Home

4 - GE Healthcare Life Sciences

Contents

1. S ertia Coshewetas Raw Only baratu Aseqpwoee Optasve Cascet Cheer Aasbypus lekre sion Dargie w atweress Devaton b ormertas Acedyeie Sem Worse 1 Pdeeasee 1 M Codice ptaewetans jE G Coptepertboe Chescrgters 7 l Fie tehewe ten 0 A Puwbor bheem W Close Internation 7 i System Ansgeevest J l Paegeeeet Nasse 1 A set Ascapweres 5 Figure 4 34 Export to Database Options dialogue 3 Select to Include All of the deviations or Approved Only deviations rows 4 The Report Interactive Confirmation Rows Only option is checked to include only those deviation types used for assignment T his list can be modified by clicking on the Interactive Assignment Options button and checking the appropriate deviations in the displayed dialogue 5 Check the relevant Columns options to be included 6 Click on OK Select File Export Result to Database Give the file a name and click on Save see Appendix B 4 15 Changing user 4 36 It is possible that several users will use M utation Analyser during the day without the application being turned off To keep a record of users within the current analysis item file and also in the report it is recommended that each new user logs his her user identification 1 Select Options Change User to display 2 Enter your User ID in the User Identification dialogue or select it from the pull down list if one of the last five names to be used Figure 4 35 User Iden
2. T o Figure 6 14 Edit Sequence dialogue 2 To replace the base select an alternative base A C T G or can be any one of the four bases and click on Replace To delete the selected base click on Delete To insert a base make the appropriate selection and click on Insert The base is inserted after the currently selected base W arning This function should be used with careful consideration since no record is made of the base editing that you perform 6 4 Adding objects to the gene configuration O bjects can be added to the gene configuration such as sequencer fragments exons areas of interest and points of interest Attention It is important that at least one sequencer fragment is defined either automatically or manually in order for the gene configuration to be functional for analysis purposes i 4 1 Adding a new object Select Edit Add Object The Add Object dialogue is displayed 2 Select the type of object to be created either Exon Sequencer Fragment Area of Interest or Point of Interest This will affect the other fields displayed in the dialogue 3 Enter the appropriate information for the selected object see below 4 Click on Add to include the new object in the gene configuration 6 12 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 5 Repeat steps 2 to 4 for other objects you want to add 6 Click on Exit once you have add
3. Basic operation 4 4 3 2 Associating a sample sequence to a fragment In some circumstances you may want to associate a sample sequence to a specific sequencer fragment for alignment This means that the Sample sequence will not be checked against other sequencer fragments during the analysis for a best alignment 1 Inthe Samples field of the Analysis Item window select a sample 2 Select Analysis Associate Fragment with Sample T he Associate Fragment with Sample dialogue is displayed amp Associate Fragment with Sample _ Oy x Sample exon 11 Fragment Any Fragment v Any Fragment Fragment 1 Fragment 2 Cancel Figure 4 11 Associate Fragment with Sample dialogue 3 From the pull down list select the specific sequencer fragment contained within gene configuration with which the selected sample will be aligned in the analysis 4 Click on OK and repeat for other samples 5 Perform a deviation calculation see Section 4 3 3 Note An association can be made after the analysis has been performed The sample corresponding to the selected deviation will be affected 4 3 3 Calculating the deviations and quality summary 1 Select Analysis Calculate Deviations T he samples included in the analysis item are automatically aligned against the gene configuration 2 The Quality Summary dialogue is automatically displayed if you did not deselect this option in the Deviation Calculation Options
4. This may be useful in discerning the peaks In a curve which had a relatively low detection signal during sequencing Attention The adjustments for individual scales are made only for the peaks present in the current display within the Raw Data Curves field Changing the magnification of the view will alter the number of visible peaks and hence the information used to calculate the separate scales Selection of separate scales can be misleading when for example trying to establish if a peak is a true peak or part of the background noise Separate amplitude scales can be toggled on and off by selecting Options Separate Amplitude Scales A check mark beside the menu option indicates that the function is active 4 6 5 Multiple raw data curve sets If you have included reference fragments in your analysis item either defined within the gene configuration see Section 6 4 1 or as separately added samples see Section 4 2 1 the curve data for these will be displayed together with the sample sequence curve data for the selected deviation M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 Some alignment deviations will occur in the overlap regions between sequencing fragments If you select such a deviation in the Deviations Table two or more sets of raw data curves will be displayed in the Raw Data Curves field In all cases the sample curve data for the selected deviation is identified by th
5. calculation i Press OK and the same format previously used in the file will be used Otherwise the export to database operation will be cancelled O pen the file from another directory or open a new file Use a new sample Try closing other applications or restart the computer Corrupted files cannot be used Recreate the source file to be opened Try closing other applications or increase the number of file handles available FILES in config sys M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Can t open sample filename and clone N ot able to open filename Couldn t open analysis item file Error when opening gene configuration file Could not copy graph view to printer Error when loading analysis result no deviations loaded for Instance instance Error when opening gene configuration file description Error when reading analysis file description Error when writing report to filename description Aborting Error while saving Sample sequence changes Error when saving edited sequence description Troubleshooting File not found or already in use When printing a deviation report and the application cannot copy the graph image During deviation calculation W hen there was an unpredicted error during loading W hen an unpredicted error occurred when writing a report to file or exporting result to a data
6. 5 21 this implies that the base calling algorithm had in this case failed to detect a weak signal for the base G If both bases are not present in the sample sequence for example only the base T was present then this suggests a single base deviation in the sample sequence Row Data Curves Espe cied T e Expected base peaks presets eeoec tor Magnrnet io occu Figure 5 23 Raw Data Curves field showing the expected and actual component bases in the raw data 5 4 4 User assignment of mixture insertion deletion deviations H aving performed a mixture analysis use the information in the Mixture Assignment bar to automatically calculate if there has been a base insertion or deletion in the mutated sequence Y ou can then make the appropriate user assignment M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 Mater Aveapemeral i 7 7 S Paice Fata s Coreeri Noun Cpt Tia Cocca Type Da Approwe Ignore Geo Urdei 4 fi Figure 5 24 Mixture Assignment bar The various information contained in the Mixture Assignment bar includes Bp Codon Estimated position of the start of the deviation and codon number in parentheses Type The type of mixture deviation By default MixInsDel is displayed until you direct the program to calculate whether the deletion is a mixture Insertion MixIns or a mixture deletion MixDel see below Size The size of the potential
7. 83 Edition AA 5 7 5 Deviation analysis 5 8 Status Colour The bar changes from grey Pending to either red Approved as deviation black approved Wild type or yellow Ignored Status The status of a particular deviation iS displayed either Wild Approved Or Ignored User Assign The user assigned base ambiguity is displayed Responsible This displays the user ID of the person whom made the assignment for this particular deviation see Section 4 12 Comments Comments that you added during assignment will be displayed By default the next deviation in the Deviations Table is automatically selected for assignment This function can be turned off by selecting Options Interactive Assignment Options and unchecking the Auto Increment Deviation List option To undo an assignment i e return to Pending status select the deviation in the Deviations Table and then Edit Undo Interactive Assignment All user assignment information including any comment will be removed Alternatively if you want to change the assignment e g from Approved to Wild select the deviation and make a new assignment 5 2 6 Approving multiple deviations If the analysis item contains a deviation at the same position in overlapping sample sequences you can make a general user assignment for all such deviations l Select Edit Multiple Sample Approval The function is active when this menu command is checked W hen you select a deviation for
8. Ambig T gt K PCR3 14H3 3 795265 Ambig G gt R PCR3 14H3 3 796 266 Ambig G PCR3 14H3 3 798 266 AmbigA gt R PCR3 14H3 3 799267 Ambig C gt M PCR 3 14H3 3 Ambig G gt R PCR 3 14H3 3 Ambig G gt S Figure 5 16 Deviations Table containing many adjacent ambiguity deviations in a p53 gene sample e Read the sequence data In the Alignment field in the same direction as the sequencing direction i e from left to right for Sense gt gt or from right to leftfor AntiSense lt lt You may see a pattern whereby the upstream region of the sequence shows good alignment and is followed by repeating groups of adjacent point ambiguities Good alignment upstream Region containing many adjacent of the suspected mixture ambiquity deviations typical of a insertion deletion deviation mixture insertion deletion deviation Ne cc OO OOOO Alignment 14H3 3 gt gt Sequencing direction Figure 5 17 Alignment field showing a p53 gene fragment sequenced in the Sense gt gt direction Reading from left to right an area of good alignment precedes an area of adjacent ambiguity deviations e Look at the data in the Analysis Overview window by selecting View Analysis Overview see Section 4 8 You should be able to see that the upstream region of the sample fragment displays relatively few deviations followed by a downstream region that is densely packed with ambiguity deviations 5 14 M utation Analyser
9. Rajbhandary L 1985 Trends in Biochem Sci 10 478 483 Donis K eller H et al 1993 Human M olecular Genetics 2 851 856 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA C 1 C Cited literature C 2 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Index Index aaaaaaaaauuuuuuuaaaauuuuuuuusssssss adding batch samples 4 6 adding objects to a region 6 12 adding reference fragments 4 4 adding samples 4 3 adjusting sample sequence bases mutation analyser 4 32 adjusting sequence bases configuration editor 6 11 ALF ALX sequences defining a region 6 2 algorithms A 1 alignment deviations alignment field 4 20 alignment field 4 19 alignment deviations 4 20 sequencing direction 4 19 ambiguity codes 5 3 ambiguity deviations 5 3 amino acid changes 5 2 amino acid sequence genomic DNA contiguous exons 6 25 non contiguous exons 6 28 mRNA cDNA 6 30 translation 6 31 wrong reading frame 6 29 analysis comments 4 30 analysis item adding samples 4 3 components of 4 2 creating new 4 2 loading 4 8 raw data curves field 4 6 removing a sample 4 8 sample information 4 5 samples 4 5 analysis overview overview display options 4 29 selecting a deviation 4 28 zoom function 4 27 area of interest object adding to region 6 15 ASCII file sequences defining a region 6 7 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Inde
10. a homogenous and homozygous cell sample This can be clearly seen in the Alignment field Delghon Figure 5 10 The appearance a single base deletion above or insertion below for a p53 gene sample sequence in the Alignment field M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 9 5 Deviation analysis M utation Analyser classifies these deviations as Insert and Delete in the Deviations column of the Deviations Table together with the number of inserted or deleted bases for adjacent insertion or deletion positions Dewintens Tntsin Anba OFS Amiao gt ag i Ang Aor Agrtag CoS Arrteg I J Pragmernrt 3 14 MA TH Aarmrieg LH Pragreern 1 MATS Arieg L 2 Fragen H 351 tye Arey A t rregreen i 14 EHUN Arrteg LO Figure 5 11 Deviations Table with an explicit deletion deviation selected in a p53 gene sample In this case it is a single base deletion as denoted by Delete 1 Selection of an insertion or deletion will display the relevant information in the Insertion Assignment and Deletion Assignment bars respectively Dotetios Assigament ET waa Corervert Figure 5 12 Deletion Assignment bar for a deletion deviation of size one base as denoted by the number 1 5 3 1 User assignment of insertion deletion deviations An insertion or deletion deviation selected in the Deviations Table is user assigned in the Insertion Assignment bar and Deletion Assignm
11. a sample in the analysis uncheck it and it will be removed from the analysis item Items not fulfilling the limit criteria will be automatically removed from the analysis item unless you explicitly check them e g for samples containing mixture insertion deletion deviations displaying a poor alignment quality Alignment Information is also shown Unaligned Fragments Colour coded red this displays the number of sequencer fragments that were not assigned a sample following the analysis Partially Aligned Fragments Colour coded yellow this displays the number of sequencer fragments only partly aligned to a sample sequence Fully Aligned Fragments Colour coded green this displays the number of sequencer fragments that were fully aligned with sample data 3 Click on OK The results of the deviation calculation are displayed in several fields including the Deviations Table Alignment field Raw Data Curves field and Assignment bar see Sections 4 4 to 4 8 Wil WAN W i VW i AN W mare cae nine ned Ae Figure 4 13 Mutation Analyser workspace following an analysis of a Ret gene analysis item M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 13 4 Basic operation 4 4 Deviations Table Following analysis the Deviations Table replaces the Samples field see Section 4 2 1 The Deviations Table contains detected alignment deviations for each sample with respect to the gene
12. acid sequence generation between contiguous BRCA1 Exons 2 and 3 but no further generation within the non contiguous Exon 5 and beyond To automatically generate the amino acid sequence in the other exons 1 Select the first exon in the relevant region after the non contiguous break e g Exon 5 in Region 3 of the BRCA1 gene configuration Select Edit Edit Object M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 2 In the Coding Sequence Information field enter the Position from which the amino acid sequence calculation should be started Take care to select the position giving correct reading frame For example in Exon 5 of the BRCA1 gene configuration this is the second base position in the exon position 72 3 Enter the correct Codon no 6 Click on OKin the Edit Object box and the amino acid sequence for all exons contiguous to the current exon will be automatically calculated and displayed Regons i Fepari Repro Amped i Reps p Puga ats amp fagod Fragnerts puaren foment fusil _fregres Sregeets 4 Fe Fe Fe Frege Erons i jaa Rapi AmS Amp pant Eust Lal i Areas of terest Ponts of terest Figure 6 33 Overview of Regions 1 to 5 of the BRCA1 gene configuration The amino acid sequence for Exon 5 onwards have been automatically created 6 7 3 Selecting the wrong reading frame If for some reason you select the wrong start position for ge
13. add them to the gene configuration Y ou can rearrange this order 1 Select Edit Rearrange Regions T he Overview window is automatically displayed with the minimum magnification to show all of the regions Each of the regions has a large identifier number indicating its current placement in the order 2 Click on the identifier number that you want to change to be the first region in the gene configuration Its number becomes 1 6 22 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 Figure 6 24 Overview window displaying the original order of the three regions 1 2 3 created for the Ret gene in the gene configuration 3 Click on the other identifier numbers in sequential order that you want the regions to be placed Figure 6 25 Overview window displaying a newly specified order of the three regions 1 2 3 created for the Ret gene in the gene configuration 4 Select Edit Rearrange Regions once more to remove the check mark and the regions are rearranged according to your selection M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 23 6 Configuration Editor Figure 6 26 Overview window displaying the rearranged order of the three regions 1 2 3 based on the previous figure 5 If you want to change the name of individual regions as a result of the rearrangement select the region and then select Edit Edit Region Settings T he Define Regi
14. all relevant samples click on the Exit button The Analysis Item window will be again displayed containing all information about the selected samples For example you should now have six samples including a Sample sequence and a reference sample sequence for each of the Ret gene exons 10 11 16 ACACTT ACagare aj Figure 4 6 Analysis Item window containing sample information The new fields include Sample Information Information about the sample selected in the Samples field is shown here This information was previously entered using the sequencing software Samples The names of the samples you included are listed here including any reference samples Selection of a sample affects what is displayed in other fields M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 5 4 Basic operation 4 6 Raw Data Curves This shows the raw data curves produced by the automatic sequencer and processed using the sequencing software see Section 4 3 3 4 2 2 Adding batch samples If you have many ALF ALX files and you want to locate a specific series of samples within the files and add them to an analysis item you can search for these samples and add them as a batch 1 Start the application and load a gene configuration into the analysis item as described in step 1 of Section 4 2 1 Select File Add Batch Samples T he Add Batch Samples dialogue is displayed Ade Catch samples Search Foe Clo
15. brcal edib2 cfg DNA Configuration i m lca i i i RB CTT 1 Ren ee 2 Rio Bom 11 Rekpoitdgich 1R2g ia tif agi beon21 Region Fragments E Exons peee g EPERE EPROR Figure 6 38 BRCA1 genomic DNA gene configuration comprising 22 regions and Exons 1 to 24 excepting the non coding Exons 1 and 4 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 35 6 Configuration Editor 6 13 3 p53 CDNA gene configuration This configuration could easily be assigned amino acid data using the Define Region dialogue see Section 6 7 4 Overview C Program Files Biotech Mutation Configurations P53exon cfg RNA Regions Fragments Areas of Interest Points of Interest Figure 6 39 p53 cDNA gene configuration comprising four sequencer fragments 6 36 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Troubleshooting 7 Troubleshooting This chapter should help you to identify and correct possible hardware problems associated with using M utation Analyser M essages displayed in M utation Analyser and Configuration Editor that require special user actions are also included 7 1 PC hardware Symptom Possible cause and or corrective Refer to measures Screen blank 1 Check power cable and internal external fuses 2 Check light contrast settings CRT Screen on CRT manual Message Non Remove the diskette in the disk system disk o
16. dialogue see Section 4 3 1 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 11 4 Basic operation Abqoureet iIntormatior Ad Segment we tay Covered Dy urapi Usaiigrad eaqycets Partetly Cawmed inqments Fely Covered lrageest l Do Met Shere Thee Dimioges Agan Figure 4 12 Quality Summary dialogue This example shows the quality summary for the alignment of sample sequences corresponding to the Ret gene Exons 10 11 and 16 Sample Quality information is presented including Name SLength Fragment FLength Score Single BD Gaps The name of the sample The number of bases in the sample sequence The name of the sequencer fragment in the gene configuration to which the sample sequence is aligned The number of bases in the gene configuration sequencer fragment The actual alignment score between the sample sequence and the gene configuration Higher values indicate better alignment The actual number of single base deviations see Section 5 2 in that sample when aligned to the sequencer fragment The actual number of explicit insertion deletion deviations in that sample see Section 5 3 when aligned to the best fitting sequencer fragment 4 12 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 By default all items fulfilling the limit criteria are checked to Keep the sample in the analysis If you do not want to keep
