target Cell Viability essseseem HH 24 H 3 No Expression of RFP or Puro or shRNAs in Target Cells sssse 24 is Technical SuppOFt iiec cer ette kennen rente deed xx x a AR aaa REO KR nee ied S e a d 24 J Safety Guidelines isis ETT 26 K sisse 26 tech cellecta com 3 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual A Introduction to Pooled shRNA Libraries The basis of Cellecta s RNAi genetic screening technology is the stable suppression of specific genes on a large scale using pooled shRNA l2. 20 000 000 Viral Stock 20 000 000 4 67 ml 3 000 000 G Calculating the Puromycin Titer If puromycin selection of transduced cells is going to be performed in the screen the fraction of RFP cells at a given MOI that will survive puromycin selection must be calculated beforehand Even though RFP and Puro resistance markers are expressed from the same promoter not all cells expressing detectable RFP are guaranteed to be puro resistant A threshold of Puro expression is required to confer puromycin resistance Depending on cell tech cellecta com 22 of 28 vi 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual type such a threshold is associated with different levels of RFP co expression Depending on the MOI used a different 9o of RFP cells will express enough Puro to survive puromycin selection i e the higher the MOI the higher the of multiple integrants so the higher the 9o of RFP cells expressing higher levels of Puro In order to calculate which fraction of RFP cells are going to survive puromycin selection the following procedure is strongly suggested Titer virus in target cell line by flow cytometry F 2 Lentiviral Titer Estimation RFP assay Based on assessed titer perform a small scale transduction aiming at 50 infected cells 3 days after transduction split cells into 2 samples grow cells puromycin for an additional 3 days then analyze both samples
3. you may wish to do a pilot experiment to determine which promoters will work best In the pooled shRNA libraries the vectors have a cDNA promoter for expression of the RFP and Puro resistance as well as a shRNA promoter for expression of the shRNA Cellecta sells pre packaged viruses expressing different marker genes from different promoters You can use these to determine which promoter combination will work the best for your cells For more information please see http www cellecta com products and services pooled lentiviral libraries control shRNA constructs E Packaging Protocol for Pooled Lentiviral shRNA Libraries If the library you purchased was provided in plasmid form you will need to package it into lentiviral particles before using it in your target cells Please refer to the User Manual specific to the library you have purchased for a detailed protocol on lentiviral packaging The viral packaging protocols used for pooled shRNA libraries differ from those used for regular viral packaging The main difference is that in order to maintain representation of all of the individual shRNAs for the screen a large scale viral packaging protocol is needed If packaging is done on too small a scale it can skew the representation of the library Cellecta offers lentiviral packaging services Please contact us at sales cellecta com or visit http www cellecta com products and services lentiviral packagin for more information t
4. 0 5 ug ml by performing a toxicity titration as described in D 3 Check Toxicity of Polybrene Section Problem Loss of lentiviral titer during storage Solution Ensure storage of aliquoted packaged shRNA library at 80 C Each freeze thaw cycle can cause unpredicable reduction of the titer Use a fresh stock for transduction Problem The RFP assay is performed too early Solution Normally the maximal expression of RFP from the integrated provirus is expected to develop by 72 hours after transduction However some cells exhibit delayed expression Try the assay at a later time such as 96 hours Problem The RFP assay is performed with the wrong flow cytometry settings Solution RFP cells are to be detected using a 561nm laser for excitation 530nm still acceptable and 600 20 band pass filters or similar for detection for TagRFP Using blue laser 488nm for excitation leads to gross underestimation of viral titer tech Qcellecta com 24 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual H 2 H 3 I Problem In the RFP assay the of transduced cells is determined by fluorescence microscopy instead of flow cytometry Solution Use flow cytometry Transduction Affects Target Cell Viability Problem Polybrene is toxic for target cells Solution Optimize the concentration and exposure time to Polybrene during the transduction step For some sensitive cells Polybrene
5. 3 ALTR ensures self inactivation of the lentiviral construct after transduction and integration into genomic DNA of the target cells e The RSV promoter upstream of 5 LTR in the lentivector allows efficient Tat independent production of lentiviral RNA reducing the number of genes from HIV 1 that are used in this system e Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev The corresponding proteins are expressed from different plasmids lacking packaging signals and share no significant homology to any of the expression lentivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent virus e None of the HIV 1 genes gag pol rev are present in the packaged lentiviral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent e Lentiviral particles will carry only a copy of your expression construct Despite the above safety features use of HIV based vectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous lentiviral sequences to form self replicating virus or the possibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www
6. a 2 or 3 generation lentiviral packaging systems Agilent 4 Designs shRNA Mir30 etc Oligo Synthesis pue A shRNA Expr H1 U6 or H1 Tet beh Li enove JZ Markers GFP RFP Puro etc i I I i Promoters UbiC EFta CMV etc Oligo PCR amp Recombinant Virus Pooled Lentiviral Detachment Cloni Producti oning o Oo roduction d ShRNA Library e c e Ss oco 3E tty B Plasmid shRNA T5 Library Target Cell pH rrr _ i Transduction ShRNA bar code HT Sequencing Illumina j er r j t EPa T HT Seq i XS e oy Dat 90 of sequences Transduced within 1 order of magnitude Target Cells tech cellecta com 5 of 28 vi 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual B 3 Unambiguous Sequenceable Barcodes Quality control of the libraries and the final screening representation analysis is greatly facilitated by the incorporation of easily sequenced barcodes in each shRNA construct The barcodes enable unambiguous identification of each shRNA species with HT sequencing Depending on the shRNA library that you have chosen the barcodes and flanking primers will vary For example the barcodes in the DECIPHER shRNA library are 18 nucleotides long while the barcodes in the Human Genome Wide shRNA library are 22 nucleotides long Upon lentiviral transduction barcodes integrate into the genomic DNA along with the shRNA expression cassette and are permanently present but not expressed in
