Home

BioMate 5 USER MANUAL

1. ccccccceceeeceeeeecceeceeeeeeeseeneneeeeeeeeees 10 BIOMATE APPLICATIONS Nucleic Acid measurements c cccececeeseceeceeeeeeeeeeeees 11 DNA measurement 0 ccceceeeeeeeecceeceeeceeeeeeeeneeeeeeeeeeeeteees 12 DNA measurement With scan cccceeeeeeeceeeeeteetteeeeees 13 Direct UV measurement 2 cccceceeeeeeeeeeeteeeeeeeeeeteees 16 Oligonucleotide measurement calculated factor 18 Protein measurement eseeeeececeeeeeeeeeeneeeeeeeeeteteteees 20 Direct UV 280 205 mosse anana aeaaeae iian 23 Warburg Christiane ii e ERE RT 24 Cell growth measurements cc ceceeeeeteeeeeetteeeeeetteeeeeeeaaes 25 Oligo calculator functions seseeeeeeeeeeeeeeeeerreeseerrssrerresne 26 SCAN Scan Meth disi dresar a nr aata 27 Manipulate aaseter ia n a r 32 FIXED Fixed Method ne ccteceivecei seh aaesieeiteeeciinedeietere aries cede 36 Fixed RESUINS 2 008 Nec net eee a saat 39 QUANT Quant Method on ea Pea F 40 Standards Eniya iere a E 42 Quant Calibration rissaa ia 43 Quant Standards cecid patie esa aaaea aaae e aesaat 44 QUANT RESUNS eee atteis a a a aiia at 45 RATE Rate Meth d nesnese naaa aaa 46 Rate Grapes aaa a a e ai 48 Manipulate tai ent osne aaan aaaea a aaa a 49 Rate R sultS rhis aa a a a 52 BioMate 5 Issue 1 English CONTENTS MCA MCA Method 2 2 21 sesstdeenitlestatesnett cdi a retai 53 Standards Entty 2 2 28 ees aue
2. Q Press EDIT CURVE on the STANDARDS RESULTS screen Q Use the arrow keys to highlight the curve fit you want to use for the standard curve and press ENTER The instrument applies the selected curve fit to the data and displays the new calibration equation and coefficient BioMate 5 Issue 1 English 21 BIOMATE APPLICATIONS Running protein measurements Q Q Place the blank in the correct cell position With the appropriate protein parameter screen displayed press ZERO BASE to measure the blank Place the unknown in the correct cell position Press RUN The protein measurement screen appears and the measurement starts When the instrument is finished measuring the absorbance of the sample it displays the ID absorbance and concentration on a screen like the one shown below Note Ifall the results do not fit on a single screen press the Down Up arrow keys to display 22 the next previous pages of results TEST NAME BRADFORD STD ID ABS CONC 260 0nm ug ml 999 0 121 123 45 1 0 234 2345 6 2 0 345 345678 PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS English BioMate 5 Issue 1 BIOMATE APPLICATIONS Direct UV 280 205 The Direct UV method determines protein concentration based on absorbance at either 280 or 205nm Note The following screens show the parameters for the Direct UV test at 280nm For the Direct UV test at 205nm the Wavelength is set to 205nm Test pa
3. The instrument has been put into remote control without allowing it to initialise first The display will return next time that the instrument is switched on An unsuccessful attempt has been made to update the software Connect the instrument to a PC and repeat the software upgrade process Any performance problem Failure to initialise or error 1053 No light can be seen from the ventilation slots in the lamphouse cover The tungsten lamp has failed fit a new lamp A small number of tungsten lamps do fail very rapidly If this happens fit a new lamp and contact your agent for a free replacement It is likely that the spare lamp shipped with the instrument will be from the same batch as the one in the instrument Lamp energy low Error 1053 Drift at visible wavelengths Instrument noisy in the visible region Check the tungsten lamp is correctly fitted and in good condition The envelope should not show any signs of blackening or opacity If in doubt replace with a new one A small number of tungsten lamps do rapidly degrade If this happens fit a new lamp and contact your agent for a free replacement BioMate 5 Issue 1 English 89 FAULT FINDING Lamp energy low Error 1053 Noisy signal Cell changer partially blocking the beam If the carousel is fitted after using another cell holder go to the Cell Changer page and key Initialise Make sure the carousel
4. units T units G units C Tm 2 A T 4 G C C Oligos up to 40 mers in length Calculation of Tm i units A units T units G units Tm G DNA DNA hybrids 81 5 16 6log10 M 1 0 7 M 0 4 7 molarity of Na 1 GC 500 L P 0 AT E GC percentage of G and C form formamide in the solution L of base pairs P mismatched Calculation of Tm units A units T units G units Tm C DNA RNA hybrids C 67 16 6log10 M 1 0 7 M 0 8 M molarity of Na GC 500 L P 0 5 form GC percentage of G and C form formamide in the solution L of base pairs P mismatched Calculation of Tm units A units T units G units Tm C RNA RNA hybrids C 78 16 6log10 M 1 0 7 M 0 7 M molarity of Na GC 500 L P 0 35 form GC percentage of G and C form formamide in the solution L of base pairs P mismatched 98 English BioMate 5 Issue 1
5. will be displayed FUNCTION KEY Q Repeat this process for a number of cycles up to a maximum of 10 then press ENTER Q Measure the total volume taken from the measuring cylinder and enter this The calibration SIPPER PAGE Returns to the SIPPER page and abandons the calibration SIPPER CALIBRATION Page SIPPER CALIBRATION Q This page displays the current sipper 25 10 96 16 47 calibration NOMINAL VOL 1 000 ml Bs tae NO SIPS DONE 5 Q To alter the calibration press CALIBRATE TOTAL VOL SIPPED 5 100 ml TUBING CAL 1 020 FUNCTION KEYS SIPPER PAGE Returns to the SIPPER page CALIBRATE Starts the calibration procedure 76 English BioMate 5 Issue 1 MINISIPPER MINISIPPER The MiniSipper is an optional accessory that enables samples to be drawn into a flowcell of the user s choice for automatic measurement After the measurement is complete the sample is sent to Waste A continuous pumping mode allows the system to be washed through when required e g between applications This section describes the operation of the MiniSipper with the Local Control software Full details of the installation and operation of the accessory are described in the MiniSipper Installation and Maintenance Manual 9499 230 45111 supplied with the MiniSipper To operate the MiniSipper install as described in the above manual Present the sample to the MiniSipper and press the switch The required sample volume
6. CALIB PRINT SAVE STORED VIEW RATE TEST TEST TESTS RESULTS Preparing and running a standard curve Q With the appropriate protein parameter screen displayed select STANDARDS and press ENTER The STANDARDS screen appears Q Edit any changed concentration values and then ACCEPT the changes Q When all the parameters are correct press CALIBRATE Q Place the standards and blank if required in the correct cell positions as prompted and then follow the on screen instructions to start the calibration Q When the instrument has measured all the standards the CALIBRATION screen will show the absorbance of each standard along with the equation of the calculated standard curve 20 English BioMate 5 Issue 1 BIOMATE APPLICATIONS Editing standard curves You may remeasure any standard on a standard curve In addition you may select a different curve fit or delete points from the curve To edit a standard Q Press STANDARDS on the CALIBRATION screen Q Press EDIT STD on the STANDARDS RESULTS screen Q Select the standard which is to edited by entering its number in the Edit box displayed Q You may now remove the standard from the calibration restore a previously ignored value or remeasure the standard s absorbance Use the Up Down arrows to select the required option and then follow the on screen instructions To select a different curve fit for a standard curve Q Press STANDARDS on the CALIBRATION screen
7. Select from ABS T CONC ABS Selects Absorbance T Selects transmittance CONC Selects Concentration mode Only available when SINGLE is selected and not available if UVCalc is installed Q CONC allows the result to be automatically multiplied by a factor to give concentration measurements If selected two further parameters are added to the method FACTOR and UNITS TEST NAME Enter a description using the TEXT ENTRY screen The Test Name identifies the method and will be saved with the method and any results produced by the method SELECT i Select from SINGLE MULTI SERIAL 2 SINGLE 4 This option is used to measure each sample at a single wavelength which is the same for each sample MULTI This option allows each sample to be measured at up to 20 wavelengths which are the same for each sample SERIAL i This option allows a single wavelength measurement to be made ata different wavelength on up to 9 samples 36 English BioMate 5 Issue 1 FIXED WAVELENGTH S SINGLE 1 Use the numeric key pad to enter the required wavelength into the pop up box Press ENTER when finished MULTI A Use the up and down arrow keys to move to the wavelength to be entered or edited and press ENTER to display the edit box Use the numeric keypad to enter the wavelength and press ENTER when finished The instrument returns to the MULTI screen with the next wavelength in the list highlighted Up to 20 wavelengths may be entere
8. sipper calibrations and CVU tests noting date time and user The file will also contain records of operations carried out by engineers during maintenance visits When HISTORY FILE is set to ON the HISTORY FILE function key becomes available on the Environment Page unless USER LOG ON is enabled and the user has been denied access by the Administrator Pressing this function key brings up the History File Pop up box SAVE HISTORY ON DISK The user is prompted for a file name and the instrument history is saved in CSV format which may be read by a suitable spreadsheet or text editor HISTORY FILE SAVE HISTORY ON DISK l CLEAR HISTORY CLEAR HISTORY Clears the Instrument History PRINT HISTORY PRINT HISTORY The Instrument History is printed out Make sure the printer is connected and ready before selecting PRINT HISTORY The History File contains a maximum of 400 entries When the number of entries reaches 390 a warning message is displayed and it is necessary for the Administrator or a user with the History File privilege save to disk and or print the existing history file then clear the history file to make room for more entries ENVIRONMENT Fl lolojo HISTORY FILE Appears when History File is enabled CHANGE USERS Available only to Administrator when User Log on enabled UVCALC OFF Only appears when UVCalc has been installed Disables UVCalc and re enables functions that UVCalc disables SETUP PAGE R
9. BioMate 5 Issue 1 English 13 BIOMATE APPLICATIONS DNA measurement with scan The DNA measurement with scan group includes two tests that function almost identically the only difference is in the wavelengths used for the measurements One test measures absorbance between 260 and 280nm while the other measures absorbance between 260 and 230nm Test parameters Note The following screens show the parameters for the DNA with scan 260 280 test For the DNA with scan 260 230 test Wavelength 2 is set to 230nm DNA WITH SCAN TEST NAME DNA WITH SCAN WAVELENGTH 1 260 0nm WAVELENGTH 2 280 0nm REF WAVELENGTH CORRECTION ON REF WAVELENGTH 320nm DNA FACTOR 11 62 90 DNA FACTOR 12 36 00 DISPLAY PROTEIN YES PROTEIN FACTOR 11 757 3 PROTEIN FACTOR 2 1552 DILUTION MULTIPLIER 1 00 UNITS ug ml SAMPLE POSITIONER AUTO 6 REF NUMBER OF SAMPLES 1 ID 0 OFF o AUTOPRINT OFF SETUP PRINT SAVE STORED VIEW SCAN TEST TEST TESTS RESULTS 14 English BioMate 5 Issue 1 BIOMATE APPLICATIONS Running DNA measurement with scan Q With the appropriate DNA parameter screen displayed select the required Sample Positioner mode number of samples if appropriate and initial sample number ID Q Place the blank in the correct cell position Q Press ZERO BASE to measure the blank Q Place the unknown s in the correct cell position s Q Press RUN to start the measurement The DNA measurement screen
10. BioMate 5 Issue 1 English 57 MCA CALIBRATION When the Standard Identifications and concentrations have been entered via the STANDARDS ENTRY page and the wavelengths have been entered via the WAVELENGTH ENTRY page the MCA application is ready for calibration Clear the beam s and press ZERO BASE to perform a baseline scan Press the CALIBRATE function key from the MCA METHODS page If any results are present you will be given the option to proceed or cancel with PROCEED highlighted All previous data will be lost if PROCEED is selected Press ENTER to proceed and then follow the on screen prompts Results for each standard will be stored in the Calibration Results Table with results for each standard on a new page Use the up and down arrow keys to move between standards When the last calibration has been done put the first sample to be analysed in the beam and press RUN ANALYSING A SAMPLE When a calibration has been performed or loaded with the method the MCA application is ready to use When RUN is pressed from the METHOD or RESULTS pages the instrument will measure the absorbance of the sample at each of the wavelengths specified in the method and compare with the absorbances of the standards at these wavelengths The concentrations of each component are calculated and displayed on the results page Results for each sample are displayed on a new page Use the up and down arrow keys to move through the pages of results
11. DELETE Removes the highlighted file from the Disk DISK VIEW LIBRARY Switches to the LIBRARY page READ DISK Reads the disk and refreshes the directory listing FORMAT DISK Formats the disk as a 1 44 Mb disk THIS WILL DELETE ALL THE FILES ON THE DISK PRINT DIR Prints the list of files on the disk COPY ALL Copies all method files from the Disk to the Library ENSURE THAT THE DISK CONTAINS ONLY VALID DATA OR METHOD FILES BioMate 5 Issue 1 English 61 SETUP Overview of Setup Options SETUP Q This section describes how to set up the instrument Q The main system setup options are available directly from the SETUP function key on the BIOMATE TESTS or GENERAL TESTS pages SETUP Page Q From the SETUP page move the cursor to the required option using the Up Down Arrow keys Select the option by pressing the ENTER key SETUP CLOCK PRINTER ENVIRONMENT WAVELENGTH INITIALISE WHITE LIGHT cvc RECORDER CLOCK Page CLOCK TIME HOURS 16 MINS 32 DATE DAY 25 MONTH 12 YEAR 96 62 CLOCK PRINTER ENVIRONMENT WAVELENGTH INITIALISE WHITE LIGHT CVC RECORDER be reset Switches to the CLOCK page Switches to the PRINTER page Switches to the ENVIRONMENT page Switches to the WAVELENGTH CALIBRATION page Switches to the OPTICAL INITIALISATION page Switches to the WHITE LIGHT Page Switches to the
12. HOURS 987 ENERGY 99 D2 STRIKING HOURS 234 ENERGY 96 RESET W HRS Resets hours and measures energy at the appropriate wavelength ALLOW THE LAMP AT LEAST 10 MINUTES TO WARM UP BEFORE RESETTING ITS HOURS RESET D2 HRS Resets hours and measures energy at the appropriate wavelength ALLOW THE LAMP AT LEAST 10 MINUTES TO WARM UP BEFORE RESETTING ITS HOURS W ENERGY ALLOW THE LAMP AT LEAST 10 MINUTES TO WARM UP BEFORE MEASURING ITS ENERGY CLEAR BOTH SAMPLE AND REFERENCE BEAMS BEFORE MEASURING LAMP ENERGIES W ENERGY ALLOW THE LAMP AT LEAST 10 MINUTES TO WARM UP BEFORE MEASURING ITS ENERGY CLEAR BOTH SAMPLE AND REFERENCE BEAMS BEFORE MEASURING LAMP ENERGIES SWITCH D2 Turns the Deuterium lamp ON or OFF depending on its current status BioMate 5 Issue 1 English 71 7 CELL CHANGER 7 CELL CHANGER Q The 7 Cell Changer is fitted as standard and enables up to seven samples to be presented for measurement sequentially This section describes the operation of the accessory with the software and also describes its removal refit When the 7 Cell Changer is installed then a status box appears on the top right hand side of the screen to the left of the Absorbance Wavelength box indicating the the presence of the accessory and its setting If this status box is displayed then the 7 Cell Changer can be moved manually using the lt gt arrow keys To step foward backward many positions repeated pressin
13. Purity 260 280 with Stop wavelength 330nm SCAN Absorbance Difference Absorbance Ratio Scan Dilution Factor Dy A 260nm DNA ug ml diluent vol sample vol A 280nm Protein ug ml sample volume Aver 320nm DNA concentration optional A Andfi Ao And amp Dr f 62 9 Protein concentration f 36 0 Ao AndG Ai AndE Dr 1552 Ratio Aj Aver fy 757 3 Ad Aref dil vol 0 smp vo 0 DNA Protein concentration and Scan Absorbance None Start wavelength 230nm None DNA Purity 260 230 with Stop wavelength 330nm SCAN Absorbance Difference Absorbance Ratio Scan Dilution Factor Dy A 260nm DNA ug ml diluent vol sample vol A gt 230nm Protein ug ml sample volume Aref 320nm DNA concentration optional Ai ArDfi A2 Aedh De f 49 1 Protein concentration f 3 48 KA Ardh A1 Aedh De f 183 Ratio Aj Aver fy 75 8 Ad Aref dil vol 0 smp vol 0 Direct UV dsDNA 260nm Factorasowa 50 Direct UV ssDNA or RNA 260nm Factorspna orssewa 40_ ig ml Direct UV oligos w base Factor calculator Direc UV oligos ae aia hag ae Bicinchoninic Acid BCA Standard Curve standard Bicinchoninic Acid BCA micro sical Direct UV 205 Factor Warburg Christian Absorbance difference Conc F x A260 260nm ug ml F factor calculated by Oligo Calculator Cone Fx Axa re Second order 595nm 100 1000
14. Regardless of where the Cell Changer is positioned when you press ZERO BASE the Cell Changer automatically moves to position 1 After the blank measurement it returns to its original position Up to 7 measurements may be made without changing the samples in the Cell Changer by using the left and right arrow keys to advance the Cell Changer to the next position Appears when the 7 Cell Changer is fitted and an automatic operating mode has been selected Valid range 1 999 FIXED Method Page Function Keys FIXED 38 VIEW RESULTS Switches to the FIXED RESULTS page SAVE METHOD Brings up the SAVE page from where the method can be saved to Disk PRINT METHOD Prints the current method parameters on the printer Q Pressing RUN starts a fixed measurement using the current method and switches to the FIXED RESULTS page Q Pressing ZERO starts a zero using the current method See page 7 English BioMate 5 Issue 1 FIXED Any changes to the WAVELENGTH BANDWIDTH INTEGRATION or LAMP CHANGE parameters will invalidate the current results If AUTOPRINTING is selected see SETUP for details a change to the MODE parameter will invalidate the current results FIXED RESULTS Page Q The layout of the page depends on the Mode and Select in use SINGLE 2 In ABS or T modes up to 2 columns of results are displayed per page In CONC mode a single column of results is displayed on each page Results accumul