17. insertion deletion deviations 5 4 5 Advanced options for mixture insertion deletion deviation assignments 5 4 6 Understanding mixture assignments 5 5 User detected deviation 5 6 Some Golden rules for interpreting mutation data 5 6 1 Single base deviations 5 6 2 Deletions and insertions 6 Configuration Editor 6 1 Creating a new gene configuration 6 2 Defining a region 6 2 1 Importing an ALF ALX sequence 6 2 2 Importing GenBank sequences 6 2 3 Importing ASCII file sequences 4 25 4 26 4 27 4 28 4 28 4 29 4 30 4 30 4 31 4 32 4 33 er ae WJ W UW UI UI UW Pep UJ UJ W O UI z h bia Gg gi Yiyi Oi n NOR RPP Fe ee E a ae OnNUWN OO WOONDUWN e p UI UI I NO N UI UW M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Contents 6 3 Navigating the region 6 8 6 3 1 Using the zoom function 6 8 6 3 2 Finding a sequence 6 9 6 3 3 Defining gene configuration objects 6 11 6 3 4 Adjusting bases in the sequence 6 11 6 4 Adding objects to the gene configuration 6 12 6 4 1 Adding a new object 6 12 6 4 2 Defining the extent of objects 6 16 6 4 3 Defining exons based on case 6 18 6 4 4 Including mutation frequency statistics 6 20 6 5 Selecting editing and deleting objects 6 20 6 5 1 Selecting an object 6 20 6 5 2 Editing an object 6 20 6 5 3 Deleting an object 6 21 6 6 Working with several regions 6 21 6 6 1 Adding new regions 6 21 6 6 2 Viewing the whole configuration 6 21 6 6 3 Rearranging
18. kinds of files can be easily created in for example M icrosoft Excel 6 5 Selecting editing and deleting objects 6 20 6 5 1 Selecting an object Click on an object in the Overview window to select it Alternatively select Edit Select Next Object to move consecutively forward through the objects or Edit Select Previous Object to consecutively move backwards through objects The selected object is coloured blue 6 5 2 Editing an object To edit an object select it and then select Edit Edit Object or Edit Object from the right mouse button menu The Edit Object dialogue is displayed M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 6 5 3 Deleting an object To delete the selected object select Edit Delete Selected Object or Delete Object from the right mouse button menu or press lt Del gt on the keyboard 6 6 Working with several regions Y ou can add more regions to the configuration sequence up to a maximum of 100 regions each containing up to 20 000 bases Regions are a convenient way of splitting particularly large or complex sequences into manageable units Separate regions are also used when you want to aggregate non contiguous sequence data In one configuration 6 6 1 Adding new regions N ew regions are created exactly as for the first region In brief 1 Select File Add Region and the relevant file format from the submenu options The appropriate Import Sequence dialo
19. of the of the Raw Data Curves field display is automatically shown i e automatic selection of Full Raw Data View and all raw data is shown with minimum magnification The magnification can be increased using the standard zoom in function and the size of the field display returned to normal by deselecting the Full Raw Data View option This on off toggle function can be similarly achieved using the lt F6 gt key on the keyboard M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 21 4 Basic operation 4 22 4 6 3 Curve shift correction By default the Options Rawdata Shift Correction function is active and enables the display of shifts in peak positioning applied by the sequencing software during the processing of the raw data This allows you to more easily distinguish the order of the peaks as they occur in the sequence Deselection of this function removes the automatic positioning and allows you to view the unaltered raw data directly A check mark beside the menu option indicates that the function is active 4 6 4 Curve amplitude scales By default the four curves are displayed on the same amplitude scale as the curve containing the largest peak The peak heights of all the curves are then correctly proportioned with respect to one another Alternatively it is possible to view the curves with separate amplitude scales so that the displayed amplitude scale for each curve is adjusted to best fit the window displayed
20. on OK to return to the Analysis Item window The Deviations Table will display the deviations based on criteria selected in the Interactive Assignment Options and Deviations Table Options see Section 4 5 1 dialogues 4 4 3 Viewing deviation information It is possible to view extensive information about a deviation 1 2 Select the deviation in the Deviations Table Select View Deviation Information or Show Deviation Information from the right mouse button menu T he Deviation Information dialogue is displayed M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 EF Deviation Information Fragment 1 exon 10 Sequencing direction AntiSense Region AT as 1778 593 GGA Gly gt GRA 10 19 Deviation JAmbig GR Figure 4 18 Deviation Information dialogue 4 5 Alignment field The Alignment field displays the sequence alignment data for the sample corresponding to the deviation selected in the Deviations Table For details about the different types of deviation encountered here see Chapter 5 Sequencing Sample no Sample position Selected direction Region no Region position deviation Figure 4 19 Alignment field in the Analysis Item window 4 5 1 Sequencing direction The sequencing direction of the specific fragment is indicated by gt gt for the Sense direction and by lt lt for the Anti Sense direction All sequence data is presented in the Sense directio
21. position in the configuration fragment M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA A 1 A Evaluation algorithms 2 Thealignment algorithm is optionally applied both on the straight sequence as obtained from the sequencer and on the complementary reversed sequence 3 Thealignment item for the configuration fragment and the sample sequence direction showing the highest score is assumed to be the right one and is used for further calculations 4 A list of deviations is derived from the best alignment The deviations are labelled according to the following table a Point M ismatching nucleic acid base code Example C A C A GC A C A GC A b Ambig Base code comprising two or three nucleic acid base components Example M atching ambiguity event according to score table notation M A C A G C A C A G C A Example M ismatching ambiguity event according to score table notation S A C A G C A C A G C A A 2 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Evaluation algorithms A c SeqStop Base code comprising all four nucleic acid base components Example N A C A G C A C A G C A d Insert Explicit gap of any length in the wild type sequence e gt gt gt gt OO e Delete Explicit gap of any length in the sample sequence gt gt gt gt OO M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA A 3 A Evaluation algorit
22. regions 6 22 6 6 4 Deleting a region 6 24 6 7 Defining the amino acid sequence 6 25 6 7 1 Contiguously numbered exons 6 25 6 7 2 Non contiguously numbered exons 6 28 6 7 3 Selecting the wrong reading frame 6 29 6 7 4 Amino acid sequences for MRN A cDNA configurations 6 30 6 7 5 Codon translation options 6 31 6 8 Saving and loading a gene configuration 6 32 6 9 Exporting a region 6 32 6 10 Printing a report 6 32 6 10 1 Configuration report options 6 32 6 10 2 Printing the configuration 6 33 6 11 Converting from a genomic DNA to amRNA cDNA configuration 6 33 6 12 Exiting the application 6 33 6 13 Examples of some configurations 6 34 6 13 1 Ret genomic DNA gene configuration 6 34 6 13 2 BRCA1 genomic DNA gene configuration 6 35 6 13 3 p53 cDNA gene configuration 6 36 7 Troubleshooting 7 1 7 1 PC hardware 7 1 7 2 Printer 7 1 7 3 Software 7 2 7 3 1 Mutation Analyser 7 2 7 4 Other problems 7 6 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA iii Contents A Evaluation algorithms A 1 B Export to database B 1 C Cited literature C 1 Index M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Introduction 7 1 Introduction Sequence based analysis is rapidly becoming the gold standard in many mutation study areas due to its ultra high level of sensitivity and specificity It becomes an increasingly important tool when used together with other popular screening methods such as Immunohisto
23. the Search String field or by loading a previously saved string by clicking on the Load button Any search string can be saved for future use by clicking on the Save As button and giving an appropriate name Define any other search criteria that you want Complement Find Check this box if you want to search the complementary sequence using complementary bases to those in the Search String field Backward search This looks for the search string beginning at the end of the sequence Click on Find First and if the string is present in the sequence its first occurrence will be detected and the Start Position shown The Start Position always shows the detected position within the configuration sequence with respect to the first base in the search string Click on Find Next to locate the next occurrence of the string The Alignment field and Raw Data Curves field are automatically centred on the beginning base of the located string M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 31 4 Basic operation Scope H H Exit e Selected Sample Selected Fragment ext Criteria Search String _ Load Save As Find First Find Next l Complement Find Start Position Backward Search Figure 4 29 Find dialogue 4 Click on Exit when the appropriate Position value is obtained 4 12 Adjusting bases in the sequence After an analysis you can edit or delete selected bases in the sample s
24. unsure about a specific file do not select to uninstall the file Remaining files should not affect your system M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 4 Basic operation This chapter introduces the basic operation of M utation Analyser Y ou will learn how to create analysis items and then perform an analysis Y ou will be introduced to the various screen components before and after an analysis and become familiar with some of the important tools needed to evaluate your results Y ou will gain further instruction on printing reports and exporting results to database for use in other applications Chapter 5 later goes on to introduce the types of deviation that you are likely to encounter and guides you in the process of performing user assignments for the deviations 4 1 Starting the application To start the application 1 Locate and select the M utation Analyser program in the taskbar Start menu for Windows 95 2 Thestart up screen is displayed together with the User Identification dialogue requesting you to enter your User ID Y our user ID can be alphanumeric and contain up to 25 characters and you must enter at least one character to proceed The user name is a necessary component for the generation of reports User Identification User ID Continue Exit dil Figure 4 1 User Identification panel The last five entered user IDs are stored in
25. was shifted in the mixture analysis to give the statistically best alignment with the gene configuration A positive value indicates that the sample sequence is shifted to the right of its current position and conversely a negative value 5 16 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 indicates that the sample sequence is shifted to the left of its current position The example shown in Figure 5 18 MixinsDel 3 indicates a shift of the sample sequence 3 places to the right of its Original position to give the statistically best alignment with the gene configuration in the affected area This result can be analysed in the Alignment field 5 4 3 Using the alignment field to evaluate mixture analysis results A colour coded representation of the mixture analysis results are displayed in the Alignment field sequenong AANE eQ Jownsteam siownent region Greco Upstream oat deatior rected Sy Pe denaii ween souaAre Meo souse Tue sate P J Start of moed wrserdon rae of Sue squares debtor devino Figure 5 21 Contents of the Alignment field for a p53 gene sample sequence In this example the mixture analysis detected a mixture insertion deletion of 3 bases Important information in the Alignment field includes Sequencing direction The mixture analysis is always performed in the sequencing direction which is displayed either as gt gt for the Sense direction o
26. 1 00 User M anual 56 3052 83 Edition AA 5 27 5 Deviation analysis 5 5 User detected deviation In some circumstances you may wish to highlight a base position in the sample sequence which has been detected as a wild type base and give a specific comment M oreover you may want to change the assignment from the wild type to another type of single base deviation This may be useful if for example the mutated component in a sample gave a very weak signal and was thus difficult to detect during sequencing M utation Analyser allows a user to identify and assign single base deviations i e ambiguities point replacements and sequence stops Such situations will only normally be found on close inspection of the raw data curves l 5 28 In the Raw Data Curves field select the base to which you want to add a comment and or change the assignment N aturally this corresponds to the wild type base in the gene configuration otherwise it would have been automatically detected as a deviation Select Edit User Detected Deviation Information about the detected deviation will now be displayed in the Deviations Table and be designated UserDev Alternatively if you know the position of a specific base without needing to look in the Raw Data Curves field select Edit User Detected Deviation A dialogue will be displayed into which you should enter the base position number Click on OK Information about the detected deviation will now be displ
27. 1 3 7 Introduction 1 4 Chapter 5 This introduces the various types of deviation and describes the process used to evaluate your samples Chapter 6 This describes the Configuration Editor module used for creating your own gene configurations Chapter 7 This describes some of the error messages that you may encounter and how to solve common hardware problems 1 2 1 Examples used In order to best describe the software functions and processes examples from three gene configurations are used e Ret genomic DNA gene configuration Exons 10 11 16 Courtesy of Dr Jorge A Leon and co workers at Q uest Diagnostics Nichols Institute San Juan Capistrano California USA e BRCA1 genomic DNA gene configuration Exons 1 through 24 excepting the non coding Exon 4 Courtesy of Prof Hans K Schackert and co workers at the Department of Surgical R esearch University of Dresden Germany e p53 cDNA gene configuration 1 2 2 Typographical conventions M enu commands the names of dialogue boxes and windows the contents of boxes and windows and option buttons are written with a bold Helvetica typeface M enu commands are written with first the menu name and then the specific command separated by a colon For example Select File Save Analysis Item As to display the Save Analysis Item As dialogue Enter the file name and select the destination drive and directory Click on OK This directs you to click on the File menu and select the
28. Analyser version 1 00 User M anual 56 3052 83 Edition AA Contents s I A Pew P ppp m Ne mrem A AAA WWVUWVUN Ta 4 4 6 4 8 4 8 4 8 4 9 4 11 4 11 4 14 4 14 4 17 4 18 4 19 4 19 4 20 4 20 4 20 4 21 4 21 4 22 4 22 4 22 4 25 Contents 4 7 Assignment bar 4 8 Analysis overview 4 8 1 Using the zoom function within O verview mode 4 8 2 Selecting a deviation for evaluation 4 8 3 Adjusting sequencer fragments 4 8 4 Changing the overview display options 4 9 Adding comments about the analysis 4 10 Save settings for options 4 11 Finding a sequence 4 12 Adjusting bases in the sequence 4 13 Printing a report 4 13 1 Printing a report 4 13 2 Printing a deviations report 4 13 3 Printing a report to file 4 14 Exporting reports and results 4 15 Changing user 4 16 Exiting the application 5 Deviation analysis 5 1 T ypes of alignment deviations 5 2 Single base deviations 5 2 1 Point replacement deviations 5 2 2 Ambiguity deviations 5 2 3 Sequence stop deviations 5 2 4 H otspot deviations 5 2 5 User assignment of single base deviations 5 2 6 Approving multiple deviations 5 3 Insertion deletion assignments 5 3 1 User assignment of insertion deletion deviations 5 4 M ixture insertion deletion deviation assignments 5 4 1 Recognising mixture insertion deletion deviations 5 4 2 Performing a mixture analysis 5 4 3 Using the alignment field to evaluate mixture analysis results 5 4 4 User assignment of mixture
29. Click on OK when you have adjusted the sample sequence 4 13 Printing a report Y ou can print out a report of the wholerun or for a specific deviation that you are evaluating 4 13 1 Printing a report Select Options Report Options The Report Options dialogue is displayed M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 33 4 Basic operation 4 34 F tehede All C Approvod Only C umoo Cmirennon Fews Opty tnacte Assignment Op vas Figure 4 33 Report Options dialogue box Select the components that you want to be included in the report by clicking in the box beside an option These include Sample Information Comments on Analysis Deviations Table Overview Graph Information about the samples that was previously entered using the sequencing software Comments that you have entered into the Comments on Analysis dialogue Columns of the Deviations Table that you have specified in the list of options see step 3 The Overview window for the current analysis Select to print One Page per Region or All Regions in One Page Select the columns to be included in Deviations Table component of the report N ote that you can only have a maximum of 5 columns Select to Include All of the deviations or Approved Only deviation rows M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 Check the Report Interactive Confirmation Rows Only option if y
30. ETdemo3 alx File name a a Files of type ALF ALX files alx alf Cancel Figure 6 3 Import dialogue for an ALF ALX sequence Locate the file containing the sequence and click on OK 3 If the sequencer fragment is an AntiSense strand check the Anti Sense Strand box Check the Reference Fragment box if the raw data for the selected Sample is to be viewed in the Raw Data Curves field during mutation analysis see Section 4 6 5 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 ALT AL file C Proqeare Piles iaca Metetion ampin Amanoa als Figure 6 4 ALF ALX file dialogue An ALX demo sample for exon 10 of the RET gene is selected 4 Click on Add Region 5 The Define Region dialogue is displayed Figure 6 5 Define Region dialogue for a genomic DNA configuration Enter a name for the region and the position of the first base in that region usually number 1 If the sequence consists entirely of lower case letters as obtained from some databases these could be converted to uppercase by checking the Set Upper Case option Do not check this option if you are able to define exons based on the case of the bases see Section 6 4 3 If you are defining a gene configuration for mMRNA cDNA you can also add information here for amino acid sequence generation see Section 6 7 4 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 3 6 Con
31. Edition AA 6 31 6 Configuration Editor 6 8 Saving and loading a gene configuration Use File Save Configuration to save the gene configuration Unsaved configurations are called Noname cfg Save changes to the gene configuration using File Save Configuration or create a copy of the configuration under a new name with File Save Configuration As Previously saved configuration files can be selected and loaded from the dialogue displayed by selecting File Load Configuration The four most recently referenced configurations can be loaded directly from the File menu 6 9 Exporting a region If you want to export the sequence data from a specific region as a text file 1 Select the region 2 Select File Export Region T he Export dialogue is shown 3 Enter a name for the exported file and click on OK 6 10 Printing a report Y ou can print a report about the configuration you have created 6 10 1 Configuration report options 1 Click on Options Report Options Report Options Contents dao YE ee Cancel V Areas of Interest M Points of Interest M Overview Graph Figure 6 36 Report Options dialogue 6 32 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 2 In the Report Option dialogue check the options you want to be incorporated in a report 6 10 2 Printing the configuration Select File Print Configuration Report to obtain a printout of the configur
32. F ALX file referenced by the current analysis item could not be found probably because it has been moved to another directory N ot able to open ALF ALX file filename and clone No graph data will be available N ot able to open graph view out of memory When out of memory Try closing other applications or restart the computer M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA N ot able to read checksum file is corrupt N ot able to read deviations information file is corrupt N ot able to read options settings file is corrupt N ot able to restore header contents file may be corrupt N ot able to save analysis item N ot enough memory available to calculate deviations Specified gene configuration file is corrupt Specified gene configuration was not loaded no fragments are defined Troubleshooting The file being opened is corrupt When appending data to a database file and choosing to use the existing column information This message occurs if the application cannot decode the existing file W hen there is not enough disc space or out of memory W hen the file being loaded iS corrupt Error when loading a gene configuration that does not contain a sequencer fragment in the first region M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Corrupted files cannot be used Recreate the source file to be Opened Corr