7. by flow cytometry By looking at the RFP intensity of puromycin treated cells calculate the of cells that survived puromycin selection The figure below shows FACS analysis of transduced cells no puromycin selection blue puromycin selection red 50 of cells were RFP 24 of the RFP cells were also puromycin resistant 12 of total m ample Name IMPORTANT The of RFP cells that are e also puromycin resistant is dependent on p 7 hDO M1 293 fes MOI as it increases with the increase of es 7K NO M1 293 pure 3d fcs RFP cells bearing multiple integrations In the example above 24 of RFP cells 12 of total were puromycin resistant when cells were infected at MOI 0 7 50 RFP cells If the same cells were infected at the recommended MOI of 0 5 40 RFP cells RFP less than 24 of RFP cells would also be 50 os puromycin resistant cells Conversely if E 4 4 cells would be infected at MOI 2 85 RFP cells a much higher than 24 of RFP RFP PuroR cells would also be puromycin resistant due 12 to high of RFP cells bearing multiple integrants and therefore expressing high levels of the puromycin resistance gene In the case described above a 27K library genetic screen was started with at least 46 m sp i0 10 E x 109 cells per replicate and transduction Cells were infected at MOI 0 7 50 transduction efficiency to obtain 23 x 10 infected RFP cells of which about 5 5 x 10
8. cdc gov biosafety publications bmbl5 bmbl5 sect iv pdf It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and follow standard microbiological practices which include e Wear gloves and lab coat at all times when conducting the procedure e Always work with lentiviral particles in a Class II laminar flow hood e All procedures are performed carefully to minimize the creation of splashes or aerosols e Work surfaces are decontaminated at least once a day and after any spill of viable material e All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory K References For a complete list of References and Product Citations please see http www cellecta com resources publications 2014 Cellecta Inc All Rights Reserved tech Qcellecta com 27 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual Trademarks CELLECTA is a registered trademark of Cellecta Inc DECIPHER is a trademark of Cellecta Inc tech cellecta com 28 of 28 v1 10 22 14
9. the cell Lastly some libraries contain clonal barcodes which enable tracking of individual cell clones expressing specific shRNA sequences These allow for a wider variety of screening protocols that involve cell proliferation differentiation migration metastasis or apoptosis in specific clones Please refer to the User Manual and product analysis certificate for the specific library you are using for detailed information on the barcodes An example barcode structure is shown below bar code H1 Tet Sext f CMV p TetRep RFP PuroR 3 ALTR unb EI liane 2A A shRNA T6 Gex2 bar code U6 Sext J UbiC p RFP _ PuroR 3 ALTR eub LA unb 2A shRNA T6 4T Gex2 B 4 Effective shRNA Sequences Cellecta has developed its own in house shRNA design algorithm that makes use of internal studies primarily focused on the most functionally effective structural features e g length loop size mismatches etc combined with published information regarding sequence preferences and known sequences that have been shown effective for a particular target G U mismatches Qo passenger strand 4 AUA CGGCUUCCUAAACACCUCUUAGUUA u yu GCCGAAGGAUUUGUGGAGAAUCGAU AcU guide strand B 5 Representation Levels of Individual shRNA Sequences Cellecta specifically designs and constructs pooled shRNA libraries using proven library construction procedures not by re amplifying and mixing pre made individual shRNA constructs As a result
10. 14 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual Negative Selection Screen 2 Aim Identifying shRNAs that synergize with cytotoxic effect of compound X in cell line A Compound X has IC50 inM when administered continuously for 7 days ShRNA library used 55K HGW1 Procedure Day 1 5x10 cells transduced at MOI 0 5 40 transduction efficiency expected Day 2 Media change Day 4 Actual transduction efficiency checked by flow cytometry Start of puromycin selection 1ug ml Day 7 End of puromycin selection 3x10 cells In some cases it can be appropriate to keep puromycin throughout the experiment Cells are pooled and re plated into 2 separate samples 6x107 cells sample Sample A is treated with 1nM compound X sample B is mock treated Day 10 AII cells from each sample are pooled and re plated at 6x10 7 cells sample Sample A is still treated with 1nM compound X sample B is still mock treated Day 13 All cells from each sample are harvested for genomic DNA isolation and HTseq sequencing of integrated barcodes 400ug genomic DNA sample is used for barcode amplification and HTseq e ShRNAs are evaluated based on barcode depletion in sample A vs sample B e gene hits are identified based on evaluation of targeting shRNAs D Recommended Pre Screen Experiments As with all lengthy experiments it is important to work out some of the details of your system before performing the ke
11. 18 hours post transduction so that the cells have not had too much time to proliferate and express shRNAs to affect the library distribution In more complex experiments aiming at identifying differential toxicity between isogenic cell lines or between compound treated and non treated cells other baselines will be needed C 3 4 Examples of Negative Selection Screens Negative Selection Screen 1 Aim Identifying shRNAs that are differentially cytotoxic in cell line A vs cell line B ShRNA library used 55K HGW1 Cell lines A and B have a doubling time of 36h Procedure Day 1 5x10 cells cell line transduced at MOI 0 5 40 transduction efficiency expected Day 2 Media change Day 4 Actual transduction efficiency checked by flow cytometry Start of puromycin selection 1ug ml Day 7 End of puromycin selection 3x108 cells sample In some cases it can be appropriate to keep puromycin throughout the experiment All cells from each sample are pooled together and re plated at 6x10 cells sample Day 10 All cells from each sample are pooled together and re plated at 6x10 cells sample Day 13 All cells from each sample are harvested for genomic DNA isolation and HTseq sequencing of integrated barcodes 400ug genomic DNA sample is used for barcode amplification and HTseq e ShRNAs are evaluated based on barcode depletion in sample A vs sample B e gene hits are identified based on evaluation of targeting shRNAs tech cellecta com
12. 9 will be puro resistant 200 puro resistant cells shRNA In your screening experiment however we do not recommend using an MOI greater than 0 5 Red 2nd l ze r IMPORTANT Using higher MOIs to achieve gt 40 RFP cells in order to obtain 20 or more puro resistant cells is not recommended It is advised to limit the RFP based MOI to 0 5 40 RFP cells and use enough cells at transduction to obtain the desired amount of puromycin resistant transduced cells at least 200 cells shRNA tech cellecta com 23 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual IMPORTANT When performing lentiviral transductions for a genetic screen make sure to use exactly the same conditions as in library titering Accurately scale up volumes surfaces cell number and reagents to be used H Troubleshooting H 1 Poor Transduction Efficiency Problem Target cells have too high or too low density Solution Plate fewer or more cells in order to have 20 50 confluency at transduction stage Problem Target cell line may be difficult to transduce Solutions 1 Use a higher concentration of lentiviral particles 2 Perform Spinoculation to improve transduction efficiency 3 Check to see if Polybrene was added at 5 ug ml Problem Wrong amount of Polybrene added during transduction stage Solution If Polybrene is toxic to the target cells optimize Polybrene concentration in the range of