15. appears When the instrument is finished measuring the absorbance scan it displays a graph of the scan along with the sample ID DNA ratio DNA concentration and protein concentration on a screen like the one shown below BioMate 5 Issue 1 DNA WITH SCAN Graph of scan With data at 260nm 280nm and 320nm if Ref wl On marked ID DNA RATIO DNA PROTEIN 99 1 7 254 6ug ml 18 1ug ml RESCALE PRINT SAVE TEST CLEAR ALL DATA PAGE RESULTS English 15 BIOMATE APPLICATIONS Direct UV measurements This group of tests includes Q dsDNA measurements Q ssDNA and RNA measurements Q Oligonucleotide measurements using an entered factor These test measurements are set up and run using the same types of test parameters Test parameters Note The following screens show the parameters for the Direct UV measurement of dsDNA test For the Direct UV measurement of ssDNA and RNA tests the parameters are the same but the factor used to convert absorbance to concentration is 40 For the Direct UV measurement of oligonucleotides tests the parameters are also the same but the factor used to convert absorbance to concentration is 33 dsDNA TEST NAME WAVELENGTH FACTOR DILUTION MULTIPLIER UNITS SAMPLE POSITIONER NUMBER OF SAMPLES dsDNA 260 0nm 50 00 1 00 ug ml AUTO 6 REF 1 LOW HIGH LIMITS 9999 9999 STATISTICS OFF ID 0 OFF o
16. calculator application Several of these categories include multiple tests that are similar so the individual sections do not include screen shots for each test For example the parameters are the same for the Direct UV measurement of dsDNA and RNA tests but the factor used to convert absorbance to concentration is different Similarly for the Direct UV measurement of oligonucleotides tests the parameters are also the same but the factors used to convert absorbance to concentration are different For a complete list of all parameters and calculations for each test refer to the appendices BioMate 5 Issue 1 English 11 DNA measurement BIOMATE APPLICATIONS The DNA measurement group includes two tests that function almost identically the only difference is in the wavelengths used for the measurements One test measures absorbance at 260 and 280nm while the other Test parameters measures absorbance at 260 and 230nm To set test parameters move the cursor to the appropriate parameter and press ENTER Note The following screens show the parameters for the DNA 260 280 test For the DNA 260 230 test Wavelength 2 is set to 230nm DNA TEST NAME DNA 260 280 WAVELENGTH 1 260 0nm WAVELENGTH 2 280 0nm REF WAVELENGTH CORRECTION ON REF WAVELENGTH 320nm DNA FACTOR 11 62 90 DNA FACTOR 12 36 00 DISPLAY PROTEIN ON PROTEIN FACTOR 11 757 3 PROTEIN FACTOR 2 1552 DILUTION MULTIPLIER 1 00 UNITS
17. categories Nucleic acid measurements Protein measurements Cell growth analysis O oO vo O Oligonucleotide calculations These tests are accessed from the BioMate Tests page which is the default Home Page I BIOMATE TESTS NUCLEIC ACID TESTS PROTEIN TESTS CELL GROWTH OLIGO CALCULATOR INSTRUMENT HOURS 1245 SETUP DATA GENERAL STORED REMOTE STORE TESTS TESTS In addition BioMate 5 also provides a range of more general operating modes Scan Fixed Quantification Rate MCA Multi Component Analysis Oooo o These applications are accessed via the GENERAL TESTS function key on the default BioMate Tests page BioMate 5 Issue 1 English 9 GENERAL GENERAL TESTS SCAN FIXED QUANT RATE MCA INSTRUMENT HOURS 1245 SETUP CAL VAL ACCESS LAMPS REMOTE ORIES SmartStart feature Q BioMate s SmartStart feature enables you to select the test methods you use most frequently and have them appear when you start up your instrument Setting up SmartStart Q Press the STORED TESTS function key on the BIOMATE TESTS page A list of all the tests on the instrument appears on the screen Q Move the cursor to the required tests and press the SMART START function key A tick will appear at the left of each selected test This set of tests will now be listed on the new Home page Q Toremove any of these tests from the Smar
18. highest gradation to the sipper NO SIPS DONE 5 uptake tube and press the switch The sipper will pump a sample and the spectrophotometer will issue a beep Withdraw the measuring cylinder and the sipper will pump the air gap The values used for sample volume and air gap are those set on the SIPPER page Q Repeat this process for a number of cycles up to a maximum of 10 then press ENTER Q Measure the total volume taken from the measuring cylinder and enter this The calibration will be displayed FUNCTION KEY SIPPER PAGE Returns to the SIPPER page and abandons the calibration 78 English BioMate 5 Issue 1 MINISIPPER SIPPER CALIBRATION Page Q This page displays the current sipper SIPPER CALIBRATION calibration 25 08 99 16 47 Q To alter the calibration press CALIBRATE NOMINAL VOL 1 000 ml NO SIPS DONE amp TOTAL VOL SIPPED 5 100 ml TUBING CAL 1 020 FUNCTION KEYS SIPPER PAGE Returns to the SIPPER page CALIBRATE Starts the calibration procedure BioMate 5 Issue 1 English 79 CVC CALIBRATION VALIDATION CAROUSEL CVC Q The Calibration Validation Carousel replaces the standard cell basket and allows for the automatic checking of the spectrophotometer to specification by measurement of the fundamental operating parameters THE PROCESS OF CALIBRATION OF ITS WAVELENGTH AND ABSORBANCE FILTERS IS ACCREDITED BY THE UNITED KINGDOM ACCREDITATION SERVICE UKAS TO AN ISO IE
19. lamp energies From each Test Page the following functions are available FUNCTION KEYS TEST PAGE Returns to the TEST HOME page SAVE RESULTS Goes to the SAVE page from where the results can be saved to Disk PRINT RESULT Prints the result of the test STOP Stops a test Only present whilst a test is running If STOP is pressed then any results obtained from a test up to that point are discarded CVC REMOVAL AND REFIT REMOVAL Q Holding the basket firmly with one hand unscrew the central screw anti clockwise until the carousel is released Q Replace the CVC as soon as convenient in its protective storage box Q REPLACE THE COVER ON THE OPTOSENSOR unless the 7 Cell Changer is to be fitted REFIT Q Remove the cover from the optosensor Q Identify the position of the keyway on the motor shaft Q View the underside of the basket to locate the position of the moulded key 82 English BioMate 5 Issue 1 CVC Q Re locate the basket on the shaft ensuring a positive location of the key in the keyway and tightened the central screw clockwise Q From the CVC page use the INITIALISE function key to correctly identify the carousel with the spectrophotometer This last action is important to ensure the correct operation of the system Whilst the spectrophotometer will check for data to carousel match on running any test an initial confirmation is recommended BioMate 5 Issue 1 English 83 INTER
20. lists the available tests and for each test reports the time and date on which the last test was run and whether it passed or failed Q To perform a test highlight the required option s either individually using the Arrow keys or as a group using the appropriate function keys and press RUN The instrument and lamp hours and lamp energies are calculated and displayed on the appropriate page as each test is run FUNCTION KEYS SAVE RESULTS Goes to the SAVE page from where the current set of results can be saved to Library or Disk Files are saved with a TST extension PRINT SUMMARY Prints the summary of results as shown on the page BioMate 5 Issue 1 English 81 CVC PRINT ALL Prints the summary of results as shown on the page and full details of the results of each of the tests TESTS 1 3 Selects the first three tests in the list These will be run in sequence when RUN is pressed ALL TESTS Selects all the tests in the list These will be run in sequence when RUN is pressed Every time a test is run the carousel serial number is read and recorded on the results If this does not match the Calibration Data then the error E3083 Serial Numbers do not match is reported RESULTS Pages Q Each results page fully details the test performed the actual and measured values the differences tolerances etc as appropriate the spectrophotometer and CVC serial numbers the instrument hours lamp hours and
21. method and calibration M RATE Rate method D RATE Rate graphics data and method M MCA MCA method DMCA MCA results TEST NAME This is the description entered when the file was saved FILENAME This is the DOS compatible filename used by the instrument and a computer BioMate 5 Issue 1 English 59 DATA STORE LIBRARY VIEW DISK Switches to the DISK page COPY ALL Copies all files from Library to Disk FORMAT LIBRARY Clears all files from the library THIS WILL DELETE ALL THE FILES IN THE LIBRARY PRINT DIR Prints a list of all the files in the Library ALL FILES RESULTS ONLY Switches display between Methods Results and Results only Using the Library LIBRARY TYPE ID FILE NAME M QUANT UV123 AB123B QNT M FIXED DATAI FXD FXD D QUANT QNT D FIXED FXD LOAD M FIXED RENAME FXD SAVE TO DISK DELETE 76 LIBRARY SPACE REMAINING HIGHLIGHT FILE AND PRESS ENTER RESULTS PRINT FORMAT COPY VIEW ONLY DIR LIBRARY ALL DISK To perform an operation on a library file first select the file To do this move the cursor to highlight the required file using the Up Down Arrow keys If the file does not appear on the list the gt and lt arrow keys will scroll one page at a time down and up the list There is a slight delay after the key is pressed while the next section of the directory is loaded Once the required file is in the window move the cursor to it using the Up Down arr
22. point Access and perform system functions Operation depends on screen in use and is indicated by labels at bottom of screen Clears entry leaving field or parameter ready for new entry clears pop up and clears error messages Enters changes to field or parameter Starts instrument measurement according to current method Returns to Home page Performs a zero or baseline as appropriate to application REMOVE THE SAMPLE AND ENSURE THAT BOTH SAMPLE AND REFERENCE BEAMS ARE CLEAR OR CONTAIN THE BASELINE SAMPLES RELEVANT TO THE ANALYSIS BEFORE ZEROING THE INSTRUMENT OR PERFORMING A BASELINE SCAN English GENERAL Parameter entry The BioMate 5 has the following types of parameter entries Q Pop up editors are provided for entering numerical parameters The valid range for the parameter is displayed in the pop up window Enter a new value using the numeric keypad and then press ENTER to accept the change Press CLEAR to return to the previous screen without changing the parameter Toggle entries offer two options for a parameter Press ENTER to switch between the two options then press the up or down arrow key to move to another parameter Pop up lists show multiple options for a parameter or display messages Press the Up or Down Arrow key to highlight the required value then press ENTER to select it Graphical cursor selections are used in graphical displays The cursor appears as a vertical line Use the Arrow keys
23. sequence entered Warburg Christian 1 55 280 0 76 260 Numeric Identifier 1 0 OFF ID autoincrements during test until 1 999 reset or test is exited Integer Lowest amp highest acceptable 9999 9999 9999 Low High Limits results outside of which the result is flagged as Low or High Number of bases contained in empty not an entry NA Number of Bases sample Number of samples to be 1 1 999 Number of Samples measure in the whole test Integer Number of standards to be Bradford Lowry BCA Biuret 6 1 20 Number of Standards measured for calibration curve Integer Internal Reference wavelength DNA 320 190 1100 for each reported measurement measures analytical wavelength amp Ref Wavelength reference wavelength Reported measurement abs analytical WL abs Reference WL Turns internal zeroing on or off Off OnoOff Ref Wavelength Correction Sample Positioner Manual moved by buttons Auto 6 Ref auto moved Ref 2 3 4 5 6 7 Auto 7 auto moved 1 2 3 4 5 6 7 Auto 6 Ref if 7 Cell Changer fitted Not displayed if Single Cell Holder fitted Auto 7 Auto 6 Ref Manual 7 for 7 Cell Changer no choice for Single Cell Holder Total volume of sample 1 1 999 Sample Volume Integer Start wavelength for scan 225 0nm 190 0 1100 0 Scan Start Final wavelength for scan 325 0nm 190 0 1100 0 Scan Stop Concentration of standards used Bradford Std 0 200 400 600
24. software that allows you to write to and read from the computer s serial port The communications parameters are Baud rate 9600 Data bits 8 Stop bits 1 No parity Flow control off Local Echo on HyperTerminal You can also use HyperTerminal that comes with Windows 95 To establish a connection start HyperTerminal and select New Connection from the file menu In the dialogue that appears type in BioMate for the name and choose an icon Key OK In the next dialogue box select Direct to COM1 and key OK Fill in the COM 1 properties dialogue box as shown below COM1 Properties 9600 Then from the FILE menu select PROPERTIES and then click on the SETTINGS tab Fill in the dialogue box as shown below Click on OK BioMate 5 Issue 1 English 91 FAULT FINDING Helios Properties Connecting BioMate 5 to a PC 1 Use a null modem cable part number 4013 172 82111 to connect the RS232C port of BioMate 5 to a free COM port on the PC Here is the pin out data for the RS232 Cable Pin Pin 9 to 9 2 3 3 2 4 8 8 4 6 1 and 7 1 and 7 6 5 5 Earth Earth Switch on the PC and set up a terminal programme as described above Collecting Data Once you have established control of the instrument and switched on the debug software you will need to collect the data that is returned and save it to file This can be done by several methods the next section details one of them 92 English BioMate 5 Iss
25. the mains and allow the lamp to cool for at least 15 minutes before proceeding Q Remove the back corner cover by turning the fastener one quarter turn anti clockwise and slide the cover up to remove Q Now lift the metal lamp cover vertically upwards to remove it a Protective Sleeve Silica Envelope Lamp Base Spring Clip Iffitted remove the spring clip Q Hold the Tungsten lamp and pull upwards to remove When fitting the new tungsten halogen lamp avoid handling the silica envelope Finger marks become burnt on and cannot be removed after the lamp is switched on As this can affect the output characteristics handle only the base of the lamp If the silica envelope does become contaminated clean with a powerful degreasing solvent such as absolute alcohol before the lamp is switched on Q Use the new lamp s protective sleeve a polythene bag or a piece of tissue paper wrapped around the lamp and insert the pins into the socket Q Replace the spring clip These lamps are manufactured to very high tolerances but to ensure optimum energy throughput align the lamp filament exactly as shown in the diagram with the white line on the lamp base facing towards the front of the instrument a Refit both the metal lamp cover and the rear cover Q Reconnect the spectrophotometer to the mains supply and switch on Q Lamp hours and energy must be reset from the controlling software BioMate 5 Issue 1 Engl
26. the upper graph limits on the SCAN GRAPH page English 29 GRAPH LOW SMOOTHING LAMP CHANGE USER UVCALC SCAN GRAPH HIGH must be 0 01 greater than GRAPH LOW Select from range 0 3 to GRAPH HIGH 0 01 Sets the lower graph limits on the SCAN GRAPH page GRAPH LOW must be 0 07 less than GRAPH HIGH Select from NONE LOW MEDIUM or HIGH Applies modified improved Savitsky Golay smoothing to the spectrum Select from 315 320 325 330 335 340 D2 W Selects the wavelength at which the source is changed between the Tungsten and Deuterium lamps Selecting D2 or W overrides any changeover and the selected lamp will be used regardless of the wavelength set Switches to the TEXT ENTRY screen The operator name is automatically saved with the method and any spectra produced by the method Changing the operator name will not cause the current spectrum to be lost If User Log on is in operation the operator name cannot be changed Appears when the UVCalc software has been installed Switches to the UVCALC screen SAMPLE POSITIONER Appears when the 7 Cell Changer is fitted Select from AUTO 7 AUTO 6 REF MANUAL 7 AUTO 7 AUTO 6 REF MANUAL 7 Up to 7 measurements may be made without changing the samples in the Cell Changer After each sample measurement the instrument automatically advances the Cell Changer to the appropriate position for the next sample Up to 6 sample measurements may be m
27. to move the cursor to the required position on the graph and then press ENTER to select it Text entry screens are provided for alphanumeric parameter input Use the Arrow keys to move the cursor to the required character in the list and press ENTER Numbers are entered using the numeric keypad If you make a mistake CLEAR will remove the whole entry TEXT ENTRY lololol lt Acts as backspace and clears the last character in the entered text ACCEPT Enters the names and returns to the calling screen CANCEL Abandons the naming operation and returns the calling screen The original entry is not changed Local and Computer Control Q From switch on a standalone instrument will automatically be under Local Control To enable control from an external computer via the RS232C port first ensure the instrument is idle and then press REMOTE on the BioMate Tests or General Tests pages olojo g REMOTE Q To return to Local Control first ensure the instrument is idle and then relinquish control of the communications port by the PC software Press the HOME key on the instrument The BioMate Tests page will be redisplayed and the spectrophotometer may now be controlled via the keypad English BioMate 5 Issue 1 GENERAL BioMate and General Tests BioMate 5 provides an assortment of specific tests used to characterize biological and biochemical substances These tests fall into the following
28. will be drawn into the tubing When the system beeps remove the sample and the required air gap will be drawn in Once the measurement has taken place press the switch again The sample will be pumped out of the flowcell to waste When the sipper is connected a status box is displayed on the right hand side of all the method screens that indicates the presence of the MiniSipper and its status SIPPER Page This page allows the MiniSipper to be set up SIPRBR for the required analysis The method set on SIPPER OFF this page will be saved with any data MODE SIP produced by the software AIR GAP 50 cm SAMPLE VOL 1 000 ml SAMEIE whore Q To reach this page press the ACCESSORIES LOW VOL OFF function key on the SETUP or GENERAL TESTS page then select SIPPER and press ENTER To change a parameter highlight the required value using the Up Down Arrow keys and press ENTER SIPPER Toggle ON or OFF Switches the MiniSipper ON or OFF MODE t Selects from SIP SIP amp RUN CONTINUOUS SIP Sets the system to fill the flowcell SIP amp RUN Sets the system to fill the flowcell and automatically perform a measurement The current method is used to produce the result e g if FIXED is current then the sample will be scanned using the FIXED METHOD as set CONTINUOUS Sets the system to pump continuously to waste Alternate switch presses will start and stop pumping The instrument will not process any key presses while t