33. M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 p Dewabors Table Optoss xX Sor Order ox a by Position C by Sample oOo x Visible Columns Caachi Bt Siats Cobow Dp Codes E Deviation E Type Name l Exon Pos States Detect l Aegon Pos E User Aneage Sampie Pos Respossible M PIA E Comment l View leteractve Contermatons Rows Only Figure 4 15 Deviations Table Options dialogue 2 Select whether the viewed deviations are sorted by Position or by Sample 3 Select the Visible Columns in the table by checking the appropriate options Status C olour This option displays a colour coded status bar on the left side of each deviation in the list A grey bar indicates a deviation that is Pending assignment by the user a red bar indicates an Approved deviation assignment a black bar indicates an approved Wild type assignment and a yellow bar indicates the user has assigned the particular deviation as Ignored Deviations Table Red approved Region 1 5exon 10 Yellow ignored Region 5 10 19f Black approved oa ll 7 wild type Region 1 5exon10 44 15 Region 1 5exon10 94 32 G region 2 3exon 11 Region 3 19exon 11 Region 3 19exon 11 Region 3 19exon 11 396 132 Region 3 19exon 11 427147 Region 3 19exon 11 426 142 138 46 Grey Pending Figure 4 16 Colour coded status bars for each of the deviations M utation Analyser ver
34. Mutation Analyser version 1 00 User Manual A Amersham e Y Biosciences 18 1118 78 56 3042 87 Edition AA Contents 1 Introduction 1 1 Using the software 1 1 1 Software protection device 1 1 2 Windows 95 operating system 1 1 3 Menu commands 1 2 Using this manual 1 2 1 Examples used 1 2 2 Typographical conventions 2 System requirements 2 1 Hardware 2 1 1 Computer 2 1 2 Printers 2 2 Operating system 3 Software installation 3 1 Installation of M utation Analyser 3 2 Uninstalling M utation Analyser 4 Basic operation 4 1 Starting the application 4 2 Creating and loading an analysis item 4 2 1 Creating an analysis item 4 2 2 Adding batch samples 4 2 3 Removing a selected sample 4 2 4 Saving an analysis item 4 2 5 Loading an analysis item 4 3 Performing an analysis 4 3 1 Deviation calculation options 4 3 2 Associating a sample sequence to a fragment 4 3 3 Calculating the deviations and quality summary 4 4 Deviations T able 4 4 1 Display options for the D eviations T able 4 4 2 Displaying deviations for interactive assignment 4 4 3 Viewing deviation information 4 5 Alignment field 4 5 1 Sequencing direction 4 5 2 Alignment deviations 4 5 3 Viewing sample or alignment information 4 6 Raw Data Curves field 4 6 1 Changing the display window size 4 6 2 The zoom function 4 6 3 Curve shift correction 4 6 4 Curve amplitude scales 4 6 5 Multiple raw data curve sets 4 6 6 Separate scrollbars M utation
35. No field of the Add Object dialogue Similarly the Start and Stop positions will be defined in the Extent field M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 Settings Region OPADHG Exon no fi Extent om earch Search Codeg Sequeece befommatioe Codoe No Posthon a aaa Search Figure 6 9 Add Object dialogue for an exon added from the GenBank Import dialogue In some circumstances the exon number or start stop positions may not be available in the GenBank Import dialogue and are thus not entered into the Add Object dialogue T hese must be entered manually For more information on adding exon objects see Section 6 4 5 Repeat step 4 to add other exons T hese will be added to the gene configuration as you define them 6 Click on Exit in the GenBank Import dialogue when you have added all relevant information 6 2 3 Importing ASCII file sequences Prior to import sequence data obtained from the Internet should be viewed in an appropriate text editor application on your PC Superfluous information such as the title and other descriptive information should be deleted leaving only the sequence data and possible base position numbering information M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 7 6 Configuration Editor 1 Select File Add Region and choose Plain ASCII from the submenu options The Import ASCII Sequence dialogue is displa
36. allation of Mutation Analyser 1 Insert the HASP into a parallel port on your computer 2 Turn on the computer M icrosoft Windows 95 should start automatically 3 Insert Disc 1 into driveA 4 Click on the taskbar Start menu and select Run 5 Enter a setup at the command prompt and click on OK 6 Follow the instructions on the screen 7 Removethe final program disc from drive A once the installation is complete 8 Thecomputer must be restarted after installation M utation Analyser and Configuration Editor should be available under the installation directory Program files Biotech Mutation unless you changed the directory during installation and are therefore located on the taskbar Start menu under Programs M utation Analyser 1 00 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 3 1 3 Software installation 3 2 Uninstalling Mutation Analyser Should you want to uninstall M utation Analyser Add Remove Programs 3 2 l Click on the taskbar Start menu and select Settings Control panel Double click on the Add Remove Programs icon Select M utation Analyser 1 00 from the list of installed components and click on the Add Remove button Alternatively select the Uninstall option from the taskbar Start menu under Programs M utation Analyser 1 00 Follow the instructions on the screen Y ou may get a warning message that some of the driver files may be shared by other applications If you are
37. alyser version 1 00 User M anual 56 3052 83 Edition AA B 1 B Export to database B 2 10 11 12 13 file For later use it is recommended that you take a note of the directory path where the file is stored R epeat for all other analysis items to be included except export to the the same file name as created in step 2 The information extracted from all analysis items will now be appended to the Original file The file can now be imported into M icrosoft Access or any similar database environment Open Microsoft Access It is assumed that this application has been previously installed on your system Refer to M icrosoft Access documentation for further information Using Microsoft Access create a new database using the File New Database menu command Chose a suitable file name and click the OK button N ote that this should not be the same file name as the one used in steps 1 3 Import the data from the analysis items using the File Import menu command Choose Text Delimited as the data source and click on the OK button Select the file you created in steps 1 3 and click the Import button In the Import Text Options dialogue box select First Row Contains Field Names Click on the Options button Set the Text Delimiter as None and Field Separator as Tab Click on the OK button to import data Close the Select File dialogue box The data from your study Is now available for further processing or examinati
38. ation you can for example define polymorphic positions as points of interest in the gene configuration see Section 6 4 1 M utation Analyser can however display the effects of a point replacement on the codon and the encoded amino acid In some cases the point replacement produces a codon that changes the encoded amino acid while in other instances there is no change This information can be viewed in the Assignment bar M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 same amino acid Bp Codon Type Codon 639 213 PointRep CGA Arg gt CGGIArgq Different amino acid Bp Codon Type Codon 742 248 PointRep CGG Arg gt TGG Trp Figure 5 3 The effect of a point replacement on the encoded amino acid can be seen in the Assignment bar No change from Arg to Arg above and a change from Arg to Trp below as detected in p53 gene samples 5 2 2 Ambiguity deviations This is where there is a replacement of a base in the sample sequence with an ambiguity code An ambiguity code is awarded where the specific base was unresolved during the sequencing process due to there being more than one base component detected at the same position An ambiguity code is unique for the specific combination of bases detected see Table 5 1 Se a a J A Se a a o fo a Table 5 1 Ambiguity codes for all combinations of unresolved components M utation Ana
39. ation information and or overview graph Y ou can also display the Windows 95 printer dialogues if you want to change the printer setup parameters 6 11 Converting from a genomic DNA to a mRNA cDNA configuration If you have created a genomic DNA configuration with defined exons you can convert this to amRNA cDNA configuration that contains only the exon information To make the conversion select File Convert to mRNA cDNA Configuration In making the conversion you will be warned that sequence information between the exons will be lost in addition to other objects such as sequencer fragments areas points of interest and mutation statistics between the exons If the exons in a gene configuration are non contiguous as a general rule you will not be able to convert the whole configuration to mMRNA cDNA Only those exons in the first contiguous exons for which an amino acid sequence has been generated will be converted In special cases only such as for the BRCA1 gene configuration where the non coding Exon 4 is not included non contiguous exons can be converted to a mRNA cDNA configuration see Section 6 7 2 Y ou are prompted to save converted configurations under a new file name 6 12 Exiting the application To exit the Configuration Editor application select File Exit M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 33 6 Configuration Editor 6 13 Examples of some configurations Presented here are three g
40. ation of a mixed PCR fragment population derived from wild type and deletion mutated gene sequences Note Itis possible of course for deviations to occur upstream of the detected mixture deviation and these should be evaluated independently of the mixture analysis 4 Thebase calling algorithm will detect the two bases at the same position in the sample sequence and ambiguity codes will be assigned to the positions of non alignment This region containing many such ambiguity codes is representative of a mixture insertion deletion deviation GACTAGATAGGTATAGTTA Wild type sequence GACTAAGGTATAGTTA Mutated sequence GACTA RRKWRKWRTWR Superimposed sequence Sequencing primer area Region of superimposed sequence Figure 5 15 A superimposed sequence resulting from a mixture of wild type and deletion mutated gene sequences 5 4 1 Recognising mixture insertion deletion deviations There are several tell tale signs that you should look for to recognise a mixture Insertion or deletion deviation e Examine the Deviations Table for a long list of adjacent ambiguity deviations Ambig in a single fragment M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 13 5 Deviation analysis Deviations PCR3 14H3 3 715239 AmbigAoW PCR 3 14H3 3 71 239 Delete 1 PCR3 14H3 3 732 244 AmbigC gt S PCR 3 14H3 3 92 264 Ambig A gt R PCR3 14H3 3 793 265 AmbigC gt S PCR3 14H3 3 794 265
41. ations in the list downstream from the mixture insertion deletion deviation Click on No if you want to manually evaluate every deviation Y our user assignment now automatically updates the information contained in the Deviations Table see Section 4 4 1 for details of the various columns in the Deviations Table The updated information includes Status Colour The bar changes from grey Pending to either red Approved black approved Wild type or yellow Ignored Status The status of a particular deviation iS displayed either Approved Wild or Ignored User Assign The nature and size of the user assignment is displayed Responsible This displays the user ID of the person whom made the assignment for this particular deviation see Section 4 12 Comments Comments that you added during assignment will be displayed 4 By default the next deviation in the Deviations Table is automatically selected for assignment If you ignored all other deviations downstream of the mixture insertion deletion deviation see Step 3 the next deviation not associated with this assignment is selected This function can be turned off by selecting Options Interactive Assignment Options and unchecking the Auto Increment Deviation List option 5 To undo an assignment i e return to Pending status select the deviation in the Deviations Table and then Edit Undo Interactive Assignment Explicit gaps and mixture analysis In some circumstance
42. ave obtained the correct Start Position value click on OK The value will be automatically entered in the appropriate Extent field for which you performed the search and will be the same as the Start Position value unless you specified other criteria in the Offset field 6 4 3 Defining exons based on case Some databases accessible via the Internet supply sequences that classify intron regions in one case upper or lower and exon regions In the other case This classification allows exon regions to be easily defined and be added as objects to the gene configuration Devre Meneame cfg DIMA x Configuration SSCS iE SRS HBR CSS BIE a i e Regen it Fragments Areas Of interest Ports of interest 5 LLL on Figure 6 20 Example of an imported sequence containing an exon defined by upper case bases flanked by lower case letters defining intron data If the imported sequence is classified as described 1 Display the Overview window and select the relevant region 2 Select Edit Auto Define Exons T he Auto Define Exons dialogue is displayed 6 18 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 Auto Define Exons Exons Defined By Upper Case ACGT Prrrrrrrririrrirrritirtt titre red Lower Case acgt Cancel Search Selected Region All Regions Figure 6 21 Auto Define dialogue 3 Select the case by which the exons are defined in the
43. ayed in the Deviations Table and be designated UserDev In the Single Base Assignment bar the base corresponding to the wild type will be checked Add a comment in the appropriate field and click on Approve if you intend to keep the wild type assignment Alternatively check the appropriate base option s and click on the Approve button The Deviations Table will now be automatically updated M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 5 6 Some Golden rules for interpreting mutation data It may sometimes be difficult to establish whether a listed deviation isa real mutation or an artifact A few simple suggestions may help you to make such judgements 5 6 1 Single base deviations 1 Check if any of the suggested bases for an ambiguity are the result of an artifact If not there most likely exists more than one population of cells which have a different base at the same sequence position Check what changes occur at the amino acid level resulting from a specific point replacement or an alternative base suggested by an ambiguity code See Section 5 2 Out of the four ALF curves a maximum of two peaks should be present at the site of an ambiguity M ore than two peaks implies possible sequencing compression or stop In case of doubt compare these peak positions in other samples preferably from the same gel W here an ambiguous peak on the curve is suggested as being a mutati
44. base file When saving revisions to the sample sequence M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Place file in the appropriate directory or close this file if in use in another application Free some disc space or memory Empty the clip board Try closing other applications or increase number of file handles available FILES in config sys Try again Try again Restart the computer 7 3 Troubleshooting Internal error description Send a bug report to Amersham Biosciences Restart computer Use more narrow search criteria M ore than 500 clones found aborting search W hen using the Add Batch Samples functions and the search criteria are too broad No deviations left calculation failed W hen generating quality data and all files have been removed or there are only reference fragments present Add samples N ot able to load alignment info During deviation calculation Try closing other applications or increasing the number of file handles available FILES in config sys Close the file if already in use or remove any write protection N ot able to open filename description When printing a report to file or exporting results to a database file The file may already be in use or write protected Return the ALF ALX file to its original directory or add the ALF ALX file again as a new sample When the AL
45. cfg Gene configuration data is automatically displayed in the Gene Configuration field M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 of TLV PULP STP COMUALIT A TIO Horor Pes a mjs Daorn J s mwaa te svete cerno reason co Comte Type e Cre n Figure 4 3 Analysis Item window containing gene configuration data for Ret exons 10 11 and 16 2 Select File Add Sample s In the Open ALF file dialogue select the appropriate drive and directory containing your samples Select an ALF ALX file For example select RETdemo17 alx Click On Open aj alf mj File garra alx al Open Figure 4 4 Open ALF ALX file panel for adding samples 3 TheALF file dialogue box is displayed An ALF ALX file contains one or more samples and information about each sample previously added in the sequencing software M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 3 4 Basic operation ALP SAL tte Preqrem Pf ihes feotecth hinon perpen Yettional als X ALF Fae Hender Operatur Dero Fen Poni Darw 0s Cond Serdord l Refurunce Fingnmast Nart ALF iho Exit Figure 4 5 ALF ALX file dialogue with a Ret gene Exon 10 sample selected To add an available sample select a sample and click on the Add sample s button For example select the sample named exon 10 with comment ret_0001 and add it to the analysis item This sample is kn
46. chemical IH C analysis and single strand conformation polymorphism SSCP M utation Analyser from Amersham Biosciences is a software package specifically developed for sequence based automated detection of base specific aberrations in sample sequences generated by ALF express or ALF series sequencer instruments M utation Analyser can detect several types of deviation in the sample sequence including replacements at single base positions explicit insertions or deletions and mixture Insertions or deletions occurring In heterogeneous cell populations The software utilises a gene configuration as the basis for comparison which is itself created in a separate Configuration Editor module supplied with M utation Analyser A gene configuration is assembled using wild type sequence data obtained from the major Internet databases or from sequences generated by ALF ALFexpress sequencers Key features of Mutation Analyser e Automated detection of single base aberrations Deviations at the single base level are automatically detected including point replacements typically mutations or polymorphisms explicit insertions or deletions and mixed population insertion deletions e Deviation detection in mixed cell populations A unique mixture analysis function locates insertions or deletions specific to mixed cell populations and samples taken from heterozygous cell sources e Rapid and simultaneous analysis of many samples M any sample sequenc
47. clicking on the Graph button in the Mixture Assignment bar following mixture analysis of a sample Upstream Peak Statistics Downstream region region with line line showing good fulfilment good alignment of the shift criterion Mixture Graph ime ay sar Score Figure 5 26 Mixture Graph panel showing the cumulative score of an alignment following mixture analysis This example comes from a sample sequenced in the Sense direction The peak line represents the start of the mixture insertion deletion deviation A peak can only be identified as a mixture insertion deletion deviation if it is followed by a continuous reduction in cumulative score equal to or greater than the Required Valley value in the Mixture Analysis dialogue T he distance between the peak line and statistics line represents the number of bases used to obtain the statistical result M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 It is not always possible for the automated mixture analysis to detect a mixture insertion deletion deviation since the Required Valley value is too high This is particularly true in a mixed sequence sample where the wild type sequence predominates with only occasional superposition of the mutated sequence for a small number of bases To detect such cases the Required Valley value should be lowered and the mixture analysis repeated The Mixture Graph can appear as a Set of incremental steps or
48. command Save Analysis Item As A dialogue called Save Analysis Item As will be displayed in which you must select the name drive and directory of the file You then click on the button named OK Some menu commands also have shortcut keys on the keyboard which are written within lt gt marks M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA System requirements 2 2 System requirements 2 1 Hardware 2 1 1 Computer Computer Compaq Pentium 133 M H z computer minimum PC with 486 processor clock speed 66 M H2 RAM memory 32 Mb minimum 16 M b Disk memory 10 M b free hard disk space for program Graphics SuperV GA graphics adapter 256 colours Minimum VGA graphics adapter 2 1 2 Printers The following printers have been tested for compatibility with M utation Analyser HP Desk et 660C 560C HP LaserJet 5 MP 2 2 Operating system M utation Analyser must be installed in the 32 bit operating environment Windows 95 see Chapter 3 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 2 1 2 System requirements 2 2 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Software installation 3 3 Software installation One set of installation diskettes is supplied that contain e Mutation Analyser 1 00 e Configuration Editor 1 00 e Demo files The various components are to be installed in the 32 bit Windows 95 International Edition operating environment 3 1 Inst