13. IRAM S CY SO EREN fy M Discovery is yours NA CELLECTA Pooled Lentiviral shRNA Library Screening Reference Manual V1 10 22 2014 www cellecta com Cellecta 2014 All Rights Reserved Cellecta Pooled Library Screening www cellecta com Reference Manual Contents A Introduction to Pooled shRNA Libraries cceecee cece eee eee ee eee mmm menn 4 B Design and Quality Control of Cellecta s shRNA Libraries ccececeeeee eee eeeeeeeeeeeeeneenees 5 B 1 Synthesis of the OligOs isti tet ERR ER ERE XRRXRRREXEER EX RRENEERRAEAFRRRARRBR KANNETE 5 B 2 Cloning of the Oligos into Lentiviral Vectors esses mmm 5 B 3 Unambiguous Sequenceable Barcodes ccceceee cece ee eee eee eee eee eee ensem eene 6 B 4 Effective shRNA Sequences sesesseeseeseennenn nennen nean sea sea sea sea sea sese nnn nnn 6 B 5 Representation Levels of Individual SARNA Sequences eeeeeennenn nnn 6 B 6 Quantifiable HT Sequencing cesssssssssseesen EERE EEE Ent E 7 C Library Complexity Maintaining Representation and Types of Screens 8 C 1 Library Complexity and Number of Cells cccecccceceece eee e ee eee eee ee eee e eens enetnetnaenaennes 8 C 1 1 Number of Starting Cells and Representation cceceee eect ee ee teeta eeeeeeeeeaeaes 8 C 1 2 Multiplicity of Infection cssssssssseeeeeenen mene nn nnns 9 C 1 3 Represe
14. NAs Positive Selection Screen 2 Aim Identifying genes required for the transactivation of promoter X by compound Y GFP is expressed from promoter X and accumulates in cells within 24h of stimulation by compound Y at 10nM concentration ShRNA library used 55K HGW1 Procedure Day 1 5x107 cells transduced at MOI 0 5 40 transduction efficiency expected Day 2 Media change Day 4 Actual transduction efficiency checked by flow cytometry Start of puromycin selection 1ug ml Day 7 End of puromycin selection Day 8 Compound Y added at 10nM concentration Day 9 1x108 cells sorted by FACS into two samples e Sample A bottom 1 dimmest GFP cells e Sample B top 50 brightest GFP cells Both samples are harvested immediately after sorting for genomic DNA isolation and HTseq sequencing of integrated barcodes For the top 50 population 400ug of genomic DNA is used for barcode PCR and HTseq sequencing For the bottom 1 population all the recovered genomic DNA is used e ShRNAs are evaluated based on barcode enrichment in sample A vs sample B e gene hits are identified based on evaluation of targeting shRNAs tech cellecta com 12 of 28 vi 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual C 3 Negative Selection Screens aka Viability Screens A standard dropout viability screen negative selection screen relies on the fact that some of the shRNAs in the screen are either cytotoxic or cy
15. a selection that eliminates most of the cells With this sort of screen the goal is to isolate a small population of cells with shRNAs that enable the cells to pass through the selection step The critical factor here then is the nature of the selection which ultimately determines the screen procedure In most cases it is advisable to wait about 1 week after library transduction before carrying out the selection step The 1 week wait period is needed to allow for knockdown of genes encoding for long half life mRNAs and proteins and the development of the resistant phenotype before applying selection Cells should then be harvested as soon as positive selection is completed Growing and expanding clones after positive selection is not advised For a positive selection screen the puromycin or other antibiotic selection of transduced cells it is not essential but provides a way to reduce the total number of cells before positive selection and makes cell culture handling more manageable C 2 2 MOI of Transduction A positive screen involves isolation of a small population of cells with shRNA sequences that will be over represented or enriched when compared to the starting library shRNA counts As with any screen to ensure reproducible and reliable results it is critical that you transduce enough cells to maintain sufficient representation of each shRNA construct present in the library The number of cells stably transduced with the shRNA library at
16. al vs noise in any screening assays or even which shRNA is actually missing in the screen In other words you need this data to know what is truly being screened B 6 Quantifiable HT Sequencing pM MCN MEE ee HT sequencing significantly outperforms the 7 shRNA Representation Curve Good Library hybridization based approach for identification of individual shRNA species based on the high quality digital expression data generated by using barcodes Even using optimized barcode sequences array hybridization suffers from a limited dynamic range of approximately 2 orders of magnitude which results in a loss of as much as 30 of the signals that fall outside their effective range Also spot to spot cross hybridization on arrays results in significant noise that does not occur with HT sequencing where virtually every shRNA in the population is detected and counted from those present in only a few copies to those present in several million Differences in shRNA species between control and test populations are very easily detected and statistically analyzed so that hits can be confidently identified Number of barcodes tech cellecta com 7 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual Example Positive Genetic Screen The percentage of hits corresponding to known apoptotic genes revealed positive in FAS induced apoptosis of HeLa cell model of known modulator
17. creens In order to calculate the enrichment fold of the shRNA sequences present in the selected population a baseline control is needed Depending on the screen the plasmid library itself can be used as baseline or pre selection cells or mock selected cells tech Qcellecta com 11 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual C 2 5 Examples of Positive Selection Screens Positive Selection Screen 1 Aim Identifying genes whose knockdown confers resistance to cytotoxic compound X Cytotoxic compound X kills 9596 9996 cells within 48h when administered at inM concentration ShRNA library used 55K HGW1 Procedure Day 1 5x10 cells transduced at MOI 0 5 40 transduction efficiency expected Day 2 Media change Day 4 Actual transduction efficiency checked by flow cytometry Start of puromycin selection 1ug ml Day 7 End of puromycin selection Day 8 Culture split 50 50 into 2 samples gt 1x108 cells sample e Sample A cytotoxic compound X added at 1nM concentration e Sample B untreated Day 10 Both samples harvested for genomic DNA isolation and HTseq sequencing of integrated barcodes For the untreated sample 400ug of genomic DNA is used for barcode PCR and HTseq sequencing For the treated sample all the recovered genomic DNA is used e ShRNAs are evaluated based on barcode enrichment in sample A vs sample B e gene hits are identified based on evaluation of targeting shR
