ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction
Contents
1. 3 6 Sequencing Bacterial Genomic DNA 3 7 Thermal Cyclers a DH EHE 3 7 Sequencing Bacterial Genomic DNA on the 3700 3 7 Preparing Sequencing 3 7 Cycle Sequencing d ueste LEURS 3 8 Sequencing on the CATALYST 800 3 9 OVELVIEW 56 o ROG RR RUNE ERR 3 9 Options for 3 9 Manual Ethanol Precipitation 3 9 Sequencing the ABI PRISM 877 3 10 Predefined Temperature 1 3 10 Ethanol Precipitation 3 10 4 Purifying Extension Products Chapter Summary er OS EIUS E 4 1 In This Chapter sete ge eg RR ive st pee I Race ge gc 4 1 Choosing a Method of Purification 4 2 Purposes sre v ERR EL ESAE BRUN RON ERES ee tte be 4 2 Spin Column vs Precipitation 4 2 Plate and Spin Column 4 2 OVErVIEW r3 Open n PRSE ELE 4 2 Recommended 384 Well Plate Columns 4 2 Recommended 96 Well Plate Columns 4 2 Recommended Spin 1 4 3 Optimizing Spin Column Purification2. 1 9 Reagents and Storage c css esient ee 1 10 Available Kats ere aS GRUSS 1 10 Description of 1 10 Storage and Use of the Kits 1 10 Materials Supplied by the 1 11 ou ace ee REIR e EE e 1 11 Materials for Cycle Sequencing 1 11 Materials for Purifying Extension 1 12 Materials for Electrophoresis 1 13 Thermal Cycling Tubes 1 14 eL LR ATH EN e DOREM E 1 15 e BDT book Pageii Monday December 13 1999 1 54 PM 1 Documentation User Attention 1 15 Ordering MSDSS 2 2 RR RR ques eR Ra 1 15 Chemical Hazard 1 16 2 Preparing the Templates Chapter Summary 2 1 n This Chapter Sr o e monete xe er RIT ses 2 1 Control DNA Templates ee 2 2 Using Control DNA teh 2 2 Control DNA Sequence eee 2 2 An Additional Control 0 0 eee eee 2 2 Template Preparation 2 3 Single and Double Stranded Templates 2 3 BAC DNA Templates 2 2 Ro aves cde
3. To precipitate in microcentrifuge tubes continued Step Action 6 Carefully aspirate the supernatants with a separate pipette tip for each sample and discard Pellets may or may not be visible IMPORTANT The supernatants must be removed completely as unincorporated dye terminators are dissolved in them The more residual supernatant left in the tubes the more unincorporated dye terminators will remain in the samples Add 250 uL of 75 isopropanol to the tubes and vortex them briefly Place the tubes in the microcentrifuge in the same orientation as in step 5 and spin for 5 minutes at maximum speed Aspirate the supernatants carefully as in step 6 Dry the samples in a vacuum centrifuge for 10 15 minutes or to dryness Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 for 1 minute 4 8 Purifying Extension Products e e book Page 9 Monday December 13 1999 1 54 PM 1 Ethanol Precipitation Unincorporated Terminators Precipitating in 384 Well Plates Precipitating in 96 Well Plates With ethanol precipitation traces of unincorporated terminators may be seen at the beginning of the sequence data up to base 40 but this is usually minimal Some loss in the recovery of the smallest fragments may also be observed IMPORTANT If you are precipitating in 384 well plates refer to the ABI PRISM
4. 5 3 Electrophoresis on the ABI PRISM 377 Sequencers 5 4 Requirements one xe RU iv Ee 5 4 Using the Lane Guide Kit 5 4 Using Long Read Gel and Buffer Formulations 5 4 Resuspending and Loading the Samples 5 5 Electrophoresis on the ABI PRISM 373 with BigDye Filter Wheel 5 6 Requirements ex E eR ERREUR E 5 6 Resuspending and Loading the Samples 5 6 Control DNA Sequence Control Sequence vov LL E EL UV Pee ned e eS A 1 Partial Sequence 34 1 Ri e BDT book Page v Monday December 13 1999 1 54 1 Ri B Technical Support Technical Support o eed eee ate ARE RE Se E B 1 To Reach Us on the amp B 1 Hours for Telephone Technical B 1 To Reach Us by Telephone or Fax in North B 1 Documents on 2 To Reach Us by E Mail esses B 3 e BDT book Page vi Monday December 13 1999 1 54 PM e e book Page 1 Monday December 13 1999 1 54 PM 1 Introduction Chapter Summary In This Chapter The following topics are covered in this chapter Topic See Page Two Kits Available 1 2 Instrument Platforms and Require
5. leave chemical containers open Use only with adequate ventilation Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended on the MSDS Comply with all local state provincial or national laws and regulations related to chemical storage handling and disposal gt je e book Page 1 Monday December 13 1999 1 54 PM 1 Preparing the Templates Chapter Summary In This Chapter The following topics are covered in this chapter Topic See Page Control DNA Templates 2 2 Template Preparation Methods 2 3 Single and Double Stranded Templates 2 3 BAC DNA Templates 2 3 PCR Templates 2 4 Use of the Primer Island Transposition Kit 2 5 Template and Primer Quantities 2 6 Preparing the Templates 2 1 je e book Page 2 Monday December 13 1999 1 54 1 Control DNA Templates Using Control DNA Control DNA Sequence An Additional Control Include a control DNA template as one of the templates in a set of sequencing reactions The results from the control can help determine whether failed reactions are the result of poor template quality or sequencing reaction failure We recommend M13mp18 as a single stranded control and pGEM 3Zf as a double stranded control All PE Biosystems DNA sequencing kits provide pGEM control DNA All dye terminato
6. 4 3 Performing Spin Column Purification 4 4 Isopropanol 4 5 9 0 e BDT book Page iv Monday December 13 1999 1 54 1 Precipitating in 384 Well 4 5 Precipitating in 96 Well 1 4 5 Precipitating in Microcentrifuge 4 7 Ethanol Precipitation eioan erana eee ee eee 4 9 Unincorporated Terminators 4 9 Precipitating in 384 Well 4 0 Precipitating in 96 Well 1 4 0 Precipitating in Microcentrifuge 4 11 Ethanol Sodium Acetate Precipitation 4 13 Procedure Not for 3700 DNA 4 13 Precipitating in 96 Well 1 4 13 Precipitating Microcentrifuge 4 15 Sample Electrophoresis Chapter Summary 1 2 eee ee eee eens 5 1 Chapter ved erected THE Eee ete 5 1 Electrophoresis on the ABI PRISM 3700 DNA Analyzer 5 2 OVELVIEW esee tad Sach eate geet he 5 2 Electrophoresis on the ABI PRISM 310 Genetic Analyzer 5 2 re ee ere 5 2 Resuspending the 1
7. To precipitate in 96 well MicroAmp trays continued Step Action 6 Place the tray in a tabletop centrifuge with tube tray adaptor and spin it at the maximum speed which must be 21400 x g but 3000 x g 1400 2000 g 45 minutes 2000 3000 x g 30 minutes Note MicroAmp tube in a MicroAmp Tray can withstand 3000 x g for 30 minutes IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Without disturbing the precipitates remove the adhesive tape and discard the supernatant by inverting the tray onto a paper towel folded to the size of the tray Place the inverted tray with the towel into the table top centrifuge and spin at 700 x g for 1 minute Add 150 uL of 70 ethanol to each pellet 10 Cap or seal the tubes then invert the tray a few times to mix 11 Spin the tray for 10 minutes at maximum speed 12 Repeat steps 7 and 8 13 Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary 4 14 Purifying Extension Products e BDT book Page 15 Monday December 13 1999 1 54 PM Precipitating To precipitate in microcentrifuge tubes Microcentrifuge Tubes Step Action 1 For each sequencing reaction prepare a 1 5 mL microcentrifuge tube containing the
8. Filter Set E Run Modules Configuration Run Module POP 6 polymer 1 mL syringe Seq POP6 1 mL E 61 cm 50 i d capillary POP 6 polymer Rapid Sequencing Seq POP6 1 mL Rapid E 1 mL syringe 47 cm 50 i d capillary Dye Set Primer Mobility Files Instrument Dye Set Primer File ABI PRISM 310 POP 6 polymer DT POP6 BD Set Any Primer ABI PRISM 310 POP 6 polymer Rapid DT POP6 BD Set Any Primer Sequencing Filter Set E Instrument Matrix File Data analysis requires Filter Set E instrument matrix file made from the ABI PRism dRhodamine matrix standards P N 4305080 See the Automated DNA Sequencing Chemistry Guide P N 4305080 http Awww pebio com ab techsupp 310 html for more information 5 2 Sample Electrophoresis e book Page 3 Monday December 13 1999 1 54 1 Resuspending the To resuspend the samples Samples Step Action 1 Resuspend each sample pellet 12 25 uL of Template Suppression reagent TSR supplied with the polymer Vortex and spin the samples Heat the samples at 95 for 2 minutes then chill on ice Vortex and spin the samples again Place on ice until ready to use OIN Refer to the ABI PRISM 310 Genetic Analyzer User s Manual P N 903565 for guidelines on loading the samples Note Although freezing is not recommended on a routine basis you can keep samples pre
9. Tubes 0 5 mL a These thermal cyclers require mineral oil that can be obtained from PE Biosystems P N 0186 2302 d e BDT book Page 15 Monday December 13 1999 1 54 PM Safety Documentation User Attention Words Ordering MSDSs Five user attention words appear in the text of all PE Biosystems user documentation Each word implies a particular level of observation or action as follows Note This word is used to call attention to information IMPORTANT This word calls attention to information that is necessary for correct use of the kit or instrument CAUTION This word informs the user that damage to the instrument could occur if the user does not comply with the information It also indicates a potentially hazardous situation that could result in minor or moderate injury to the user WARNING This word informs the user that serious physical injury or illness to the user or other persons could occur if these required precautions are not taken DANGER Indicates an imminently hazardous situation that if not avoided will result in death or serious injury You can order free additional copies of MSDSs for chemicals manufactured or distributed by PE Biosystems using the contact information below To order MSDSs Then Over the Internet Use www pebio com techsupport a Select MSDS Search button b Enter keywords or partial words or a part number or the MSDSs Documen