49. con to again view the window or select Window Comments on Analysis Note You can change the default template to display text of your choice when the Comments on Analysis window is opened for the first time for each analysis item Locate the file called Template in the directory where you have installed M utation Analyser e g in C Program files Biotech M utation Double click on the file to open it in Windows 95 N otePad M odify the template text and save the changes 4 10 Save settings for options If you want to save the settings you selected for the various option dialogues select Options Save Settings T he saved settings are valid until the Save Settings command is used the next time for new settings Y ou can save the settings made for e Deviation Calculation Options e Interactive Assignment Options 4 30 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 e Deviations Table Options e Report Options e Export Report Options 4 11 Finding a sequence Y ou can use the Find function to locate a specific sequence in the Sequencer Fragment or the currently selected sample 1 Select a deviation in the Deviations Table and select Edit Find The Find dialogue Is displayed Select the Scope of the find either in the currently selected sample or in the corresponding sequencer fragment of the gene configuration Enter a search string either by directly entering a sequence into
50. configuration For details about the different types of deviation encountered here see Chapter 5 Deviations Table Fragment 1 exon 1 Fragment 1 exon 1 Fragment exon 1 17 78 593 Fragment 1 exon 1 1803 601 Fragment 1 exon 1 1653 6178 Fragment 1 exon 11 Fragment 2 exon 17 Fragment 2 exon 1 1904635 Fragment 2 exon 17 Fragment 3 exon Tt Fragment 3 exon Tf Fragment 3 exon Tf racnmoant 4 ownn 1f 27R3r019 Type Name Bp Codon Deviation UserAssign Start Extra 15 Ambig G gt K Ambig G gt R Ambig G gt R Ambig G gt 5 End Extra 4 start Extra 6 Ambig G gt R End Extra 13 start Extra 295 Ambig G gt R Ambig G gt R rmhia T 3 Comment Figure 4 14 Deviations Table in the Analysis Item window following analysis of Ret gene demo samples The information displayed in the table is dependent on the columns selected in the Deviations Table Options dialogue see Section 4 4 1 The width of each column can be adjusted by dragging the border of the column heads It is also possible to increase the display size of the Deviations Table by hiding the Gene Configuration field Select View Hide Gene Configuration 4 4 1 Display options for the Deviations Table The information displayed in the Deviations Table is dependent on the columns selected for viewing 1 Select Options Deviations Table Options T he Deviations Table Options dialogue is displayed 4 14
51. contain any number of small peaks and valleys Mixture Graph Figure 5 27 Mixture Graph panel showing the cumulative score of an alignment following a mixture analysis where the Required Valley value needed to be lowered from 5 to 1 in order to detect the mixture insertion deletion deviation sample sequenced in the Sense direction M ax Probe Length The Max Probe Length value is the maximum number of bases used in the mixture analysis for the statistical calculation These bases are represented by the blue squares in the Alignment field If there is a good alignment fewer bases will have been used to obtain the result and consequently less blue squares will be seen In other cases the alignment may not beso perfect and hence more bases are needed in the analysis to obtain statistically meaningful results By default the Maximum Probe Length value is 50 5 4 6 Understanding mixture assignments In Sections 5 4 2 to 5 4 4 you were shown how to automatically calculate the specific type of mixture deviation either an insertion or deletion In most cases mixture analysis is performed on samples containing a stronger wild type sequence signal and thus with no explicit deletion adjacent to the area suspected of containing a mixture insertion deletion The process behind the mixture analysis is described Insertion or deletion The information contained in the Deviations Table and Alignment fields together with the raw data curves all
52. currently displayed alignment respectively will be analysed This in turn means that tentative insertions deletions of 10 bases or less are looked for Each sample sequence will be shifted one step at a time away from its original position with respect to the gene configuration The alignment between sample sequence and gene configuration is then statistically tested before shifting another step The number of stepwise shifts is equal to the range limit both to the left and right of the currently viewed alignment position 3 Ifyou want to analyse only the selected sequence sample i e the Sample containing the deviation selected in the Deviations Table check the Selected Sample Only option By default this function is not selected so that all sample sequences in the analysis item will be included in the analysis 4 Click on OK The analysis will now be performed and if a significant result is obtained these will be shown in the Deviations Table This will be displayed as a new class of deviation namely MixinsDel Drvintonr Type Name apeCodon Deventer User Asuan Conner act 14H abi ee Agia A gt 14H t Leiste iz k zis Si a ewe m Figure 5 20 Deviations Table displaying a Mixture insertion deviation deviation detected in a p53 gene sample The size of the mixture insertion deletion deviation shown in the Deviation column of the Deviations Table represents the number of places that the sample deviation
53. d to directly save a newly created analysis item Select File Save Analysis Item In the Save Analysis Item As dialogue box select the destination drive and directory and enter a file name for the new item Click on Save As Save Aenuhyors Bem As Jaakna Fie pame Save ns hoe Anman tern Arro Canoa Figure 4 9 Save Analysis Item As dialogue box At any point during an analysis you can save the item in its current state by selecting File Save Analysis Item or save a copy of the analysis item under a new file name using File Save Analysis Item As 4 2 5 Loading an analysis item To load an analysis item select File Load Analysis Item Select an analysis item from the appropriate drive and directory and then click on Open The analysis item will be loaded in the state it was last saved Alternatively you can select an analysis item listed in the File menu if it was one of the last four opened analysis items M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 3 Performing an analysis Basic operation 4 This section describes how to perform an analysis and also select the analysis options The various screen components displayed following an analysis are introduced in sections 4 4 to 4 8 Interpretation of analysis results and user assignment are presented in Chapter 5 4 3 1 Deviation calculation options Prior to performing an analysis you should select the deviation calculation options 1 Se
54. e configuration are displayed based on the selected overview options see Section 4 8 4 e Sample fragments are shown in their aligned position relative to the gene configuration Deviations are marked on the sample fragments with a vertical cursor line passing through the currently selected deviation Click on a deviation mark to select it within the window A legend helps you to identify the types of deviation marks M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 e Reference fragments will be displayed if included in the analysis item Configuration RETdemo Fy ane Figure 4 24 Analysis Overview window showing the analysis results based on the Ret gene configuration 4 8 1 Using the zoom function within Overview mode Y ou can increase or decrease the magnification of the data in the window by using the Zoom function For successive zoom in Capability repeatedly select View Zoom In or Zoom In from the right mouse button menu or use the lt F7 gt key on the keyboard Conversely select View Zoom Out or Zoom Out from the right mouse button menu or use the lt F8 gt key for successive reduction of the magnification The magnified area is centred on the selected deviation and the individual bases in the gene configuration sequence and individual amino acids for the coding sequence can be viewed Select View Full Zoom Out to return to the lowest magnification to view the w
55. e blue box containing the sample name in white letters Figure 4 21 Raw data curves centred on a selected deviation in the sample sequence bottom and a corresponding reference fragment defined in the gene configuration top Viewing different sets of curve data To select the types of curve data that you want to be displayed 1 Click on View Related Raw Data or select Related Raw Data from the right mouse button menu The Related Raw Data dialogue is displayed M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 23 4 Basic operation 4 24 View An C Retereece C Nowe C Seulwcted Samgplux 1 Fragment I axoe 10 2 Fragment axon 11 3 Fragment 3 axon 16 Figure 4 22 Related Raw Data dialogue Select the appropriate option The Raw Data Curves field is automatically updated as you select an option All Reference None Selected Samples This displays all sets of raw data curves corresponding to the selected deviation in the sample sequence including reference fragments and overlapping fragments This displays the sample sequence for the selected deviation in addition to any reference fragments This displays only the sample sequence for the selected deviation This displays only those curves checked in the custom list below and only if they correspond to the selected deviation in the sample sequence Close the dialogue when you no longer need it Alternativel
56. e number of sequences contained within the file and also define exons based on the supplied start and end positions M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 5 6 Configuration Editor 6 6 Gener Loces More DPADHOGI Waossts Tygo DAMA Deiniina N D penedondensa Adb qere i aobo detyetrogesar 948 smi Figure 6 8 GenBank Import dialogue Select a sequence and click on Add Region T he Define Region dialogue is displayed Enter a name for the region and the position of the first base in that region usually number 1 If the sequence consists entirely of lower case letters as obtained from some databases these could be converted to uppercase by checking the Set Upper Case option Do not check this option if you are able to define exons based on the case of the bases see Section 6 4 3 If you are defining a gene configuration for MRNA cDNA you can also add information here for amino acid sequence generation see Section 6 7 4 Click on OK The Overview window is updated with the sequence information The GenBank Import dialogue also remain open Some GenBank files contain Exon data The exon number is displayed together with the Start and Stop base position delimiting the extent of the exon Select an exon and click on Add The Add Object dialogue is displayed to define the exon If the added exon has a number in the GenBank Import dialogue this will be displayed in the Exon
57. e population 2 Ifthe additional end peak described in the previous point comes before the normal end peak this indicates a deletion An extra peak after the normal peak indicates an insertion Compare with neighbouring clones of the same fragment type 3 Smaller deletions or insertions 2 4 bases are indicated by an end peak that is wider than normal This may be difficult to measure 4 Look for the characteristic behaviour of deletions or insertions when a well aligned sequence suddenly becomes mixed and generates a lot of ambiguities These instances usually require you to perform an automated mixture analysis to determine the size 5 30 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 6 Configuration Editor The Configuration Editor application allows you to create your own configuration files for a specific gene Gene configurations are based on the wild type sequence for the gene and are consequently loaded into M utation Analyser and used as the basis for alignment with sample sequences and consequent detection of deviations Gene configurations can be based on genomic DNA or mRNA cDNA See Section 6 13 for three examples of gene configurations 6 1 Creating a new gene configuration 1 Start the application select the Configuration Editor program from the Windows 95 Start menu 2 Select File New Configuration T he Configuration Type dialogue is automatically displayed in which
58. e sequence configuration editor 6 11 evaluation algorithms A 1 exiting configuration editor 6 33 exiting mutation analyser 4 37 exon object adding to region 6 13 defining by case 6 18 importing from GenBank 6 6 export report 4 35 export report options 4 35 export to database B 1 exporting a region 6 32 extent of objects 6 16 _ finding a sequence configuration editor 6 9 forcing alignment 4 11 full raw data view 4 21 full zoom out 4 21 G I3IVXVFSSSTYYy gap in mixture analysis 5 22 GenBank sequences defining a region 6 5 gene configuration BRCAI genomic DNA 6 35 converting from genomic DNA to mRNA cDNA 6 33 examples 1 4 6 34 hide data 4 14 loading 4 2 6 32 new 6 1 p53 cDNA 6 36 Ret genomic DNA 6 34 saving 6 32 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA iii Index gene configuration description 6 1 gene configuration field 4 2 generating hotspot deviations 4 10 golden rules 5 29 a hardware requirements 2 1 HASP software protection 1 3 hide gene configuration data 4 14 hotspot deviations 5 6 generating 4 10 hotspots example of generating deviations 5 6 importing exons from GenBank 6 6 insertion deletion deviation assignment 5 10 insertion deletion deviations 5 9 installing HLA SequiTyper 3 1 installing the software 3 1 interactive assignment options 4 17 3 key features 1 1 _ loading a gene co
59. e sequence database search engine 7 6 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Evaluation algorithms A A Evaluation algorithms Detection and classification of wild type deviations in sequence data The method used for the detection and classification of wild type deviations in sequence data provided by the automatic sequencer is based on the dynamic programming algorithm originally proposed by Needleman and Wunsch 2 The method is reviewed in a more recent paper by Pearson and M iller 3 The method has been further extended with some functions dedicated to the present application A condensed description of the different steps involved is given below 1 The sample sequence is aligned to the different sequence fragments specified by the gene configuration For each configuration fragment an alignment is found that optimises the score defined by the following score table when summed up for the entire sequence length Event Score M atching base 1 M ismatching base 1 M atching ambiguity 0 M ismatching ambiguity 1 Gap 1 independent of gap length The matching ambiguity event occurs when there is an ambiguous base call in the sample sequence comprising a base component that matches the aligned base in the configuration fragment The mismatching ambiguity event occurs when there is an ambiguous base call in the sample sequence not comprising as a component the base found at the corresponding
60. ection 4 4 1 for details of the various columns in the Deviations Table The updated information includes Status Colour The bar changes from grey Pending to either red Approved black approved Wild type or yellow Ignored Status The status of a particular deviation iS displayed either Wild Approved Or Ignored User Assign The nature and size of the user assignment is displayed Responsible This displays the user ID of the person whom made the assignment for this particular deviation see Section 4 12 Comments Comments that you added during assignment will be displayed M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 11 5 Deviation analysis 7 By default the next deviation in the Deviations Table is automatically selected for assignment This function can be turned off by selecting Options Interactive Assignment Options and unchecking the Auto Increment Deviation List option 8 To undo an assignment i e return to Pending status select the deviation in the Deviations Table and then Edit Undo Interactive Assignment Alternatively if you want to change the assignment e g from Approved to Wild select the deviation and make a new assignment 5 4 Mixture insertion deletion deviation assignments M utation Analyser has an advanced Mixture Analysis function that can detect insertion deletion deviations in sequence data derived from Samples containing mixed cell populations or cells t
61. ed all objects The Overview window will display all of the objects that you have added Adding a sequencer fragment object This is valid for regions where there was no automatic generation of a sequencer fragment resulting from using an ALF ALX sample see Section 6 2 M any mutation analysis methods are based on sequencing both the Sense and AntiSense strands It is recommended that you define two separate sequencer fragment objects one for each direction It may be convenient for example to have the option to separately adjust the extents of both objects later on when the method is being optimised It also aids documentation of the method Taming Rogos Regios Type fut O Ama of Sere E Sequencer Frogment Punt of intusest Pe naan D AM Same vard Figure 6 15 Add Object dialogue for a sequencer fragment Sequencer fragments are necessary for the analysis process to function in M utation Analyser The sequencer fragments also define and document the evaluation method 1 Enter a name for the sequencer fragment 2 Enter the Extent position values for the object see Section 6 4 2 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 13 6 Configuration Editor 3 If the object is an AntiSense strand check the Anti Sense Strand box Optionally define a reference ALF ALX sample corresponding to this sequencer fragment that will be displayed in the Raw Data Curves field durin
62. egion Settings T he Define Region dialogue is displayed 3 Enter the Codon No and the start Position number from which the amino acid sequence generation will begin 4 Click on OK and the amino acid sequence is generated 6 30 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 teeth ngs Nannu Posion of test base j l Set Upper Come Codng Sequesce inimmahnn Codon Mo Positioa Soarch Figure 6 35 Define Region dialogue for an MRNA cDNA gene configuration 6 7 5 Codon translation options There is unusual codon use in some mitochondrial DNA sources such that mRNA transcripts can produce different amino acids for some codons compared to the normal universal assignment in eukaryotic and prokaryotic cells Y ou can account for this unusual codon use by selecting the correct translation option This will automatically update the amino acid sequence Select Options Codon Translation Options and check the relevant DNA source from the sub menu i e Universal used in most cases for normal assignment in eukaryotic and prokaryotic cells Human Mitochondria Yeast Mitochondria and Neurospora Mitochondria The following table shows the unusual codon use Universal H uman Y east N eurospora Mitochondria Mitochondria Mitochondria Ge LL bh Leu ae ae Table 6 1 Unusual codon use in mitochondria 4 M utation Analyser version 1 00 User M anual 56 3052 83
63. encing direction containing a mixture insertion deviation of 3 bases 5 26 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 e f the deviation occurs within a sample with an AntiSense sequencing direction a positive size value Indicates an insertion of length equal to the size value This can be explained in that a statistically meaningful alignment is obtained in the affected sequence area if the Sample sequence is shifted to the right of its original position from the start point of the deviation i e upstream in the sequencing direction Those bases already present upstream in the sample sequence equivalent to the shift value are base insertions Figure 5 30 Example of a sample with an Anti Sense sequencing direction containing a mixture insertion deviation of 3 bases e f the deviation occurs within a sample with an AntiSense sequencing direction a negative size value indicates a deletion of length equal to the size value This can be explained in that a statistically meaningful alignment is obtained in the affected sequence area if the sample sequence is shifted to the left of its original position from the start point of the deviation i e downstream in the sequencing direction This leaves a gap in the sample sequence hence a deletion Figure 5 31 Example of a sample with an Anti Sense sequencing direction containing a mixture deletion deviation of 3 bases M utation Analyser version