18. ction integrations cell can be calculated with good accuracy in the range 0 2 1 5 MOI tech cellecta com 21 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual Titer is calculated according to the TITER FORMULA below MOI TU s lls at T ducti P EE EE TE DRGEP se EEE E ae ORR GEA ml of Viral Stock used at Transduction ml Example IF The original of cells at Transduction was 100 000 and The volume of virus stock used was 10 ul and The observed of transduced RFP cells is 25 THEN The calculated MOI is 0 3 from the chart and The TITER is 100 000 ce 0 01 3 000 000 TU ml Once titer is estimated the amount of Lentiviral Stock necessary to transduce any given of target cells at any transduction efficiency range of 10 80 infected cells can be back calculated from the TITER FORMULA and TITER CHART above Example To transduce 20 000 000 cells at 5096 transduction efficiency with a Lentiviral Stock titer of 3 000 000 TU ml we calculated the required amount of Lentiviral Stock as follows We calculate the required MOI to achieve 50 transduction efficiency using the TITER CHART 50 transduction efficiency 0 7 MOI We calculate the volume of Lentiviral Stock required using the TITER FORMULA TU MOI E of cells at Transduction ml of Viral Stock used at Transduction 0 7 ml of Viral Stock used at Transduction 3 000 000
19. d therefore drop out of the population It is critical to maintain the full library representation that was initially used at the start of the screen If a portion of propagating cells are removed during propagation e g cells are split the representation of the library can be skewed in the sample which introduces significant random noise This effect is readily seen in the second bar in the Reproducibility of Triplicates figure where the effect of starting with sufficient cells i e 200 fold library complexity is completely undercut by splitting cells during propagation so that that the final count of cells after 10 days is the same as the initial number of transduced cells i e 200 fold library complexity The correlation between triplicates falls dramatically when the cells are split to this degree For this reason if cells are ever to be discarded or samples split at any time during the screen the number of remaining cells in each sample should always exceed the complexity of the library by at least 1 000 fold as shown in the first bar of the figure For example keep at least 27 million cells after every splitting step for a 27K library Also before splitting or discarding make sure you first pool all cells from the same replicate together C 1 4 Modular Approach to Genome Wide Screening Library representation is often overlooked especially when the desire is for large scale unbiased screens However without careful consideration i
20. e the lowest concentration of puromycin that kills gt 90 of cells in 72 hours Use this concentration at puromycin selection step during the screen D 3 Check Toxicity of Polybrene Polybrene is a transduction enhancement reagent used during transduction of the pooled ShRNA lentiviral library into the target cells Polybrene is a polycation that neutralizes charge interactions to increase binding between the lentiviral envelope and the plasma membrane The optimal concentration of Polybrene depends on cell type and may need to be empirically determined Excessive exposure to Polybrene can be toxic to some cells Before transducing your target cells we recommended performing a Polybrene toxicity titration In a 12 well plate grow cells in complete culture medium with a range of Polybrene concentrations 0 ug ml 1 ug ml 2 ug ml 3 ug ml 4 ug ml 5 ug ml for 24 hours Then replace old medium with Polybrene free complete culture medium and grow cells for an additional 72 hours Check for toxicity by counting viable cells For your experiments use the highest concentration of Polybrene that results in less than 10 cell toxicity compared to no Polybrene typically 5 ug ml is recommended For some cell types you cannot use Polybrene tech cellecta com 16 of 28 vi 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual D 4 Promoter Validation If you have not used lentiviral vectors in your target cells before
21. ech cellecta com 17 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual F Transduction Protocols and Lentiviral Titer Estimation The following section uses packaged lentiviral particles for transduction into example target cells HEK293 Please note that lentiviral particles should only be opened within the laminar flow hood and should be used under biosafety Level 2 conditions For more information on the biosafety of lentiviral particles please refer to tech cellecta com 18 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual J Safety Guidelines below F 1 Transduction Lentiviral transductions are performed by mixing cells and virus in culture media supplemented with Polybrene For both adherent and suspension cells transductions are initiated in suspension and carried out overnight Adherent cells are allowed to adhere to substrate during transduction and are transduced at a cell density that allows for 2 3 population doublings before reaching confluence Suspension cells are typically transduced at higher density than standard growth density and then they are diluted to standard growth density 18 24 hours after transduction F 1 1 Transduction of Adherent Cells HEK293 cells The following protocol has been optimized for HEK293 cells For other adherent cell types parameters such as media growth surface time of detection etc will have t
22. esuspended at 2 x 109 cells per ml in RPMI 10 FBS supplemented with 20mM HEPES pH7 4 and Polybrene 5 ug ml 0 5 ml aliquots are placed into each well in a 24 well plate 1 x 10 cells well total This cell density has proven effective for many suspension cell lines in house at Cellecta To each cell containing well add increasing amounts of lentiviral stock to be titered For standard 100 fold concentrated lentiviral stock add O ul 0 3 ul 1 ul 3 ul and 10 pl virus Close the plate mix by gentle agitation wrap the perimeter with parafilm and place the plate into centrifuge with an appropriate balance and centrifuge at 1 200 x g at 25 C for 2 hours 4 Following centrifugation remove plate s from centrifuge carefully remove parafilm and place in incubator After 3 hours feed cells with 0 5 ml additional complete medium per well no Polybrene 5 24 hours after spinoculation resuspend cells at 2 x 10 cells ml in RPMI 1096 FBS in the appropriate culture vessel and grow for additional 48 hours 6 72 hours after spinoculation perform titer as previously described NOTE Use larger vessels for large scale genetic screen transductions Scale up all volumes accordingly tech cellecta com 20 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual F 2 Lentiviral Titer Estimation RFP assay Lentiviral shRNA vectors that express the fluorescent protein TagRFP excitation 560nm emission 590