10. 2 3 PER Templates pie e rep EE pee 2 4 Use of the Primer Island Transposition 2 5 Overview Cup dH eg e ER a RR RUE 2 5 About Transposons lessen 2 5 Inserting Artificial 2 5 Technique eo res Op b RM 2 5 Template and Primer 2 6 OVELVICW c tb ce UR es e s t grace trc ee 2 6 Template Quantity IA 2 6 Template Volume eA 2 6 3 Performing Cycle Sequencing Chapter Summary 0 0 I 3 1 In Eis Chapter es cd mte TCR noe OT EE 3 1 Sequencing Plasmids and PCR Products 3 2 OVELVIEW NP geen edd 3 2 Sequencing Plasmids on 3700 3 2 Instruments dele ree UEBER qeR PER 3 2 Preparing the 3 2 P e BDT book Page iii Monday December 13 1999 1 54 1 Cycle Sequencing on the GeneAmp 9700 9600 or 2400 3 3 Cycle Sequencing on TC1 or DNA Thermal Cycler 480 3 3 Sequencing BAC DNA dese do bade ee ae eh Gece be bees 3 5 Thermal Cyclers ea ERU ee ANE E 3 5 Sequencing BAC DNA 3700 3 5 Preparing Sequencing 3 5 Performing Cycle Sequencing
11. ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kits Original and Version 2 0 Protocol PE Biosystems A PE Corporation Business e BDT book Pageii Monday December 13 1999 1 54 PM Copyright 1999 PE Corporation Printed in the U S A For Research Use Only Not for use in diagnostic procedures Notice to Purchaser Limited License The purchase of the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit or the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit v2 0 include a limited nontransferable non exclusive license without the right to resell repackage or sublicense under U S Patent 5 800 996 and corresponding foreign patents and patent applications to use this product solely with an Applied Biosystems commercial automated DNA sequencing machine or other authorized automated DNA sequencing machines that have been authorized under this patent by PE Corporation No license is hereby granted for the use of this kit or the reagents therein in any other automated sequencing machine Such license is granted solely for research and other uses that are not unlawful No other license is granted expressly impliedly or by estoppel For information concerning the availability of additional licenses to practice the patented methodologies contact Director of Licensing PE Corporation PE Biosystems 850 Lincoln Centre Drive Foster City California 94404 Patents are
12. Cycle Sequencing To perform cycle sequencing Step Action 1 Place the tubes in a thermal cycler and set the volume to 40 2 Heat the tubes at 95 for 5 minutes 3 Repeat the following for 45 cycles Rapid thermal ramp to 95 95 C for 30 seconds Rapid thermal ramp to 50 55 depending on template 55 C 20 seconds Rapid thermal ramp to 60 60 C for 4 minutes 4 Rapid thermal ramp to 4 C and hold until ready to purify 5 Spin down the contents of the tubes in a microcentrifuge 6 Proceed to Chapter 4 Purifying Extension Products a Rapid thermal ramp is 1 C sec 3 8 Performing Cycle Sequencing e book Page 9 Monday December 13 1999 1 54 PM 1 Sequencing on the CATALYST 800 Overview Options for Sequencing Manual Ethanol Precipitation Required Templates that have been prepared as described in chapter 2 should be suitable for use on the CATALYST 800 Molecular Biology LabStation Follow the protocols in the Turbo Appendix of the CATALYST 800 Molecular Biology LabStation User s Manual P N 903939 to set up your reactions Terminator sequencing has two options A reaction premix containing the sequencing primer or premixing template with primer in the sample tube A reaction cocktail lacking primers water and primer from one tube combined with template from another tube Ethanol precipitation is
13. Washington Univ School of Medicine Genome Sequencing Center http genome wustl edu gsc Protocols BAC shtml Commercial Kits Commercial kits are also available for BAC DNA preparation QIAGEN tip 100 QIAGEN P N 10043 25 reactions 10045 100 reactions QIAGEN tip 500 QIAGEN P N 10063 25 reactions 10065 100 reactions 1 Marra M Weinstock L A and Mardis E R 1996 End sequence determination from large insert cloning using energy transfer fluorescent primers Genomic Methods 6 1118 1122 Preparing the Templates 2 3 e book Page 4 Monday December 13 1999 1 54 PM 1 E PCR Templates Cycle sequencing provides the most reproducible results for sequencing PCR templates Although PCR fragments can be difficult to denature with traditional sequencing methods cycle sequencing provides several chances to denature and extend the template which ensures adequate signal in the sequencing reaction Importance of Purifying Product For optimum results purify the PCR product before sequencing In general any method that removes dNTPs and primers should work We recommend Centricon 100 columns P N N930 2119 The protocol for using these columns is provided in Purifying PCR Fragments Purifying PCR Fragments To purify PCR fragments by ultrafiltration Step Action 1 Assemble the Centricon 100 column according to the manufacturer s recommendations 2 Load 2 mL deionized wat
14. BDT book Page 11 Monday December 13 1999 1 54 PM Precipitating in precipitate in microcentrifuge tubes Microcentrifuge Tubes Step Action 1 Pipet the entire contents of each extension reaction into a 1 5 mL microcentrifuge tube Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 4 7 Add the following 16 of deionized water 64 uL of non denatured 95 ethanol The final ethanol concentration should be 60 3 WARNING CHEMICAL HAZARD Ethanol is a flammable chemical and is irritating to the skin eyes respiratory system It can cause nerve and liver damage CNS depression nausea vomiting and headache Always work ina fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Close the tubes and vortex briefly Leave the tubes at room temperature for 15 minutes to precipitate the extension products Note Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators Place the tubes in a microcentrifuge and mark their orientations Spin the tubes for 20 minutes at maximum speed IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more imme
15. Thailand Bangkok 662 719 6406 Fax 662 319 9788
16. pGEM 3Zf sequenced with BigDye terminators v2 0 Introduction 1 5 e BDT book Page 6 Monday December 13 1999 1 54 DyeSpectra The normalized emission spectra of the dRhodamine dyes in the BigDye terminators are shown below 10 dTAMBA Fluorescence 500 550 600 650 700 Wavelength 1 6 Introduction 5 e e BDT book Page 7 Monday December 13 1999 1 54 PM T Tt Instrument Platforms and Required Software Instrument The ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Platforms Kits are for use with the following instruments ABI PRISM 3700 DNA Analyzer ABI PRISM 810 Genetic Analyzer ABI PRISM 377 DNA Sequencers ABI PRISM 377 ABI PRISM 377 18 ABI PRISM 377 with XL Upgrade ABI PRISM 377 with 96 Lane Upgrade ABI PRISM 373 DNA Sequencers with BigDye Filter Wheel ABI PRISM 373 ABI PRISM 378 with XL Upgrade These kits are designed for use with ABI PRISM 373 DNA Sequencers and ABI PRISM 373 DNA Sequencers with XL Upgrade on which the ABI PRISM BigDye Filter Wheel has been installed Refer to the ABI PRISM BigDye Filter Wheel User Bulletin P N 4304367 for more information Thermal Cyclers This protocol has been optimized for all PE Biosystems thermal cyclers including GeneAmp PCR Systems 9700 9600 and 2400 ABI PRISM 877 Integrated Thermal Cycler CATALYST 800 Molecular Biology LabStation
17. plasmid M13 BAC large 3 3 2 2 DNA 3 Vortex and spin the samples Heat the samples at 95 for 2 minutes to denature Place on ice until ready to load 5 6 Sample Electrophoresis T e BDT book Page 7 Monday December 13 1999 1 54 PM 1 To resuspend and load the samples continued Step Action 5 Load each sample into a separate lane of the gel as follows Volume pL 18 24 320r 36 Template well well 48 well 64 well PCR product 3 4 3 4 2 4 2 4 plasmid M13 BAC large 3 3 2 2 DNA Sample Electrophoresis 5 7 e book Page 8 Monday December 13 1999 1 54 e e book Page 1 Monday December 13 1999 1 54 PM 1 Control DNA Sequence Control Sequence Partial Sequence The pGEM 3Zf sequence below is the the sequence of the 21 M13 of 37 forward primer followed by the ensuing 1000 bases TGTAAAACGACGGCCAGT 21 M13 primer GAATTGTAAT GTACCCGGGG GCTTGAGTAT ATCATGGTCA CTCACAATTC GTAAAGCCTG AATTGCGTTG CTGTCGTGCC GGAGAGGCGG GCTCACTGAC GCGGTATCAG CAGAATCAGG AGGCCAGCAA CTGGCGTTTT ACAAAAATCG AGGACTATAA CTCGTGCGCT ACCTGTCCGC TCATAGCTCA GTTCGCTCCA AGCCCGACCG GTCCAACCCG GCCACTGGTA GTGCTACAGA CACTAGAAGG ACGACTCACT ATCCTCTAGA TCTATAGTGT TAGCTGTTTC CACACAACAT GGGTGCCTAA CGCTCACTGC AGCTGCATTA TTTGCGTATT TCGCTGCGCT CTCACTCAAA GGATAACGCA AAGG
18. the pipet tip does not touch the gel surface If samples are not properly loaded peaks from unincorporated dye terminators can result Spin the column at 325 730 x g for best results Use the following formula to calculate the best speed for your centrifuge 11 18 x rx rpm 1000 where relative centrifugal force r radius of the rotor in cm rpm revolutions per minute not spin for more than 2 minutes Perform the entire procedure without interruption to ensure optimal results Do not allow the column to dry out Purifying Extension Products 4 3 je e BDT book Page 4 Monday December 13 1999 1 54 PM Performing Spin perform spin column purification Column Purification Step Action 1 Gently tap the column to cause the gel material to settle to the bottom of the column Remove the upper end cap and add 0 8 mL of deionized water Replace the upper end cap and vortex or invert the column a few times to mix the water and gel material Allow the gel to hydrate at room temperature for at least 2 hours Note Hydrated columns can be stored for a few days at 2 6 Longer storage in water is not recommended Allow columns stored at 2 6 to warm to room temperature before use Remove any air bubbles by inverting or tapping the column and allowing the gel to settle Remove the upper end cap first then remove the bottom cap Allow the column to dra