29. 0 000 9999 Standard Concentrations to generate standard curve for the test 800 1000 Bradford micro 0 20 40 60 80 100 Lowry Std 0 100 200 500 1000 2000 Lowry micro 0 20 50 100 200 500 BCA Std 0 0 2 0 4 0 6 0 8 1 0 BCA micro 0 0 5 1 2 5 10 Biuret 0 2 4 6 8 10 BioMate 5 Issue 1 English 95 APPENDIX A PARAMETER DESCRIPTION INITIAL DEFAULT VALUES RANGE Statistics Turns statistics function on or off if ON calculates average and Std Dev of results Off OnoOff Test Name Defined by user to identify stored tests DNA 260 280 DNA 260 230 DNA WITH SCAN dsDNA ssDNA RNA OLIGOS FACTOR OLIGOS CALC BRADFORD STANDARD BRADFORD MICRO LOWRY STANDARD LOWRY MICRO BCA STANDARD BCA MICRO BIURET DIRECT UV 280 DIRECT UV 205 WARBURG CHRISTIAN CELL GROWTH up to 19 characters Tm values Predicted melting point temperatures empty not an entry NA Units Labels concentration results DNA Ratio ug ml for DNA amp Protein DNA Scan ug ml for DNA amp Protein dsDNA pg ml ssDNA amp RNA pg ml Oligos ug ml Bradford Protein ug ml Lowry Protein ug ml BCA Standard Protein mg ml BCA micro pg ml Biuret Protein mg ml Direct UV Protein mg ml Warburg Christian mg ml Up to 9 characters Wavelength values Values for the analytical wavelengths DNA 260 280 260 230 dsD
30. 0 123 123 4 56 7 1 0 345 12 34 5 67 2 0 678 1 234 0 567 3 1 234 12345 57890 PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS BioMate 5 Issue 1 English 19 BIOMATE APPLICATIONS Protein measurements Bradford standard amp micro Lowry standard amp micro BCA standard amp micro amp Biuret measurements You can use these tests to determine the concentration of protein in a given sample using the following analytical methods Q Bradford measures absorbance at 595nm determines concentration for either standard or micro sample volumes Q Lowry measures absorbance at 550nm determines concentration for either standard or micro sample volumes Q Bicinchoninic Acid BCA measures absorbance at 562nm determines concentration for either standard or micro sample volumes Q Biuret measures absorbance at 540nm Several of these categories include multiple tests that are similar so this section includes screen shots for the standard Bradford test For a complete list of all parameters and calculations for each test refer to Appendices A and B Test parameters for preparing and running a standard curve BRADFORD STANDARD TEST NAME BRADFORD STANDARD DATE STANDARDS MEASURED 17 01 01 WAVELENGTH 595 0nm CURVE FIT QUADRATIC STANDARDS 6 UNITS ug ml SAMPLE POSITIONER AUTO 6 REF NUMBER OF SAMPLES 1 ID 0 OFF o LOW HIGH LIMITS 9999 9999 STATISTICS OFF AUTOPRINT OFF
31. 1 20 Pressing the CHANGE USERS function key brings up the CURRENT USERS page Up to 20 users can be listed by name and password The privileges of each user can be set individually by the Administrator and can be any combination of Edit Methods Calibrations Delete Files Initialisations History File Reset Lifetimes Default Baseline Only the Administrator is able to change passwords or edit the Current Users Page It is strongly recommended that a new password for the Administrator is set as soon as USER LOG ON is activated and that USER LOG ON is activated whenever the instrument is to be used in a multi user environment After USER LOG ON is enabled each time the instrument is powered up the user will be prompted to log on by entering name and password At the close of a session the user logs off by pressing the LOG OFF function key on the General Tests and Setup Pages and choosing whether to PROCEED or STOP When PROCEED is chosen the system waits for the next user to enter their name USER LOG ON can be reset to OFF only by the Administrator After USER LOG ON has been set to OFF the list of users is cleared and the default User Name and Password are both reset to ADMIN 66 English BioMate 5 Issue 1 SETUP HISTORY FILE Toggles between ON and OFF The History File contains the history of the instrument An entry is put into the file when there are changes to default baselines wavelength calibrations EHT calibrations
32. AUTOPRINT OFF PRINT SAVE STORED VIEW TEST TEST TESTS RESULTS 16 English BioMate 5 Issue 1 BIOMATE APPLICATIONS Running Direct UV measurements Q Place the blank in the correct cell position Q Press ZERO BASE to measure the blank Q Place the unknown s in the correct cell position s Q With the appropriate Direct UV parameter screen displayed select the required Sample Positioner mode number of samples if appropriate and initial sample number ID absorbance and concentration on a screen like the one shown below Note Ifall the results do not fit on a single screen press the Down Up Arrow key to display the next previous page of results TEST NAME dsDNA ID ABS CONC 260 0nm ug ml 999 0 121 123 45 LOW 1 0 234 2345 6 2 0 345 345678 HIGH PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS BioMate 5 Issue 1 English Q Press RUN to start the measurement The Direct UV measurement screen appears When the instrument is finished measuring the absorbance of the sample it displays the ID 17 BIOMATE APPLICATIONS Oligonucleotide measurement calculated factor The Oligonucleotide measurement using a calculated factor test measures absorbance at 260nm then converts absorbance to concentration using a factor that the instrument calculates using molecular weight and the extinction coefficient Test parameters 18 OLIGOS CALC TES
33. Bradford Standard Quadratic Bradford micro Quadratic Lowry Standard Quadratic Lowry micro Quadratic BCA Standard Quadratic BCA micro Quadratic Biuret Linear Through Zero Linear Through Zero Quadratic Quadratic Through Zero Date Standards Measured Date when standards were last measured with this instrument Volume of diluent added prior to 0 0 999 Diluent Volume measurement Integer Factor used to correct for sample 1 00 1 00 99999 dilution X XX Dilution Multiplier re XXX X XXXX XXXXX Indicates whether results should On OnoOff Display Protein appear as units of protein concentration Extinction coefficient empty not an entry NA DNA 260 Molecular weight of DNA empty not an entry NA DNA Mol Wt contained in sample 94 English BioMate 5 Issue 1 APPENDIX A INITIAL DEFAULT PARAMETER DESCRIPTION VALUES RANGE See individual calculations for DNA 260 280 DNA with Scan 0 001 to 99999 usage 260 280 0 001 to 99999 DNA Factor 260 62 9 DNA Factor 280 36 0 X XXX Protein Factor 260 757 3 XX XX Protein Factor 280 1552 XXX X XXXX DNA 260 230 DNA with Scan xxxxx 260 230 DNA Factor 260 49 1 DNA Factor 230 3 48 Protein Factor 260 75 8 Factor Protein Factor 230 183 dsDNA 50 ssDNA ssRNA 40 Direct UV Oligos 33 Direct UV 280 1 Direct UV 205 31 Oligo calculator blank if no base sequence entered calc value if base
34. C GUIDE 25 APPROVED PROCEDURE Q Calibration can be performed automatically on start up if the CVC is fitted From the SETUP menu select ENVIRONMENT select AUTOMATIC CAL VAL and toggle to ON with the Enter key On start up the instrument will then automatically wait for the warm up period 60 minutes and then perform tests 1 2 and 3 Calibration can be aborted by pressing Clear Q Calibration values are provided on a PC format floppy disk which is loaded on installation see below IT IS RECOMMENDED THAT A BACK UP COPY OF THIS DISK IS MADE BEFORE USE AND THE MASTER RETAINED IN A SECURE SAFE LOCATION Q This section describes the installation and operation of the accessory with the software Q This section also describes its removal refit SETUP CVC SETUP CVC This page allows the CVC calibration data provided on disk to be loaded into the CALIBRATION DATA spectrophotometer memory To reach this page highlight the CVC option from the SERIAL NUMBER 32764 CALIBRATION DATE 03 12 96 SETUP page and press ENTER CAROUSEL SERIAL NUMBER 32764 CALIBRATION DATA SERIAL NO Displays the serial number of the calibration and therefore the actual parameter values loaded into the memory of the spectrophotometer CALIBRATION DATE Date of original calibration CAROUSEL SERIAL NO Unique identifier read by initialising the carousel FUNCTION KEYS LOAD DATA Allows calibration data to be loaded into the s
35. E When selected this displays a pop up menu to choose between initialisation of optics or baseline OPTICS During initialisation the instrument performs some simple hardware checks calculates various data tables and measures the dark current The filter wheel is then initialised before the instrument drives to the default wavelength and performs an autozero BASELINE This re measures the default baseline Ensure that both lamps are on and that the spectrophotometer is fully warmed up This process will take about one hour The default baseline should be re measured whenever one of the source lamps is changed or if the instrument is working at temperatures significantly different from 25 C or if the wavelength calibration is altered INITIALISE WITH D2 This sets the instrument to initialise with or without the Deuterium lamp on If set to ON then the instrument will automatically strike the Deuterium lamp during initialisation 68 English BioMate 5 Issue 1 SETUP WHITE LIGHT Page Q The WHITE LIGHT feature is used to facilitate alignment of optical accessories in the sample compartment Q When the INITIALISE function key is pressed the instrument will align the grating so that the zero order diffraction passes through the sample compartment This provides a beam of white light which can be seen when a white card or similar is placed in the light path In double beam instruments the action of the chopper causes the light to
36. ER OF SAMPLES Appears when the 7 Cell Changer is fitted and an automatic operating mode has been selected Valid range 1 999 54 English BioMate 5 Issue 1 MCA MCA PARAMETERS Page function keys VIEW RESULTS Transfers to the Results Table if it contains results VIEW STDS Transfers to Standards results table if a calibration has been performed SAVE METHOD Brings up the SAVE page from where the method can be saved to Disk PRINT METHOD Prints the current method parameters on the printer CALIBRATE Moves to the CALIBRATION PAGE to perform a calibration if standards and wavelengths have been entered BioMate 5 Issue 1 English 55 MCA STANDARDS ENTRY Page a When MEASURE STDS YES Use the up and down arrow keys to move up and down the list When the highlight is on the field to be entered or edited press ENTER to display the Text Entry dialogue box Enter the name of the Standard and press the ACCEPT function key when finished The instrument returns to the STANDARDS ENTRY page with the concentration field for the standard highlighted Press ENTER to display the edit dialogue box enter the concentration using the numeric keypad and press ENTER when finished The instrument returns to the STANDARDS ENTRY page with the ID for the next standard highlighted Up to 20 standards can be entered in this way The standards are displayed on two pages The STD11 STD20 function key toggles between the two pages Q W
37. F DATE FORMAT Defaults to dd MM yy but USER LOG ON OFF will toggle with ENTER to MM dd yy HISTORY FILE OFF AUTOMATIC CAL VAL Toggles between OFF and ON with Enter Q When ON and the CVC Calibration Validation Carousel is fitted the instrument automatically waits on start up for the warm up period 60 minutes and then performs the Wavelength Absorbance and UV Absorbance calibration tests See CVC Section Pressing Clear aborts the calibration DEFAULT FILE TYPE Selects the default file type on the SAVE RENAME page Q Available formats are NORMAL The native file type used by the Local Control software CSV Comma separated variable JCAMP DX JCAMP data exchange format Use up down arrow keys to highlight choice and press ENTER to confirm selection LIMS SUPPORT Toggles between OFF and ON Q When ON results methods and sample IDs when selected are exported automatically after each measurement to the central LIMS computer via the RS232 port THIS INTERFACE MUST BE CONNECTED BEFORE LIMS SUPPORT IS ACTIVATED 64 English BioMate 5 Issue 1 SETUP USE SAMPLE IDS Choose between OFF SEEDED and PROMPT USER Q OFF The system does not attach an identity to the sample Q SEEDED Enables the system to be set up to attach an identity to each sample automatically This appears on the screen and the print out It is also exported to the LIMS when enabled with the results of the run and method
38. Issue 1 PEAK TABLE SCAN Select from OFF PEAKS VALLEYS PKS amp VALLEYS ZERO CROSS TRACK RATIO CORR RATIO PEAK HEIGHT Note RATIO CORR RATIO and PEAK HEIGHT do not appear on this menu when UVCalc has been installed UVCalc can perform these calculations if required in addition to a wide range of additional data manipulations See UVCalc Manual This selects the type of peak picking done automatically as part of the method Results are reported on the Peaks Page Peaks information is stored with any saved spectrum OFF PEAKS VALLEYS PKS amp VALLEYS ZERO CROSS TRACK RATIO CORR RATIO PEAK HEIGHT GRAPH HIGH BioMate 5 Issue 1 Sets Peak Table to Off No peaks information is produced as part of the scan Picks the highest peaks in a spectrum up to a maximum of 10 peaks Picks the lowest troughs in a spectrum up to a maximum of 10 troughs Picks the 5 highest peaks and the 5 lowest valleys Picks all the points where the spectrum crosses zero up to a maximum of 10 crossing points This function allows the Absorbance or other mode values to be reported at up to 10 user selected wavelengths To enter the desired wavelengths select PEAK TABLE TRACK then press VIEW GRAPH You do not have to have a spectrum present on the graph to enter the selected wavelengths Press MANIPULATE and select TRACK For each wavelength move the cursor to the desired position press ENTER Once all the
39. Issue 1 QUANT QUANT CALIBRATION Q Q Press ZERO BASE to zero the instrument with the current method See page 7 To calibrate the system press return to the QUANT page and press CALIBRATE The QUANT CALIBRATION graph will be displayed and the instrument will prompt for each standard and replicate in turn As the measurements of the standards proceed the datapoints are marked on the graph When all the standards have been measured the system calculates the equation rescales the graph then draws and displays the line of best fit on the graph A calibration can be stopped by pressing the STOP function key The calibration will be aborted and the software will return to the QUANT STANDARDS page Any values obtained will be lost If a calibration has not been done pressing RUN causes the warning prompt CANNOT RUN WITHOUT CALIBRATION to appear otherwise it takes a sample measurement and switches to the Quant Results screen 0 0000 50 000 COEFFICIENT 0 9999 VIEW RESULTS Switches to the Quant Results page if there are results QUANT PAGE Switches back to the Quant page STANDARDS Switches to the Quant Standards page PRINT GRAPH Prints the Quant method and calibration graph SAVE METHOD Switches to the SAVE page BioMate 5 Issue 1 English 43 QUANT QUANT STANDARDS Page Q Press STANDARDS on the Quant Calibration Graph Page to display the Quant Standards Page Thi
40. NA ssDNA RNA 260 DNA scan 225 325 Oligos entered factor 260 Oligos calc factor 260 Bradford Standard amp micro 595 Lowry Standard 550 Lowry micro 750 BCA Standard amp micro 562 Biuret 540 Direct UV 280 Direct UV 205 Warburg Christian 260 280 Cell Growth 600 190 0 1100 0nm 96 English BioMate 5 Issue 1 APPENDIX B CALCULATIONS FOR BIOMATE 5 TESTS Test Types Calculation s Default Parameters Displayed Units DNA Protein concentration and Absorbance Difference DNA Purity 260 280 Absorbance Ratio DNA Protein concentration and Absorbance Difference DNA Purity 260 230 Absorbance Ratio Dilution Factor Dy A 260nm DNA ug ml diluent vol sample volume Az 280nm Protein ug ml sample volume Aver 320nm Ratio no units DNA concentration optional Ai Aref A2 Areh D f 62 9 Protein concentration f 36 0 Ag Aren f Ai Arfa De f 1552 Ratio Ay Aver fy 757 3 Ad Aref dil vol 0 smp vol 1 Dilution Factor D A 260nm DNA ug ml diluent vol sample volume Ay 230nm Protein ug ml sample volume Aver 320nm Ratio No units DNA concentration optional At Arfi A2 Ares 2 Dr f 49 1 Protein concentration f 3 48 A2 Ardh A1 Aredia De f 183 Ratio Ay Aver fy 75 8 Ad Aref dil vol 0 smp vol 1 DNA Protein concentration and Scan Absorbance None Start wavelength 230nm None DNA
41. NAL PRINTER INTERNAL PRINTER The Internal Printer is a factory fitted thermal head printer It is supplied with a roll of 11 2cm wide single ply thermal paper Paper rolls may be ordered separately under the following part number 4401 161 00391 For long term storage it is recommended that the paper is kept away from light and at room temperature A red warning stripe is printed on the paper within 1 metre of the end of the roll It is recommended that the roll is replaced as soon as the warning stripe is visible to avoid possible paper jams The printer is fitted with a Line Feed Button Press this once to switch the printer off line and feed the paper though the printer Press the button a second time to put the printer back on line Do not press the Line Feed Button during printing as this will cause a internal error condition which can only be rectified by restarting the instrument To replace the paper roll Q Q 84 Cut the paper at the end of the new roll in a V to make a point at the end of the paper Carefully feed the printer paper from the bottom of the roll i e shiny side down into the back of the printer using the Line Feed Button Keep the Line Feed Button depressed until the paper emerges squarely through the top slot of the printer housing English BioMate 5 Issue 1 MAINTENANCE MAINTENANCE Q Q The information given in this section deals only with those parts of maintenan
42. PROTEIN FACTOR 42 DILUTION MULTIPLIER UNITS SAMPLE POSITIONER NUMBER OF SAMPLES ID 0 OFF LOW HIGH LIMITS STATISTICS AUTOPRINT WARBURG CHRISTIAN AUTO 6 REF 280 0nm 260 0nm 1 550 0 760 1 00 mg ml 1 o 9999 9999 OFF OFF PRINT SAVE TEST TEST STORED TESTS VIEW RESULTS Running Warburg Christian measurements Q Place the blank in the correct cell position Q Place the unknown in the correct cell position Q With the Warburg Christian parameter screen displayed press ZERO to measure the blank Q Press RUN to start the measurement The Warburg Christian measurement screen appears When the instrument is finished measuring the absorbance of the sample it displays the sample ID its absorbance at 280 and 260nm and its protein concentration on a screen like the one shown below 24 TEST NAME WARBURG CHRISTIAN ID ABS 1 1 ABS 1 280 0nm 260 0nm 999 0 123 0 456 PROTEIN CONC 1111 1 mg ml 1 1 234 1 567 PROTEIN CONC 33 8 mg ml PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS English BioMate 5 Issue 1 BIOMATE APPLICATIONS Cell growth measurements The cell growth measurement uses absorbance at 600nm to indicate the progress of cell growth in a sample The instrument does not perform any calculations or graphing for the data Test parameters CELL GROWTH TEST NAME CELL GROWTH WAVELENGTH 600 0