23. ibraries allowing for loss of function screens in mammalian cell systems Genetic screens with shRNA libraries can be utilized to investigate most aspects of biology that can be recapitulated in a cell culture model As opposed to expressing and assaying the functional effects of an individual shRNA molecule the development of complex shRNA libraries allows for simultaneous screening of thousands of different shRNA molecules on a target population In general genetic screens represent an unbiased approach to identify genes that act in specific cellular pathways HT RNAi genetic screens have been proven to be an extremely potent and versatile tool to explore the molecular basis of cancer development and progression and to discover genes essential for viability in cancer cells that can be used as targets for anticancer drug development Primary Screen identification of 1 d Growth shRNA bar code SC NMNSONODOR row Insert Amplification Primary Hits mi zm amp HT Sequencing Set of Pathway amp pm PA s f Cancer associated Re gt P gt g ad ug itid f Cancer aul I ooled DECIPHER Cance shRNA Library Cells The screening process introduces a lentiviral library encoding a highly heterogeneous population of barcoded shRNA constructs that are packaged in viral particles pseudotyped with the vesicular stomatitis virus glycoprotein G VSV g into a population of cells under conditions where most of the cells only take up and e
24. it is possible to obtain a narrow representation of virtually all tech cellecta com 6 of 28 vi 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual ShRNA The use of our optimized and unambigious barcodes in combination with HT sequencing enables Cellecta to ensure that more than 99 of shRNA encoding inserts are present in every library and that the representation frequencies of 80 90 of them fall within a 10 fold range In the shRNA Representation Curve figure below the upper panel shows a pooled library of 27 000 shRNAs with very good representation Virtually all the shRNAs are seen between between 100 copies and 1 000 copies in 20 million reads Thus there is just a 10 fold difference between the most represented and least for about 90 of the shRNAs The library has a relatively balanced representation of all ShRNAs On the other hand the lower panel shows a poor library where almost half of the shRNAs are present at less than 100 copies whereas the others are very highly represented Overall the distribution is very broad It is only possible to get readable signals for about half the shRNAs using the library in the lower panel This definitive representation data at the start of a screening provides a starting point for the analysis to find shRNAs that significantly increase or decrease during screening indicating relevant targets With a poorly defined distribution it is difficult to differentiate sign
25. mycin after transduction and at what concentration For how long did you use puromycin on the cells RNAi Screen tech Qcellecta com 25 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual e Could you briefly explain your experiment e How many infected cells were used Sample Preparation amp HT Sequencing e What protocol was used to amplify the barcodes e What HT sequencing system and which Illumina HT Sequencing reagents kit and flow cell did you use e How many sequences were read per sample e Would you be able to send us the raw data so that it may help us diagnose the issue Please refer to the questions above and contact us by phone or email Phone 1 650 938 3910 Toll Free 1 877 938 3910 Fax 1 650 938 3911 E mail Technical Support tech cellecta com General Information info cellecta com Sales sales cellecta com Orders orders cellecta com Blog http www cellecta com blog Postal Mail Cellecta Inc 320 Logue Ave Mountain View CA 94043 For more information about Cellecta s products and services please visit our web site at http www cellecta com tech cellecta com 26 of 28 vi 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual J Safety Guidelines The HIV based lentivector system is designed to maximize its biosafety features which include e A deletion in the enhancer of the U3 region of
26. n designing screening procedures that reflect the complexity of the library results of these large scale screens can produce relatively meaningless data with anecdotal results at best So what about genome wide screening Our approach is to provide modules each targeting approximately 5 000 genes with 27 500 shRNA in our DECIPHER library or targeting 6 500 with 55 000 shRNA in our Human Genomewide hGW library These modules enable comprehensive genome wide screens with manageable numbers of cells for negative selection screens For cases where it is practical to work with larger numbers of cells for example some positive screens the modules of the hGW library can be combined to make a larger library since they contain non overlapping barcodes C 2 Positive Selection Screens aka Rescue Screens Find genes required to produce a response to added factors or compounds for example genes necessary for trigging apoptosis or cell death in response to FAS PUMA or other effectors Positive screens are also known as enrichment screens Many positive screens use FACS to look for modulators of signaling molecules like NF KB p53 c myc HSF 1 HIF 1a using tech Qcellecta com 10 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual fluorescent reporter cell lines or cells expressing specific antibody detectable markers such as specific receptors C 2 1 Length of the Screen A positive screen involves
27. nm allow lentiviral titer estimation by flow cytometry RFP assay or by a combined flow cytometry puromycin resistance assay RFP Puro assay To check lentiviral titer we recommend always using the same cells you will use in the screen Most of the commonly used mammalian cell lines can be effectively transduced by lentiviral constructs Relative titers can vary up to 50 fold depending on the chosen cell line Lentiviral titer is measured as Transduction Units ml TU ml One TU produces one integration event in target cells Integration events can be calculated from observed of transduced cells according to the table below TITER CHART 100 4 90 80 70 60 50 40 96 infected cells 30 20 10 0 0 5 1 1 5 2 2 5 MOI integrations cell The of infected cells is determined by flow cytometry excitation 56inm emission 2600 20 for TagRFP by observing the of RFP cells in the transduced cell sample When the of infected cells is at or below 20 the of integrations is with good approximation equivalent to the of transduced cells At higher transduction efficiencies the fraction of transduced cells bearing multiple integrations becomes higher and higher so that the increase in of transduced cells relative to integration events cell is no longer linear Using the table below MOI MOI2multiplicity of infe
28. ntation and Cell Propagation Techniques eeseeee n 9 C 1 4 Modular Approach to Genome Wide Screening eeeeeeeee nennen 10 C 2 Positive Selection Screens aka Rescue Screens csesseseeeeenn nnn 10 C 2 1 Length of the Screens iue eere ebbe vesci nb rebel ee eder an e i pa e 11 2 2 MOL of TransductiODni sionem err bees reir eb rk eei dr eee ra eee Re eR 11 C 2 4 Baseline Controls for Positive Selection Screens esseeeeseeee 11 C 3 Negative Selection Screens aka Viability Screens oo cece cccee eee e testes eee teat eaeeaees 13 C 3 T Length Of the SCree Mesiucieiicatedetseaian tion iebelsaa i e a Peace Da Rete nA Ue E RE 13 C 3 2 MOI of Transduction Number of Cells to Transduce Culture and Collect Amount of DNA to Use for Barcode Amplification sess nnn 13 C 3 3 Baseline Controls for Negative Screens essssssssssenn enne 14 D Recommended Pre Screen Experiments sssssssssesseesee nemen nennen nnns 15 D 1 Doubling TIME sasinen nae ii ede a e bd nb dui idi cenbl d de adr ei or dad 15 D 2 Calculating a Kill CUVE iiir reiecit ebrietate med cd embed eje tion ndi d 16 D 3 Check Toxicity of Polybrene ccccceecece eee e cence eee nnne meneame nea sea sea sna nean nn nnn 16 D 4 iPromoter Validation 1 pier ERRARE RR de behead noe RD EREFRMPAPERU Ra KADER RAS EECEFA OUS 17 E Packaging Protocol for Pooled Lentiviral SARNA Libraries