19. the reaction mixtures Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 8 0 uL Template Single stranded DNA 50 100 ng Double stranded DNA 200 500 ng PCR product DNA See table in Template Quantity on page 2 6 Primer 3 2 pmol Deionized water q s Total Volume 20 uL 2 Mix well and spin briefly 3 2 Performing Cycle Sequencing e book Page 3 Monday December 13 1999 1 54 1 M To prepare the reaction mixtures continued Step Action 3 If using the DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 overlay reaction mixture with 40 uL of light mineral oil Cycle Sequencing sequence DNA on the GeneAmp PCR System 9700 9600 or 2400 on the 9700 9600 or 2400 Action 1 Place the tubes in a thermal cycler and set the volume to 20 2 Repeat the following for 25 cycles Rapid thermal ramp to 96 96 for 10 seconds Rapid thermal ramp to 50 50 C for 5 seconds Rapid thermal ramp to 60 60 C for 4 minutes 3 Rapid thermal ramp to 4 C and hold until ready to purify 4 Spin down the contents of the tubes in a microcentrifuge 5 Proceed to Chapter 4 Purifying Extension Products a Rapid thermal ramp is 1 C sec Cycle Sequencing seq
20. 0 P N Kit Reactions 403052 M13 Reverse 100 4313682 Lane Guide 200 403050 M13 Reverse 5000 4313677 Lane Guide 1000 403057 Protocol 4313679 Lane Guide 5000 4313804 Protocol BigDye Terminator Cycle Sequencing Kits with AmpliTaq DNA Polymerase FS ABI Prism Matrix Standards P N Kit Reactions P N Kit Instrument 4303149 Ready Reaction 100 4305609 Matrix Standard Set 3700 4303150 Ready Reaction 1000 403047 dRhodamine Matrix 310 4303151 Ready Reaction 5000 Standards 4303237 Protocol 403047 dRhodamine Matrix 377 373 Standards a BDT book Page vi Monday December 13 1999 1 54 1 PE Biosystems A PE Corporation Business THE AMERICAS United States PE Biosystems 850 Lincoln Centre Drive Foster City CA 94404 650 570 6667 800 345 5224 Fax 650 572 2743 Canada Mississauga Ontario Tel 905 821 8183 800 668 6913 Fax 905 821 8246 Latin America Del A Obregon Mexico Tel 305 670 4350 Fax 305 670 4349 EUROPE AFRICA Austria Wien Tel 01 602 3101 01 602 5174 Benelux Nieuwerkerk IJssel Netherlands Tel 31 0 180 331400 Fax 31 0 180 331409 Chekia Rep Praha Tel 2 61 22 21 64 Fax 2 61 22 21 68 Denmark Aller d Tel 48 100 400 Fax 48 100 401 Finland Espoo Tel 09 751 72 700 Fax 09 751 72 701 France Paris Tel 33 1 69 59 85 85 Fax 33 1 69 59 85 00 P N 4303237 Rev D Germany Wei
21. 3 1999 1 54 PM 1 T Materials Supplied by the User Overview IMPORTANT This section describes materials that are required for sample preparation Refer to the instrument s user manual for materials that are required for the operation of the instrument Topic See Page Materials for Cycle Sequencing 1 11 Materials for Purifying Extension Products 1 12 Materials for Electrophoresis 1 13 Materials for Cycle Sequencing ABI Prism 3700 DNA Analyzer Material Supplier GeneAmp PCR Systems 9700 or PE Biosystems 9600 Thermal cycling tubes see PE Biosystems page 1 14 ABI PRISM 310 Genetic Analyzer Thermal Cycler see page 1 7 PE Biosystems Thermal cycling tubes see PE Biosystems page 1 14 ABI PRISM 377 or 373 with BigDye Filter Wheel Thermal Cycler see 1 7 PE Biosystems Thermal cycling tubes see PE Biosystems page 1 14 Introduction 1 11 e BDT book Page 12 Monday December 13 1999 1 54 PM 1 E Materials for Purifying Extension Products 1 12 Introduction ABI Prism 3700 DNA Analyzer Material Supplier Choose one of the following 384 Well Plate Columns for Purification See page 4 2 96 Well Plate Columns for Purification See page 4 2 Ethanol EtOH non denatured 9596 MLS lIsopropanol 100 anhydrous MLS Aluminum foil tape adhesive backed Scotch Tape P N 439 ABI PRISM 310 Genetic Analy
22. 3700 DNA Analyzer Sequencing Chemistry Guide P N 4309125 for the procedure IMPORTANT Where 9596 ethanol is recommended in precipitation protocols purchase non denatured ethanol at this concentration rather than absolute 100926 ethanol Absolute ethanol absorbs water from the atmosphere gradually decreasing its concentration This can lead to inaccurate final concentrations of ethanol which can affect some protocols To precipitate in 96 well MicroAmp plates Step Action 1 Remove the MicroAmp plate from the thermal cycler Remove the caps from each tube 2 Add the following 16 of deionized water 64 uL of non denatured 95 ethanol The final ethanol concentration should be 60 3 WARNING CHEMICAL HAZARD Ethanol is a flammable chemical and is irritating to the skin eyes respiratory system It can cause nerve and liver damage CNS depression nausea vomiting and headache Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves 3 Seal the tubes with strip caps or by applying a piece of 3M Scotch Tape 439 adhesive backed aluminum foil tape Press the foil onto the tubes to prevent any leakage 4 Invert the tray a few times to mix Purifying Extension Products 4 9 e BDT book Page 10 Monday December 13 1999 1 54 PM To precipitate in 96 well MicroAmp plates continued Step Ac
23. CCAGGA TCCATAGGCT ACGCTCAAGT AGATACCAGG CTCCTGTTCC CTTTCTCCCT CGCTGTAGGT AGCTGGGCTG CTGCGCCTTA GTAAGACACG ACAGGATTAG GTTCTTGAAG ACAGTATTTG ATAGGGCGAA GTCGACCTGC CACCTAAATA CTGTGTGAAA ACGAGCCGGA TGAGTGAGCT CCGCTTTCCA ATGAATCGGC GGGCGCTCTT CGGTCGTTCG GGCGGTAATA GGAAAGAACA ACCGTAAAAA CCGCCCCCCT CAGAGGTGGC CGTTTCCCCC GACCCTGCCG TCGGGAAGCG ATCTCAGTTC TGTGCACGAA TCCGGTAACT ACTTATCGCC CAGAGCGAGG TGGTGGCCTA GTATCTGCGC TTCGAGCTCG AGGCATGCAA GCTTGGCGTA TTGTTATCCG AGCATAAAGT AACTCACATT GTCGGGAAAC CAACGCGCGG CCGCTTCCTC GCTGCGGCGA CGGTTATCCA TGTGAGCAAA GGCCGCGTTG GACGAGCATC GAAACCCGAC TGGAAGCTCC CTTACCGGAT TGGCGCTTTC GGTGTAGGTC CCCCCCGTTC ATCGTCTTGA ACTGGCAGCA TATGTAGGCG ACTACGGCTA TCTGCTGAAG Control Sequence 1 40 80 120 160 200 240 280 320 360 400 440 480 520 560 600 640 680 720 760 800 840 880 920 960 1000 e e book Page 2 Monday December 13 1999 1 54 e e book Page 1 Monday December 13 1999 1 54 PM 1 Technical Support Technical Support To Reach Us on the Web Hours for Telephone Technical Support To Reach Us by Telephone or Fax in North America PE Biosystems web site address is http www pebiosystems com techsupport We strongly encourage you to visit our web site for answers to frequently asked questions and to learn more about our products You can also order technical documents
24. High Accuracy Reads on the 377 Sequencer P N 4315153 Both the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit and the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit v2 0 provide DNA Polymerase FS BigDye terminators and all the required components for the sequencing reaction In the Ready Reaction format the dye terminators deoxynucleoside triphosphates AmpliTaq DNA Polymerase FS r7th pyrophosphatase a component in AmpliTaq DNA Polymerase FS magnesium chloride and buffer are premixed into a single tube of Ready Reaction Mix and are ready to use These reagents are suitable for performing fluorescence based cycle sequencing reactions on single stranded or double stranded DNA templates on polymerase chain reaction PCR fragments and on large templates e g BAC clones o 0 e BDT book Page 3 Monday December 13 1999 1 54 1 T The dNTP mix includes dITP in place of dGTP to minimize band compressions The dNTP mix also uses dUTP in place of dTTP dUTP improves the incorporation of the T terminator and results in a better T pattern Cycle Sequencing Both kit formulations contain the sequencing enzyme DNA with Polymerase FS This enzyme is a variant of Thermus aquaticus DNA AmpliTaq DNA Polymerase that contains point mutation in the active site This results Polymerase FS in less discrimination against dideoxynucleotides This enzy
25. If a weak signal is obtained on the ABI PRISM 377 with XL Upgrade rerun the samples using a CCD gain of 4 Refer to the ABI PRISM 377 DNA Sequencer XL Upgrade User s Manual P N 904412 for more information Sample Electrophoresis 5 5 o 340 e BDT book Page 6 Monday December 13 1999 1 54 Electrophoresis on the ABI PRISM 373 with BigDye Filter Wheel Requirements Electrophoresis Collect BigDye terminator data with Filter Set A on the ABI PRISM 373 Resuspending and To resuspend and load the samples Loading the Samples E sequencer with BigDye Filter Wheel Data Analysis Data analysis requires a Filter Set A instrument matrix file made from the ABI PRISM dRhodamine matrix standards P N 4305080 and BigDye terminator mobility file Step Action 1 Prepare a loading buffer by combining the following in a 5 1 ratio 5 parts deionized formamide to 1 part EDTA with blue dextran Deionized formamide 25 mM EDTA pH 8 0 with blue dextran 50 mg mL WARNING CHEMICAL HAZARD Formamide is a known teratogen i e it can cause birth defects Wash thoroughly after handling formamide Wear appropriate protective eyewear clothing and gloves Obtain a copy of the MSDS from the manufacturer 2 Resuspend each sample pellet in loading buffer as follows Volume pL 180r24 320r 36 Template well well 48 well 64 well PCR product 3 4 3 4 4 4