64. ene configurations 6 13 1 Ret genomic DNA gene configuration Points of interest objects detailing known mutation sites 5 have been included in this gene configuration T hese can be used to generate hotspot deviations in the analysis and be included in the interactive confirmation process see Section 5 2 4 Overview C Program Files Biotech Mutation Configurations RE I demo cfg DNA Configuration RETdemo Regions 1 Exon 10 region 12 Exon 11 region 3 Exon 16 region a gt gt Exons 1 i Exon 10 n Exon 11 Exon 16 Fragments n Fragment 1 Fragment 2 Fragment 3 Areas of Interest codon 603 codon 634 codon 916 Codon Bu Codon 691 odon 618 Coden 620 Points of Interest T gt G or C T gt Aorc G gt AorT CEs T gt A orG cree G gt AorT CEs G gt or T GA i i i i i i I i i i i Be Pe A a A a 1i i j e 4 e Figure 6 37 Ret genomic DNA gene configuration comprising 3 regions 3 exons 10 11 16 and areas of interest for each exon 6 34 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 6 13 2 BRCA1 genomic DNA gene configuration This gene configuration is divided into 22 regions and contains 24 exons The non coding Exon 4 is not included in the configuration Exon 1 does not contain coding sequence so is not used to generate the amino acid sequence Overview C Program Files Biotech Mutation Configurations
65. ent bar 1 View the selected deviation in the Raw Data Curves field This will help you to evaluate the validity of the assignment made by the alignment calculation algorithm If you want to change the specified size of the insertion or deletion enter the new value into the Size box in the Assignment bar N ote that details can be given in the Comments box as to the identity of the bases involved in the insertion or deletion resulting from the change in size 5 10 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 2 Typein any comments into the Comments box in the Single Base Assignment bar 3 Makethe appropriate assignment based on the following criteria Wild Use this button if you want to a automatically assign the deviation back to the wild type i e the same as in the gene configuration This option also automatically approves the wild type assignment Use this button if you want to approve the insertion or deletion assignment proposed by M utation Analyser or an assignment of your own choice N ote Use of the Wild button automatically approves the assignment Use this button if you want to ignore the Ignore selected deviation or you are unable to make a determination about the deviation depending on your evaluation strategy N ote This should be used with caution 6 Your user assignment now automatically updates the information contained in the Deviations Table see S
66. entering a sequence into the Search String field or by loading a previously saved string by clicking on the Load button Any search string can be saved for future use by clicking on the Save As button and giving an appropriate name Define any other search criteria that you want Complement Find Check this box if you want to search the complementary sequence using complementary bases to those in the Search String field Backward search This looks for the search string beginning at the end of the sequence Click on Find First and if the string is present in the sequence its first occurrence will be detected and the Start Position shown The Start Position always shows the detected position within the configuration sequence with respect to the first base in the search string Click on Find Next to locate the next occurrence of the string The Overview window is automatically centred on the located string Click on Exit when the appropriate Position value is obtained Manew ionanw chg DMA Configuration CT C t A S A TT T T Figure 6 12 Overview window centred on the search string used in the Find dialogue e g GGGGCAG M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 6 3 3 Defining gene configuration objects The overview mode can be used to directly define the extent of bases for objects to be added to the gene configuration see Section 6 4 This iS particularly
67. equence or insert new bases Warning This function should be used with careful consideration since no record is made of the base editing that you perform 1 Select a deviation in the Deviations Table or a base position in the Alignment field 2 Select Edit Adjust Sample Sequence to display the Adjust Sample Sequence dialogue for the selected deviation or base position Adjust Sample Sequence Sample Sequence Base Components Adjusted lA G Original A Figure 4 30 Adjust Sample Sequence dialogue 4 32 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 To replace the selected base click on Replace to display the Edit Sample Base dialogue Edit Sample Base Edit Base ACL Adjusted Kp Original G Cancel Figure 4 31 Edit Sample Base dialogue Check the appropriate base component s and click on OK The Adjusted and Original base components are displayed in the Adjust Sample Sequence dialogue To delete the selected base click on Delete To insert a base before the currently selected base click on Insert to display the Insert Sample Base dialogue Insert Sample Base New Base OK Cancel Figure 4 32 Insert Sample Base dialogue AIG IL Adjusted if Select the base component s to be inserted and click on OK The base or appropriate ambiguity for more than one selected component is inserted
68. equencer fragments if both strands are being analysed If this option is checked any points of interest that you defined in the gene configuration see Section 6 4 1 will be included in Deviations Table as hotspots following analysis see Section 5 2 This iS particularly useful for labelling known polymorphisms and or known mutation sites H otspots can also be user assigned see Section 4 4 2 No hotspots will be generated if sample data is missing from these base positions Change the Quality Limits if required Min Alignment Score 0 00 1 00 Max No of Single Base Deviations Max No of Gap Deviations The minimum acceptable alignment score between the sample sequence and the gene configuration The score is also used for finding the best fitting sequencer fragment N ote that samples containing mixed insertions deletions may give rise to a poor score The maximum number of single base deviations see Section 5 2 allowed for a Sample sequence when aligned to the gene configuration The maximum number of explicit insertion deletion deviations see Section 5 3 for a sample sequence when aligned to the gene configuration By default a quality summary Is displayed after deviation calculation Uncheck the Show Quality Summary after option if you do not want the summary displayed Click on OK when you have selected the appropriate options M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA
69. er by directly entering a sequence into the Search String field or by loading a previously saved string by clicking on the Load button Any search string can be saved for future use by clicking on the Save As button and giving an appropriate name 3 Define any other search criteria that you want Complement Find Check this box if you want to search the complementary sequence using complementary bases to those in the Search String field Backward search This looks for the search string beginning at the end of the sequence Start Position Y ou can define the base position number from where the search begins After the search the base position in the located sequence corresponding to the first base in the search string is shown Offset Add xx Bases To allows you to add or subtract if a negative value is given a specified number of base positions relative to the start of or the end of the search string After the search is complete This value will be used to define one of the extent values for the new object M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 17 6 Configuration Editor 4 Click on Find First and if the string is present in the sequence its first occurrence will be detected and the Start Position shown The Start Position always shows the detected position with respect to the first base in the search string Click on Find Next to locate the next occurrence of the string 5 When you h
70. es can be simultaneously and rapidly analysed e Interactive user assignment Use the extensive analysis information to perform an interactive user assignment for each deviation Y ou can approve a deviation assign the deviation back to wild type or assign an undetermined flag for further evaluation M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 1 1 7 Introduction Genomic DNA and cDNA mRNA Sample sequences from genomic DNA and cDNA mRNA can be analysed The software automatically accounts for intron regions in genomic DNA sequences Platform for creating gene configurations The Configuration Editor module allows you to create or edit gene configurations against which sample sequences are analysed In a gene configuration you are able to define sequencer fragments exons areas of interest and points of interest Thus the gene configuration defines and documents your evaluation method Amino acid sequence for the coding sequence Configuration Editor automatically generates the amino acid sequence for the coding sequence data defined in the exons of a gene configuration Long gene configurations The complete gene configuration can contain 100 sequence regions each of up to 20 000 bases in length User defined deviations Study the raw data curves and include your own user defined deviations for evaluation Generation of reports and export files The results of an analysis and subsequent user evaluation ca
71. eviations Table For example 1 Create an analysis item see Section 4 2 1 based on the RET demo gene configuration see Section 6 13 1 2 To generate hotspots check the Generate Hotspots from Points of Interest option in the Deviation Calculation Options dialogue prior to analysis see Section 4 3 1 3 Include the hotspot deviations in the user assignment by checking the Hotspot deviation type in the Interactive Assignment Options dialogue see Section 4 4 2 4 Perform an analysis Analysis Calculate deviations or lt F9 gt The detected hotspot deviations including deviation type are displayed in the Deviations Table Deviahans Tate Type Nama BpiCodon Devieton User Assign Conenary Prager ee tert fate 15 7 r r TA lawpa l Ambi rh TR Praeger Pragmert eer 768 Ambiga oe Fagmort cen AMAD f Fiare Fiat Fiat Fre wreore Precareerr i rimcgrert cane Prrecereers i gt 1 amp amp amp Figure 5 8 Deviations Table containing Hotspot deviations for an analysis item based on the RETdemo gene configuration 5 6 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 5 2 5 User assignment of single base deviations A single base deviation selected in the Deviations Table including point replacements PointRep ambiguities Ambig sequence stops SeqStop and hotspots Hotspot will be represen
72. figuration Editor 6 4 6 A sequencer fragment will be automatically generated from the ALF ALX sequence corresponding to the defined region H owever if the imported file contains ambiguity codes the Ambiguities in Fragment dialogue is automatically displayed This dialogue shows all of the detected ambiguities in the Ambiguities Found field and allows you to reassign or exclude these bases accordingly e The Adjust Base field allows you to select a base for the highlighted ambiguity and replace it by clicking on Replace If you select the wildcard character and then click on Replace the Adjusted Code can represent any one of the four bases A C G T e You can exclude sequence data up to and including the selected ambiguity by selecting Cut From Beginning and then clicking on Cut Alternatively you can exclude all ambiguities from the currently selected position by selecting Cut To End and then clicking on Cut Note Cut does not remove or delete sequence data but instead affects the extent of the sequencer fragment to be defined Ambiguities In Fragment Ambiguities Found Position Original Code Adjusted Code N YV y N N N oO Adjust Base Adjust Fragment Extent gt A C T S g Cut From Beginning Repl Cut eplace u Skip Figure 6 6 Ambiguities in Fragment dialogue Click on Define once you have made the appropriate adjustments If there are stil
73. g mutation analysis see Section 4 6 5 Click on the Browse button to locate the relevant reference file and sample The pathway to this file is updated in the Ref Sample File field Adding an exon object Exon objects may already have been added if you defined a region using GenBank sequence data see Section 6 2 2 Settag Repos Rego am Type Ex Exon l Aree of imams l Sequence Fraqmest Prevt of internet Sea Search Cudno Sequence liomai os Codos Ne Postion Figure 6 16 Add Object dialogue for an exon l 2 6 14 Enter the Exon no Enter the Extent position values for the object see Section 6 4 2 If the sequence is derived from an Internet database and utilises lower case upper case letters for the definition of introns and exons exon objects can be easily added using the functions described in Section 6 4 3 Enter the Coding Sequence Information for automatic generation of the amino acid sequence see Section 6 7 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 Note An exon isa prerequisite for obtaining amino acid information during analysis using genomic DNA gene configurations CDN A mRNA configurations by contrast do not necessarily need defined exons to show the amino acid sequence see Section 6 7 Adding an area of interest object Settings Region 1 Region 1 ma gel F Area of Interest ll C Sequencer Fregmeat C Poin of
74. gue is displayed Select the sequence see Section 6 2 for the configuration in that region and click on OK Create a region based on the specific details for the sequence file format that you are using see Section 6 2 Note Regions are sequentially added and numbered within the gene configuration in the order that you add new regions See Section 6 6 3 if you want to change the order of the regions 3 Build up the gene configuration by adding objects see Section 6 4 6 6 2 Viewing the whole configuration W hen there is more than one region the whole gene configuration can be viewed by selecting View Full Zoom Out or Full Zoom Out from the right mouse button menu M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 21 6 Configuration Editor Mirae C agaa F rhe Heeter ts Aeteye ies coed epereyb ress leet chp COMA olx Configuration ret exon 10 11 16 TT eee seers HEH HEHEHEHEHE lt FEHEEHFEHEEHEEHEH Fragments i Arens of imerest i fttn ao fata Gas petsa Gie peat pmm geangie pate bl Points of interest Figure 6 23 Overview window containing three regions defined for the Ret exons 10 11 and 16 respectively Note that Region 2 is surrounded by a box which denotes that it is active The active region is surrounded by box Use the Zoom function to view only the selected region see Section 6 3 1 6 6 3 Rearranging regions The regions are automatically arranged in the order that you
75. hat are heterozygous 1 When a tissue sample is prepared it possibly contains a heterogeneous population of cells including the normal cells and tumour cells The normal cells may originate from the surrounding healthy tissue or come from a tumour specimen that contains both cell types 2 Two types of sequencing fragment will be produced namely a wild type gene fragment and a mutant gene fragment If the mutant gene has an insertion or deletion this means that the resulting sequencer fragment will be longer or shorter respectively than the corresponding wild type fragment 1 Wild type sequence ACGTTTGACTAGATAGGTATAGTTA 2 Deletion action producing mutated sequence GAT ra ACGTTTGACTA AGGTATAGTTA p L ACGTTTGACTAAGGTATAGTTA Figure 5 13 An example wild type fragment sequence and the corresponding sequence in a mutated sample fragment containing a 3 base deletion 5 12 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 3 When sequencing is performed detection of bases from the mutated gene fragment and wild type fragment will be similar up until the point where the insertion or deletion occurs After this point more than one base will be detected at each position Sequencing direction ACGTTITGACTAGATAGGTATAGTTA Wild type sequence ACG GACTAAGGTATAGTTA Mutated sequence Sequencing primer area Figure 5 14 Amplific
76. he sequencer fragment Click on OK The previous analysis results are consequently removed and you must perform the analysis again to accommodate the changes you made to the sequencer fragment 4 8 4 Changing the overview display options The components displayed in the Analysis Overview window can be selected as follows 1 Select Options Overview Options T he Overview Options dialogue is displayed Overview Options Include x Mutation Frequency x Exons Cancel x Areas of Interest Points of Interest x Gene Configuration Fragments x Test Sample s x Reference Sample s Figure 4 27 Overview Options dialogue box 2 Select the components to be included in the Analysis Overview window 3 Click on OK M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 29 4 Basic operation 4 9 Adding comments about the analysis Comments about the current analysis can be written in a separate window which are then saved together with the specific analysis item 1 Select Edit Comment Analysis The Comments on Analysis window will be displayed Type in new text relevant to the current analysis or update the existing text if you have already saved this in an earlier session with the current analysis item ty LL a Le Asay d zj Figure 4 28 Comments on Analysis window Iconise or close the window while you are not using it M aximise the i
77. hms A 4 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Export to database B B Export to database A typical use of the Export Result to Database function is illustrated in Figure B 1 The results from all the analysis items produced in a clinical evaluation study are exported to a Microsoft Access database together with information about the individuals and information from an external mutation database The different pieces of information are then processed together using the tools available in M icrosoft Access and different kinds of reports as well as statistics diagrams are produced Individuals Mutation Statistics E o E i am nS E 7 oe Individuals Infomation Analysis Items Mutation Datafase External Mutation Database Reports Figure B 1 Scheme showing the typical use of the Export Result to Database function The procedure used for exporting data to the M Icrosoft Access environment is described in more detail Note Data can be exported to other database environments in a similar way 1 After you have evaluated all the analysis items included in your study open the first Analysis item and select File Export Result to Database 2 In the Export to Database dialogue box that is displayed enter a suitable file name and click the OK button The information extracted from the analysis item will now be saved in the chosen M utation An
78. hole gene configuration M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 27 4 Basic operation 4 28 F Anahi saretee wee Contiguration RETdemo ee a E I E y vw om I Aag Peatiien I Sedie J Pur Dette Gria bema Mereegtheres Ost sore a Peres l Figure 4 25 Analysis Overview window with maximum magnification 4 8 2 Selecting a deviation for evaluation If you want to select a deviation in the Analysis Overview window for evaluation purposes 1 Click on the deviation mark that you want to evaluate The cursor line will now pass through the selected mark 2 Keep the mouse cursor on the selected deviation and click on the right mouse button to display the associated menu 3 Select Analysis Window from the menu options The Analysis Item window is displayed and the deviation selected in the Overview window is active 4 8 3 Adjusting sequencer fragments Y ou can adjust the extent of the sequencer fragments used for alignment against the sample sequences 1 Click on the relevant sequencer fragment in the Overview window 2 Select Edit Adjust Fragment Extent to display the Adjust Fragment Extent dialogue M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 Adjust Fragment Extent Fragment Fragment 2 Extent OK H H H H H H Da Cancel Figure 4 26 Adjust Fragment Extent dialogue 3 Enter the new extent of t
79. imerest Figure 6 17 Add Object dialogue for an area of interest 1 Enter a name for the area of interest 2 Enter the Extent position values for the object see Section 6 4 2 This is particularly useful for visualising specific codons M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 15 6 Configuration Editor Adding a point of interest object Figure 6 18 Add Object dialogue for a point of interest 1 Enter a name for the point of interest 2 Enter the Position value for the object see Section 6 4 2 This is particularly useful for defining polymorphic base positions or mutation hotspots The Name field could then be used for information about known substitutions 6 4 2 Defining the extent of objects The extent of an object can be defined in four ways by e selecting the base range in overview mode see Section 6 3 3 e manually entering the extent values in the Object dialogue e utilising the lower case upper case sequence definition exons only see Section 6 4 3 e using the embedded Search function to locate the relevant positions To use the Search function 1 Click on the appropriate Search button and the Find dialogue is displayed 6 16 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 l Complement Find Stan Position l Backward Search Offset Add T Bases To a Figure 6 19 Search dialogue 2 Enter a search string eith