29. nual T In2 Xe In Gp Doubling Time where T Time in any units in this case days For Example let s say that on Day 0 you count 2x10 cells Three 3 days later you count the cells at 16x10 cells Xb 2x109 T2 3 days Xe 16x109 Doublina Time n2 3 069 208 _ oubDimg meo md 000000 me 208 ay 2 000 000 D 2 Calculating a Kill Curve Most vectors from Cellecta that are used to make pooled shRNA libraries have an antibiotic resistance gene which allows you to select the cells that have received a copy of the shRNA In order to successfully select your cells you need to know the concentration of antibiotic that kills your untransduced cells within a given amount of time Antibiotic selection is not necessary for most screens but it is a convenient way of removing excess cells that have not received the lentiviral vector It is helpful to use minimal levels of antibiotic so as not to kill cells that just have a weaker expression of the antibiotic resistance gene Many vectors contain a puromycin resistance gene therefore we will use this example as to the method of calculating a puromycin kill curve Aliquot cells in a 12 well plate at such a density so they are at 72 hours from confluence Add puromycin at 0 ug ml 0 5 ug ml 1 ug ml 2 ug ml 5 ug ml and 10 ug ml in six different wells Mix and return cells to incubator Grow cells under standard conditions for 72 hours then count viable cells and determin
30. o be adjusted Day 1 1 Quickly thaw the lentiviral particles in a water bath at 37 C Transfer the thawed particles to a laminar flow hood gently mix by rotation inversion or gentle vortexing and keep on ice CAUTION Only open the tube containing the lentiviral particles in the laminar flow hood NOTE Unused lentiviral stock may be refrozen at 80 C but it can result in unpredictable loss of titer 2 Trypsinize and resuspend HEK293 cells to a density of 1 x 10 cells ml in D MEM supplemented with 1096 FBS and 5 ug ml Polybrene Aliquot 1 ml well in a 12 well plate and add O ul 3 ul 10 ul 33 ul and 100 ul of lentiviral stock supernatant filtered to remove cells and cell debris not concentrated to six different wells If concentrated virus is used scale down virus volumes accordingly Mix and return cells to CO2 incubator Grow cells under standard conditions for 24 hours NOTE It is important to accurately record the original of cells at Time of Transduction as this is critical in titer calculation For adherent cells other than HEK293 choose a different of cells at time of transduction depending on cell size As a rule of thumb cells should be transduced at such a density such that they would become confluent in 48 hours tech cellecta com 19 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual Day 2 3 Between 16h 24 hours post transduction replace media with fre
31. rated provirus After transduction the ideal is to never discard any cells at any time during the experiment e g at treatment harvesting DNA purification etc However this is often not practical especially for a negative screen where most of the cells propagate normally If the number of cells becomes too large and you are forced to discard a fraction the number of remaining tech Qcellecta com 13 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual cells should always exceed the complexity of the library by at least 1 000 fold e g keep at least 27 million cells after every splitting step for a 27K library Similarly when amplifying barcodes from isolated DNA you should always use all the genomic DNA recovered from cell samples up to the amount corresponding to 1000X cells the library size C 3 3 Baseline Controls for Negative Screens In a simple screen aimed at identifying shRNAs which are cytotoxic in a given cell line we typically use the library itself as the baseline control since the shRNA frequency distribution in plasmid and packaged lentiviral library is virtually identical The plasmid library has already been sequenced as part of the QC when we made the library so it is not necessary to re sequence the library at this point If you would also like to use transduced cells as a baseline control typically we recommend harvesting and sequencing genomic DNA from them by about
32. ries of this complexity this number of unique shRNA sequences can produce technical challenges with some types of screens C 1 1 Number of Starting Cells and Representation Pooled shRNA library screens require quantification of changes in the fraction of cells bearing each shRNA sequence in selected vs control cells or starting library A hit occurs when selected cells have significantly more or fewer cells bearing a particular shRNA sequence Whether one is looking at enrichment of shRNA sequences in the selected cell population vs control positive selection or depletion of shRNA sequenced in selected cell population vs control negative selection it is critical that the screens begin with sufficient numbers of cells tech Qcellecta com 8 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual expressing each shRNA to ensure measured changes in the fraction of cells bearing any given ShRNA sequence are statistically significant This means that if there are very low numbers of cells bearing specific shRNA sequences at the start of the screen small random changes in a drifting population may be difficult to differentiate from significant trends Simply put a loss of 2 cells is a 20 change if there are only 10 initially vs 2 if there are 100 For this reason a least a few hundred cells need to be infected with each shRNA to initiate a good screening This is demonstrated in the Reproducibilit
33. s of apoptosis N un dag Hybridization HT Sequencing C Library Complexity Maintaining Representation and Types of Screens Researchers are often interested in using a pooled shRNA library for genome wide RNAi screening to cast a very wide and unbiased net to identify any and all genes functionally involved in some pathway Although it is not difficult to make an shRNA library targeting all human or mouse genes it is difficult to comprehensively screen using such a library Careful consideration of starting cell numbers and handling of cells during propagation is essential to ensure thorough screening of pooled shRNA expression libraries minimize false negatives and obtain consistent and reproducible results C 1 Library Complexity and Number of Cells First there is an issue of library complexity since it is necessary to have several shRNAs designed to target each gene The effectiveness of validated shRNA varies from cell to cell For these reasons it is necessary to incorporate several shRNAs for each gene to ensure reasonable knockdown of a high percentage of targets Cellecta typically designs 5 10 shRNAs against each target gene depending on the design of the library so at least 25 000 shRNAs are required to target 2 500 5 000 genes A library targeting the entire human genome of approximately 20 000 genes requires approximately 115 000 individual shRNA constructs While it is not particularly difficult to construct libra