26. P N 4309125 for information about reaction set up and cycle sequencing Preparing The type of tube required depends on the thermal cycler that you are Sequencing Using Refer to Thermal Cycling Tubes Required on page 1 14 Reactions To prepare the sequencing reaction Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 16 uL DNA Template 0 5 1 0 ug Primer 5 10 pmol Deionized water q s Total Volume 40 uL 2 Mix well and spin briefly Performing Cycle Sequencing 3 5 e BDT book Page 6 Monday December 13 1999 1 54 PM 1 Performing Cycle To perform cycle sequencing on BAC DNA Step Action 1 Place the tubes in a thermal cycler and set the volume to 30 uL 2 Heat the tubes at 95 for 5 minutes 3 Repeat the following for 30 cycles Rapid thermal ramp to 95 95 C for 30 seconds Rapid thermal ramp to 50 55 depending on template 50 55 for 10 seconds Rapid thermal ramp to 60 60 C for 4 minutes 4 Rapid thermal ramp to 4 C and hold until ready to purify 5 Spin down the contents of the tubes in a microcentrifuge 6 Proceed to Chapter 4 Purifying Extension Products a Some laboratories have found that increasing the number of cycles gives better results b Rapid thermal ramp is 1 C sec 3 6 Performi
27. S 01 dROX dTAMRA dR6G dR110 PE Biosystems P N 4305609 ABI PRISM 310 Genetic Analyzer Formamide MLS EDTA MLS ABI PRISM dRhodamine Matrix Standards Kit PE Biosystems P N 403047 ABI PRISM 377 or 373 with BigDye Filter Wheel Formamide MLS EDTA MLS 25 mM EDTA with 50 mg mL blue dextran PE Biosystems P N 402055 ABI PRISM dRhodamine Matrix Standards Kit PE Biosystems P N 403047 Introduction 1 13 E 40 e BDT book Page 14 Monday December 13 1999 1 54 PM 1 E Thermal Cycling The table below shows several thermal cyclers along with the Tubes Required appropriate plates and tubes for each 1 14 Introduction Thermal Cycler Plate or Tube PE Biosystems Part Number GeneAmp PCR MicroAmp 384 Well Reaction Plate 4305505 System 9700 MicroAmp 96 Well Reaction Plate N801 0560 MicroAmp Reaction Tubes 0 2 uL N801 0533 GeneAmp PCR MicroAmp 96 Well Reaction Plate N801 0560 System 9600 MicroAmp Reaction Tubes 0 2 uL N801 0533 MicroAmp Caps 12 or 8 strip N801 0534 N801 0535 GeneAmp PCR MicroAmp Reaction Tubes 0 2 uL N801 0533 System 2400 MicroAmp Caps 12 or 8 strip N801 0534 N801 0535 DNA Thermal GeneAmp Thin Walled Reaction N801 0537 Cycler 4808 Tubes 0 5 mL GeneAmp Thin Walled Reaction N801 0737 Tubes with Flat Cap DNA Thermal GeneAmp Thin Walled Reaction N801 0537 Cycler TC1
28. Thermal Cycler 480 Thermal Cycler TC1 If you use a thermal cycler not manufactured by PE Biosystems you may need to optimize thermal cycling conditions Ramping time is very important If the thermal ramping time is too fast gt 1 poor noisy data may result je e book Page 8 Monday December 13 1999 1 54 1 T Run Modules and You must use Filter Set E run modules and dye set primer mobility Dye Set Primer files on instrument platforms except the ABI PRISM 373 DNA Mobility Files Sequencer Use Filter Set A on ABI PRISM 373 DNA Sequencers with the ABI PRISM BigDye Filter Wheel IMPORTANT Users of the ABI PRISM 3700 DNA Analyzer refer to the ABI PRISM 3700 DNA Analyzer User s Manual P N 4306152 for information on run modules and dye set primer mobility files modules and dye set primer mobility files are included in the current versions of data collection software The run modules and dye set primer mobility files can be downloaded from the Internet http www pebio com ab techsupp softlib html f you do not have access to the Internet you can get the files from PE Biosystems Technical Support or from your local field applications specialist call your local sales office for more information Run Modules Run modules are the same as for the dRhodamine terminators and BigDye primers Dye Set Primer Mobility Files You must install new
29. and or an index of available documents and have them faxed or e mailed to you through our site see the Documents on Demand section below In the United States and Canada technical support is available from 5 30 a m to 5 00 p m Pacific Time See the back cover of this booklet for how to contact local service representatives outside of the United States and Canada Call Technical Support at 1 800 831 6844 and select the appropriate option below for support on the product of your choice at any time during the call To open a service call for other support needs or in case of an emergency press 1 after dialing 1 800 831 6844 For Support On This Product Dial 1 800 831 6844 and ABI PRISM 3700 DNA Press FAX Analyzer 8 650 638 5981 DNA Synthesis Plass FAX 21 650 638 5981 Technical Support 1 e book Page 2 Monday December 13 1999 1 54 PM 1 For Support On This Product Dial 1 800 831 6844 and Fluorescent DNA Sequencing Press FAX 22 650 638 5891 Integrated Thermal Cyclers Press FAX 24 650 638 5891 Documents on Free 24 hour access to PE Biosystems technical documents including Demand MSDSs is available by fax or e mail You can access Documents on Demand through the internet or by telephone If you want to order Then through the Use http www pebiosystems
30. chase of this kit reagent includes a limited non exclusive sublicense without the right to resell repackage or further sublicense under such patent rights to use this reagent for DNA sequencing or fragment length analysis solely with a PE commercial automated sequencing machine or other authorized DNA sequencing machines that have been authorized for such use by PE Applied Biosystems of PE Corporation or for manual DNA sequencing No license is hereby granted for the use of this kit or the reagents therein in any other automated sequencing machine Such sublicense is granted solely for research and other uses that are not unlawful No other license is granted expressly impliedly or by estoppel For information concerning the availability of additional license to practice the patented methodologies contact Amersham Life Science Inc Vice President Regulatory Affairs Box 22400 Cleveland Ohio 44122 Patents are pending in countries outside the United States ABI PRISM GeneScan and MicroAmp are registered trademarks of PE Corporation ABI Applied Biosystems BigDye CATALYST PE POP and POP 6 are trademarks of PE Corporation AmpliTaq and GeneAmp are registered trademarks of Roche Molecular Systems Inc Centricon is a trademark of W R Grace and Co Centri Sep is a trademark of Princeton Separations Inc pGEM is a registered trademark of Promega Corporation other trademarks are the sole property of their respective owne
31. com DNA Synthesis Protein Sequencing Peptide and corelab pebio com Technical Support 3 40 e BDT book Page 4 Monday December 13 1999 1 54 e e book Page v Monday December 13 1999 1 54 1 ABI PRISM DNA Sequencing Kits and Related Products 9 To order ABI PRISM DNA Sequencing Kits please contact PE Biosystems at of the regional sales offices listed on the back of this protocol reagents are quality controlled in stable formulations the kits listed below include protocols Protocols can also be ordered separately dRhodamine Terminator Cycle Sequencing Kits with AmpliTaq DNA Polymerase FS P N Kit Reactions 403044 Ready Reaction 100 403045 Ready Reaction 1000 4303143 Ready Reaction 5000 403041 Protocol BigDye Primer Cycle Sequencing Ready Reaction Kits with AmpliTaq DNA Polymerase FS BigDye Terminator Cycle Sequencing Ready Reaction Kits v2 0 with AmpliTaq DNA Polymerase FS P N Kit Reactions 4314414 Ready Reaction 100 4314415 Ready Reaction 1000 4314416 Ready Reaction 5000 4314849 Ready Reaction 25 000 4303237 Protocol ABI Prism Lane Guide Lane P N Primer Reactions Identification Kits for use on the 377 403051 21M13 100 Sequencer 403049 21 M13 500
32. com techsupport internet You can search for documents to order using keywords Up to five documents can be faxed or e mailed to you by title by phone from the a Call 1 800 487 6809 from a touch tone phone Have United States or your fax number ready Canada b Press 1 to order an index of available documents and have it faxed to you Each document in the index has an ID number Use this as your order number in step d below c Call 1 800 487 6809 from a touch tone phone a second time d Press 2 to order up to five documents and have them faxed to you t e book Page 3 Monday December 13 1999 1 54 1 If you want to order Then by phone from a Dial your international access code then outside the 1 858 712 0317 from a touch tone phone United States or Have your complete fax number and country code Canada ready 011 precedes the country code Press 1 to order an index of available documents and have it faxed to you Each document in the index has an ID number Use this as your order number in step d below Call 1 858 712 0317 from a touch tone phone a second time Press 2 to order up to five documents and have them faxed to you To Reach Us Contact technical support by e mail for help in the following product E Mail areas For this product area Use this e mail address Genetic Analysis galab pebio
33. d Software 1 7 Reagents and Storage 1 10 Materials Supplied by the User 1 11 Safety 1 15 Introduction 1 1 je e book Page 2 Monday December 13 1999 1 54 E Two Kits Available Protocol for Two Kits Comparing the Two Kits BigDye Terminator Ready Reaction Kits 1 2 Introduction This protocol describes how to use the following kits ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit v2 0 IMPORTANT The protocol is identical for both of the kits The ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit v2 0 contains the same components as the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit original kit However the ratio of dideoxy to deoxy terminators has been changed in the v2 0 kit The new formulation distributes more signal to the longer DNA fragments Reactions generated with the v2 0 kit show higher signal in longer fragments relative to shorter fragments Recommended Use of Version 2 Kit The v2 0 kit can be used in place of the original kit on all of the sequencing platforms see Instrument Platforms on page 1 7 but is primarily recommended for use with the ABI PRISM 3700 DNA Analyzer and the ABI PRISM 377 DNA Sequencer with 48 cm well to read The v2 0 kit is very effective when following the extended read protocol described in Achieving Longer