80. ing the whole region can also be seen If there are ambiguity codes in the sequence these are coloured black Reducing magnification To successively reduce the magnification repeatedly select View Zoom Out or Zoom Out located on the right mouse button menu or press lt F8 gt on the keyboard M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 To return to the default lowest magnification select View Full Zoom Out or Full Zoom Out located on the right mouse button menu or lt F6 gt on the keyboard Note If your gene configuration contains more than one region the full zoom out function will show an overview of all regions see Section 6 6 2 Dinara me LA Ar F Configuration EIAI S EHTI R RAIS UIA YNI EBIN Or Y ff la Figure 6 10 Overview window with full magnification 6 3 2 Finding a sequence Y ou can use the find function to find a string of bases in the sequence 1 Usethe zoom function see Section 6 3 1 to maximise the magnification in the window for optimal visualisation of the individual bases 2 Select Edit Find and the Find dialogue is displayed Exit Search String Load Save As Se GGGGCAG l Complement Find Start Position fo l Backward Search Find Next Figure 6 11 Find dialogue M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 9 6 Configuration Editor 6 10 4 Enter a search string either by directly
81. l ambiguities present within the remaining fragment extent a warning message will be displayed indicating that a sequencer fragment cannot be automatically created while ambiguities remain M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 Alternatively click on Skip to define the region inclusive of all ambiguities although no sequencer fragment will be automatically produced Ports af interest zj PE zl Figure 6 7 Overview window with defined region and automatically generated sequencer fragment based on an ALX sample for exon 10 of the RET gene Note that the sequencing direction of sequencer fragment is indicated with an arrow 8 The sequence is imported into the Overview window and displayed at the lowest magnification Increased magnification will display more detail see Section 6 3 1 6 2 2 Importing GenBank sequences 1 Select File Add Region and choose GenBank from the submenu options The Import GenBank Sequence dialogue is displayed for the appropriate file format Select the appropriate file and click on OK 2 The GenBank Import dialogue is displayed This presents information stored in the GenBank file imported from the GenBank database via the Internet The information contained within a GenBank file may sometimes be incomplete so you should exercise care when defining a region In the GenBank Import dialogue you can define one or more regions depending on th
82. lect Options Deviation Calculation Options A dialogue box Is displayed Deviation Calculation Options i Gene Configuration Direction Only l Generate Hot Spots from Points of Interest Cancel i Quality Limits Min Alignment Score 0 00 1 00 0 70 Max No of Single Base Deviations eo Max No of Gap Deviations 50 x Show Quality Summary after Deviations Calculation Figure 4 10 Deviation Calculation Options dialogue box 2 Check the appropriate Settings options Include all bases Gene Configuration Direction Only T owards the end of a sequencing run the quality of the data may deteriorate By default this data at the end of the run will be included in the analysis as denoted by the checked option By unchecking this option this data will be excluded from the analysis If this option is checked and you have defined the sequencing directions of the individual sequencer fragments in the gene configuration the analysis will align each sample sequence in the direction specified in the gene configuration M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 9 4 Basic operation 4 10 Generate Hotspots from Points of Interest Unchecking this option aligns the sample sequence in both directions with respect to the gene configuration This latter process takes a longer time It is recommended that you use the former method and that you define two separate s
83. lity limit in mixture analysis 5 23 quality summary 4 11 setting limits 4 10 Fe raw data curves 4 20 changing window display size 4 21 multiple sets of raw data curves 4 23 rawdata shift correction 4 22 separate amplitude scales 4 22 raw data curves field mixture analysis 5 19 zoom function 4 21 rawdata shift correction 4 22 rearranging regions 6 22 reference fragments 4 4 referenced literature C 1 region adding objects 6 12 adding several 6 21 defining 6 3 6 6 6 8 amino acid sequence MRNA cDNA 6 30 defining in configuration editor 6 2 delete 6 24 deleting objects 6 20 editing objects 6 20 exporting 6 32 naming 6 3 6 6 6 8 rearranging the order 6 22 selecting objects 6 20 using ALF ALX sequences 6 2 using ASCII file sequences 6 7 using GenBank sequences 6 5 removing a sample 4 8 report export 4 35 export report options 4 35 export to database 4 35 options 4 33 options for configuration editor 6 32 print to file 4 35 printing 4 33 printing the gene configuration 6 32 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Index required valleyin mixture analysis 5 24 revert to pending status 5 12 3s sample information 4 20 sample information field 4 5 samples field 4 5 save analysis item 4 8 save analysis item as 4 8 save settings for options 4 30 saving a gene configuration 6 32 searching for object extents 6 16 selecting a deviation in analysi
84. lyser version 1 00 User M anual 56 3052 83 Edition AA 5 3 PAK KCT 5 Deviation analysis An ambiguity deviation is clearly seen in the Alignment field Ambiguity lt lt Alignment 5exon 10 Figure 5 4 Alignment field with an ambiguity deviation selected in a Ret gene sample sequence M utation Analyser classifies these as Ambig deviations in the Deviations Table Deviations Table Type Name Bp Codon Deviation UserAssign Comment lt Fragment 1 exon 11 Ambig G gt K Fragment exon 1 17 8 593 Ambig G gt R Fragment exon1 1803 601 Ambig GR Fragment exon 1 1853 618 9 Ambig G gt S Fragment 2 exon 1901 634 Ambig G gt R Fragment 3 exon Tf Ambig G gt R Ambig G gt R Ambig T gt Ambig C gt 5 Ambig A gt R Fragment 3 exon Tf Fragment 3 exon 1t 2159720 Fragment 3 exon 1f 2190 730 Fragment 3 exon 1f 2191 731 Figure 5 5 Deviations Table with an ambiguity deviation selected in a Ret gene sample Ambiguities are indicative of a mixed cell population and or a heterogeneous cell sample A given sample possibly contains cells from normal tissue and cells from tumour tissue or that that there are polymorphic differences between alleles i e heterozygous As discussed for point replacements see Section 5 2 1 M utation Analyser does not differentiate between a polymorphism and a mutation M oreover in the case of ambiguities no information can be given abo
85. mples list you can see the located File Names and pathway the number of the Clone in the sample file the Clone Name and Comment 6 To add an available sample select it and click on the Add sample s button Repeat this process for other samples Alternatively you can select several clones at once by clicking on the first sample and then pressing the lt Shift gt key while you click on the last sample All samples between the two will be automatically selected Click on Add to include these in the analysis item 7 When you have added all relevant samples from the current search click on Exit The Add Batch Samples dialogue is shown allowing you to make another search following steps 2 to 6 For example you can add the reference fragments for exons 10 11 16 by entering ret_ref in the Clone Comment field and starting the search T hese samples will be located and can be added to the analysis item Remember to check the Fragment option before you add the samples M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 7 4 Basic operation 4 8 8 When you have added all of the samples click on Exit The Analysis Item window will be again displayed containing all information about the selected samples 4 2 3 Removing a selected sample If you want to remove a sample from the analysis item select it in the Samples field and then select File Remove Selected Sample 4 2 4 Saving an analysis item Y ou are recommende
86. mutation False rate This is an estimate of the statistical probability that the program assignment following the results of the mixture analysis is false i e the lower the figure presented here the higher the probability that the program assignment based on the calculated shift is true The Undefined option is automatically selected until you calculate the type of mixture insertion deletion deviation 1 Click on the No Gap button if there was no explicit insertion or deletion directly adjacent and upstream of the detected deviation position This will be true for most of the instances when you perform a mixture analysis The result insertion Mixins or deletion MixDel will be automatically displayed in the Type field T he size of the insertion or deletion is equivalent to the shift value indicated For details on the process behind the calculation see Section 5 4 6 Note You should not become confused by the sign of the Size value Only the magnitude of the value is relevant here The sign of the number is used in the alignment calculation see Section 5 4 6 2 Add any appropriate comments M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 21 5 Deviation analysis 3 TO approve the assignment click on the Approve button A dialogue box will be displayed asking if you want to ignore all subsequent deviations downstream of the Mixins or MixDel deviation Click on Yes if you want to ignore devi
87. n M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 19 4 Basic operation 4 5 2 Alignment deviations Bases in the sample sequence are aligned with the corresponding bases in the gene configuration W here there is an alignment deviation in the Sample sequence with the gene configuration the mismatched bases for the sample and gene configuration sequence are separated up and down respectively By default the alignment deviation last selected in the Deviations Table is highlighted in the Alignment field The sample number and sample position for the deviation is displayed together with the corresponding region number and region position in the gene configuration 4 5 3 Viewing sample or alignment information Y ou can switch the view from the Alignment field and the Sample Information field by selecting View Show Sample Information To return to the Alignment field either select View Show Alignment Information or select a deviation in the Deviations Table 4 6 Raw Data Curves field The Raw Data Curves field displays curve data for the currently selected sample As for the alignment data in the Alignment field all data is presented in the Sense direction There are four colour coded curves one for each of the four bases A C G T Each peak in a curve corresponds to a base detected for that position A correspondingly coloured letter for the specific base is shown underneath a detected peak The displayed data i
88. n AA Configuration Editor 6 Figure 6 30 Overview of Region 1 of the BRCA1 gene configuration The amino acid sequence is generated based on the defined start position within Exon 2 Note that it is Exon 2 and not Exon 1 that contains the start to the coding sequence W ith reduced magnification the extent of the amino acid sequence is seen on other contiguous exons Figure 6 31 Overview of Regions 1 and 2 of the BRCA1 gene configuration The amino acid sequence is automatically generated along contiguous exons in this case for Exons 2 and 3 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 27 6 Configuration Editor 6 28 6 7 2 Non contiguously numbered exons In some gene configurations sequence information for all exons may not be available The gene configuration BRCA1 is an interesting example because e Exon 2 rather that Exon 1 contains the first coding sequence information e t contains 24 exons of which sequence information for the non coding Exon 4 is unavailable This means that Exon 2 is used as the first exon to define the coding sequence M oreover when calculating the amino acid sequence from Exon 2 only Exon 3 is automatically included as it is contiguous with the previous exon The next exon is Exon 5 which is non contiguous with exon 3 thus Exons 5 to 24 are not included in the initial automatic amino acid sequence generation Bo TEE ft Figure 6 32 Automatic amino
89. n be presented in a full report M oreover vital information can be exported to database for subsequent inclusion in other software applications Graphically interactive analysis The analysis proceeds in a few clearly defined and straightforward stages Sample information raw data graphs and analysis data are graphically presented in full colour to enhance user interaction and optimise the evaluation process Windows 95 The software has a modern user interface developed for Windows 95 1 1 Using the software 1 2 Y ou should check that your computer complies with the minimum hardware specification requirements detailed in Chapter 2 and that you are using M icrosoft Windows 95 operating system The application software should be installed according to the instructions in Chapter 3 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Introduction 7 1 1 1 Software protection device Each M utation Analyser software supplied by Amersham Biosciences comes with a HASP software protection device The HASP fits into any parallel port of an IBM compatible PC and contains a code that is matched with the current version of the software In order for the software to run properly the HASP must be fitted prior to software installation The HASP is transparent which means that peripherals such as a printer can be attached to the parallel port containing the H ASP and function normally Note If the HASP Is not fit
90. nces 18 1118 78 Edition AA 56 3042 87 Printed in Sweden by TK i Uppsala AB April 1997
91. ne Name ee Clone Comment z Ty Search in CL ASIOTECIAMIUTATION Search welode Setedewecturnes Exi Figure 4 7 Batch Load Samples dialogue The clone comment ret_0001 has been entered as the search string Enter a search string based on the Clone Name and or Clone Comment For example to find all of the sample sequences corresponding to exons 10 11 16 in the Ret gene configuration enter ret_0007 in the Clone Comment field Y ou can direct the search to take place in any directory If you want to change the currently selected directory click on the Change button and select the new search directory Check the Include Subdirectories option if you the want the search extended to subdirectories of the search directory For example the RET demo files are located in the Samples subdirectory under the M utation directory M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 5 Click on Search The results of the search are displayed in the ALF ALX file dialogue For example all samples containing the Clone Comment ret_0001 will be located and displayed Asn ablo Samples Fe Narre Cie Clone Name Conwrert Rpimpsce Fmomeant Add varreiu s boot Figure 4 8 ALF ALX file dialogue after a search for batch clones In this example clones for the Ret gene exons 10 11 16 were located corresponding to the Clone Comment search string ret_0001 In the Available Sa
92. nerating the amino acid sequence the calculation will be performed in the wrong reading frame This should be clearly evident once the calculation has been made since the amino acid sequence across all of the exons will be prematurely terminated This termination results from the random occurrence of stop codons produced in the wrong reading frame Configuration Editor stops the process of generating an amino acid sequence when it meets the first stop codon for example TAA TAG or TGA in the Universal transcription mode see Section 6 7 5 in the exon coding sequence M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 29 6 Configuration Editor were Proqram Fin ncn Cmon becel edt terrmismion cig DMA i OE Configuration Val Ser Pie Wet TTT eT TE L Oa Sl Win 12 13 Regi n gt Regesl Fragments Fagrar Fr Exons Eam aj po ail Figure 6 34 Amino sequence of BRCA1 Exon 5 generated in the wrong reading frame leading to termination at the first occurring stop codon TAA 6 7 4 Amino acid sequences for mRNA CDNA configurations Since MRNA and cDNA do not contain intron data the gene configuration should contain abutted exons thus giving an uninterrupted coding sequence This means that the sequence data used to define the region can be directly used to generate the amino acid sequence 1 Create a gene configuration for mRNA cDNA You should not define any exon objects 2 Select Edit Edit R
93. nfiguration 4 2 6 32 loading an analysis item 4 8 OO max probe length in mixture analysis 5 25 mixture analysis 5 15 advanced options 5 23 gap 5 22 max probe length 5 25 no gap 5 21 probability limit 5 23 required valley 5 24 results 5 17 shift range 5 16 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Index mixture assignment 5 20 mixture assignment bar 5 21 mixture graph 5 24 mixture assignment theory 5 25 mixture graph in mixture analysis 5 24 mixture insertion deletion deviations assignment bar 5 20 causes 5 12 mixture analysis 5 15 recognising 5 13 mRNA cDNA generating an amino acid sequence 6 30 multiple deviations user assignment 5 8 multiple sets of raw data curves 4 23 mutation analyser background 1 1 exiting 4 37 installation 3 1 key features 1 1 starting the application 4 1 uninstallation 3 2 mutation frequency statistics 6 20 no gap in mixture analysis 5 21 non contiguous exons generating an amino acid sequence 6 28 Oe object extents 6 16 overview options 4 29 overview options 4 29 Fe performing an analysis 4 9 4 11 point of interest object adding to region 6 16 for generating hotspots 6 16 point replacement deviations 5 2 amino acid changes 5 2 printers 2 1 printing a gene configuration report 6 32 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA V Index vi printing a report 4 33 probabi
94. ntain coding sequence bases but instead are used in site recognition etc 3 Usethe Find function to locate the first base of the start codon in the selected exon Briefly use the Zoom function to maximise the magnification of the Overview window for the selected region see Section 6 3 1 Select Edit Find to display the Find dialogue Enter the appropriate search string for the start codon often ATG Click on Find First and Find Next until the appropriate start codon string is located in the sequence N ote down the Start Position value from the Find dialogue and click on Exit See Section 6 3 2 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 25 6 Configuration Editor Figure 6 28 Example of using the Find dialogue to locate the appropriate start position of the start codon for the coding sequence 4 Select Edit Edit Object or select Edit Object from the right mouse button menu The Edit Object dialogue is displayed for the selected exon 5 In the Coding Sequence Information field enter the start Codon no and also the Position value that you obtained in step 3 a ay Figure 6 29 Coding Sequence Information field in the Edit Object exon dialogue defining the first codon and coding position 7 Click on OK in the Edit Object box and the amino acid sequence for all contiguous exons will be automatically calculated and displayed 6 26 M utation Analyser version 1 00 User M anual 56 3052 83 Editio
95. ogue The parameters that you can alter are the Probability Limit Required Valley and Max Probe Length Probability limit The Probability Limit value sets the inclusion threshold for calculated alignment probabilities in the mixture analysis results Values less than the set probability limit indicate that a statistically significant alignment was obtained between sample sequence and master sequence for the currently tested shift position All shifts fulfilling the probability limit criterion will be presented By default the probability limit is set to 0 01 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 23 5 Deviation analysis 5 24 Required valley During mixture analysis the alignment algorithm assigns a cumulative score unique for each shift as the alignment proceeds in the sequencing direction The awarded score is based upon the type of association between the base in a sample sequence and the corresponding base in the gene configuration Event Score M atching base 1 Shift criterion fulfilled 1 During a mixture analysis the algorithm uses a drop in the value of the cumulative score to detect the mixture insertion deletion deviation The Required Valley value is the number of cumulative points that must be lost in order for it to be treated as a deviation By default this value is set to 5 In an ideal situation the cumulative score produces a very characteristic curve This can be viewed by
96. on There are four types of single base deviation e Point replacement deviations e Ambiguity deviations e Sequence stop deviations e Hotspot deviations M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 1 5 Deviation analysis 5 2 5 2 1 Point replacement deviations This is where a base in the sample sequence is replaced with another resolved base that is different to the aligned base in the gene configuration This is clearly seen in the Alignment field Point Replacement Alignment 13C gt gt Figure 5 1 Alignment field with selected point replacement from A to Gina p53 gene sample sequence This is classified as a PointRep deviation in the Deviations Table Deviations Table Type Name Bp Codon Deviation Status UserAssign amp Fragment 1 13C5 Ambig A W Pending Fragment 1 13C5 seqstop GN Pending PointRep A gt G Fragment3 13C 742 248 PointRep C gt T Pending Fragment3 13G5 1121 374 Ambig G gt B Pending Fragment3 13G5 1136 379 Ambig GK Pending Figure 5 2 Deviations Table with a point replacement deviation selected in a p53 gene sample A point replacement is indicative of either a polymorphism or a mutation see Beaudet and Tsui 1993 1 although M utation Analyser does not make this differentiation User knowledge about the specific gene should allow you to identify a polymorphism vis a vis mutation As an additional tool in this identific