43. S Enter units for concentration using the TEXT ENTRY page 40 English BioMate 5 Issue 1 QUANT CURVE FIT Select from LINEAR LINEAR TO 0 QUADRATIC QUAD TO 0 Q Selects the curve fit algorithm used in the calibration LINEAR performs a linear calibration At least two standards are required LINEAR TO 0_ performs a linear calibration forced through zero QUADRATIC performs a quadratic fit on the data At least three standards are required QUAD TO 0 performs a quadratic fit with the data forced through zero At least two standards are required Changing the curve fit will cause the existing calibration to be recalculated Any results associated with the previous calibration will be lost LAMP CHANGE Select from 315 320 325 330 335 340 D2 W Q Selects the wavelength at which the source is changed between the Tungsten and Deuterium lamps Selecting D2 or W overrides any changeover and the selected lamp will be used regardless of the wavelength set Any current data will be lost if the lamp changeover wavelength is changed USER Switches to the TEXT ENTRY screen The User name is automatically saved with the method and any data produced by the method Changing the User name will not cause any current data to be lost If User Log on is in operation the User name cannot be changed UVCALC Switches to the UVCALC screen Q Only available if UVCalc is installed See UVCalc Manual MEASURE STDS Toggles between
44. SETUP CVC Page Switches to the RECORDER Page Q From this page the internal spectrophotometer clock calendar can Q To reset the time or date highlight the required parameter and press ENTER Enter the new value using the number keys and press ENTER Q Once all the parameters have been changed press ACCEPT The date or time will not be changed unless ACCEPT is pressed Q CANCEL cancels the edit leaving the previous values unchanged English BioMate 5 Issue 1 SETUP PRINTERS Page This page sets the system to work with the selected printer Q The printer type is always highlighted If an internal printer is supplied this will be the default printer otherwise the default printer is HP Mono To choose a printer press ENTER to display the list of supported printers and select using cursor keys Press ENTER to confirm entry Printer options Supported Printers EPSON 9 PIN Epson 9 or 24 Pin Dot Matrix using pee OPIN ESC P language HP LASERJET HP LASERJET HP Laserjet Series HP MONO HP MONO HP Deskjet 500 Series and HP PLOTTER above Black amp White 0 fone HP PLOTTER Compatible with plotters using HPGL language INTERNAL HP 690C HP Deskjet 690C Colour HP 400 HP Deskjet 400 Mono Q Printers not on the above list that claim Epson 9 pin 24 pin ESC P or HP PCL Programming Control Language Level 3 compatibility should work with the instrument but are not guaranteed to do so and are therefore no
45. T NAME OLIGOS CALC WAVELENGTH 260 0nm DILUTION MULTIPLIER 1 00 UNITS pg ml pmol l SAMPLE POSITIONER AUTO 6 REF NUMBER OF SAMPLES 1 ID 0 OFF o AUTOPRINT OFF BASE SEQUENCE ATCGTCGATTGAGCATCAGCATGACTAGATCAGAATCGCG BASE SEQUENCE FACTOR 26 68 BASE PRINT SAVE STORED VIEW SEQ TEST TEST TESTS RESULTS English BioMate 5 Issue 1 BIOMATE APPLICATIONS Running oligonucleotide measurements with a calculated factor Q Enter a base sequence With the Oligos calc factor parameter screen displayed press BASE SEQ to view the Base Sequence screen and then follow the instructions in the Oligo calculator functions section of this manual to specify the sequence With the appropriate DNA parameter screen displayed select the required Sample Positioner mode number of samples if appropriate and initial sample number ID Place the blank in the correct cell position Press ZERO BASE to measure the blank Place the unknown s in the correct cell position s Press RUN to start the measurement The Oligos calc factor measurement screen appears When the instrument is finished measuring the absorbance of the sample it displays the ID absorbance and concentration on a screen like the one shown below Note Ifall the results do not fit on a single screen press the Down Up Arrow key to display the next previous page of results TEST NAME OLIGOS CALC ID ABS 1 OLIGOS OLIGOS 260 0nm pg ml pmol l 999
46. TOCA CLEAR RESULTS Clears the results table MCA PAGE Returns to the MCA METHOD page SAVE DATA Displays the SAVE page from which the results can be saved to Library or Disk PRINT LIST Prints the list on the selected printer 58 English BioMate 5 Issue 1 DATA STORE DATA STORE Pages Q To access the Data Store select the DATA STORE function key on the BIOMATE TESTS page Q The Data Store page provides access to both the instrument Library and the disk drive Both method and data files may be stored The files can be loaded renamed copied to or from the disk drive and deleted Saving files to the Data Store is done from the method and result pages of the application LIBRARY Page LIBRARY TYPE TEST NAME FILENAME D QUANT UV123 AB123B QNT D FIXED UV146 DE146G FXD D QUANT UV146 TEST QNT D FIXED UV146 TEST2 FXD D FIXED 1X2 THRIB FXD 76 LIBRARY SPACE REMAINING HIGHLIGHT FILE AND PRESS ENTER ALL PRINT FORMAT COPY VIEW FILES DIR LIBRARY ALL DISK Q The LIBRARY Page lists all the files in the Library including the file type description and file name FILE TYPE This describes the type of information contained in the file M BIO BioMate test D BIO BioMate test and results M SCAN Scan method D SCAN Spectrum data and method M FIXED Fixed wavelength method D FIXED Fixed wavelength results and method M QUANT Quant method including calibration D QUANT Quant results including
47. The measured i ra PA values will be ABS T INTENSITY or 1D 2D 3D 4D oS a 4620 depending on the current mode O VIEW GRAPH Switches to the TRACK page LIMS EXPORT Sends the results via the RS232 port PRINT LIST Prints the list on the selected printer SCAN GRAPH Returns to the SCAN GRAPH page Ifa spectrum is saved then the track markers are also saved and will be displayed when the spectrum is reloaded 34 English BioMate 5 Issue 1 SCAN PEAK TABLE Page PEAK TABLE ABS A WAVELENGTH nm The list shows the positions and values of the peaks as 1PEAK 0 472 447 0 calculated by the function selected in MANIPULATE Ei tie ee PEAKS The measured values will be ABS T is C INTENSITY or 1D 2D 3D 4D depending on the current mode and are sorted by wavelength Each marker is identified as a peak valley or zero crossing Y LIMS EXPORT Sends the results via the RS232 port PRINT LIST Prints the list on the selected printer SCAN GRAPH Returns to the SCAN GRAPH page RATIO TABLE Page RATIO TABLE MARK ABS A WAVELENGTH nm Q The page shows the positions and values of the wavelengths and the ratio as selected by the RATIO or 2 2 002 463 0 CORR RATIO functions Not available if UVCalc has c 0 375 480 0 been installed VIEW GRAPH Returns to the SCAN GRAPH page LIMS EXPORT Sends the result
48. Thermo Spectronic Europe Middle East and Africa Mercers Row Cambridge CB5 8HY UK Tel 44 0 1223 446600 Fax 44 0 1223 446644 E mail info thermospectronic co uk www thermospectronic com 9499 230 46211 Issue 1 010301 All rights reserved Thermo Spectronic North America and Latin America 820 Linden Avenue Rochester NY 14625 USA Tel 800 654 9955 or 716 248 4000 Fax 716 248 4014 E mail info thermospectronic com www thermospectronic com Thermo Spectronic BioMate 5 User Manual Copyright 2001 Unicam Limited Registration No 441506 For Indian Sub continent Far East and Australasia Contact Thermo Spectronic Europe Middle East and Africa A Thermo Electron business BioMate 5 User Manual 9499 230 46211 Issue 010301 Thermo spect ronic A Thermo Electron business CONTENTS USER MANUAL CONTENTS Section Page REQUIREMENTS Environmental and Electrical Requirements 0005 1 INSTALLATION Unpacking locating ae a EAE EEEN TEET 2 Making connections InitialiSing 0 eeceeeeeeeeeeeeteeeeeeees 3 SAFETY Safely NOS onia a AA Aaa 5 GENERAL INtrOUUCTION tiA Se ee ee dest ete 6 USEr interlace i is 22 seks chien ea aii ate 7 Parameter entry s cnse iti icin teste ait dees 8 Local and computer control ccccceeeeeeeeeeceeeeeeeeeeeeeeees 8 BioMate and General Tests ccceceeeeeeeeeeeeeeeeeeteeeneeee 9 SmartStart feature
49. Tungsten and Deuterium lamps Selecting D2 or W overrides any changeover and the selected lamp will be used regardless of the wavelength set The current data will be lost if the lamp change parameters are changed USER Switches to the TEXT ENTRY screen Q The User name is automatically saved with the method and any data produced by the method Changing the User name will not cause any current data to be lost If User Log on is in operation the User name cannot be changed SAMPLE POSITIONER Appears when the 7 Cell Changer is fitted Select from AUTO 7 AUTO 6 REF MANUAL 7 AUTO 7 Up to 7 measurements may be made without changing the samples in the Cell Changer After each sample measurement the instrument automatically advances the Cell Changer to the appropriate position for the next sample AUTO 6 REF Up to 6 sample measurements may be made without changing the samples in the Cell Changer The instrument automatically measures the blank in position 1 then automatically advances the Cell Changer to the appropriate position for the next sample Regardless of where the Cell Changer is positioned when you press ZERO BASE the Cell Changer automatically moves to position 1 After the blank measurement it returns to its original position MANUAL 7 Up to 7 measurements may be made without changing the samples in the Cell Changer by using the left and right arrow keys to advance the Cell Changer to the next position NUMB
50. YES and NO Q When YES and Standard concentrations have been entered from the Quant Standards page pressing Calibrate causes the instrument to prompt the user to put the standard in the beam and press Run to measure for each Standard in turn Q When NO pressing Calibrate causes the system to prompt for an absorbance to be entered manually for each Standard effectively enabling a calibration originating elsewhere to be entered SAMPLE POSITIONER Appears when the 7 Cell Changer is fitted Select from AUTO 7 AUTO 6 REF MANUAL 7 AUTO 7 Up to 7 measurements may be made without changing the samples in the Cell Changer After each sample measurement the instrument automatically advances the Cell Changer to the appropriate position for the next sample AUTO 6 REF Up to 6 sample measurements may be made without changing the samples in the Cell Changer The instrument automatically measures the blank in position 1 then automatically advances the Cell Changer to the appropriate position for the next sample Regardless of where the Cell Changer is positioned when you press ZERO BASE the Cell Changer automatically moves to position 1 After the blank measurement it returns to its original position BioMate 5 Issue 1 English 41 MANUAL 7 NUMBER OF SAMPLES QUANT Page function keys QUANT QUANT Up to 7 measurements may be made without changing the samples in the Cell Changer by using the left and right ar
51. ade without changing the samples in the Cell Changer The instrument automatically measures the blank in position 1 then automatically advances the Cell Changer to the appropriate position for the next sample Regardless of where the Cell Changer is positioned when you press ZERO BASE the Cell Changer automatically moves to position 1 After the blank measurement it returns to its original position Up to 7 measurements may be made without changing the samples in the Cell Changer by using the left and right arrow keys to advance the Cell Changer to the next position NUMBER OF SAMPLES Appears when the 7 Cell Changer is fitted and an automatic 30 operating mode has been selected Valid range 1 99 English BioMate 5 Issue 1 SCAN SCAN PARAMETERS page function keys SCAN VIEW RESULTS Switches to the Scan Peak Table screen if any of the peak functions have been performed or the Track Table screen if track has been used VIEW GRAPH Switches to the Scan Graph screen SAVE METHOD Brings up the Filename Function screen and then saves the method including ID operator name and track wavelengths if the PEAK TABLE parameter is set to TRACK PRINT METHOD Prints the current method parameters on the printer Tri UVCALC RESULTS Switches to UVCalc results screen if an equation has been entered and results are available Only available if UVCalc has been installed SCAN GRAPH Page This page displays sp
52. age is displayed with the default printer HP Mono Internal selected PRINTERS PRINTER TYPE HP MONO PRINTER EPSON 9 PIN HP LASERJET HP MONO HP PLOTTER HP 690C HP 400 INTERNAL SETUP PAGE Q Press ENTER again to display the Printer Menu and using the cursor keys select the required printer Q Press ENTER 4 English BioMate 5 Issue 1 SAFETY SAFETY Q THIS SPECTROPHOTOMETER SYSTEM HAS BEEN DESIGNED TO BE USER INSTALLED READ THIS PAGE CAREFULLY BEFORE INSTALLING AND USING THE INSTRUMENT AND ITS ACCESSORIES The safety statements in this manual comply with the requirements of the HEALTH AND SAFETY AT WORK ACT 1974 The instrument and accessories described in this manual are designed to be used by properly trained personnel only Adjustment maintenance and repair of exposed equipment must be carried out only by qualified personnel who are aware of the hazards involved Where indicated in the relevant manual certain maintenance processes may be carried out by the user who must be fully aware of and apply the following safety precautions For the correct and safe use of this instrument and its accessories it is essential that both operating and servicing personnel follow generally accepted safety procedures in addition to the safety precautions specified in this manual Specific warning and caution statements where applicable can be found throughout the ma
53. alternate between the sample and reference beams Q When alignment is completed pressing the STOP function key returns the grating to its normal position and pressing the SETUP PAGE function key returns to the Setup Page SET UP CVC Page Q This page allows the CVC calibration data provided on disk to be loaded into the spectrophotometer memory For full details please see the CVC section of this manual BioMate 5 Issue 1 English 69 SETUP RECORDER Page pe og ae gg ep ee 4 RECORDER I I CHART HIGH ABS 3 000 CHART LOW ABS 0 300 H I I I I CHART HIGH T 200 0 CHART LOW T 0 1 I I I I CHART HIGH I 99 9999 H CHART LOW I 0 0000 f i 4 Q The Chart High and Chart Low parameters set the full scale deflection on the analogue chart recorder output for each of the available measurement modes On startup these limits are set to the maximum measurement ranges as shown above Q To reset the limits highlight the required parameter and press ENTER Enter the new value using the number keys and press ENTER Using a Chart Recorder Q Use the Recorder Lead part number 4401 172 00401 to connect the recorder to the socket labelled REC located to the rear of the spectrophotometer This lead is used for both 0 10mV and 0 1V full scale deflection fsd chart recorders Use the blue plug for 0 10mV or the red plug for 0 1V Q N B If your chart recorder is capable of either voltage range it is ad
54. ate on the same page until it is full MULTI A Two columns of results are displayed per page Results of each sample always start on a new page SERIAL One column of results is displayed per page Results accumulate on the same page until it is full Q To move up or down pages of results use the Up Down arrow keys Q Results are numbered sequentially from 1 to 600 Conc values are from 0 0001 to 9999 9 Any concentration value outside this range is marked UNDER RANGE or OVER RANGE FIXED RESULTS ABS ABS 1 0 201 15 2 0 201 16 eos E CLEAR RESULTS All results are cleared ready for the start of the next batch FIXED PAGE Returns to the FIXED METHOD page SAVE DATA Brings up the SAVE page from where the results can be saved to Disk or Library PRINT LIST Prints the list on the selected printer LIMS EXPORT Sends the results via the RS232 port Q Press RUN to take another sample measurement Q Press ZERO BASE to zero the instrument at the wavelength s specified in the method See page 7 BioMate 5 Issue 1 English 39 QUANT QUANTIFICATION Instrument and analysis parameters are set up on the QUANT page Move the cursor to the required parameter using the Up Down Arrow keys Change the parameter by pressing the ENTER key Q Once all results have been collected save the data QUANT METHOD Page QUANT TEST NAME WAVELENGTH 550 0 nm BANDWIDTH 2 0
55. aving the old list unchanged Alternatively wavelengths may be entered directly from a scan Clear the beam s and press ZERO BASE to perform a baseline scan then put the sample in the cell holder and press the SCAN GRAPH function key The instrument performs a scan using the method currently entered in the SCAN PARAMETERS page Use left and right arrow keys to move the vertical cursor to a suitable wavelength and press ENTER to mark it Repeat until all required wavelengths have been marked Marks can be removed using the CLEAR key or the CLEAR ALL function key When all required wavelengths have been marked press the ACCEPT function key to accept the list and return to the MCA Methods page Wavelengths can be selected either from a scan of the mixture to be analysed or by performing a scan on each standard in turn and selecting suitable wavelengths Wavelengths already entered in the table are shown on the Scan Graph At least one wavelength must be entered for each standard Oloo ACCEPT Transfers to the MCA METHODS page with all marked wavelengths added to the wavelength list FAST SLOW Toggles between two cursor speeds In FAST mode the cursor jumps 5 of the graph or to the next data point whichever is the greater In SLOW mode the cursor jumps to the next data point or the next display pixel whichever is the greater CLEAR ALL Clears all marks RESCALE Rescales the x and y axes so that the spectrum fills the screen