34. d plate and spin columns for purifying extension products Recommended For large scale procedures you can use the following commercially 384 Well Plate available 384 well reaction plate Columns Arraylt Telechem P N DTC 384 100 384 System Edge Biosystems P N 95674 Refer to the manufacturer s instructions for procedures Recommended For large scale procedures you can use the following commercially 96 Well Plate available 96 well purification plates Columns 96 Well Spin Columns Gel Filtration Kit Edge Biosystems P N 94880 Telechem P N DTC 96 100 Centri Sep 96 plate Princeton Separations P N CS 961 Multiscreen 96 Well Filter Plates Millipore P N MADYEKIT1 4 2 Purifying Extension Products e book Page 3 Monday December 13 1999 1 54 1 T Quantum Prep SEQueaky Kleen 96 well Terminator Removal Kit Bio Rad 732 6260 Refer to the manufacturer s instructions procedures Recommended We recommend Centri Sep spin columns Princeton Spin Columns Separations P N CS 901 Optimizing Spin IMPORTANT For the BigDye terminators hydrate the column for 2 hours Column Purification Tips for optimizing spin column purification Use one column for each sample not process more columns than you can handle conveniently at one time Load the sample in the center of the column bed Make sure that the sample does not touch the sides of the column and that
35. diately before performing the next step Carefully aspirate the supernatants with a separate pipette tip for each sample and discard Pellets may or may not be visible IMPORTANT The supernatants must be removed completely as unincorporated dye terminators are dissolved in them The more residual supernatant left in the tubes the more unincorporated dye terminators will remain in the samples Add 250 uL of 70 ethanol to the tubes and vortex them briefly Purifying Extension Products 4 11 o e e BDT book Page 12 Monday December 13 1999 1 54 PM 4 12 To precipitate in microcentrifuge tubes continued Step Action 8 Place the tubes in the microcentrifuge in the same orientation as in step 5 and spin for 10 minutes at maximum speed Aspirate the supernatants carefully as in step 6 Dry the samples in a vacuum centrifuge for 10 15 minutes or to dryness Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 for 1 minute Purifying Extension Products e e BDT book Page 13 Monday December 13 1999 1 54 PM 1 Ethanol Sodium Acetate Precipitation Procedure Not for 3700 DNA Analyzer Precipitating in 96 Well Plates IMPORTANT This procedure is not recommended for use on the ABI PRISM 3700 DNA Analyzer IMPORTANT Use non denatured 95 ethanol rather than absolute 100 ethanol Absolute ethano
36. dye set primer mobility files for the BigDye terminators original and version 2 kits Dye set primer file names for the dRhodamine terminators are similar to those for the BigDye terminators Their respective mobility files can be mistaken for each other easily If a mobility file for the wrong sequencing chemistry is used some bases will be miscalled This is because in the dRhodamine chemistry C is labeled with dTAMRA and T labeled with dROX whereas in the BigDye terminator chemistry C is labeled with dROX BigDye and T is labeled with dTAMRA BigDye In addition there are differences in the mobility shifts of dRhodamine terminators and BigDye Terminators gt 0 e book Page 9 Monday December 13 1999 1 54 1 Instrument Data analysis requires a Filter Set E instrument matrix file Matrix File IMPORTANT Users of the ABI PRISM 3700 DNA Analyzer refer to the Required Ap PRISM 3700 DNA Analyzer User s Manual P N 4306152 for information on instrument matrix files For the ABI PRISM 310 377 and 373 with BigDye Filter Wheel Instrument matrix files are the same for dRhodamine terminator chemistry and Big Dye terminator chemistries original and version 2 Instrument matrix files are made using the ABI PRISM dRhodamine matrix standards P N 403047 Refer to the Automated DNA Sequencing Chemistry Guide P N 4305080 http www pebio com ab techsupp 31 0 html for inf
37. e tube To remove reactions run on the TC1 or DNA Thermal Cycler 480 Place the pipette tip into the bottom of the reaction and carefully remove the reaction from the oil Oil Reaction IMPORTANT Transfer as little oil as possible 2 Add one of the following 80 uL of 75 isopropanol 20 uL of deionized water and 60 uL of 100 isopropanol The final isopropanol concentration should be 60 5 WARNING CHEMICAL HAZARD Isopropyl alcohol can be harmful if inhaled ingested or absorbed through the skin It can cause CNS depression and be irritating to the eyes skin and mucous membranes Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves 3 Close the tubes and vortex briefly Leave the tubes at room temperature for 15 minutes to precipitate the extension products Note Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators 5 Place the tubes in a microcentrifuge and mark their orientations Spin the tubes for 20 minutes at maximum speed IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Purifying Extension Products 4 7 o e e book Page 8 Monday December 13 1999 1 54
38. ently as templates for PCR and or sequencing reactions Transposon insertion is an alternative to subcloning or primer walking when sequencing a large cloned DNA region 2 3 The Primer Island Transposition Kit provides reagents for generating artificial transposon insertions into target DNA in vitro The artificial transposon contains the PI and PI priming sites The Primer Island reagents are combined with a target DNA of choice and used to transform Escherichia coll Technique To identify the E coli carrying the transposon the transformed bacteria are plated on Luria Bertani LB agar plates containing carbenicillin and trimethoprim antibiotics Each carbenicillin and trimethoprim resistant colony has integrated a copy of the transposon into the target DNA Follow the Primer Island Transposition Kit Protocol P N 402920 for transposon insertion and template preparation 2 Devine S E and Boeke J D 1994 Efficient integration of artificial transposons into plasmid targets in vitro a useful tool for DNA mapping sequencing and functional analysis Nucleic Acids Res 22 3765 3772 3 Devine S E Chissoe S L Eby Y Wilson R K and Boeke J D 1997 A transposon based strategy for sequencing repetitive DNA in eukaryotic genomes Genome Res 7 551 563 Preparing the Templates 2 5 0 e BDT book Page 6 Monday December 13 1999 1 54 PM T Template and Primer Quantities Overview f poss
39. er onto the column 3 Add the entire sample to the column Spin the column at 3000 x g in a fixed angle centrifuge for 10 minutes Note The manufacturer recommends a maximum speed of 1000 x g but 3000 x g has worked well in PE Biosystems laboratories If you are following the manufacturer s guidelines increase the time to compensate 5 Remove the waste receptacle and attach the collection vial 6 Invert the column and spin it at 270 x g for 2 minutes to collect the sample This should yield approximately 40 60 uL of sample 7 Add deionized water to bring the purified PCR fragments to the original volume 2 4 Preparing the Templates T e book Page 5 Monday December 13 1999 1 54 1 T Use of the Primer Island Transposition Kit Overview BigDye terminators are also suitable for sequencing plasmid templates generated using the Primer Island Transposition Kit P N 402984 This kit uses transposons to insert primer binding sites into cloned DNA About Transposons are mobile genetic elements regions of DNA capable of Transposons inserting themselves or copies of themselves into the genome Transposons encode the proteins that facilitate their insertion into the target DNA Inserting Artificial This property of transposons can be exploited to place unique primer Transposons binding sites randomly throughout any large segment of DNA These primer sites may be used subsequ
40. following 2 0 uL of 3 M sodium acetate NaOAc pH 4 6 50 uL of 95 ethanol EtOH Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 4 7 WARNING CHEMICAL HAZARD Ethanol is a flammable chemical and is irritating to the skin eyes respiratory system It can cause nerve and liver damage CNS depression nausea vomiting and headache Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Pipet the entire contents of each extension reaction into a tube of sodium acetate ethanol mixture Mix thoroughly Vortex the tubes and leave at room temperature for 15 minutes to precipitate the extension products Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators Spin the tubes in a microcentrifuge for 20 min at maximum speed Carefully aspirate the supernatant with a pipette tip and discard IMPORTANT The supernatants must be removed completely as unincorporated dye terminators are dissolved in them The more residual supernatant left in the tubes the more unincorporated dye terminators will remain in the samples Rinse the pellet with 250 uL of 70 ethanol Vortex briefly Spin for 5 m