97. on the background on the curve should be stable and regular in the area around the ambiguity Check if there is noise on the curve in the regions before and after the ambiguous peak The mutation or change in the DNA sequence should not be present in all clones If so this suggests a sequencing artifact Estimate the peak height and valley depth by comparing similar regions within and between samples This will give you an indication of whether a peak is likely to be an artifact Take into consideration the sequence context i e the size of a peak is influenced by the specific pattern of neighbouring sequences Comparisons of different regions within the same sample are not totally reliable since the peak heights and valley depths are dependent on the resolution at a particular point of the run When available you can confirm a suspected mutation by reading the overlapping sequence from the neighbouring fragment If a suspected mutation is not clear enough you must do a confirmation run with newly sequenced DNA from the original tissue sample M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 29 5 Deviation analysis 5 6 2 Deletions and insertions 1 In a heterogeneous cell population if the deletion or insertion is large gt 5 7 bases you should see widened or even two extension product peaks This corresponds to there being one DNA fragment being longer or shorter than the other fragment in the mixed sampl
98. on dialogue is displayed Define Region X R Cancel ooo Ej Figure 6 27 Define Region dialogue for a genomic DNA gene configuration 6 6 4 Deleting a region To delete a region first make sure that it is active and then click on File Delete Selected Region 6 24 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Configuration Editor 6 6 7 Defining the amino acid sequence Configuration Editor can automatically calculate for the amino acid sequence for gene configurations For genomic DNA configurations this uses the coding sequence bases contained within the defined exons of the gene configuration Y ou need to supply the start position to the coding sequence in the correct reading frame for the first appropriate exon The amino acid sequence for that exon and all contiguous exons will be automatically generated see section 6 7 1 It is also possible to account for non contiguous exons in a gene configuration see section 6 7 2 For mRNA cDNA sequences you can define the amino acid sequence based on exons as for genomic DNA but a simpler method is to use the Define Region dialogue see Section 6 7 4 6 7 1 Contiguously numbered exons 1 Add the exon objects see Sections 6 4 1 and 6 6 1 for all regions see Section 6 6 1 in the gene configuration 2 Select the first exon containing the coding sequence in the gene configuration Note Some upstream exons in a gene may not co
99. on with respect to the coding information in the gene configuration Type This displays the type of deviation Ambig selected See Chapter 5 for more information about the different types of deviation M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 25 4 Basic operation Codon GAC Asp gt RACI Comment 4 8 Analysis overview 4 26 This compares the codon and corresponding amino acid in the gene configuration left with the codon containing the selected deviation left In the latter case the encoded amino acid is only shown if all bases in the codon are resolved This allows you to enter a comment about the selected deviation that will be displayed in the Deviations Table following user assignment These buttons allow you to make an assignment for the selected deviation Y our can Approve an assignment make an assignment to Ignore a deviation or automatically convert the deviation back to the wild type and approve it by selecting Wild The buttons shown are dependent on the type of Assignment bar Y ou can select to display an analysis overview which shows the whole gene configuration together with sample fragments and detected deviations Select View Analysis Overview T he Analysis Overview window Is displayed containing the following e The gene configuration is displayed for all of the regions together with the amino acid coding sequence O ther components of the gen
100. on within the M icrosoft Access environment Note You can now erase the file that you created in steps 1 3 to save 14 disk space D ata from other sources e g mutation databases information about the samples and the individuals included in the study can be imported into the database as separate tables in a similar way Refer to the Microsoft Access documentation for information on document preparation M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Export to database B 15 Finally the information in the different tables can be linked together based on fields with common information and different kinds of reports or statistics can be derived using the graphical design tools provided in the M icrosoft Access development environment Refer to the Microsoft Access documentation for details M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA B 3 B Export to database B 4 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Cited literature C C Cited literature 1 2 3 4 5 Beaudet A L and Tsui L C 1993 Human M utation 2 245 248 N eedleman S and Wunsch C 1970 J Mol Biol 48 444 Pearson W R and M iller W 1992 M ethods in Enzymology 210 575 V arious sources Anderson S et al 1981 N ature 290 547 Borst P 1980 81 International Cell Biology H G Schweiger ed Springer Verlag p 239 Breitenberger C and
101. only one of them was detected 1 Click on the red base of interest in the Alignment field The sample sequence base is non compatible with the gene configuration base as a result of a shift 3 places to the right Alignment gt gt Sample 1 194 Region 1 808 0 Figure 5 22 A base in the sample sequence which shows non agreement with the gene configuration as a result of a 3 base shift to the right 2 If there are two bases in the sample sequence and one of these was not detected by the base calling algorithm you would expect to be able to see both bases in the Raw Data Curves field Indeed the selected deviation is automatically selected in the Raw Data Curves field and an indication of the Expected bases is given i e the two bases that are expected to be present in the sample sequence if there is to be an agreement as a result of the shift In the example shown in Figures 5 20 and 5 21 the red base in the sample sequence is a T and the base in the gene configuration three bases to the right is a G Thus for there to be an agreement as a result of the shift the sample sequence is expected to contain aT and G base at the same position M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 19 5 Deviation analysis 5 20 3 Magnify the view for the raw data View Zoom In or lt F7 gt and determine if both of the expected bases are present If both bases are present as in Figure
102. ou want to include only those deviation types used for assignment This list can be modified by clicking on the Interactive Assignment Options button and checking the appropriate deviations in the displayed dialogue Click on OK Select File Print Report Y ou can select the printer setup options in the Print dialogue 4 13 2 Printing a deviations report The File Print Deviations Report command prints out extensive information about the deviation selected in the Deviations Table This includes the raw data curves graph deviation information codon information and alignment sequence data 4 13 3 Printing a report to file To print a report to a file in text txt format 1 Select Options Report Options The Report Options dialogue is displayed see Section 4 12 1 Select the components that you want to be included in the report Click on OK Select File Print to File enter a name for your report file and click on Save The file can be opened in most word processor applications 4 14 Exporting reports and results It is possible to export reports in simple text format to facilitate easy integration of information into other applications To export a report to a database l Select Options Export to Database Options A dialogue is displayed Select the components that you want to include in the exported file Click on OK M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 35 4 Basic operation
103. ow you to manually differentiate between a mixture insertion or deletion deviation The same principles are applied when you select No Gap in the Mixture Assignment bar see Section 5 4 4 to obtain the same result M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 25 5 Deviation analysis e f the deviation occurs within a sample with a Sense sequencing direction a positive size value indicates a deletion of length equal to the size value This can be explained in that a statistically meaningful alignment is obtained in the affected sequence area if the sample sequence is shifted to the right of its original position i e downstream in the sequencing direction This leaves a gap in the Sample sequence that corresponds to a deletion Figure 5 28 Example of a sample with a Sense sequencing direction containing a mixture deletion deviation of 3 bases e f the deviation occurs within a sample with a Sense sequencing direction a negative size value indicates an insertion of length equal to the size value This can be explained in that a statistically meaningful alignment is obtained in the affected sequence area if the Sample sequence is shifted to the left of its original position from the start point of the deviation i e upstream in the sequencing direction Those bases already present upstream in the sample sequence equivalent to the shift value are base insertions Figure 5 29 Example of a sample with a Sense sequ
104. own to contain base specific deviations compared with the wild type sequence for exon 10 In the gene configuration R epeat this process for other samples in the current ALF ALX file These may be reference samples that are not included in the analysis process but instead used for comparative purposes of the raw data curves Check the Reference Fragment option to include the sample for reference purposes only For example select the sample named exon 10 with comment ret_ref check the Reference Fragment box and add the sample to the analysis item This sample is the wild type sequence for exon 10 as used in the gene configuration 4 Toaddasamplefrom another ALF ALX file click on the Next ALF ALX file button This will return you to the Open ALF file dialogue in the same drive and directory from where you made your previous ALF ALX file selection Select a new ALF ALX file For example select the file called RETdemo2 alx and add the mutant sample exon 11 ret_0007 and the reference fragment exon 11 ret_ref 4 4 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 5 Repeat steps 3 and 4 until you have obtained all of the samples that you want to include in your new analysis item For example include the final sample for a Ret gene analysis by selecting the file called RETdemo3 alx and adding the mutant sample exon 16 ret_0001 and the reference fragment exon 16 ret_ref 6 When you have added
105. r lt lt for the Anti Sense direction The example shown in Figure 5 19 displays a sample fragment sequenced in the Sense direction M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 17 5 Deviation analysis Start position of deviation This is the estimated position where the mixture insertion deletion occurs Blue squares The blue squares indicate those bases that were used in the mixture analysis to give a statistically meaningful result The analysis uses the minimum possible number of bases in order to achieve this result Green squares The green squares indicate those bases in the sample sequence which are in agreement with the bases in the gene configuration resulting from the shift The value of the shift is displayed in the Deviation column of the Deviations table A positive value indicates an equivalent shift of the sample sequence to the right of its currently displayed alignment A negative value indicates an equivalent shift of the sample sequence to the left of its currently displayed alignment Red squares The red squares indicate those bases in the sample sequence which are not in agreement with the bases in the gene configuration resulting from the shift Alignment area upstream of the deviation As described earlier the upstream area of the sample sequence shows good alignment to the gene configuration and the alignment only becomes poor in the downstream area affected by the mixture inser
106. r drive and restart disk error on start up Other start up Bad configuration or system Check PC user s failure messages failure manual or contact local Amersham Biosciences Service Support 7 2 Printer Symptom Possible cause and or corrective Refer to measures Communication 1 Check that the printer is On Printer manual failure Line 2 Check communication cables N o message Print manager has to be open in about paper the background and active when plotting Garbled or no Check printer setup printout M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 7 1 Troubleshooting 7 3 Software 7 2 7 3 1 Mutation Analyser filename Column information differs Use existing column order instead filename does not exist Can t calculate clonename sequence data not available Can t add more samples to this analysis item Can t open clone No sequence data available Checksum is incorrect file has been modified aborting load Can t open internal file to present deviations W hen trying to append data to an existing database file and the column order was different to the existing file column format W hen selecting a file from the most recently used M RU list that is no longer available W hen a sample is being analysed that does not contain sequence data When out of memory The file being opened is corrupt During deviation
107. s the mutated sequence may predominate over the wild type sequence in a mixed population In the deviations calculation the mutated sequence will likely find the greatest degree of 5 22 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 alignment with the gene configuration sequence If the mutated gene sequence contains a deletion or insertion this will be displayed as explicit insertion s or deletion s respectively These can normally be evaluated without the need for a mixture analysis In some cases however there may be sufficient interference from the wild type sequence in the region downstream of the explicit insertion or deletion that you wish to perform a mixture analysis This is performed in exactly the same way as described in Sections 5 4 2 to 5 4 4 except that the Gap radio button is chosen in the Mixture Assignment bar for automatic calculation of the type of mixed deviation The results of the calculation are displayed accordingly 5 4 5 Advanced options for mixture insertion deletion deviation assignments There are several parameters that may be altered to adjust the sensitivity of the mixture analysis Select Analysis Mixture analysis to display the Mixture Analysis dialogue Miture Aj TUA Ophuss Seteocted sample onty Lic J Sart range a to pe _cancot_ Advenced Probatiliy Limit bit x Roqured Valley Max Probe Lenght Figure 5 25 Mixture Analysis dial
108. s centred on the sample sequence base currently selected in the Deviations Table The base corresponding to the selected base has a black box surrounding it A vertical cursor line can be moved in the field by holding down the left mouse button 4 20 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 Figure 4 20 Raw Data Curves field in the Analysis Item window 4 6 1 Changing the display window size To view only the Raw Data Curves field i e make the field bigger select View Full Raw Data View or Full Raw Data View from the right mouse button menu To reverse the function i e return the field to its normal size select the checked menu option a second time Alternatively make the Raw Data Curves field larger or smaller by dragging the right field border while holding down the left mouse button 4 6 2 The zoom function Y ou can increase or decrease the magnification of the data within the field by using the Zoom function For successive zoom in capability repeatedly select View Zoom In or Zoom In from the right mouse button menu or use the lt F7 gt key on the keyboard Conversely select View Zoom Out or Zoom Out from the right mouse button menu or use the lt F8 gt key for successive reduction of the magnification It is also possible to view a fully zoomed out display of all the data by selecting View Full Zoom Out or Full Zoom Out from the right mouse button menu The full size
109. s overview 4 28 selecting objects 6 20 separate amplitude scales 4 22 separate raw data scrollbars 4 25 sequence finding in configuration editor 6 9 sequence stop deviations 5 5 sequencer fragment adding to region 6 13 ambiguities in ALF ALX sequence 6 4 automatic generation in gene configuration 6 4 sequencing direction alignment field 4 19 setting quality summary limits 4 10 shift range 5 16 show sample information 4 20 single base deviation 5 1 assignment bar 5 7 single base deviation assignment 5 7 user detected deviation 5 28 software installation 3 1 software protection 1 3 software uninstallation 3 2 starting the application 4 1 translation amino acid sequence 6 31 troubleshooting 7 1 typographical conventions 1 4 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA vii Index viii De understanding mixture analysis 5 25 undo an assignment 5 12 uninstalling the software 3 2 user assignment insertion deletion deviations 5 10 mixture insertion deletion 5 20 multiple deviations 5 8 single base deviations 5 7 user detected deviation 5 28 user identification 4 1 changing user 4 36 a Windows 95 1 3 2 1 wrong reading frame generating an amino acid sequence 6 29 3 zoom function analysis overview 4 27 configuration editor 6 8 raw data curves field 4 21 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Amersham Bioscie
110. sequence either Upper Case or Lower Case 4 Select if the search should include only the selected region or all regions if there are more than one Click on OK 5 The Add Object dialogue displays the extent of the first detected exon region Setimgs Mego 1 Exon 1 mad e P Fa Esp po fi E xteni Search Search Cong Seqeente Whormathon Codon No Pusibon Search Figure 6 22 Add Object dialogue M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 19 6 Configuration Editor 9 Enter the Exon no Click on Add to include this object in the gene configuration Click on Next to locate each exon in the region s and add them accordingly If you click on Next after the last exon has been located you will be informed that there are no more exons and the dialogue will automatically close Click on Quit to close the dialogue at any other time Added exons are displayed in the Overview window 6 4 4 Including mutation frequency statistics l 2 Select a region Select File Add Mutation Statistics T he Import Mutation Statistics dialogue is displayed Select the relevant file and click on Open The statistics are presented as a bar histogram on the base position scale Note Mutation statistics should be stored in tabbed ASCII files one for each region Each file should contain the position numbers of the bases and the corresponding frequencies in two tab separated columns T hese
111. sion 1 00 User M anual 56 3052 83 Edition AA 4 15 4 Basic operation 4 16 Some deviations have a white status bar T hese deviations are not subject to user assignment as defined in the Interactive Assignment Options dialogue see Section 4 4 2 These can be hidden from the display by checking the View Interactive Confirmation Rows Only option see step 4 below Type Name This option displays the fragment type as defined in the gene configuration and the name of the sample fragment Bp C odon This option displays the base position and codon number in parentheses of the deviation This information is only available if coding sequence information has been included in the gene configuration Exon Pos This option displays the exon number and the base position within the exon of the deviation Region position This option displays the region number and base position within the region for the deviation according to the definitions in the gene configuration Sample position This option displays the sample number and base position of the deviation with respect to its position in the sample sequence P A A P and or an A in this column indicates whether the deviation coincides with a point of interest and or falls within an area of interest D eviation This options displays information about the type of deviation Status This option displays the user assignment status of the deviation either Pending an Appro
112. ted M utation Analyser can only be used for demonstration purposes using the supplied Demo files 1 1 2 Windows 95 operating system It is assumed that you have a working Knowledge of M icrosoft Windows 95 For further information on specific operating system functions and terms you should refer to the appropriate user manual 1 1 3 Menu commands M any of the menu commands in M utation Analyser are similarly located on the right mouse button menu The contents of a menu are dependent on the field from which you activate the right mouse button function M any of these menu commands are indicated in the manual and those that are not mentioned you will quickly find through working with the software Y ou will also find many keyboard shortcuts and these are summarised in the on line H elp 1 2 Using this manual This User M anual provides you with step by step instructions on how to perform an analysis using M utation Analyser and gives you guidance in using the various tools necessary for evaluating the results To successfully use M utation Analyser you are recommended to read this manual entirely Chapter 2 This tells you the minimum and recommended hardware requirements needed to run M utation Analyser Chapter 3 This gives a brief description of how to install M utation Analyser Chapter 4 This gives you an overview of the basic operation of M utation Analyser M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA
113. ted in the Single Base Assignment bar 1 View the selected deviation in the Raw Data Curves field This will help you to evaluate the validity of the assignment made by the alignment calculation algorithm Inthe Single Base Assignment bar select the base s that you m gG consider should be assigned to the specific deviation By default E m the base s corresponding to the selected deviation is selected as denoted by the checked box es 3 Typein any comments into the Comments box in the Single Base Assignment bar 4 Makethe appropriate assignment based on the following criteria Wild Use this button if you want to ms automatically assign the deviation back to the wild type i e the same as in the gene configuration This option also automatically approves the wild type assignment see Approve button description next Use this button if you want to approve the assignment proposed by M utation Analyser or an assignment of your own choice Use this button if you want to ignore the ignore selected deviation or you are unable to make a determination about the deviation depending on your evaluation strategy N ote This should be used with caution 6 Your user assignment now automatically updates the information contained in the Deviations Table see Section 4 4 1 for details of the various columns in the Deviations Table The updated information includes M utation Analyser version 1 00 User M anual 56 3052
114. the pull down list so it is possible to select your user name here if it is one of the last five M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 1 4 Basic operation User Identification Exit Figure 4 2 Pull down list in User Identification panel 3 Click on the Continue button By default an empty Analysis Item window is displayed 4 2 Creating and loading an analysis item type A tel Bee wet otc Sette Ree creo Dog Cost te Ores ham tean n yy enw ade Serpii ert dati ph eqs 4 2 In order to make an analysis you must create an analysis item which comprises the following components e A gene configuration containing the wild type sequence against which sample sequences are aligned and analysed see Chapter 6 for details on creating gene configurations e Sample sequences from one or more ALF ALF express sequencing runs that can be aligned with the gene configuration sequence and be analysed e Possible additional ALF ALX samples for reference purposes in the analysis 4 2 1 Creating an analysis item After you have started the application an Analysis Item window is displayed called Noname itm The gene configuration last used is already loaded 1 Select File Load Gene Configuration to load a new gene configuration The Load Gene Configuration dialogue is displayed Select a configuration file and click on Open For example select the configuration file called RETdemo
115. tification dialogue M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 4 16 Exiting the application To exit M utation Analyser select File Exit M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 37 4 Basic operation 4 38 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 5 Deviation analysis In Chapter 4 it was explained how to create an analysis item and then perform an analysis The key information and tools associated with the analysis were presented This chapter introduces the various types of alignment deviations that you will encounter and guides you on performing user assignments for the deviations Note It is assumed that you have performed an analysis of your analysis item using the Analysis Calculate Deviations command lt F9 gt see Section 4 3 5 1 Types of alignment deviations There are several types of deviation that you will encounter when using M utation Analyser These can be classified into four main groups Single base deviations see Section 5 2 Insertion deletion deviations see Section 5 3 M ixture Insertion deletion deviations see Section 5 4 User defined deviations See Section 5 5 5 2 Single base deviations This class includes all cases where M utation Analyser has detected a difference in the sample sequence at a single base position compared to the aligned base in the gene configurati
116. tion deletion As a result of the mixture analysis the upstream area will almost entirely display red squares T his is because the applied shift to this upstream area results in a non compatible alignment between the sample sequence and gene configuration Any green squares displayed in the upstream area as a result of the shift are random events Alignment region downstream of the deviation Contrary to the upstream area the downstream area should after mixture analysis display a dramatic improvement in the alignment between the sample sequence and gene configuration as a result of the shift This should be evident by the majority of green squares Any red squares indicate a disagreement between the sample sequence and gene configuration sequence as a result of the shift Assuming the mixture 5 18 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 insertion deletion deviation is valid red squares can occur for two reasons e there is a single base deviation at the position marked by the red square hence the non alignment after the shift e there are two components occurring at the same position in the Sample sequence but the base calling algorithm of the sequencing software was only able to detect one component that is not compatible with the base in the gene configuration It is possible to check if there is a single base deviation in the sample sequence or if there are two components of which
117. ts see Section 4 3 1 from points of interest defined in the gene configuration see Section 6 4 1 check the Hotspot deviation option A hotspot deviation will be entered into the Deviations Table for all points of interest and must be user assigned as for single base deviations see Section 5 2 If you checked the View Interactive Confirmation Rows Only option in the Deviations Table Options dialogue see Section 4 4 1 only those deviations selected for interactive assignment will be displayed in the Deviations Table M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 4 17 4 Basic operation 4 18 letoractivwes Contiireatios Rows I ype OK E Powthep P Mx bea Det NoDev Ambig m Sanj Ead Missing l SmnjEnd Erta Cancel E Insort Deteto W UserDev M HotSpot Scope Defoe w An Potts of leternet Desas T Ateas of Interest X Ano lecromon Figure 4 17 Interactive Confirmation Options dialogue Select the Scope of the deviations to be included in the interactive assignment process Y ou can select to include All deviations or those deviations occurring at Points of Interest within Areas of Interest and within Exons By default the Auto Increment option is checked so that when a user has made an assignment for a deviation M utation Analyser automatically goes to the next deviation in the table Deselect this option if you want to manually select the order of deviations for assignment Click
118. upted files cannot be used Create a new database file Free up disc space or memory Restart the computer Try closing other applications or restart the computer Corrupted files cannot be used Recreate the source file to be Opened R edefine the current gene configuration or use another 7 5 Troubleshooting The available printer When trying to print a Use another fonts may not produce report ona printer which printer a correct layout does not support the fonts Courier or Courier New orisa Line Printer Too short sequenceto When the sequence Try again calculate modulation contained in the loaded maybe change factor ALF ALX file was too filename short to calculate any modulation factor W rong file format W hen the file being Open afiletype N ot an Analysis Item Opened is not an analysis designated itm file item file 7 4 Other problems High background in your sample sequence If you experience high background in your sample sequence leading to unresolved base calling you should try applying a different post run action sensitivity to your sample sequence in the sequencing software Incomplete G enBank data imported If you do not get any locus or type information in a GenBank file this may be due to the use of a non appropriate file format e g html format when importing the file from the Internet Establish how native GenBank format files are produced by your favourit
119. useful for defining areas of interest or points of interest 1 Locate the base s of interest using the Find function see Section 6 3 2 2 10 definea string of bases to create an object hold down the left mouse button and drag the cursor over the appropriate bases For longer sequences select the first base and click on the lt Shift gt key when selecting the last base to select all bases in between Owarweew C Program Files Biotect Mutation ret qm ctg DNA OT x a Configuration ret exons 10 11 12 OF HSHH HHHH THH hH HHH t g 110 Region Regn Fragments Exons Areas Of interest Points of interest A iid Pm Figure 6 13 Selected sequence TGC defining the extent of an object to be created 3 Select Edit Add Object The Object dialogue is displayed and the extent values of the selection are shown see section 6 4 4 Enter the other variables for the object e g tyoe and name of object see Section 6 4 for details 6 3 4 Adjusting bases in the sequence Y ou can edit or delete selected bases in the sequence or insert new bases 1 Select the relevant base in the sequence and then select Edit Sequence from the right mouse button menu The Edit Sequence dialogue is displayed M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 11 6 Configuration Editor Edit Sequence x Adjust Base A C r C S E se Replace Insert 7 Delete Note Changes are permanent
120. ut the encoded amino acid since the specific base is unresolved The bases constituting the specific ambiguity code are readily seen in the Assignment bar by viewing the checked options M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 The ambiguity code S prevents determination of the encoded amino acid aea fambig___fOCTIAls XSCT Figure 5 6 The encoded amino acid cannot be determined in the Assignment bar from an ambiguity 5 2 3 Sequence stop deviations A sequence stop is designated the ambiguity code N and means that all four bases were detected at the same position in the sequencer fragment see Table 5 1 Figure 5 7 Raw Data Curves field showing four bases at the same position Sequence stops are indicative of problem regions in the template causing the sequencing enzyme to fall off without incorporating the correct ddN TP terminator hence creating signals in all four base channels M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 5 5 Deviation analysis Sequence stops are classified as SeqStop deviations in the Deviations Table and counts as an ambiguity deviation for purposes of user assignment 5 2 4 Hotspot deviations If you defined points of interest in the gene configuration see Section 6 4 1 whether for positions known to be polymorphic or prone to mutation these can be used to generate Hotspot deviations that are shown in the D
121. ved user assignment or Ignored see Chapter 5 The Status Colour option also gives the same indication of status M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 User Assign This option displays specific details about the assignment made by the user Responsible This option displays the name of the user last responsible for making an assignment for that deviation Comment This option displays comments added during user assignment in the Assignment bar see Section 4 7 4 By default all deviation positions are displayed Some deviations are not subject to user assignment as defined in the Interactive Assignment Options dialogue see Section 4 4 2 Such deviations have a white status bar if the Status Colour option is selected These can be hidden from the display by checking the View Interactive Confirmation Rows Only option 5 Click on Default if you want to return to the original table display settings 6 Click on OKto accept you options selection 4 4 2 Displaying deviations for interactive assignment The contents displayed in the Deviations Table can be further filtered to display only the types of deviation that are to be included for user assignment 1 Click on Options Interactive Assignment Options to display the Interactive Assignment Options dialogue Check the deviation types to be included in the interactive assignment process Note If you selected to generate hotspo
122. version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 yment 2 Gene configuration Fragment fragments _ _ Sample fragment with suspected mixture insertion deletion deviation Downstream region containing many adjacent ambiguity deviations Figure 5 18 Portion of the Analysis Overview window showing the alignment between a p53 gene configuration sequencer fragment and a sample fragment suspected of containing a mixture insertion deletion Note that the fragment contains an upstream area with good alignment followed by a downstream area that is densely packed with ambiguity deviations 5 4 2 Performing a mixture analysis If you suspect that one or more of the samples contain a mixture insertion or deletion it is possible to confirm this by performing a mixture analysis 1 Select Analysis Mixture Analysis T he Mixture Analysis dialogue is displayed Mixture Ana WSIS Optiess Setected sampte onty SAN range i to 10 _Sancat Advanced Probabebty Limit fe n Required Valley f Max Probe Length so Figure 5 19 Mixture Analysis dialogue M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 5 15 5 Deviation analysis 2 Select the Shift range for the analysis This will set the limits for the number of alignment shift positions to be tested T he default range of 10 to 10 means that the 10 alignment positions both to the left and right of the
123. which there is a deviation in the same position in overlapping sample sequences all will be grouped together in the Deviations Table and naturally in the Raw Data Curves field M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Deviation analysis 5 Preorrest ewn l Star Extra 15 Frogen Tr Def Ea I5 Fregmeast aeon li Antg Gor Pregreest eeon ts 177875 Amtig R Frores J ewh 1 177858 Aarmteg Gor Pregrest mwn 100 501 Antigo GR Precrrest ewn Ii 1807801 4Qanteg Goh Froprest gwon 11 1957578 no Gos Fareri i f ni tial e artag lros Fribgroni l gwon End Ene 4 Pregrest econ Erd Erte 4 TET TE Ad Oher Erta Figure 5 9 Deviations Table showing a selected deviation in a Ret gene sample A deviation at the same base position in an overlapping sample is grouped underneath the selected deviation and is highlighted in as a grey row 3 Follow the user assignment instructions detailed in Section 5 2 5 The only difference is that the Approve button is replaced with Approve All which means that the same assignment is made for the deviation group in all overlapping samples Similarly selecting Wild applies to the deviation group H owever if you assign Ignore this is only valid for the selected deviation and other instances of the deviation must be user assigned separately 5 3 Insertion deletion assignments Explicit base insertions or deletions in the sample sequence can be detected in
124. x assignment bar 4 25 insertion deletion deviations 5 10 mixture insertion deletion 5 20 single base deviations 5 7 associating a sample sequence to a fragment 4 11 autodefining exon objects 6 18 OOOO LLL T_E changing the raw data curves field size 4 21 changing user 4 36 cited literature C 1 codon translation options for amino acid sequence 6 31 comments about the analysis 4 30 computer requirements 2 1 configuration editor exiting 6 33 generating an amino acid sequence 6 25 new gene configuration 6 1 zoom function 6 8 contiguous exons generating an amino acid sequence 6 25 converting from genomic DNA to mRNA cDNA 6 33 creating a new analysis item 4 2 a defining a gene configuration region 6 2 defining an object gene configuration overview 6 11 defining several gene configuration regions 6 21 deleting a region 6 24 deleting objects 6 20 deviation calculation options 4 9 deviation types 5 1 deviations ambiguities 5 3 golden rules 5 29 hotspots 5 6 insertion deletion 5 9 mixture insertion deletion 5 12 point replacements 5 2 sequence stops 5 5 single base 5 1 deviations calculation 4 9 4 11 deviations information 4 18 M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Index deviations table 4 14 increased size 4 14 deviations table options 4 14 editing objects 6 20 editing the sample sequence mutation analyser 4 32 editing th
125. y you can remove a set of curves from the display by double clicking on it with the left mouse button The Related Raw Data M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA Basic operation 4 dialogue will be automatically displayed in which the Selected Samples option is active for the remaining sets of raw data curves Select other options to see other sets of curves 4 6 6 Separate scrollbars By default the Raw Data Curves field has only one horizontal scrollbar This means that all data will be similarly affected with the scrollbar if multiple sets of data are displayed By selecting Options Separate Raw Data Scrollbars each set of displayed data will obtain its own scrollbar 4 7 Assignment bar The Assignment bar Single Base Assignment Insertion Assignment Deletion Assignment or Mixture Assignment allows you to makea user assignment for each of the deviations beeape Howe Assigersert i revere igoe rer wed Figure 4 23 Assignment bar User assignment is presented in Chapter 5 although a brief description of the Assignment bar components is given here Siew Codary Tyo Casen Comtevr The checked boxes correspond to the base components detected for the selected deviation Y ou can check any selection of base components that you consider should be assigned to the deviation KAK a Bo Cadon This displays the base position 19 7 and codon number in parentheses of the selected deviati
126. yed for the appropriate file format Select the appropriate file and click on OK 2 Select a sequence and click on Add Region T he Define Region dialogue is displayed Enter a name for the region and the position of the first base in that region usually number 1 If the sequence consists entirely of lower case letters as obtained from some databases these could be converted to uppercase by checking the Set Upper Case option Do not check this option if you are able to define exons based on the case of the bases see Section 6 4 3 If you are defining a gene configuration for MRNA cDNA you can also add information here for amino acid sequence generation see Section 6 7 4 Click on OK The Overview window is updated with the sequence information 6 3 Navigating the region 6 8 There are several tools available that allow you navigate the region and view the sequence data along 6 3 1 Using the zoom function The zoom function allows you to magnify an area of the Overview window contents so that the individual bases in the configuration sequence can be visualised Increasing magnification To successively increase the magnification first select the region of interest and then repeatedly select View Zoom In or Zoom In located on the right mouse button menu or press lt F7 gt 0n the keyboard With increased magnification the individual coloured bases in the configuration sequence can be visualised A scale bar spann
127. you must select either Genomic DNA or mRNA cDNA corresponding to the configuration you want to create Configuration Type What type of configuration mRNA cDNA Figure 6 1 Configuration type dialogue 3 An empty Overview window is displayed called Noname cfg 4 Select Edit Edit Description to open a dialogue that allows you to add a description that is valid for the whole gene configuration Figure 6 2 Configuration description dialogue M utation Analyser version 1 00 User M anual 56 3052 83 Edition AA 6 1 6 Configuration Editor 6 2 Defining a region 6 2 A region is a defined sequence of up to 20 000 bases in length The sequence is imported into Configuration Editor and is derived from several sources typically from the international sequence databases accessible on the Internet or as an ALF ALX file generated from ALF ALFexpress sequencers Within a region specific objects that are relevant to the gene configuration can be added such as sequencer fragments exons areas of interest and points of interest For particularly large or complex genes the configuration can be split into several regions see Section 6 6 2 1 Importing an ALF ALX sequence Select File Add Region and choose ALF ALX from the submenu options The Import ALF ALX Sequence dialogue is displayed for the appropriate file format Import ALF ALX Sequence Ei FS Look in i Samples a cl bt fE a p53demo1 alf a R

Download Pdf Manuals

Related Search

Related Contents

MANUAL DE USUARIO  intext:Betriebsanleitung filetype:pdf  John Deere AT-3201-J User's Manual  Bitácora Electrónica de Obra Pública  LG LW1812HR Owner's Manual  Samsung WF7522SUV Felhasználói kézikönyv  enrique cervantes - Facultad de Ingeniería Mecánica y Eléctrica  MIKUNI TDMR32 （ダウンドラフト） ビッグキャブレターキット 取扱説明書  Untitled - PlayStation  manual de instalação do certificado digital a1  

Copyright © All rights reserved. Failed to retrieve file