56. ce or service which can be safely carried out by the user Work other than that detailed should be carried out by a service engineer ALWAYS ENSURE THAT BOTH THE SAMPLE AND REFERENCE BEAMS ARE CLEAR BEFORE SWITCHING ON THE INSTRUMENT Failure to do so will produce abnormal results Low lamp energy values can be caused by leaving cells in the sample and or reference beams during energy measurement ALWAYS CHECK THAT BOTH BEAMS ARE CLEAR BEFORE MEASURING LAMP ENERGIES Abnormal results will be produced if a sample is left in the beam when ZERO BASE is pressed ALWAYS ENSURE THAT THE SAMPLE IS REMOVED AND THAT BOTH BEAMS ARE CLEAR OR CONTAIN THE APPROPRIATE ZERO REFERENCES BEFORE ZEROING THE INSTRUMENT OR PERFORMING A BASELINE SCAN VERY OFTEN POOR INSTRUMENT PERFORMANCE OR FAILURE CAN BE ATTRIBUTED TO SIMPLE FAILURE OF THE TUNGSTEN LAMP THEREFORE REPLACE AS BELOW USING THE SPARE LAMP PROVIDED BEFORE SEEKING FURTHER ASSISTANCE If any fault occurs including the above lamp failure these are reported by the system as an Error condition and an Exxxx number is generated Descriptive text is also included with this message DETAILED BELOW ARE THE ERROR CODES PRODUCED IF 1 The tungsten lamp fails or is poorly aligned E3010 E3011 E3104 E3015 E3030 2 The deuterium lamp fails E3003 E3004 E3005 E3006 E3007 E3008 E3009 E3012 E3013 E3022 E3029 E3044 E3045 3 The beam s is blocked on initialisation E3027 E3056 4 The 7 C
57. ceeeeeeeeeeeeenneneees 84 MAINTENANCE Routine Maintenance c ceeecececceeeeeeeeeeeeneeeeeeeeeeeeeteees 89 Removal and Replacement of Lamps ceeeeeeeee 91 FAULT FINDING Fault Finding Guide eee ceeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeseeaeees 89 Connecting BioMate 5 to a PC oo eee eeeeeeeeeeneeeeeeenaes 91 APPENDICES A BioMate 5 Test Parameters cceceeeeeeeseeeeeees 94 B Calculations for BioMate 5 Tests ceeeeeeeeee 97 C BioMate Oligo Calculator ce ceeeeeeeteeeentteeeeeenaes 98 English BioMate 5 Issue 1 REQUIREMENTS Environmental and Electrical Requirements Your BioMate 5 spectrophotometer has been designed to operate under the environmental and electrical requirements listed below Line Voltages 100 240V 10 max 50 60Hz 10 Power input 180VA Operating Environment Temperature 5 C to 40 C Rate of change of temperature lt 1 C hour Relative humidity 20 to 90 non condensing Absolute humidity 3g m to 20g m Air pressure 68kPa to 106kPa Air velocity 0 5m s Transport and storage requirements Temperature 20 C to 70 C Rate of change of temperature 5 C hour Relative humidity 5 to 95 non condensing Absolute humidity 0 1g m to 35g m Air pressure 25kPa to 110kPa Air velocity lt 30m s For Indoor Use only Installation Category Il The following are important for the safe operation of the instrument When c
58. ctrum is displayed with the peak positions marked RATIO For a peak to be found there must be more than 15 data CORR RATIO points between that point and a previous peak PK HEIGHT For RATIO and CORR RATIO enter the wavelengths as prompted All results can be viewed by pressing O O O O view RESULTS BioMate 5 Issue 1 English 33 SCAN PEAKS Marks the 10 highest peaks VALLEYS Marks the 10 lowest valleys PKS amp VALLEYS Marks the 5 highest peaks and 5 lowest valleys ZERO CROSS Marks the first 10 zero crossings RATIO Calculates the ratio A4 A CORR RATIO Calculates the ratio 1 A3 A A3 PK HEIGHT Calculates the peak maximum relative to a local baseline Ratio Corr Ratio and Pk Height are not available when UVCalc has been installed SMOOTHING This option offers a pop up menu to choose one of three smoothing algorithms Choices are NONE LOW MEDIUM and HIGH A Savitsky Golay smooth is performed on the data and in each case data points will be lost from either end of the data SMOOTHING No of POINTS POINTS LOST AT USED EACH END NONE 0 0 LOW 9 4 MEDIUM 17 8 HIGH 33 16 ORIGINAL Q This removes any manipulation and displays the spectrum as originally collected and specified by the scan method It will also clear any Compare spectrum TRACK TABLE Page C TRACK LIST Q The list shows the y axis values of the spectrum for the MARK ABS A WAVELENGTH nm wavelengths marked during TRACK
59. d When the list is finished press the ACCEPT function key to accept the new list or the CANCEL function key to return to the FIXED METHOD page without changing the wavelength list SERIAL Press ENTER to display the edit box for the wavelength to be used for the first sample Data entry is as for MULTI A above When the required wavelengths have been entered press ACCEPT to accept the new list or press CANCEL to return to the FIXED METHOD page leaving the original list unchanged If the wavelength requires the Deuterium lamp then this will be switched on The current data will be lost if the wavelength is changed BANDWIDTH This is fixed at 2 0 nm INTEGRATION Enter integration time in seconds Q This sets the integration time for which the result is measured The current data will be lost if the integration time is changed DELAY TIME Set a time in the range 00 05 to 99 59 using to separate minutes and seconds Q This sets the time between pressing RUN and the start of the measurement The range is from 0 to 99 minutes and 59 seconds LAMP CHANGE Select from 315 320 325 330 335 340 D2 W Selects the wavelength at which the source is changed between the Tungsten and Deuterium lamps Selecting D2 or W overrides any changeover and the selected lamp will be used regardless of the wavelength set FACTOR Enter the factor for the concentration Only available in CONC mode the factor is used to multiply the absorbance
60. d the base to the sequence Repeat these steps until you have specified the entire base sequence The displayed number of bases percent GC content molecular weight absorptivity e and conversion factor will be updated as each new base is added to the sequence Using the oligonucleotide calculator Q 26 With the Base Sequence screen displayed press Tm CALC to view the Melting Point calculator Use the Up Down Arrow keys to select any parameter to be changed and then press ENTER to start the edit process Once all parameters have been set appropriately the relevant set of melting point predictions will be displayed English BioMate 5 Issue 1 SCAN SCAN Q To select Scan highlight the SCAN option on the General Tests Page and press ENTER The SCAN Methods page is displayed and from here the instrument and analysis parameters can be set up Q Move the cursor to the required parameter using the Up Down Arrow keys Press ENTER to enable a parameter to be changed Q Once the method has been set up press ZERO BASE to perform a baseline scan with the current method see page 7 and then press RUN The spectrophotometer will perform the scan and display the result on the SCAN GRAPH page From here the spectrum can be manipulated and saved to Library or Disk See the DATA STORE section for explanation of file functions SCAN PARAMETERS Page Note The current spectrum will be lost if any of the method parameters excep
61. ectra and allows them to be manipulated 400 0 500 0 600 0 VIEW RESULTS Switches to the PEAK TABLE page SCAN PAGE Returns to the SCAN page SAVE DATA Displays the SAVE screen from where method and data can be saved to disk PRINT GRAPH Provides a hardcopy of the results as shown on screen i MANIPULATE Displays the Manipulate options Q Pressing RUN starts a scan using the current method Q Pressing ZERO BASE starts a baseline using the current method See page 7 BioMate 5 Issue 1 English 31 SCAN MANIPULATE OPTIONS TRACK Reports x and y axis values using the tracking cursor TRACK RESCALE Changes x and y axis scales automatically or manually RESCALE COMPARE MODE COMPARE Loads reference spectrum for comparison PEAKS SMOOTHING MODE Changes mode Select from T ABS 1D 2D 3D 4D ORIGINAL PEAKS Finds spectral peaks Select from PEAKS VALLEYS PEAKS amp VALLEYS ZERO CROSS RATIO CORR RATIO PK HEIGHT Ratio Corr Ratio and Pk Height are not available when UVCalc has been installed SMOOTHING Applies LOW MEDIUM or HIGH modified improved Savitsky Golay smoothing to the spectrum ORIGINAL Resets the graph to display the data as originally collected TRACK Q To move the vertical cursor across the screen use the Left and Right Arrow keys The cursor always moves to a data point regardless of the displayed scales Pressing ENTER places a marker at the current waveleng
62. ell Changer is stalled in use or fails to initialise E3001 E3002 E3054 E3055 E3082 E3084 5 The sample compartment is open E3053 E3062 E3068 E3069 E3071 A comprehensive list of these codes is available in the Service Manual for this product Generation of a code not related to replacement of either the tungsten or deuterium lamps usually requires you to contact your local Thermo Spectronic approved Customer Support Organisation BioMate 5 Issue 1 English 85 MAINTENANCE ROUTINE MAINTENANCE Very little maintenance is required to keep the spectrophotometer in good working condition The interior should be kept as dust free as possible and the sample compartment cleaned regularly wipe off spilt chemicals immediately Replacement sample compartment liners are available under the following part number 9423 UV9 7020E Cleaning Instrument Exterior The exterior of the instrument can be cleaned periodically as follows CAUTION Do not allow moisture to leak into the instrument Q Switch off the spectrophotometer and disconnect from the mains supply Q Using a lint free cloth dampened with a weak solution of detergent and water wipe the exterior surface of the instrument as necessary Q Wipe over with a cloth dampened with plain water Q Dry the surface with another cloth 86 English BioMate 5 Issue 1 MAINTENANCE REMOVAL AND REPLACEMENT OF TUNGSTEN HALOGEN LAMP WARNING Switch off and disconnect the spectrophotometer from
63. eturns to the SETUP page When UVCalc has been turned off the UVCalc disk will be required to reinstate it BioMate 5 Issue 1 English 67 SETUP WAVELENGTH CALIBRATION Page Q From this page the Wavelength calibration of the WAVELENGTH CALIBRATION instrument can be adjusted CALIBRATION USING D2 LAMP WARNING DO NOT ATTEMPT TO RECALIBRATE THE INSTRUMENT UNLESS YOU ARE ABSOLUTELY SURE YOU NEED TO DO SO IF IN ANY DOUBT CONTACT THERMO SPECTRONIC APPROVED CUSTOMER SUPPORT ENSURE BOTH SAMPLE AND REFERENCE BEAMS ARE CLEAR BEFORE ATTEMPTING ANY WAVELENGTH CALIBRATION a This option will optimise the wavelength calibration of the instrument by measuring the Deuterium lamp emission line at 656 1nm and fitting the calibration accordingly It should only be attempted if for any reason the instrument no longer achieves its quoted wavelength accuracy specification The calibration will take at least 10 minutes Ensure Deuterium Lamp is ON Ensure instrument is fully warmed up and the beams are clear From WAVELENGTH CALIBRATION page press CALIBRATE Once calibration is complete switch the instrument OFF Switch instrument and Deuterium lamp ON and allow to warm up Run Default Baseline Oooooo OPTICAL INITIALISATION Page Q This page is used to reset the instrument and define its initialisation and default baseline These procedures ensure the optimum performance of the spectrophotometer INITIALISATION TYP
64. etween 190 0 nm and 1096 0 nm Q Selects start wavelength If the start wavelength requires the Deuterium lamp then this will be switched on The Start wavelength must be at least 4 nm less than Stop wavelength The current spectrum will be lost if the Start wavelength is changed STOP g Select a wavelength between 194 0 nm and 1100 0 nm Q Selects stop wavelength The Stop wavelength must be at least 4 nm greater than the Start wavelength The current spectrum will be lost if the Stop wavelength is changed BANDWIDTH This is fixed at 2 0 nm SPEED Selection depends on Scan Type selected Q In Intelliscan mode select from COLOUR ZIP SURVEY NORMAL QUANT Q In Standard mode select from 3800 2400 1200 600 240 120 30 10 or 1 nm per min DATA INTERVAL Sets the frequency of data points in the spectrum Selection depends on Scan Type In Intelliscan mode the data interval is fixed according to the intelliscan type selected Intelliscan Interval between points COLOUR 10nm ZIP 4nm SURVEY 2nm NORMAL inm QUANT 0 5 nm HIGH RES 0 2 nm In Standard mode the choice of data interval depends on the scan speed selected Speeds Data Intervals 3800 10 4 2400 10 4 2 1200 10 4 2 1 600 10 4 2 1 0 5 240 10 4 2 1 0 5 0 2 120 10 4 2 1 0 5 0 2 30 10 4 2 1 0 5 0 2 10 10 4 2 1 0 5 0 2 1 10 4 2 1 0 5 0 2 The current spectrum will be lost if the scan speed is changed 28 BioMate 5
65. eypad and LCD display or externally from a computer Q The system is composed of a spectrophotometer with integral keypad LCD display 1 44 Mbyte Disk Drive Local Control Software and output device LCD display contrast can be controlled during initialisation or from the BIOMATE TESTS GENERAL TESTS and SETUP pages using the left and right arrow keys Q Always remove disks from the disk drive when not in use Never power up the instrument with a disk in place as permanent damage may be caused to the disk The only exception to this rule is when upgrading the instrument software or installing the UVCalc accessory Then automatic recognition of a software disk causes an automatic upgrade of the software a The Local Control software controls all aspects of the systems operation Q Where installed the UVCalc software accessory provides automatic calculation of results from measurements using user defined equations in SCAN FIXED and QUANT modes 6 English BioMate 5 Issue 1 User Interface Key Arrow Keys Numerical Keys Function Keys Clear Enter Run Home Zero Base BioMate 5 Issue 1 GENERAL Home Zero Base Com Run S amp amp 2 Function Keys 4 gt Arrow Keys v Clear Enter Numerical Keys Operation Highlight menu options move track cursor or move 7 Cell Changer depending on page in use Change display contrast with lt gt from Home Page Enter numbers minus and decimal
66. g of the key will be remembered by the system This page allows the 7 Cell Changer to be set up CELL CHANGER To reach this page press ACCESSORIES from the GENERAL TESTS or SETUP pages then select CELL POS 1 CELL CHANGER and press ENTER SPEED HIGH CELL POS Used to change the current cell position This change is reflected in the Status box SPEED Displays a pop up list to enable HIGH MEDIUM or LOW rotation speed to be selected FUNCTION KEY INITIALISE Resets the accessory and places cell 1 in the sample beam 7 CELL CHANGER REMOVAL AND REFIT This procedure is essential for the fitting of any of the alternative cell holders available for long pathlength cells single cell thermostatting or the MiniSipper Ifthe 7 Cell Changer basket is removed replaced at any time the Refit procedure must always be repeated REMOVAL Q Holding the basket firmly with one hand unscrew the central screw anti clockwise until the basket is released Q REPLACE THE COVER ON THE OPTOSENSOR and secure the cell holder 72 English BioMate 5 Issue 1 7 CELL CHANGER REFIT Q Remove the cover from the optosensor and remove the cell holder Q Indentify the position of the keyway on the motor shaft Q View the underside of the basket to locate the position of the moulded key Q Re locate the basket on the shaft ensuring a positive location of the key in the keyway and tightened the cen
67. he MiniSipper is pumping in continuous mode AIR GAP Enter value between 0 and 500 cm Sets the gap between the trailing meniscus of the current sample and the leading meniscus of the next sample The gap is measured to the nearest centimetre BioMate 5 Issue 1 English 77 MINISIPPER For best results set the airgap no less than 8cm from the flowcell SAMPLE VOL f Enter a value between 0 5 and 9 999 ml Sets the volume of sample to be pumped SAMPLE Set to WASTE After measurement the sample is pumped through the flowcell to waste by the act of pumping the next sample LOW VOL Set to OFF A standard internal diameter 4 0mm uptake tube is used FUNCTION KEYS VIEW CALIB Goes to the SIPPER CALIBRATION page CALIBRATE Starts the Sipper calibration procedure Sipper Calibration This calibrates the MiniSipper to take account of variations in pump and uptake tubing and sample viscosities A volume is set and several sips are performed using the appropriate solvent The actual volume sipped is entered and a calculation done to produce a calibration factor This factor is then used to adjust the pumping time to ensure that the correct volume of sample is always used Details of the calibration used are displayed on the SIPPER CALIBRATION page CALIBRATE SIPPER Page O Using the solvent which will be used for the TICALIBRATE SIPPER t sample solutions offer a measuring cylinder NOMINAL VOL 1 000 ml filled to the
68. hen MEASURE STDS NO Press ENTER to display the LIBRARY page Select and load the files for each standard in turn A library of standards can be built up using the MULTI function in FIXED The same method must be used for each MULTI result and will be used for the MCA analysis When the first MULTI A file is loaded the current MCA method is changed to that used to obtain the MULTI A result Standards can thus be used in any combination without having to recalibrate for each new mixture STD1 STD10 STD11 STD20 Toggles between displaying the first and second halves of the Standards List ACCEPT transfers to the MCA METHODS page with the new list accepted CANCEL Transfers to the MCA METHODS page leaving the old list unchanged 56 English BioMate 5 Issue 1 MCA WAVELENGTH ENTRY page Use the up and down arrow arrow keys to move up and down the list When the highlight is on the field to be entered or edited press ENTER to display the EDIT box and enter the values with the numeric keys It is not necessary to enter the values in numerical order although analysis will be quicker if they are Press ENTER when finished The instrument will return to the WAVELENGTH ENTRY page with the new value inserted in the list and the highlight moved to the next wavelength When all wavelengths have been entered press the ACCEPT function key to return to the MCA methods page using the new list or the CANCEL function key to return le
69. ied to the Rate Curve ABS DISPLAY Sets the display of absolute absorbance values or absorbances relative to the first measurement s of the run ORIGINAL Resets the graph to display the data as originally collected ANOTHER CELL Parallel Rate measurements only Enables the results of another sample from the same run to be displayed TRACK Q To move the vertical cursor across the screen use the Left and Right Arrow keys The cursor always moves to a data point regardless of the displayed scales Pressing ENTER places a marker at the current time Q To delete a marker place the cursor on the marker and press CLEAR BioMate 5 Issue 1 English 49 RATE Q The x axis values are used to recalculate the rate of change of Absorbance between the new start and stop times Results are listed on the RATE RESULTS page Up to four discrete pairs of cursors can be placed on the graph Arrows are placed on the cursors and results are displayed on the RATE RESULTS page for those parts of the graph indicated by the arrows Q Selecting SECTION will remove the TRACK markers Q The minimum interval between TRACK cursors is one second TRACK Iolo VIEW RESULTS Switches to the RATE RESULTS page FAST SLOW Toggles between two cursor speeds In FAST mode the cursor jumps 5 of the graph or to the next data point whichever is the greater In SLOW mode the cursor jumps to the next data point or the next display pixel whichever is the grea