41. ible quantitate the amount of purified DNA by measuring the absorbance at 260 nm or by some other method Template Quantity The table below shows the amount of template to use in a cycle sequencing reaction Template Quantity PCR product 100 200 bp 1 3 ng 200 500 bp 3 10 ng 500 1000 bp 5 20 ng 1000 2000 bp 10 40 ng 22000 bp 40 100 ng Single stranded 50 100 ng Double stranded 200 500 ng Cosmid BAC 0 5 1 0 ug Bacterial genomic DNA 2 3 ug Note In general higher DNA quantities give higher signal intensities Note The template quantities stated above should work with all primers you may be able to use even less DNA especially when sequencing with the 21 M13 primer The amount of PCR product to use in sequencing will also depend on the length and purity of the PCR product Template Volume Cycle sequencing reactions are made up in a final volume of 20 uL The volume includes 8 uL for DNA template and 4 uL for primer If your DNA is not concentrated enough and you need to add more than 8 uL of DNA template then you can compensate for the additional volume by using a more concentrated solution of primer For example if your concentration of primers is increased from 0 8 pmol uL to 3 2 pmol L then the volume of primers can be reduced from 4 uL to 1 uL Because less volume is used for the primers more volume can then be added for the template In this example the volume of DNA template c
42. in completely by gravity Note If flow does not begin immediately apply gentle pressure to the column with a pipette bulb Insert the column into the wash tube provided Spin the column in a microcentrifuge at 730 x g for 2 minutes to remove the interstitial fluid Remove the column from the wash tube and insert it into a sample collection tube e g a 1 5 mL microcentrifuge tube 10 Remove the extension reaction mixture from its tube and load it carefully onto the center of the gel material Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 4 7 11 Spin the column in a microcentrifuge at 730 x g for 2 minutes Note If using a centrifuge with a fixed angle rotor place the column in the same orientation as it was in for the first spin This is important because the surface of the gel will be at an angle in the column after the first spin 12 Discard the column The sample is in the sample collection tube 13 Dry the sample in a vacuum centrifuge for 10 15 minutes or until dry Do not overdry 44 Purifying Extension Products o e e book Page 5 Monday December 13 1999 1 54 PM 1 T Isopropanol Precipitation Precipitating in IMPORTANT If you are precipitating in 384 well plates refer to the ABI Prism 384 Well Plates 3700 DNA Analyzer Sequencing Chemist
43. inutes in a microcentrifuge at maximum speed Again carefully aspirate the supernatant and discard Dry the pellet in a vacuum centrifuge for 10 15 minutes or until dry Do not over dry Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 for 1 minute Purifying Extension Products 4 15 e e BDT book Page 16 Monday December 13 1999 1 54 PM e e book Page 1 Monday December 13 1999 1 54 PM 1 Sample Electrophoresis Chapter Summary In This Chapter The following topics are covered in this chapter Topic See Page Electrophoresis on the ABI PRISM 3700 DNA Analyzer 5 2 Electrophoresis on the ABI PRISM 310 Genetic Analyzer 5 2 Electrophoresis on the ABI PRISM 377 Sequencers 5 4 Electrophoresis on the ABI PRISM 373 with BigDye Filter Wheel 5 6 Sample Electrophoresis 5 1 je e book Page 2 Monday December 13 1999 1 54 T Electrophoresis on the ABI PRISM 3700 DNA Analyzer Overview For information on how to perform sample electrophoresis on the ABI PRISM 3700 DNA Analyzer refer to the following manuals ABI PRISM 8700 DNA Analyzer Sequencing Chemistry Guide P N 4309125 ABI PRISM 3700 DNA Analyzer User s Manual P N 4306152 Electrophoresis on the ABI PRISM 310 Genetic Analyzer Requirements Electrophoresis and data analysis of samples requires the following
44. l absorbs water from the atmosphere gradually decreasing its concentration This can lead to inaccurate final concentrations of ethanol which can affect some protocols To precipitate in 96 well MicroAmp trays Step Action 1 Remove the MicroAmp Tray from the thermal cycler Remove the caps from each tube Add the following 2 0 uL of 3 M sodium acetate NaOAc pH 4 6 50 uL of 95 ethanol EtOH The final ethanol concentration should be 65 WARNING CHEMICAL HAZARD Ethanol is a flammable chemical and is irritating to the skin eyes respiratory system It can cause nerve and liver damage CNS depression nausea vomiting and headache Always work ina fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Seal the tubes with strip caps or by applying a piece of 3M Scotch Tape 425 3 adhesive backed aluminum foil tape Press the foil onto the tubes to prevent any leakage Invert the tray a few times to mix Leave the tray at room temperature for 15 minutes to precipitate the extension products Note Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators Purifying Extension Products 4 13 e BDT book Page 14 Monday December 13 1999 1 54 PM 1 E
45. me also has a second mutation in the amino terminal domain that virtually eliminates the 53 nuclease activity of AmpliTaq DNA Polymerase The enzyme has been formulated with a thermally stable inorganic pyrophosphatase to eliminate problems associated with pyrophosphorolysis Cycle sequencing protocols that rely on the use of AmpliTaq DNA Polymerase FS offer the following advantages over traditional sequencing methods Less hands on operation No alkaline denaturation step required for double stranded DNA Same protocol for both single and double stranded templates Less starting template needed 9 9 More reproducible results BigDye PE Biosystems has developed a set of dye terminators labeled with Terminators novel high sensitivity dyes The dye structures contain a fluorescein donor dye e g 6 carboxyfluorescein 6 FAM linked to a dichlororhodamine dRhodamine acceptor dye The excitation maximum of each dye label is that of the fluorescein donor and the emission spectrum is that of the dRhodamine acceptor See Dye Spectra on page 1 6 The donor dye is optimized to absorb the excitation energy of the argon ion laser in the PE Biosystems DNA sequencing instruments The linker affords extremely efficient energy transfer quantum efficiency nearly 1 0 i e 10096 between the donor and acceptor dyes The BigDye terminators are 2 3 times brighter than the rhodamine dye terminators when incorporated into cycle sequencing
46. mp Reaction Plates continued Step Action 6 Place the tray in a table top centrifuge with tube tray adaptor and spin it at the maximum speed which must be 21400 x g but 3000 x g 1400 2000 g 45 minutes 2000 3000 x g 30 minutes Note MicroAmp tube in a MicroAmp Tray can withstand 3000 x g for 30 minutes IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step 7 Without disturbing the precipitates remove the adhesive tape and discard the supernatant by inverting the tray onto a paper towel folded to the size of the tray 8 If you are performing this procedure for electrophoresis on the 3700 DNA Analyzer a Rinse the pellet by adding 150 uL of 70 isopropanol to each well b Seal the plate with adhesive tape c Invert the plate a few times 9 Place the inverted tray with the towel into the table top centrifuge and spin at 700 x g for 1 minute 10 Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary 4 6 Purifying Extension Products e BDT book Page 7 Monday December 13 1999 1 54 PM Precipitating in precipitate in microcentrifuge tubes Microcentrifuge Tubes Step Action 1 Pipet the entire contents of each extension reaction into a 1 5 mL microcentrifug
47. n of ethanol until plate processing can be completed This delay can be programmed on the Chemistry page of the Sequencing Notebook 3 10 Performing Cycle Sequencing e book Page 1 Monday December 13 1999 1 54 PM 1 Purifying Extension Products Chapter Summary In This Chapter The following topics are covered in this chapter Topic See Page Choosing a Method of Purification 4 2 Plate and Spin Column Purification 4 2 Isopropanol Precipitation 4 5 Ethanol Precipitation 4 9 Ethanol Sodium Acetate Precipitation 4 13 Purifying Extension Products 4 1 e book Page 2 Monday December 13 1999 1 54 Choosing a Method of Purification Purpose Unincorporated dye terminators must be completely removed before the samples can be analyzed by electrophoresis Excess dye terminators in sequencing reactions obscure data in the early part of the sequence and can interfere with base calling Spin Column vs Use the method that works best for your particular application Precipitation 4 precipitation methods are cheaper and faster but they remove less of the unincorporated dye labeled terminators that can obscure data at the beginning of the sequence The plate column and spin column procedures remove more terminators but are more costly and take time to perform Plate and Spin Column Purification Overview This section describes the recommende
48. ng Cycle Sequencing e BDT book Page 7 Monday December 13 1999 1 54 PM 1 Sequencing Bacterial Genomic DNA Thermal Cyclers Sequencing Bacterial Genomic DNA on the 3700 Preparing Sequencing Reactions The following thermal cyclers can be used with this protocol This protocol needs to be reoptimized for use on other thermal cyclers GeneAmp PCR Systems 9600 or 9700 in 9600 emulation mode ABI PRISM 877 Integrated Thermal Cycler CATALYST 800 Molecular Biology LabStation IMPORTANT If you are sequencing bacterial genomic DNA on the ABI PRISM 3700 DNA Analyzer refer to the AB PRISM 3700 DNA Analyzer Sequencing Chemistry Guide P N 4309125 for information about reaction set up and cycle sequencing The type of tube required depends on the thermal cycler that you are using Refer to Thermal Cycling Tubes Required on page 1 14 To prepare the sequencing reactions for bacterial genomic DNA Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 16 uL DNA Template 2 3 ug Primer 6 13 pmol Deionized water q s Total Volume 40 uL a Shearing the DNA by passing it seven times through a 21 gauge 1 inch long needle can improve signals 2 Mix well and spin briefly Performing Cycle Sequencing 3 7 40 e book Page 8 Monday December 13 1999 1 54 1