34. sh D MEM supplemented with 10 FBS and without Polybrene Return cells to CO2 incubator and grow under standard conditions for additional 48 hours Avoid confluence trypsinize and re plate cells if needed Day 4 72 hours after transduction 4 Detach cells from the plate by trypsin treatment block trypsin with FBS media centrifuge resuspend in 1X D PBS and determine the of transduced RFP positive cells by flow cytometry NOTE Attempting to determine the of transduced cells by fluorescence microscopy is NOT RECOMMENDED IMPORTANT Flow cytometry settings to detect RFP positive cells are the following Excitation 561nm 530nm laser is still acceptable Emission 600 20 band pass filter or similar for TagRFP 5 Proceed to Lentiviral Titer estimation RFP assay F 1 2 Alternative Transduction Protocol Spinoculation for Suspension Cells The following protocol has been optimized for K 562 cells For other cell types parameters such as media growth surface time of detection etc will have to be adjusted 1 K 562 cells are transduced infected using spinoculation This is performed using multi well tissue culture plates and a tabletop centrifuge capable of 1 200 x g and centrifugation of multi well plates 2 Grow K 562 cells and maintain them between 2 x 10 and 1 x 108 cells ml Do not let them become too dense or let the medium become yellow at any point 3 For lentiviral library titration K 562 cells are r
35. should not be used Problem Virus containing conditioned media is toxic to target cells Solution Concentrate the virus using Lentifuge reagent Cellecta according to the protocol and resuspend the virus in target cell growth media PBS 10 FBS or PBS 1 BSA Consider order custom viral packaging service of low toxicity viral stock from Cellecta No Expression of RFP or Puro or shRNAs in Target Cells Problem The promoter is not functional in target cells Solutions e Change the target cells e Contact Cellecta at tech Qcellecta com to have the library cloned in another vector with different promoter Technical Support If you run into any problems or questions in setting up your RNAi screen our team is happy to advise you To ensure that we can provide the best information we prefer that you email us rather than call when possible and provide us with the following details Please email technical support at tech cellecta com with the answers to the questions below if applicable Library Used Which library did you use and which Module s What are the lot numbers Packaging the Library What was the lentiviral titer and what was the total number of TU packaged How was the virus concentrated if applicable Transducing Target Cells What MOI did you use to transduce your target cells What target cells did you use How many replicates did you use i e duplicate triplicate etc Did you use puro
36. taining heterogeneous mixtures of shRNA constructs allow you to assay the effects of many thousands of pooled shRNA expressing constructs in one experiment Although Cellecta s shRNA screening libraries are generated using standard proven genetic library construction techniques there are a number of technical challenges to produce quality shRNA expression libraries B 1 Synthesis of the Oligos For large scale production of heterogeneous populations of designed oligonucleotides for complex libraries Cellecta has partnered with Agilent Technologies Agilent s microarray based oligonucleotide synthesis platform provides full length oligonucleotides over 100 bases in length with minimal mutations Additionally the solid support synthesis minimizes bias by providing similar levels of each individual species B 2 Cloning of the Oligos into Lentiviral Vectors To provide efficient delivery of complex shRNA libraries into different cell types for a variety of experimental designs we have developed HIV based lentiviral shRNA cloning vectors with H1 or U6 tet regulated or constitutive promoters for expression of shRNA and a choice of a single or dual selection marker GFP RFP PuroR BleoR etc expressed from a single CMV EF1 PGK UbiC or other promoter Cellecta s HIV based lentiviral vectors can be packaged as VSV g pseudotyped viral particles and have a broad range of tropisms for efficient transduction in a wide variety of cells using either
37. th a redundant shRNA library challenging The lower the MOI the more cells you need to start the screen so it is tempting to use a high MOI However you should consider that a higher MOI produces a higher percentage of infected cells bearing two or more different shRNA constructs For most RNAi screens we tech cellecta com 9 of 28 vi 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual recommend optimizing conditions and performing genetic screen transductions at no more than 0 5 MOI ca 40 transduction efficiency which balances these two considerations Please note that to accurately calculate the MOI it is critical to determine the library titer directly in your target cells prior to beginning your experiment Once conditions are established to achieve 40 transduction efficiency in the titering assay scale up all conditions proportionately to accommodate the larger amount of transduced cells needed for the genetic screen C 1 3 Representation and Cell Propagation Techniques Finally to ensure a comprehensive screen it is not simply sufficient to start with the right amount of cells During the screening process incorrect propagation of the cells can completely undercut the representation set up at the initiation of the screen This is especially true for a negative selection screen such as a viability screen where one is interested in identifying shRNA that kill or inhibit proliferation of cells an
38. the time of transduction should exceed the complexity of the shRNA library by at least 200 fold For a library with 27 500 shRNAs the starting population should be at least 5 5 million infected cells and for a library with 55 000 shRNAs the starting population should be at least 11 million infected cells C 2 3 Maintenance of the Cells A positive selection screen often involves the comparison of two types of samples selected and unselected control samples After transduction and before selection it is best practice not to discard any cells However this is often not practical If cells have to be discarded or split before selection the number of remaining cells in each sample should always exceed the complexity of the library by at least 1 000 fold e g keep at least 2 7 x 10 cells after every splitting step for a 27K library After the selection step all the cells in the selected samples should be collected for genomic DNA purification and barcode PCR amplification For the control samples follow the above mentioned 1 000 fold rule in the sense that you should collect enough cells to equal 1 000 fold the complexity of the library Similarly when amplifying barcodes from isolated DNA you should always use all the genomic DNA recovered from cell samples up to the amount corresponding to 1000X cells the library size For diploid cells 25 30 million cells 150 180 ug of genomic DNA C 2 4 Baseline Controls for Positive Selection S