70. is not jamming or being fouled on tubing Make sure there are no cells in the beam Fails to initialise Error 3093 Check that the sample compartment lid is correctly shut Check that the accessory panel found at the left hand side of the sample compartment is in place Position the instrument so that it is not directly in strong sunlight If using a water circulator ensure that black water tubing is used Deuterium lamp energy low Lamp energy is indicated as low but performance seems OK Lamp energy was measured with a cell in the beam Remove all cells and re measure the lamp energy Deuterium Lamp energy low Performance is poor in the UV region Plastic cells that do not transmit in the UV are being used The deuterium lamp may need replacing Fails to initialise Error 3027 Check that the beams are clear and retry Record all the error messages 3027 is a general failure message it is usually preceded by more specific error codes Check that the tungsten lamp is working Check that the cell programmer is not blocking the beam If the problem persists insert a blank formatted disk into the disk drive Switch the instrument on whilst holding down the RUN key Debug data will be sent to the disk Email the file to customer support for further help 90 English BioMate 5 Issue 1 FAULT FINDING Connecting BioMate 5 to a PC Terminal programmes You will need
71. is set to RETURN then alternate switch presses will fill and empty the flowcell In this mode instrument operation is completely independent of the SuperSipper SIP amp RUN Sets the system to fill the flowcell and automatically perform a measurement If SAMPLE is set to RETURN then alternate switch presses will fill and empty the flowcell The current method used to produce the result e g if FIXED is current then the sample will be measured using the FIXED METHOD as set 74 English BioMate 5 Issue 1 SUPERSIPPER CONTINUOUS Sets the system to pump continuously to waste Alternate switch AUTOSAM AIR GAP presses will start and stop pumping In this mode instrument operation is completely independent of the SuperSipper Sets the system to work with the Gilson 221XL and 222XL Autosamplers Refer to the Autosampler Interface manual for further details Enter value between 0 and 500 cm Sets the gap between the trailing meniscus of the current sample and the leading meniscus of the next sample The gap is measured to the nearest centimetre For best results set the airgap no less than 8cm from the flowcell SAMPLE VOL SAMPLE WASTE RETURN LOW VOL OFF ON FUNCTION KEYS Enter a value between 0 2 and 9 999 ml Sets the volume of sample to be pumped Selects from WASTE or RETURN After measurement the sample is pumped through the flowcell to waste by the act of pumping the next sample After measurement the pu
72. ish 87 MAINTENANCE REMOVAL AND REPLACEMENT OF DEUTERIUM LAMP WARNING 1 Switch off and disconnect the spectrophotometer from the mains supply and allow the lamp to cool for at least 15 minutes before proceeding 2 UV radiation from a Deuterium lamp can be harmful to the skin and eyes Always view the lamp through protective glasses that will absorb UV radiation Avoid looking directly at the Deuterium arc Do not expose the skin to direct or reflected UV radiation Q Set the power switch to off and disconnect the spectrophotometer from the mains supply Q Remove the back corner cover by turning the fastener one quarter turn anti clockwise and sliding the cover up to remove Q Make sure the lamp has cooled Disconnect the lamp at the in line Inline connector connector Using the key provided loosen the three locating screws rotate lamp assembly anti clockwise and lift lamp out When fitting the Deuterium lamp avoid handling the silica envelope Finger marks become burnt on and cannot be removed after the lamp is switched on This can affect the light output characteristics Handle only the base of the lamp or the mounting plate If the silica envelope becomes contaminated clean with a powerful degreasing solvent such as absolute alcohol before the lamp is switched on Q Take the new lamp identify the notch in the mounting plate Locate the lamp such that the notch points towards the lamp NS h f f i change mir
73. itiaden deine tei aien oats 56 Wavelength Entry cosinat iiei a ayes 57 Calibration z sanre ii ae e Ai ee tame ee 58 Analysing a Sample eccececcceeeeeteeeeeeeneeeeeteeeeeetneeeeeeaa 58 DATA STORE tbra Pagasa n aaa EA AA 59 DIK PIGE ERA EA A ETOT A 61 SETUP OVEMieW Clock mri a a a a a a i 62 Printers eren eae a ea E a satin 2 aA 63 Environments aena m e a e a a a T aii 64 Wavelength Calibration and Optical Initialisation 68 White Light sets ties co sects a a a A EAA 69 SOUP CVG niie a cat pence ad aa e a a a 69 Recordem a r e a area a aa aiaa a Eade eea a al eae 70 LAMPS aeeie a ae ie eee aa 71 7 CELL CHANGER 7 Cell Changer modes of operation 0 eeeeeeeeeteeeeeetees 72 Removal and Refit cccccceeeceseeeeeceeeeeeeeeeeeceeeeeeeeeeeeeeeeea 72 SUPERSIPPER SuperSipper modes of operation ccccceceeeceecereeeeees 74 Sipper Calibration ccccceccececeeeeeeeeceeceeeeeeeeseesesiaeeeeeees 75 MINISIPPER MiniSipper modes of operation ccesesecceeeeeeeeeeeeeee 77 MiniSipper Calibration eccceeecceceeeeeeeeeeeeeeeeeeeeeeeeeeees 78 CALIBRATION VALIDATION CAROUSEL CVC Setup CVG ai uane aeea e a aE sheet gas e 80 CVC modes of operation 0 ccceceeeccecceceeeeeeeeeeeeeeeeeeeeees 81 Results Removal and Refit ccccccccceeecesseseeeeeeeseanees 82 INTERNAL PRINTER Internal Printer Operation ccceceeeeeeee
74. lated 00 00 00 15 00 30 lElelplo VIEW RESULTS Switches to the RATE RESULTS page RATE PAGE Returns to the RATE PARAMETERS page SAVE DATA Brings up the SAVE screen from where method and data can be saved to disk PRINT Provides a hardcopy of the results i e RATE GRAPH and RATE RESULTS MANIPULATE Brings up the Manipulate options 48 English BioMate 5 Issue 1 RATE Q Parallel Rate results have three printing options ALL OVERLAY ALL SEQUENTIAL and ONE RESULT ALL OVERLAY Prints the results of all cells in the run together in batches of 4 3 if using the internal printer TRACK and SECTION markers are not included ALL SEQUENTIAL Prints each result in the run separately TRACK and SECTION markers are included ONE RESULT Prints the result currently displayed TRACK and SECTION markers are included Q Pressing RUN starts a measurement using the current method Q Pressing ZERO BASE zeros the instrument using the wavelength specified in the current method See page 7 MANIPULATE MANIPULATE TRACK SECTION RESCALE SMOOTHING ABS DISPLAY ORIGINAL ANOTHER CELL TRACK Sets the start and stop time for the rate calculations SECTION Sets sequential start and stop times to enable rates to be calculated on up to four sections of the rate curve RESCALE Changes y axis scale automatically or manually SMOOTHING Allows three levels of smoothing to be appl
75. ll be pumped out of the flowcell either to waste or returned to the sample vessel When the sipper is connected a status box is displayed on the right hand side of all the method screens that indicates the presence of the SuperSipper and its status SIPPER Page r A SIPPER a This page allows the SuperSipper to be set S PPER Jorr up for the required analysis The method set MODE SIP l on this page will be saved with any data AIR GAP 50cm i produced by the software SAMPLE VOL 1 000 ml SAMPLE 1 WASTE Q To reach this page press the ACCESSORIES I I eget oe function key on the SETUP or GENERAL PM chal ea a eat ep a BAe ee a ee TESTS page then select SIPPER and press ENTER To change a parameter highlight the required value using the Up Down Arrow keys and press ENTER SIPPER Selects from ON OFF or STANDBY In STANDBY mode the sipper pumps a small volume approximately every 30 minutes This is to change the point at which pressure is applied to the Sipper tubing thus preventing the formation of a permanent kink The first 6 movements are in the Return direction and the next 6 are in the Waste direction The total volume pumped is sufficiently small as to ensure that any sample present remains in the tubing When the sipper is operated normally its clock is reset and the Standby process re starts MODE Selects from SIP SIP amp RUN CONTINUOUS AUTOSAM SIP Sets the system to fill the flowcell If SAMPLE
76. mp direction is reversed and the sample is returned to the sample vessel Toggles ON or OFF Automatically adjusts the pumping time to maintain the correct air gap for narrow uptake tubing Use standard internal diameter 1 1mm uptake tube Use narrow internal diameter 0 8mm uptake tube VIEW CALIB Goes to the SIPPER CALIBRATION page CALIBRATE Starts the Sipper calibration procedure Sipper Calibration Q This calibrates the SuperSipper to take account of variations in pump and uptake tubing and sample viscosities A volume is set and using the appropriate solvent and tubing several sips are performed The actual volume sipped is entered and a calculation done to produce a calibration factor This factor is then used to adjust the pumping time to ensure that the correct volume of sample is always used Q Details of the calibration used are displayed on the SIPPER CALIBRATION page BioMate 5 Issue 1 English 75 CALIBRATE SIPPER Page CALIBRATE SIPPER NOMINAL VOL 1 000 ml NO SIPS DONE 5 SUPERSIPPER Q_ Using the solvent and tubing which will be used for the sample solutions offer a measuring cylinder filled to the highest gradation to the sipper uptake tube and press the switch plate The sipper will pump a sample and the spectrophotometer will issue a beep Withdraw the measuring cylinder and the sipper will pump the air gap The values used for sample volume and air gap are those set on the SIPPER page
77. nd Operator Name are also loaded with the standards and cannot be edited Any attempt to do so causes the prompt Change method by loading MCA standards to appear and no action is taken Changing the MEASURE STANDARDS parameter will cause all previous data to be lost STANDARDS Switches to the STANDARDS ENTRY screen Identifications and concentrations of up to 20 standards may be entered UNITS Switches to the TEXT ENTRY screen Q Enter the units for the concentration WAVELENGTH S Select a wavelength between 190nm and 1100nm If the wavelength requires the Deuterium lamp then this will be switched on The current data will be lost if the wavelength is changed BANDWIDTH This is fixed at 2 0nm INTEGRATION Enter integration time in seconds This sets the integration time for which the result is measured The minimum is 1s and the maximum is 9999s The current data will be lost if the integration time is changed BioMate 5 Issue 1 English 53 MCA DELAY TIME Set a time in the range 00 00 to 99 59 using to separate minutes and seconds The number of seconds must always be entered explicitly Q_ This sets the time between pressing RUN and the start of the measurement The range is from 0 to 99 minutes and 59 seconds This field is only available if UVCalc has been installed LAMP CHANGE Select from 315 320 325 330 335 340 D2 W Q Selects the wavelength at which the source is changed between the
78. nm INTEGRATION 1s STANDARDS 3 REPLICATES 1 UNITS CURVE FIT LINEAR LAMP CHANGE 325 nm USER UVCALC o MEASURE STDS YES SAMPLE POSITIONER AUTO 7 NUMBER OF SAMPLES 2 TEST NAME Enter a description using the TEXT ENTRY screen Q The Test Name identifies the method and will be saved with the method and any results produced by the method WAVELENGTH Select a wavelength between 190 0 nm and 1100 0 nm If the wavelength requires the Deuterium lamp then this will be switched on The current data will be lost if the wavelength is changed BANDWIDTH This is fixed at 2 0 nm INTEGRATION Enter integration time in seconds This sets the integration time for which the result is measured The current data will be lost if the integration time is changed STANDARDS Brings up the Standards Entry Page Use the up and down arrow keys to move through the list of standards When the standard to be entered or edited is highlighted press ENTER to display the Edit pop up Use the numeric keys to enter the concentration of the standard and press ENTER when finished The instrument returns to the Standards Entry page with the highlight on the next standard on the list Up to 20 standards can be specified Changing the standards will cause any current data to be lost REPLICATES Enter number of replicates for each standard Q Sets the number of times each standard is measured maximum 3 Each value obtained is used in the calibration UNIT
79. nm SAMPLE POSITIONER AUTO 6 REF NUMBER OF SAMPLES 1 ID 0 OFF o LOW HIGH LIMITS 9999 9999 STATISTICS OFF AUTOPRINT OFF PRINT SAVE STORED VIEW TEST TEST TESTS RESULTS Running cell growth measurement Q With the cell growth parameter screen displayed select the required Sample Positioner mode number of samples if appropriate and initial sample number ID Place the blank in the correct cell position Press ZERO BASE to measure the blank Place the unknown s in the correct cell position s Press RUN to start the measurement When the instrument is finished measuring the absorbance of the sample it displays the sample number and absorbance on the screen BioMate 5 Issue 1 English 25 BIOMATE APPLICATIONS Oligo calculator functions The oligonucleotide calculator determines the following data for a base sequence that you enter Ooo o vo O Number of bases Percent GC content Molecular weight Absorptivity Conversion factor to be used in Oligonucleotide measurements Tm for oligos up to 20 mers DNA DNA hybrids DNA RNA hybrids amp RNA RNA hybrids Appendix C lists the parameters and formulae used for each of these calculations Specifying a base sequence You will need to enter a base sequence before you can run the oligonucleotide calculations Q With the Base Sequence screen displayed press the Right Left Arrow keys to select the required base Press ENTER to ad
80. nual Warning and caution statements and or symbols are marked on the apparatus where necessary The instrument covers and accessories should only be removed by personnel who have been trained to avoid the risk of electric shocks The mains electricity supply to the instrument must be disconnected at the mains supply connector and at least three minutes allowed for capacitors to discharge Some of the chemicals used in spectrophotometry are corrosive and or flammable and samples may be radioactive toxic or potentially infective Care should be taken to follow the normal laboratory procedures for handling chemicals The UV radiation from a deuterium lamp can be harmful to the skin and eyes Always view the lamp through protective glasses goggles that will absorb the UV radiation and avoid looking directly at the deuterium arc Do not expose the skin to direct or reflected UV radiation Whenever it is likely that safety protection has been impaired the instrument and or accessory must be made inoperative and secured against any unintended operation The matter should then be referred to the appropriate servicing authority Safety protection is likely to be impaired if for example the instrument fails to perform the intended measurements or shows visible damage BioMate 5 Issue 1 English 5 GENERAL GENERAL Introduction Q The range comprises a group of UV Visible spectrophotometers which can be controlled independently via an integral k
81. one and then confirm in writing wy 3 Find a suitable location see below AVOID STATIC ELECTRICITY NO DIRECT B MINIMISE VIBRATION 4 Connect the supplied power cord to the spectrophotometer Connect power cord here 2 English BioMate 5 Issue 1 INSTALLATION 5 Ensure NO SAMPLE S are in place in the sample compartment Turn the spectrophotometer on 6 The Local Control display shows this initialisation sequence Successive items are ticked as the initalisation proceeds SPECTROPHOTOMETER INITIALISING INITIALISE OPTICS TEST W LAMP y INITIALISE MONOCHROMATOR y TEST OPTICS OPTIMISE MONOCHROMATOR y SET DEFAULTS Approximately PLEASE WAIT 3 minutes 7 After initialisation the BioMate Tests Home Page is displayed BIOMATE TESTS NUCLEIC ACID TESTS PROTEIN TESTS CELL GROWTH OLIGO CALCULATOR INSTRUMENT HOURS 1245 SETUP DATA GENERAL STORED REMOTE STORE TESTS TESTS THIS COMPLETES THE INSTALLATION OF A STANDALONE SYSTEM BioMate 5 Issue 1 English INSTALLATION Connecting an External Printer Q ENSURE THAT THE SPECTROPHOTOMETER IS TURNED OFF Q Connect the printer to the Parallel port on the spectrophotometer using the cable supplied Q POWER UP THE SYSTEM AND ALLOW TO INITIALISE From HOME page press SETUP Q Select PRINTER using the cursor keys Q Press ENTER The PRINTERS p
82. onnecting the instrument into a mains socket ensure the socket is earthed Position the instrument sufficiently away from other objects walls etc to ensure a free airflow around the instrument and also to allow access to the mains switch on the rear of the product The mains switch is marked 0 and I When 0 is depressed the instrument is off When I is depressed the instrument is switched on The fuse on the internal power supply is rated at 3 15A type T The following connectors are provided on the rear of the instrument Sipper Use to connect a SuperSipper or MiniSipper RS232 Use to connect a computer or printer with an RS232 interface Parallel Use to connect a printer with a parallel interface Rec Use to connect a Chart Recorder Ensure that any equipment such as printers which are connected to the sockets on the rear panel conform to relevant IEC safety standards Trademarks All company product or brand names are trademarks or registered trademarks of their respective holders BioMate 5 Issue 1 English 1 INSTALLATION THIS SYSTEM IS DESIGNED TO BE USER INSTALLED So use the following procedures to quickly get your new spectrophotometer system in position and running the way you want it 1 Read the Safety instructions on page 5 of this manual 2 Check the component parts of the system against the Despatch Note and Packing List Immediately report any discrepancies by E teleph