49. not available for Terminator Sequencing protocols on the CATALYST 800 Molecular Biology LabStation Ethanol precipitation or spin column purification must be performed manually See Chapter 4 Purifying Extension Products Performing Cycle Sequencing 3 9 e BDT book Page 10 Monday December 13 1999 1 54 PM E Sequencing on the ABI PRISM 877 ITC Predefined Temperature Profiles Ethanol Precipitation Predefined temperature profiles are provided for the following on the ABI PRISM 877 Integrated Thermal Cycler Terminator Sequencing uses a reaction premix containing the sequencing primer or requires premixing template with primer in the sample tube Terminator Automix Sequencing combines reaction cocktail lacking primers water primer from one tube and template from another tube The profile is chosen on the Chemistry page of the Sequencing Notebook and can be edited to make custom profiles Refer to Chapter 4 Using the ABI PRISM 877 Software in the ABI PRISM 877 Integrated Thermal Cycler User s Manual P N 904414 Ethanol precipitation can be chosen for dye terminator sequencing The proportions of ethanol and precipitation additive are set for default reaction volumes These volumes can be changed especially if the reaction volume is modified After the program is completed proceed to Chapter 4 Purifying Extension Products On extended runs e g overnight we recommend withholding additio
50. ormation on creating instrument files Introduction 1 9 e BDT book Page 10 Monday December 13 1999 1 54 PM Reagents and Storage Available Kits The following kits are available Number of Kit Reactions Part Number ABI PRISM BigDye Terminator Cycle 100 4303149 Sequencing Ready Reaction Kit 1000 4303150 5000 4303151 ABI PRISM BigDye Terminator Cycle 100 4314414 Sequencing Ready Reaction Kit v2 0 1000 4314415 5000 4314416 25 000 4314849 Description of description of the kit components is listed below Reagents Terminator Ready Reaction Mix A Dye Terminator labeled with dichloro R6G C Dye Terminator labeled with dichloro ROX G Dye Terminator labeled with dichloro R1 10 TDye Terminator labeled with dichloro TAMRA Deoxynucleoside triphosphates dATP dCTP dITP dUTP AmpliTaq DNA Polymerase FS MgCl Tris HCl buffer pH 9 0 37 double stranded DNA Control Template 0 2 ug uL 21 M13 Control Primer forward 0 8 pmol uL Storage and Use of Store the kits at 15 to 25 C Before each use of either kit allow the the Kits frozen stocks to thaw at room temperature do not heat Whenever possible thawed materials should be kept on ice during use IMPORTANT Mix each stock thoroughly and then centrifuge briefly to collect all the liquid at the bottom of each tube aa 0 e BDT book Page 11 Monday December 1
51. ould be increased from 8 uL to 11 uL 2 6 Preparing the Templates e book Page 1 Monday December 13 1999 1 54 PM 1 Performing Cycle Sequencing Chapter Summary In This Chapter The following topics are covered in this chapter Topic See Page Sequencing Plasmids and PCR Products 3 2 Sequencing BAC DNA 3 5 Sequencing Bacterial Genomic DNA 3 7 Sequencing on the Catalyst 800 3 9 Sequencing on the ABI Prism 877 ITC 3 10 Performing Cycle Sequencing 3 1 je e book Page 2 Monday December 13 1999 1 54 T Sequencing Plasmids and PCR Products Overview This section describes how to prepare reactions and perform cycle sequencing on plasmids and PCR Products Sequencing IMPORTANT If you are sequencing plasmids and PCR products on the Plasmids on the PRISM 3700 DNA Analyzer refer to the PRISM 3700 DNA Analyzer 3700 Sequencing Chemistry Guide P N 4309125 for information about reaction set up and cycle sequencing Instruments The following thermal cyclers can be used with this protocol GeneAmp PCR Systems 9700 9600 and 2400 ABI PRISM 877 Integrated Thermal Cycler CATALYST 800 Molecular Biology LabStation DNA Thermal Cycler 480 DNA Thermal Cycler TC1 9 Preparing the The type of tube required depends on the thermal cycler that you are Reactions using Refer to Thermal Cycling Tubes Required on page 1 14 To prepare
52. pared in TSR frozen for several weeks before running on the ABI PRISM 310 Genetic Analyzer with no detectable loss in resolution or base calling Sample Electrophoresis 5 3 e BDT book Page 4 Monday December 13 1999 1 54 PM T Electrophoresis on the ABI PRISM 377 Sequencers Requirements Electrophoresis and data analysis of samples require the following Filter Set E Run Modules Configurationa Run Module 36 cm wtr 1200 scans hr any comb Seq Run 36E 1200 36 cm wtr 2400 scans hr any comb Seq Run 36E 2400 48 cm wtr 1200 scans hr any comb Seq Run 48E 1200 a Any plate check and prerun modules can be used with the ABI PRISM 377 DNA Sequencer Dye Set Primer Mobility File DT BD Set Any Primer The dye set primer file can be used with 5 and 5 596 Long Ranger gels and 4 and 4 25 polyacrylamide gels 19 1 acrylamide bis Filter Set E Instrument Matrix File Data analysis requires Filter Set E instrument matrix file made from the ABI PRISM dRhodamine matrix standards P N 4305080 See the Automated DNA Sequencing Chemistry Guide P N 4305080 http www pebio com ab techsupp 31 0 html for more information Using the Lane To resuspend and load samples using the ABI PRISM Lane Guide Lane Guide l dentification Kit refer to the kits protocol P N 4313804 Using Long Read For longer sequencing read lengths follow the gel and buffer Gel and Buffer formulations described in the
53. pending in countries outside the United States Notice to Purchaser Limited License The purchase price of this product includes a limited nontransferable license under U S Patent 5 075 216 or its foreign counterparts owned by Roche Molecular Systems Inc and Hoffmann LaRoche Ltd Roche to use only this amount of the product for DNA Sequencing and related processes described in said patent solely for the research and development activities of the purchaser No license under these patents to use the PCR process is conveyed expressly or by implication to the purchaser by the purchase of this product A license to use the PCR Process for certain research and development activities accompanies the purchase of certain reagents from licensed suppliers such as PE when used in conjunction with an Authorized Thermal Cycler or is available from PE Corporation Further information on purchasing licenses to practice PCR Process may be obtained by contacting Director of Licensing at PE Corporation 850 Lincoln Centre Drive Foster City California 94404 or at Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda California 94501 Notice to Purchaser About Limited License This kit reagent is sold pursuant to a limited sublicense from Amersham International plc under one or more U S Patent Nos 5 498 523 4 994 372 U S Patent Application Serial Nos 08 324437 08 337615 and corresponding foreign patents and patent applications The pur
54. products 0 a BDT book Page 4 Monday December 13 1999 1 54 The BigDye terminators are labeled with the following dRhodamine acceptor dyes Color of Raw Data on Color of Raw Data Acceptor ABI PRISM 3700 or 310 on ABI PRISM 377 Terminator Dye Electropherograms or 373 Gel Image A dR6G Green Green C dROX Red Red G dR110 Blue Blue T dTAMRA Black Yellow Comparing Peak Data generated with dRhodamine dye terminators or BigDye Height Patterns terminators gives more even peak height patterns than data generated with rhodamine dye terminators In particular the weak G after A pattern characteristic of the rhodamine dye terminators is greatly reduced Figure 1 1 through Figure 1 4 on page 1 5 TGAATCGGCCAACGCGCGGGG AGAGGCGGTTTGCGTATTGGGCGCTCT 300 310 320 330 340 Figure 1 1 Region of pGEM 3Zf sequenced with rhodamine dye terminators qoc L t je a BDT book 5 Monday December 13 1999 1 54 1 GAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTC 300 310 320 330 Figure 1 2 Region of pGEM 3Zf sequenced with dRhodamine terminators T6G6RRTCGGCCRRCGCGCGGGGR6RG66CGG6TTTGCGTRTTG6GGCGCTCT 300 310 320 330 340 Figure 1 3 Region of pGEM 32Zf sequenced with BigDye terminators ATGAATCGGCCAACGCGCGGGGAGAGGECGGTTIGCGTATTGGGEGCTCT 300 310 320 330 340 li dad Lo al Figure 1 4 Region of
55. r cycle sequencing kits include a 21 M13 control primer The partial sequence of pGEM 3Zf from the 21 M13 forward primer followed by the ensuing 1000 bases is shown in Appendix A Control DNA Sequence The BigDye Terminator Cycle Sequencing Standard P N 4304154 provides an additional control to help in troubleshooting electrophoresis runs This standard contains lyophilized sequencing reactions that require only resuspension and denaturation before use 2 2 Preparing the Templates e book Page 3 Monday December 13 1999 1 54 1 M Template Preparation Methods Single and Refer to the Automated DNA Sequencing Chemistry Guide Double Stranded P N 4305080 http Awww pebio com ab techsupp 310 html for Templates information on preparing single and double stranded templates BAC DNA With larger DNA targets such as bacterial artificial chromosomes Templates BACs the quality of DNA template is important to the success of the sequencing reaction Two methods have given good sequencing results Alkaline lysis Cesium chloride CsCl banding Internet Addresses for BAC DNA Protocols For other BAC DNA preparation protocols refer to the following Internet addresses Centre National CNS or G noscope http www cns fr externe arabidopsis protoBAC html University of Oklahoma Advanced Center for Genome Technology http www genome ou edu DblAcetateProcV3 html