39. tostatic presumably by interfering with an essential target gene Cells with shRNAs that do not inhibit growth then grow normally populating the culture in which the cells with the lethal shRNA do not propagate The endpoint analysis involves looking for shRNA sequences that are underrepresented or depleted in the sample population relative to the original library C 3 1 Length of the Screen For a dropout viability screen to work the cells need to be cultured long enough for the cells with unaffected growth to significantly increase their proportion relative to the affected cells For this to occur the cells need enough time in culture for multiple doublings The length of any particular screen may need to be altered depending on the specifics e g cell growth rates types of targets of interest if additional compounds are used However typically we find allowing for 10 population doublings after transduction to be optimal If the screen is not run long enough all the shRNA counts will be in a narrow range and it will be difficult to identify significantly depleted shRNA sequences from background variability If the screen is run too long the range of representation of shRNA sequences will become broader due to the natural growth variance in different cells in the population This phenomena often referred to as genetic drift will increase the background variance of the screen and if the spread becomes too broad can also make it diffic
40. ult to identify significantly depleted shRNAs from background variability For optimal results it is important to run the screen long enough that shRNAs that have an effect on cell growth viability will be distinct from background variance but not to the point where background variance becomes large enough to confound the ability to call hits For a negative selection screen the puromycin or other antibiotic selection it is not essential but provides a way to reduce the total number of cells and makes cell culture handling more manageable In a typical screen about 30 40 cells are transduced the remaining 60 70 of cells without virus are not needed Unless you want to maintain a larger than needed cell population throughout the screen it makes sense to perform antibiotic selection to get rid of unwanted cells C 3 2 MOI of Transduction Number of Cells to Transduce Culture and Collect Amount of DNA to Use for Barcode Amplification As mentioned above the number of cells stably transduced with the shRNA library at the time of transduction should exceed the complexity of the shRNA library by at least 200 fold For a library with 27 500 shRNAs the starting population should be at least 5 5 million infected cells and for a library with 55 000 shRNAs the starting population should be at least 11 million infected cells The MOI of transduction should be kept at or below 0 5 to ensure that the majority of transduced cells carry only one integ
41. xpress a single gene specific shRNA On completion of the screen cells exhibiting the desired phenotypic changes are isolated and the shRNA constructs presumably inducing the phenotypes are recovered by PCR and identified by HT sequencing of shRNA specific barcodes Major advantages of VSV g pseudotyped lentivectors for shRNA library delivery are e Broad spectrum transduction tropism allowing efficient transduction of non transfectable cell types and tissues e Long term silencing of target genes presenting the possibility of screening functions senescence differentiation growth in soft agar etc that require weeks rather than days in vitro or ex vivo Genetic screens using pooled shRNA libraries have the requirement for recipient cells with desired phenotypic changes to be selected from a pool of unaffected cells Selection may be based on cell survival appearance of specific markers induction of reporter constructs changes in cell morphology or behavior etc The design of a selection strategy is the most critical arm of any genetic screen project Repeated rounds of selection may be necessary for either secondary validation or to reduce the number of false positives thereby increasing the percentage of positive hits tech cellecta com 4 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Manual B Design and Quality Control of Cellecta s shRNA Libraries Pooled lentiviral based libraries con
42. y of Triplicate figure below where starting with a smaller population of just 50 cells per shRNA third bar leads to significantly more variation than starting with a population of 200 cells per shRNA first bar To ensure adequate representation of the whole library in the initial population start a screen by infecting at least 200 times more cells than the complexity of the library For a library with 25 000 shRNAs the starting population should be at least 5 million infected cells and for a library with 55 000 shRNAs the starting population should be at least 11 million infected cells Reproducibility of Triplicates Viability Screen 1 0 95 0 9 0 8 0 7 0 64 0 6 0 5 0 4 0 3 0 2 0 1 0 88 Replicate Correlation 200 1000 200 200 50 no splitting cells shRNA at infection at splitting C 1 2 Multiplicity of Infection For pooled shRNA screens it is important to have 2 3 times more cells than infecting viral particles i e a multiplicity of infection MOI of 0 3 0 5 to ensure that the majority of cells are only infected with one shRNA carrying virus so you need to have 2 3 times more cells than the number targeted for infection Thus 6 8 million cells are needed to start a screen with libraries of 25 000 shRNAs and a whole genome library of 150 000 shRNAs would require 60 90 million cells Since each screen should be done in duplicate or better triplicate the number of cells needed makes a full genome screen wi
43. y protocols These suggestions will help you to get the most reliable data from your screen in the shortest amount of time It is important to do the following pilot studies in the model cell system that you will use for the pooled library screen as the results may be cell type specific D 1 Doubling Time The doubling time is the time it takes your cells to double in number It is useful to know the doubling time of your cells so that you can plate the appropriate number for transduction with the lentiviral library Start with cells that have already been growing for a few weeks rather than using cells that have just been thawed from a frozen state To calculate the doubling time trypsinize your cells as if you were going to split them Count them using a hemacytometer or cell counter and keep track of the number that you replate onto the cell culture plates The starting number of cells is Xb Propagate the cells as you normally do replacing media as necessary The next time they are ready to be split trypsinize them as usual and count them again using a hemacytometer or cell counter The number of cells at the end is referred to as Xe The cells should be in the log phase of growth to calculate doubling time properly so it is important to not let the cells become confluent To calculate the doubling time use the following formula tech cellecta com 15 of 28 v1 10 22 14 Cellecta Pooled Library Screening www cellecta com Reference Ma
Download Pdf Manuals
Related Search