83. ops up a window for entry of the required start wavelength GRAPH STOP Pops up a window for entry of the required stop wavelength PROCEED Used after GRAPH HIGH GRAPH LOW GRAPH START or GRAPH STOP to return to the SCAN GRAPH page with the graph rescaled using the new parameters COMPARE Q When selected Compare goes to the LIBRARY page and displays a list of scan data files Highlight the desired file using the Up Down Arrow keys and press LOAD The reference spectrum is displayed as a dotted trace Q Once loaded the reference spectrum will remain on the screen and will be printed with all subsequent scans until removed To remove the reference spectrum from the display select MANIPULATE ORIGINAL or load a new method MODE Select from ABS T 1D 2D 3D 4D ABS Selects Absorbance T Selects transmittance 1D Selects first derivative This records the first derivative of the Absorbance spectrum 2D Selects second derivative This records the second derivative of the Absorbance spectrum 3D Selects third derivative This records the third derivative of the Absorbance spectrum 4D Selects fourth derivative This records the fourth derivative of the Absorbance spectrum PEAKS a This option enables the spectrum to be automatically searched for peaks valleys or zero crossing points Move varies the cursor to one of the options and press ENTER to SKS ees perform a search When the search is complete the ZERO CROSS spe
84. ow keys as above With the required file highlighted press ENTER to display the LIBRARY pop up menu Use the Up Down arrow keys to highlight the required operation and press ENTER LOAD Loads the file from the Library RENAME Switches to the SAVE RENAME page where file name and description can be changed SAVE TO DISK Copies the highlighted file to the disk DELETE Removes the highlighted file from the library 60 English BioMate 5 Issue 1 DATA STORE DISK Page Q This page allows access to the instrument disk drive It lists all the files on the disk currently in the instrument drive including file type description and file name Q Move the cursor to highlight the required file using the Up Down Arrow keys If the file does not appear on the list the gt and lt arrow keys will scroll one page at a time down and up the list There is a slight delay after the key is pressed while the next section of the directory is loaded Once the required file is in the window move the cursor to it using the Up Down arrow keys as above Q When the required file is highlighted select the file by pressing the ENTER key The popup menu will appear Then highlight the required operation and press ENTER LOAD Loads the file from Disk TESTFILE FXD RENAME Switches to the SAVE RENAME page where file LOAD ne RENAME name and description can be changed SAVE TO LIB DELETE SAVE TO LIB Copies the highlighted file to the Library
85. pectrophotometer INITIALISE Initialises the carousel and reads the serial number SETUP PAGE Returns back to SETUP 80 English BioMate 5 Issue 1 CVC SETUP PROCEDURE Q From SETUP choose CVC and place the disk in the drive on the spectrophotometer The first time this procedure is actioned a warning message W1022 NVM Checksum will be displayed This is expected Press C to clear Q With the disk in place press LOAD DATA Appearance of the appropriate Serial Number and Calibration Date confirms storage of the data in NVM CAROUSEL INSTALLATION Q Remove the cover from the optosensor Q Identify the position of the keyway on the motor shaft Q View the underside of the basket to locate the position of the moulded key Q Re locate the basket on the shaft ensuring a positive location of the key in the keyway and tightened the central screw clockwise Q From the CVC page use the INITIALISE function key to correctly identify the carousel with the spectrophotometer At this point check that the two serial numbers match CVC HOME Page CVC TEST TEST STATUS TIME DATE 1 WAVELENGTH PASS 11 05 03 12 96 2 ABSORBANCE PASS 11 20 03 12 96 3 UV ABSORBANCE PASS 11 25 03 12 96 4 STRAY LIGHT PASS 11 28 03 12 96 5 BANDWIDTH PASS 11 33 03 12 96 6 NOISE PASS 11 38 03 12 96 7 DRIFT PASS 12 40 03 12 96 Q This page is reached by pressing CAL VAL from the General Tests page This page
86. pg ml SAMPLE POSITIONER AUTO 6 REF NUMBER OF SAMPLES 1 ID 0 OFF o AUTOPRINT OFF PRINT SAVE STORED VIEW TEST TEST TESTS RESULTS 12 English BioMate 5 Issue 1 BIOMATE APPLICATIONS Running DNA measurements Note If you are using the 7 Cell Changer in AUTO 6 REF mode place the blank and Q Place the blank in the correct cell position Q With the appropriate DNA parameter screen displayed select the required Sample Positioner mode number of samples if appropriate and initial sample number ID unknowns in the correct cell positions and press RUN The instrument will measure the blank and samples automatically Q Press ZERO BASE to measure the blank Q Place the unknown s in the correct cell position s Q Press RUN to start the measurement The DNA measurement screen appears When the instrument is finished measuring the absorbance of the sample it displays the absorbance DNA ratio and DNA concentration on a screen like the one shown below Note Ifall the results do not fit on a single screen press the Down Up Arrow key to display the next previous page of results TEST NAME DNA 260 280 ID ABS A1 ABS A1 ABS REF 1 260 0nm 280 0nm 320 0nm 999 0 123 0 456 0 789 DNA RATIO 1 7 DNA CONC 1234 5 ug ml PROTEIN CONC 1111 1 pg ml 1 1 234 1 567 1 890 DNA RATIO 1 6 DNA CONC 1234 9 ug ml PROTEIN CONC 33 8 pg ml PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS
87. rameters DIRECT UV TEST NAME WAVELENGTH FACTOR DILUTION MULTIPLIER UNITS SAMPLE POSITIONER NUMBER OF SAMPLES DIRECT UV 280 280 0nm 1 000 1 00 mg ml AUTO 6 REF 1 ID 0 OFF o LOW HIGH LIMITS 9999 9999 STATISTICS OFF AUTOPRINT OFF PRINT SAVE STORED VIEW TEST TEST TESTS RESULTS Running Direct UV measurements Q With the appropriate Direct UV parameter screen displayed select the required Sample Positioner mode number of samples if appropriate and initial sample number ID Place the blank in the correct cell position Press ZERO BASE to measure the blank Place the unknown s in the correct cell position s Press RUN The Direct UV measurement screen appears When the instrument has finished measuring the absorbance of the sample it displays the ID absorbance and concentration on a screen like the one shown below TEST NAME DIRECT UV 280 ID ABS CONC 280 0nm mg ml 999 0 121 123 45 1 0 234 2345 6 2 0 345 345678 PRINT SAVE TEST CLEAR LIST DATA PAGE RESULTS BioMate 5 Issue 1 English 23 BIOMATE APPLICATIONS Warburg Christian The Warburg Christian analysis is uses an absorbance difference measurement at 280 and 260nm to determine the concentration of protein in an unknown sample Test parameters WARBURG CHRISTIAN TEST NAME WAVELENGTH 1 WAVELENGTH 2 PROTEIN FACTOR 41
88. rements are made is the product of the MEASURE INTERVAL and the MEASURE CYCLES For example an analysis using 4 cells with MEASURE INTERVAL set to 15 seconds and MEASURE CYCLES set to 20 would give a total measurement time of 5 minutes English BioMate 5 Issue 1 RATE WAVELENGTH Select a wavelength between 190 nm and 1100 nm a Ifa wavelength is selected that requires the Deuterium lamp then this will automatically be switched on Any current data will be lost if the wavelength is changed BANDWIDTH This is fixed at 2 0 nm MEASURE TIME Set a time in the range 00 05 to 99 59 Q For SERIAL Rate measurements this sets the time over which the sample will be measured The range is from 5 seconds to 99 minutes and 59 seconds in steps of 1 second MEASURE INTERVAL Set a time in the range 00 05 to 99 59 QO For PARALLEL Rate measurements the measurement time sets the time between individual measurements on the first cell i e the time for each measurement cycle DELAY TIME i Set a time in the range 00 05 to 99 59 This sets the time between pressing RUN and the start of the measurement The range is from 0 to 99 minutes and 59 seconds in steps of 1 second SLOPE Select from POSITIVE or NEGATIVE Sets the graph to display positive or negative changes in Absorbance Choose POSITIVE if Absorbance increases with time Choose NEGATIVE if Absorbance decreases with time RANGE Set a number in the range 0 to 3A Q This sets
89. result to produce a concentration result Changing the factor will not cause current results to be lost They will be recalculated using the new factor CONC mode is not available when UVCalc has been installed or when MULTI A or SERIAL is selected UNITS Enter units for concentration using the TEXT ENTRY page Only available in CONC mode used to enter the required description of the concentrations up to 11 alphanumeric characters BioMate 5 Issue 1 English 37 USER FIXED Switches to the TEXT ENTRY screen Q The operator name is automatically saved with the method and any data produced by the method Changing the User name will not cause any current data to be lost N B If user log on is in operation the User name cannot be changed UVCALC SAMPLE POSITIONER AUTO 7 AUTO 6 REF MANUAL 7 NUMBER OF SAMPLES Switches to the UVCALC screen if installed Appears when the 7 Cell Changer is fitted Select from AUTO 7 AUTO 6 REF MANUAL 7 Up to 7 measurements may be made without changing the samples in the Cell Changer After each sample measurement the instrument automatically advances the Cell Changer to the appropriate position for the next sample Up to 6 sample measurements may be made without changing the samples in the Cell Changer The instrument automatically measures the blank in position 1 then automatically advances the Cell Changer to the appropriate position for the next sample
90. ror Tighten locating screws Locating screws KO A down with the key provided Q Re connect the new lamp at the in line connector Q Refit the rear cover Q Reconnect the spectrophotometer to the mains supply and switch on Allow half an hour for warm up time Lamp hours must be reset by the controlling software 88 English BioMate 5 Issue 1 FAULT FINDING Fault Finding Guide Problem Symptom Possible Cause Instrument dead The fans are not running 1 N Oo N Ensure the mains lead is firmly pressed home Some leads are a very tight fit in the three pin IEC connector on the rear of the instrument If a switched outlet is being used ensure it is on Check the fuse in the plug Try another mains lead Try another mains outlet Ensure the power switch on the instrument has been fully operated If all of the above are OK the power supply may have failed Contact your local agent Display Blank No text on display a slight glow can be seen around the edges of the display in subdued lighting The contrast control is incorrectly set Go to the HOME page the right and left arrow keys adjust the contrast If nothing happens it may be that error messages are being displayed Press the CLEAR key 5 times at 10 second intervals to clear the error list and try again The display contrast is affected by temperature and may need adjusting from day to day or as the instrument warms up
91. row keys to advance the Cell Changer to the next position Appears when the 7 Cell Changer is fitted and an automatic operating mode has been selected Valid range 1 999 VIEW CALIB Switches to the QUANT GRAPH page if a valid calibration exists VIEW RESULTS Switches to the Quant Results page if there are any sample results SAVE METHOD Brings up the SAVE page from where the method can be saved to Disk PRINT METHOD Prints the current method parameters and the standards table on the printer CALIBRATE Starts the calibration process STANDARDS ENTRY Page Q Select STANDARDS on the Quant Method page to display the Standards Entry Page This page lists the standards as defined in the QUANT METHOD Before the system can be calibrated each standard must have a concentration entered Q To enter Standard concentrations use the up and down arrow keys to move through the list of standards When the standard to be entered or edited is highlighted press ENTER to display the Edit pop up Use the numeric keys to enter the concentration of the standard and press ENTER when finished The instrument returns to the Standards Entry Page with the highlight on the next standard on the list Up to 20 standards can be specified When all the standards have been entered press the ACCEPT function key to return to the QUANT Page with the new list of standards or CANCEL to return leaving the old list unchanged 42 English BioMate 5
92. s ENTER to enable a parameter to be changed Once the method has been set up press RUN The spectrophotometer will perform the rate and display the result on the RATE GRAPH page From here the data can be manipulated and saved to Disk RATE PARAMETERS Page Note The current data will be lost if any of the method parameters except for the ID Slope Factor Units and User name are changed RATE TEST NAME TEST 1 RATE MODE PARALLEL WAVELENGTH 340 0 nm BANDWIDTH 2 0 nm MEASURE INTERVAL 00 30 DELAY TIME 00 00 SLOPE POSITIVE RANGE 0 5 FACTOR 1 000 UNITS I U LAMP CHANGE 325 nm USER Name NUMBER OF SAMPLES 7 MEASURE CYCLES 10 TEST NAME Enter a description using the TEXT ENTRY screen Q The Test Name identifies the method and will be saved with the method and any results produced by the method RATE MODE SERIAL PARALLEL 46 Toggles between SERIAL PARALLEL when 7 Cell Changer is installed Fixed at SERIAL for single cell holders Each sample is measured individually In this mode MEASURE TIME replaces MEASURE INTERVAL and sets the total time over which the sample is measured Rate measurements for up to 7 samples may be made in parallel In this mode MEASURE INTERVAL sets the time between each cycle i e the length of time between successive measurements on the first sample The number of measurements taken on each sample is set by the MEASURE CYCLES parameter The total time over which the measu
93. s page displays the measurements for each standard and the equation of line and correlation coefficient for the curve fit Qll E VIEW CALIB Switches to the QUANT GRAPH page if a valid calibration exists VIEW RESULTS Switches to the QUANT RESULTS page if there are any results in the table QUANT PAGE Switches back to the Quant page EDIT STD Available after calibration Allows each standard to be used ignored or remeasured EDIT CURVE Available after calibration Allows curve fit to be changed 44 English BioMate 5 Issue 1 QUANT QUANT RESULTS Page To view further pages of results use the Up and Down arrow keys Q Pressing RUN takes another sample measurement and displays the result Q Results are numbered sequentially and any batch can be of up to 600 samples QUANT RESULTS ABS CONC mg 1 1 0 201 10 122 2 0 201 10 122 CLEAR RESULTS Deletes all results from the results table QUANT PAGE Switches back to the Quant page SAVE DATA Brings up the SAVE page PRINT RESULTS Gives a printout of the results LIMS EXPORT Sends the results via the RS232 port BioMate 5 Issue 1 English 45 RATE RATE To select Rate highlight the RATE option on the GENERAL TESTS page and press ENTER The RATE Methods page is displayed and from here the instrument and analysis parameters can be set up Move the cursor to the required parameter using the Up Down Arrow keys Pres
94. s via the RS232 port PRINT LIST Prints the list on the selected printer SCAN GRAPH Returns to the SCAN GRAPH page PEAK HEIGHT Page PEAK HEIGHT This page shows the position and values of the MARES ABSA WAVELENGTH na wavelengths and the peak height as selected by the oara Tro PEAK HEIGHT function Not available if UVCalc has 0 375 480 0 been installed QlQIog VIEW GRAPH Returns to the SCAN GRAPH page LIMS EXPORT Sends results via the RS232 port PRINT LIST Prints the list on the selected printer SCAN GRAPH Returns to the SCAN GRAPH page BioMate 5 Issue 1 English 35 FIXED FIXED Q Instrument and analysis parameters are set up on the FIXED page Move the cursor to the required parameter using the Up Down Arrow keys Change the parameter by pressing the ENTER key Q Once the method has been set up ensure that both sample and reference beams are clear or contain blank samples Press ZERO BASE to zero the instrument for the current method then insert the sample and press RUN The spectrophotometer will perform a measurement and display the result on the FIXED RESULTS page Q Once all results have been collected save the data FIXED METHOD Page FIXED MODE ABS TEST NAME 2 SELECT SINGLE 1 WAVELENGTH S 550 0 nm BANDWIDTH 2 0 nm INTEGRATION 1s DELAY TIME 00 00 LAMP CHANGE 325 nm USER UVCALC o SAMPLE POSITIONER AUTO 7 NUMBER OF SAMPLES 2 MODE
95. t for the User name are changed SCAN SCAN TYPE INTELLISCAN TEST NAME TEST 1 MODE ABS START 400 0 nm STOP 600 0 nm BANDWIDTH 2 0 nm SPEED NORMAL DATA INTERVAL 1 0 nm PEAK TABLE OFF GRAPH HIGH 2 000 GRAPH LOW 0 000 SMOOTHING NONE LAMP CHANGE 325 nm USER Name UVCALC o SAMPLE POSITIONER AUTO 7 NUMBER OF SAMPLES 2 SCAN TYPE Select from STANDARD INTELLISCAN Q Standard mode enables the setting of a given scan speed and data interval Intelliscan mode sets the data interval automatically and varies the scan speed according to the Absorbance of the spectrum TEST NAME Enter a description using the TEXT ENTRY screen Q The Test Name identifies the method and will be saved with the method and any spectra produced by the method MODE Select from ABS T 1 1D 2D 3D 4D ABS Selects Absorbance T Selects transmittance Selects Intensity mode This will measure the intensity of the signal in the sample beam 1D Selects first derivative This records the first derivative of the Absorbance spectrum 2D Selects second derivative This records the second derivative of the Absorbance spectrum BioMate 5 Issue 1 English 27 SCAN 3D Selects third derivative This records the third derivative of the Absorbance spectrum 4D Selects fourth derivative This records the fourth derivative of the Absorbance spectrum The current spectrum will be lost if the Scan Mode is changed START Select a wavelength b
96. t supported If in doubt contact your local Thermo Spectronic approved Customer Support Organisation Note Printers designed to work only in a Windows environment are not compatible with Local Control Software Before attempting to print using an external printer at any point during operation of the instrument ensure that the printer is ready to print Failure to do so will result in an error condition Press CLEAR to clear the error message Then rectify the problem with the printer and try again BioMate 5 Issue 1 English 63 SETUP ENVIRONMENT page This page is used to select the language used for the software the use of the beep date format and to enable disable Automatic Calibration Validation and LIMS Laboratory Information Management System Support and to select the default filetype used when saving results Where installed UVCalc can be turned off from the Environment Page by pressing the UVCALC OFF function key When UVCalc has been turned off the UVCalc disk will be required to reinstate it ENVIRONMENT LANGUAGE Select from the list The language used immediately changes to the LANGUAGE ENGLISH one selected SOUND OFF DATE FORMAT dd MM yy AUTOMATIC CAL VAL OFF SOUND Turns the warning beeper DEFAULT FILE TYPE NORMAL ON or OFF If set to OFF then the only LIMS SUPPORT OFF indication of any error is the screen message USE SAMPLE IDS OFF AUTOSAVE RESULTS OFF AUTOPRINT RESULTS OF