56. rs PE Corporation formerly the Perkin Elmer Corporation is committed to providing the world s leading technology and information for life scientists PE Corporation consists of the PE Biosystems and Celera Genomics businesses PE Biosystems comprises four divisions Applied Biosystems PE Informatics PerSeptive Biosystems and Tropix PE SCIEX which is managed through the PerSeptive Biosystems Division is a joint venture between PE Corporation and SCIEX the instrumentation technology division of MDS Inc e e BDT book Pagei Monday December 13 1999 1 54 PM 1 Contents 1 Introduction Chapter Summary zoo sre RU OUVRIR EE LR EE 1 1 In This Chapter ee rege pex Eee eres 1 1 Two Kits ee 1 2 Protocol for Two Kits ee RES 1 2 Comparing the Two 8 1 2 BigDye Terminator Ready Reaction its 1 2 Cycle Sequencing with AmpliTaq DNA Polymerase FS 1 3 BigDye Terminators 1 3 Comparing Peak Height Patterns 1 4 DyeSpectra os vite EO ER EP S 1 6 Instrument Platforms and Required Software 1 7 Instrument 1 1 7 Therinal Cyclers 1 eee tree rere 1 7 Run Modules and Dye Set Primer Mobility Files 1 8 Instrument Matrix File Required
57. ry Guide P N 4309125 for the procedure Precipitating in Note This procedure does not use salt 96 Well Plates To precipitate in 96 Well MicroAmp Reaction Plates Step Action 1 Remove the MicroAmp Tray from the thermal cycler Remove the caps from each tube 2 Add one of the following 80 uL of 75 isopropanol 20 uL of deionized water and 60 uL of 100 isopropanol The final isopropanol concentration should be 60 5 WARNING CHEMICAL HAZARD Isopropyl alcohol can be harmful if inhaled ingested or absorbed through the skin It can cause CNS depression and be irritating to the eyes skin and mucous membranes Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves 3 Seal the tubes with strip caps or by applying a piece of 3M Scotch Tape 439 adhesive backed aluminum foil tape Press the foil onto the tubes to prevent any leakage Invert the tray a few times to mix 5 Leave the tray at room temperature for 15 minutes to precipitate the extension products Note Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators Purifying Extension Products 4 5 e BDT book Page 6 Monday December 13 1999 1 54 1 T To precipitate in 96 Well MicroA
58. terstadt Tel 0 6150 101 0 Fax 0 6150 101 101 Hungary Budapest Tel 36 1 258 8410 Fax 36 1 256 9802 Italy Milano Tel 039 23831 Fax 039 2383492 Norway Oslo 0 22 02 1500 Fax 0 22 02 1501 Poland Warszawa Tel 48 22 866 4010 Fax 48 22 866 4020 Portugal Lisboa Tel 351 1 386 0997 Fax 351 1 386 1000 Russia Moskva Tel 095 935 8888 Fax 095 564 8787 South Africa Johannesburg Tel 27114780411 2711 478 0349 Spain Madrid 91 806 1200 Fax 91 804 0414 Sweden Stockholm Tel 0 8 619 4400 Fax 0 8 619 4401 Switzerland Rotkreuz 041 799 7708 Fax 041 790 0676 United Kingdom Warrington Cheshire Tel 01925 825650 Fax 01925 282502 Regional Sales Offices Other European Countries Middle East West Asia Africa Except South Africa Langen Germany Tel 49 6103 708 301 Fax 49 6103 708 310 EASTERN ASIA CHINA OCEANIA PACIFIC RIM Australia Scoresby Victoria Tel 03 9212 8585 Fax 03 9212 8502 China Beijing Tel 86 10 6238 1156 Fax 86 10 6238 1162 Hong Kong Tel 852 2756 6928 Fax 852 2756 6968 Japan Chiba Tel 0473 80 8500 Fax 0473 80 8505 Korea Seoul Tel 822 592 7238 Fax 822 532 4908 Malaysia Kuala Lumpur 603 758 1118 Fax 603 754 9043 Singapore Tel 65 896 2118 Fax 65 896 2147 Taiwan Taipei Hsisn Tel 886 22 698 3505 Fax 886 22 698 3405
59. tion 5 Leave the tray at room temperature for 15 minutes to precipitate the extension products Note Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators Place the tray in a tabletop centrifuge with tube tray adaptor and spin it at the maximum speed which must be 21400 x g but 3000 x g 1400 2000 x g 45 minutes 2000 3000 9 30 minutes Note tube MicroAmp Tray can withstand 3000 x g for 30 minutes IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Without disturbing the precipitates remove the adhesive tape and discard the supernatant by inverting the tray onto a paper towel folded to the size of the tray If you are performing this procedure for electrophoresis on the 3700 DNA Analyzer a Rinse the pellet by adding 150 uL of 70 ethanol to each well b Seal the plate with adhesive tape c Invert the plate a few times Place the inverted tray with the towel into the tabletop centrifuge and spin at 700 x g for 1 minute 10 Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary 4 10 Purifying Extension Products e e
60. ts on Demand index number Select Search d Select the Adobe Acrobat symbol to view print or download the document or check the box of the desired document and delivery method fax or e mail By automated Use Documents on Demand on page B 2 telephone service from any country By telephone in the Dial 1 800 327 3002 then press 1 United States Introduction 1 15 e e e BDT book Page 16 Monday December 13 1999 1 54 PM 1 To order MSDSs Then By telephone from Canada If you want ordering Then dial 1 800 668 6913 instructions in and English Press 1 then 2 then 1 again French Press 2 then 2 then 1 By telephone from See the back cover of this protocol booklet any other country For chemicals not manufactured or distributed by PE Biosystems call the chemical manufacturer Chemical Hazard WARNING CHEMICAL HAZARD Some of the chemicals used with Warning PE Biosystems instruments are potentially hazardous and can cause injury illness or death Read and understand the material safety data sheets MSDSs provided by the chemical s manufacturer before you store handle or work with any chemicals or hazardous materials Minimize contact with and inhalation of chemicals Wear appropriate personal protective equipment when handling chemicals e g safety glasses gloves or clothing Consult the listing in the MSDS
61. uence DNA on the TC1 or DNA Thermal Cycler 480 on the TC1 or DNA Thermal SteP Action Cycler 480 1 Place the tubes in a thermal cycler and set the volume to 20 2 Repeat the following for 25 cycles Rapid thermal ramp to 96 96 for 30 seconds Rapid thermal ramp to 50 50 C 15 seconds Rapid thermal ramp to 60 60 for 4 minutes 3 Rapid thermal ramp to 4 C and hold until ready to purify 4 Spin down the contents of the tubes in a microcentrifuge Performing Cycle Sequencing 3 3 je e BDT book Page 4 Monday December 13 1999 1 54 PM To sequence DNA on the TC1 or DNA Thermal Cycler 480 Step Action 5 Proceed to Chapter 4 Purifying Extension Products a Rapid thermal ramp is 1 C sec 3 4 Performing Cycle Sequencing e e book Page 5 Monday December 13 1999 1 54 PM 1 Sequencing BAC DNA Thermal Cyclers The following thermal cyclers can be used with this protocol GeneAmp PCR Systems 9600 or 9700 in 9600 emulation mode ABI PRISM 877 Integrated Thermal Cycler CATALYST 800 Molecular Biology LabStation This protocol needs to be reoptimized for use on other thermal cyclers Sequencing IMPORTANT If you are sequencing DNA on the ABI PRISM 3700 DNA DNA on the 3700 Analyzer refer to the PRISM 3700 DNA Analyzer Sequencing Chemistry Guide
62. user bulletin entitled Achieving Longer Formulations High Accuracy Reads on the 377 Sequencer P N 4315153 5 4 Sample Electrophoresis e book Page 5 Monday December 13 1999 1 54 1 Resuspending and Note You can use any plate check and prerun modules Loading the Samples To resuspend and load the samples Step Action 1 Prepare a loading buffer by combining the following in a 5 1 ratio 5 parts deionized formamide to 1 part EDTA with blue dextran Deionized formamide 25 mM EDTA pH 8 0 with blue dextran 50 mg mL WARNING CHEMICAL HAZARD Formamide is a known teratogen i e it can cause birth defects Wash thoroughly after handling formamide Wear appropriate protective eyewear clothing and gloves Obtain a copy of the MSDS from the manufacturer Resuspend each sample pellet in loading buffer as follows Volume pL Volume pL Template 18 or 36 well 48 64 or 96 well PCR product 6 8 4 6 plasmid M13 BAC large 2 1 5 DNA Vortex and spin the samples Heat the samples at 95 for 2 minutes to denature Place on ice until ready to load Load each sample into a separate lane of the gel as follows Volume pL Volume pL Template 18 or 36 well 48 64 or 96 well PCR product 0 75 1 5 0 5 1 0 plasmid M13 BAC large 2 48 well 1 5 DNA 64 well 1 5 96 well 1 0 1 5 Note
63. zer Choose one of the following Spin column Centri Sep 1 mL 32 columns 100 columns Ethanol EtOH non denatured 9596 Isopropanol 100 anhydrous 75 Isopropanol 9 9 Ethanol non denatured and 9596 Sodium acetate NaOAc 3 M pH 4 6 PE Biosystems P N 401763 P N 401762 MLS MLS MLS MLS and PE Biosystems P N 400320 Aluminum foil tape adhesive backed Scotch Tape P N 439 ABI PRISM 377 or 373 with BigDye Filter Wheel Choose one of the following 96 Well Plate Columns for Purification Spin column Centri Sep 1 mL 32 columns 100 columns Ethanol EtOH non denatured 95 Isopropanol 100 anhydrous 75 Isopropanol 9 9 Ethanol non denatured and 9596 Sodium acetate NaOAc 3 M pH 4 6 See page 4 2 PE Biosystems P N 401763 P N 401762 MLS MLS MLS MLS and PE Biosystems P N 400320 Aluminum foil tape adhesive backed Scotch Tape P N 439 a Contact 3M in the USA at 800 364 3577 for your local 3M representative Use of other tapes may result in leakage or contamination of the sample e BDT book Page 13 Monday December 13 1999 1 54 PM 1 Materials for Electrophoresis ABI Prism 3700 DNA Analyzer Material Supplier Choose one of the following Deionized water MLS 2 Pyrrolidinone MLS Hi Di Formamide 25 mL bottle PE Biosystems P N 4311320 Matrix Standard Set D
Download Pdf Manuals
Related Search