97. t the upper y axis value ABS DISPLAY This option enables the RATE GRAPH to be redisplayed with Absolute Absorbance or Relative Absorbance values SMOOTHING This option offers a pop up menu to choose one of three smoothing algorithms Choices are NONE LOW MEDIUM and HIGH A moving point average is performed on the data and in each case data points will be lost from either end of the data SMOOTHING No of POINTS POINTS LOST AT USED EACH END NONE 0 0 LOW 9 4 MEDIUM 17 8 HIGH 37 18 ORIGINAL This removes any manipulation and displays the rate graph as originally specified by the rate method ANOTHER CELL Q If more than one rate has been run in parallel using the 7 Cell Changer then this function allows the results from any cell in the run to be selected and displayed Enter the number of cell for which you wish to display results BioMate 5 Issue 1 English 51 RATE RATE RESULTS Page The Rate Results page displays the Initial and Final Absorbance Initial and Final Time the change in absorbance per minute calculated Activity Correlation Coefficient of the best fit line and finally the smoothing parameter used If the rate curve has been tracked the Initial and Final Absorbance with the Initial and Final Time will reflect those chosen by the two cursors Shown below is the Rate Results page after choosing SECTION and the three sets of data represent results calculated for each section A similar displa
98. tStart Home page listing navigate to the Stored Tests page move the cursor to the required test and press SMART START again 10 English BioMate 5 Issue 1 BIOMATE APPLICATIONS BIOMATE APPLICATIONS All of the parameters for the BioMate applications described in this section are factory set This means that if you want to change the parameters you will need to specify a different name to save the new test parameters Appendix A lists all the parameters used in each pre set test Appendix B lists the calculations used by each test Nucleic acid measurements You can use these tests to determine the concentration and purity of nucleic acid in a given sample Q DNA measures absorbance at 260 and 280nm or at 260 and 230nm determines concentration and purity based on absorbance ratio and absorbance difference Q DNA with scan records absorbance scan between 260 and 280nm or between 260 and 230nm determines concentration and purity based on absorbance ratio and absorbance difference Q dsDNA measures absorbance at 260nm calculates concentration based on absorbance and concentration factor Q ssDNA RNA measures absorbance at 260nm calculates concentration based on absorbance and concentration factor Q Oligonucleotides measures absorbance at 260nm calculates concentration based on absorbance and concentration factor or calculates concentration based on absorbance and concentration factor determined by the oligo
99. ter The function key label shows the next speed ie the opposite to the one selected CLEAR ALL Clears all the markers RATE GRAPH Returns to the RATE GRAPH page SECTION Q To move the vertical cursor across the screen use the Left and Right Arrow keys The cursor always moves to a data point regardless of the displayed scales Pressing ENTER places a marker at the current time Q To delete a marker place the cursor on the marker and press CLEAR Up to five markers can be placed on the graph Rate results will be reported between markers providing a maximum of four sets of results Sections The minimum Section size is one second Results are listed on the RATE RESULTS page Selecting TRACK will remove the SECTION markers RESCALE Q This option gives a pop up menu for changing the graph y axis scale Q Move the cursor to one of the options and press ENTER to select an operation The rescale options depend on whether Absolute or Relative Absorbance has been selected 50 English BioMate 5 Issue 1 RATE Absolute Absorbance AUTO Displays the RATE GRAPH with the y axis rescaled so that the trace fills the screen AUTO GRAPH HIGH GRAPH HIGH GRAPH LOW Allow the user to set the GRAPH LOW upper and lower limits for the RATE GRAPH y axis Relative Absorbance RESCALE AUTO Displays the RATE GRAPH with the y axis rescaled so that the trace fills the screen AUTO RANGE RANGE Allows the user to se
100. th Up to 10 wavelengths can be selected TRACK page function keys Q Pressing CLEAR will delete markers in turn highest number first The x axis values are listed on the TRACK table page Further markers can be added to the spectrum at any time however selecting TRACK will cause any previous PEAK TABLE information to be lost VIEW TABLE Switches to the TRACK TABLE page FAST SLOW Toggles between two cursor speeds In FAST mode the cursor jumps 5 of the graph or to the next data point whichever is the greater In SLOW mode the cursor jumps to the next data point or the next display pixel whichever is the greater The function key label shows the next speed ie the opposite to the one selected CLEAR ALL Clears all the markers and the TRACK TABLE PRINT GRAPH Provides a hardcopy of the results showing the markers and x and y axis values SCAN GRAPH Returns to the SCAN GRAPH page 32 English BioMate 5 Issue 1 SCAN RESCALE Q This option gives pop up menus for changing the graph X and y axis scales AUTO GRAPH HIGH GRAPH LOW Q Move the cursor to one of the options and press GRAPH START ENTER to select an operation GRAPH STOP PROCEED AUTO Displays the SCAN GRAPH with the x and y axes rescaled so that the Spectrum fills the screen GRAPH HIGH Pops up a window for entry of the GRAPH HIGH limit GRAPH LOW Pops up a window for entry of the GRAPH LOW limit GRAPH START P
101. the graph y axis Enter a number slightly larger than the change in Absorbance expected FACTOR Enter the factor for Activity as a number in the range 0 001 to 9999 999 UNITS Enters the units of Activity using the TEXT ENTRY page Q Enters the required description or units of Activity up to 11 alphanumeric characters LAMP CHANGE Select from 315 320 325 330 335 340 D2 W Q Selects the wavelength at which the source is changed between the Tungsten and Deuterium lamps Selecting D2 or W overrides any changeover and the selected lamp will be used regardless of the wavelength set USER Switches to the TEXT ENTRY screen Q The User name is automatically saved with the method and any data produced by the method Changing the User name will not cause the current data to be lost If User Log on is in operation the User name cannot be changed BioMate 5 Issue 1 English 47 RATE NUMBER OF SAMPLES For PARALLEL Rate measurements Valid range 2 7 MEASURE CYCLES For PARALLEL Rate measurements Valid range 1 300 RATE PARAMETERS Page function keys RATE Llll VIEW RESULTS Goes to the RATE RESULTS page VIEW GRAPH Goes to the RATE GRAPH page SAVE METHOD Brings up the SAVE page from where the method can be saved to disk PRINT METHOD Prints the current method parameters on the printer RATE GRAPH Page This page displays the RATE curve and allows it to be manipu
102. tral screw clockwise Q From the CELL CHANGER page use the INITIALISE function key to correctly align the basket with the spectrophotometer This last action is important to ensure the correct operation of the system Whilst there is significant resistance to manual movement of the motor it is suggested that as routine initialisation of the 7 Cell Changer should be performed as a check before any measurements are performed BioMate 5 Issue 1 English 73 SUPERSIPPER SUPERSIPPER Q The SuperSipper is an optional accessory that enables samples to be drawn into a flowcell of the user s choice for automatic measurement After the measurement is complete the sample may be sent to waste or returned to its original vessel A continuous pumping mode allows the system to be washed through when required e g between applications This section describes the operation of the SuperSipper with the Local Control software Full details of the installation and operation of the accessory are described in the SuperSipper Installation and Maintenance Manual 9499 230 29611 supplied with the SuperSipper To operate the SuperSipper install as described in the above manual Present the sample to the SuperSipper and press the switch The required sample volume will be drawn into the tubing When the system beeps remove the sample and the required air gap will be drawn in Once the measurement has taken place press the switch again The sample wi
103. ttempting to print at any point during operation of the instrument ensure that the printer is ready to print ie switched on on line and supplied with paper Failure to do so will result in an error condition Press Clear to clear the error message the system may take a little time to respond Ensure the printer is ready and retry BioMate 5 Issue 1 English 65 SETUP USER LOG ON The default setting is OFF Changing the setting to ON is password protected When set to OFF any user has full access to all the functions of the instrument When set to ON users must identify themselves by user name and password at log on and then have access to whichever functions are enabled for them by the System Administrator Setting User Log on to ON is password protected Use the up and down arrow keys to move the highlight to USER LOG ON and press Enter This brings up the Text Entry Page When the correct password is entered USER LOG ON is set to ON otherwise an error message is displayed and it remains set to OFF The default password is ADMIN Note that the password is case sensitive and in this password all the letters are upper case Logging on as ADMIN gives access to the system at Administrator level and the CHANGE USERS function key is enabled CURRENT USERS PASSWORD E EDIT METHODS H HISTORY FILE C CALIBRATIONS L RESET LIFETIMES F DELETE FILES B DEFAULT BASELINE I INITIALISATIONS USERS CANCEL ACCEPT 1
104. ue 1 FAULT FINDING Using Hyperterminal to collect data 1 From the menu bar select TRANSFERS and then CAPTURE TEXT Helios HyperT erminal Reon 2 The CAPTURE TEXT dialogue box appears Type in a path and file name then key START Capture Text 3 Once the instrument has stopped sending data from the menu bar Select TRANSFER then CAPTURE TEXT then key STOP to terminate the transfer and save the file Helios HyperT erminal Capture Text BioMate 5 Issue 1 English 93 APPENDIX A BIOMATE 5 TEST PARAMETERS The following table lists alphabetically all the parameters used for the BioMate Tests The list includes a brief description of each parameter the applicable range and the initial default values Use this list as a reference when setting up tests INITIAL DEFAULT PARAMETER DESCRIPTION VALUES RANGE a Percentage of formamide 50 1 100 Formamide contained in the sample Integer 3 Percentage of GC pairs contained empty not an entry NA GC in the sample OnE Percentage of mismatched bases 0 1 100 Mismatched in the sample Integer Turns automatic printout on or off Off OnoOff Auto Print Base Sequence Sequence of bases contained in the sample empty field unless sequence entered previously 40 characters max Molarity of cation Na contained 0 050 0 001 9999 Cation Molarity in the sample Type of Line fit calculation Std Curve Linear Linear Curve Fit
105. ug ml Standard concentrations of 0 200 400 600 800 1000 Second ort 595nm 10 100ug ml Standard concentrations of 0 20 40 60 80 100 Second or 550nm Standard concentrations of 0 100 200 500 1000 2000 Second or 750nm 10 500ug ml Standard concentrations of 0 20 50 100 200 500 Second or 562nm 0 1 Img ml Standard concentrations of 0 0 2 0 4 0 6 0 8 1 Second or 562nm Standard concentrations of 0 0 5 1 2 5 10 First order through zero 540nm 0 10mg ml Standard concentrations of 0 2 4 6 8 10 Conc F x A230 280nm mg ml Factorogo Conc F x A205 205nm mg ml Factor295 31 Dilution Factor Dp A 280nm mg ml diluent vol sample vol A 260nm sample volume f 1 55 Protein Concentration f 0 76 Ai fi A2 f Dr Call growth BioMate 5 Issue 1 English 97 APPENDIX C BIOMATE OLIGO CALCULATOR Calculation Name Entry Parameters l Formula l Displayed Units of bases Repetitive sequence of A T G and C Count of total of bases entered Length of bases GC content Use ATGC sequence entered above GC of G C bases x 100 Percentage total of ATGC Molecular weight MW 312 2 x A 328 2 x T Molecular weight x daltons M 288 2 x G 303 2 x C 61 Absorptivity 260 16 000 x A 9 600 x T Extinction coefficient M em mo 000 x G 7 000 x C Factor e a i El Weight x 10 ug mL e a i El Coefficient Calculation of Tm ee units A
106. used Selection of SEEDED causes two additional items to appear in the Environment Menu SAMPLE ID Enter the name of the sample via the Text Entry Page Use the Arrow keys to move the cursor to the required character and press ENTER Once all the required characters up to 11 have been entered press ACCEPT If you make a mistake oOlololol will act as a backspace or CLEAR will clear the whole entry SAMPLE ID SEED Sets the number to be used for the first sample via the numeric keypad The Sample ID is incremented automatically after each run Q PROMPT USER Before each run the Text Entry Page appears and the user is prompted to enter an identity for the sample NOTE a When the 7 Cell Changer is used in automatic mode the Sample ID is incremented automatically without stopping for ID confirmation between samples b PROMPT USER is not compatible with the Sipper used in Sip and Run or AutoSampler modes AUTOSAVE RESULTS Toggles between ON and OFF When ON results are saved automatically after each run Selecting ON causes two additional items to appear in the Environment menu FILENAME Enter a filename of up to 5 characters via the Text Entry Page FILE NUMBER Enter a number between 0 and 999 via the numeric keypad The number is appended to the filename and incremented automatically after each run AUTOPRINT RESULTS Toggles between ON and OFF When ON results are printed automatically after each run Before a
107. visable to use the 0 1V setting and only use the 2 appropriate plugs red and black Q The Chart High and Chart Low parameters set the 0 to 1V full scale deflection fsd on the analogue chart recorder output for each of the available measurement modes Q Operating tip if you are working with absorbances close to zero best results are obtained if the Chart Low ABS limit is set to a small negative value say 0 1A Q Now navigate to your chosen method insert a blank sample and press ZERO Once the instrument has finished zeroing adjust the chart recorder backoff so that its baseline is at the required position Q N B The chart recorder will be driven off scale while the instrument is zeroing 70 English BioMate 5 Issue 1 SETUP LAMPS Page Q The lamp functions are available directly from the LAMPS key on the SETUP page If User Log on is not in use the GENERAL TESTS page will also have a LAMPS key Q This page shows the status of the Tungsten Halogen and Deuterium lamps whether ON OFF or FAILED and their appropriate energy levels It also allows the lamp hours to be reset and the Deuterium lamp to be switched on or off Q The HOURS parameter states the number of hours that the lamp has been in use The Tungsten Halogen lamp should be replaced after 2000 hours The Deuterium lamp should be replaced after 1000 hours Whenever a lamp is changed then the hours parameter should be reset to zero LAMPS TUNGSTEN ON
108. wavelengths have been entered go back to the SCAN METHOD page and save the method This function allows the ratio of the measurements at the two wavelengths to be automatically calculated at the end of the scan e g Abs A1 Abs A2 To enter the desired wavelengths select PEAK TABLE and press ENTER then select RATIO A pop up box appears in which to enter the first wavelength Enter the desired wavelength and press ENTER Repeat for the second wavelength Once all the method parameters have been set save the method This function allows the ratio of measurements at two wavelengths to be calculated relative to that at a third wavelength automatically at the end of a scan e g Abs A1 Abs A3 Abs A2 Abs A3 To enter the desired wavelengths select PEAK TABLE and press ENTER then select CORR RATIO A pop up box appears in which to enter the first wavelength Enter the desired wavelength and press ENTER Repeat for the second and correction wavelengths Once all the method parameters have been set save the method This function allows the height of a peak to be calculated relative to local baseline rather than y 0 To enter the desired wavelengths select PEAK TABLE and press ENTER then select PEAK HEIGHT A pop up box appears in which to enter the wavelengths required 44 and define the baseline A2 defines the peak Once all the parameters have been set save the method Select from range GRAPH LOW 0 01 to 6 00 Sets
109. y will be seen with TRACK RATE RESULTS VIEW GRAPH Returns to the RATE GRAPH page RATE PAGE Returns to the RATE PARAMETERS page SAVE DATA Brings up the SAVE screen from where method and data can be saved to disk PRINT Provides a hardcopy of the results i e RATE GRAPH and RATE RESULTS LIMS EXPORT Sends the results via the RS232 port Q For Parallel Rate measurements to view the result of any other sample press MANIPULATE on the RATE GRAPH page and select ANOTHER CELL Q To print the results press PRINT on either the RATE GRAPH page or the RATE RESULTS page 52 English BioMate 5 Issue 1 MCA MCA Q The MCA Multi Component Analysis application is able to measure up to 20 components in a mixture measuring up to 20 wavelengths per sample Q Standards can be measured at run time or loaded from files obtained using the MULTI function of the FIXED application MCA METHOD Page MCA TEST NAME TEST 1 MEASURE STDS YES STANDARDS o UNITS WAVELENGTH S 1 BANDWIDTH 2 0nm INTEGRATION 1s DELAY TIME 00 LAMP CHANGE 325nm USER Name SAMPLE POSITIONER AUTO 7 NUMBER OF SAMPLES 2 TEST NAME Enter a description using the TEXT ENTRY screen MEASURE STDS Use ENTER to toggle between YES and NO YES Standards are measured with the run and all fields remain editable NO Standards are loaded from Library or Disk The Wavelength s Bandwidth Integration Delay time Lamp change a

BioMate 5 USER MANUAL

Contents

Download Pdf Manuals

Related Search

Related Contents