Home

Yeast Display scFv Antibody Library User`s Manual

1. CCCTACGGTC GGACTCACCA GAGATGCACA AGCCGCCTCC CTGGTTCGAG EcoRI HindIII 25 G I L E L I 5 E E D L Soll ACCGTCCTAT CCGGAATTCT AGAACAAAAG CTTATTTCTG AAGAAGACTT TGGCAGGATA GGCCTTAAGA TCTTGTTTTC TTCTTCTGAA NotI L 901 GTAATAGCTC GGCGGCCGCA CATTATCGAG CCGCCGGCGT PNL9rev primer GCCTTAAGAT CTTGTTTTCG Note 9rev primer will only hybridize to an scFv clone in the library vector pPNL6 and not the starting vector 35 Sequence of pPNL6 and pPNL9 pPNL6 sequence cgacaggttatcagcaacaacacagtcatatccattctcaattagctctaccacagtgtgtgaaccaatgtatccagcaccacctgt aaccaaaacaattttagaagtactttcactttgtaactgagctgtcatttatattgaattttcaaaaattcttactttttttttggatggacgc aaagaagtttaataatcatattacatggcattaccaccatatacatatccatatacatatccatatctaatcttacttatatgttgtggaaa tgtaaagagccccattatcttagcctaaaaaaaccttctctttggaactttcagtaatacgcttaactgctcattgctatattgaagtac ggattagaagccgccgagcgggtgacagccctecgaaggaagactctectccgtgcgtectegtettcaccggtegcgttectg aaacgcagatgtgcctcgcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagaggaaaaattg gcagtaacctggccccacaaaccttcaaatgaacgaatcaaattaacaaccataggatgataatgcgattagttttttagccttattt ctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatgcaaaaactgcataaccactttaactaatacttt caacattttcggtttgtattacttcttattcaaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgtcaagga gaaaaaaccccggatcgaattccctacttcatacattttcaattaagatgcagttacttcgctgtttttcaatattttctgttattegcttcag ttttagcacaggaactga
2. Liquid media grown cells are centrifugation and induced An aliquot is generally frozen as well Therefore from 10 cells you might sort out a total of 10 to 104 cells Typically 50 of the cells will form colonies or will be viable For subsequent sorts 70 of the cells will be c myc positive with the vast majority being binding antigen After regrowth and induction of the yeast from the Round 1 selection 10 labeled with antigen at a concentration of 0 5X to 0 1X the concentration at Kp The addition of anti c myc and the staining with secondary reagents is as described in section 3 5 10 Sort on the brightest 0 196 of antigen binding c myc positive clones Note The sub libraries overall Kp can be determined using a similar approach as determining the Kp of an individual clone as outlined in section 3 5 We will generally do our first sort with antigen concentration at Kd and then drop the concentration by 2 10 fold each subsequent sort Repeat steps 6 10 for 2 additional rounds Individual clones can be assayed for Kp and sequencing of the insert can determine number of unique clones and where particular changes from the parental clone occur Generally by the forth round of selection 80 of the clones in the sub library will be improved mutants Note We often place a sort gate in the are where a saturated clone resides in the bivariate plot for the parental clone The sorts use 1 10 antigen concentration at Kd for
3. PNL9for GACGTTCCAG ACTACGCTGG TGGTGGTGGT TCTGCTA PNL9rev GGGTTAGGGA TAGGCTTACC CTGTTGTTCT AGAATTCCG An additional vector diagram is included that showing an scFv clone from the library with all relevant primers and restriction sites as well as the surrounding sequence in both the secretion vector and surface expression vector Changes to Revision 031113 1 Try to more clearly indicate the need to duplicate the data in Figures 6 and 7 with the control scFv clone included in the kit Generating a data set as in Figure 4 might also be useful 2 Try to more clearly indicate the need to duplicate the data for HA and staining of the library in Figure2 44
4. spectrophotometer We find about 2 x 10 cells mL per OD oo unit This should be determined by plating yeast on agar plates or using a hemacytometer to calibrate your laboratories spectrophotometer 3 1 1 Libraries of scFv 1 Start a SD CAA culture that contains a minimum of a 10x representation of the diversity of your library For a 10 diverse library 10 yeast are needed to start the culture The culture would be 1 L of 0 5 OD mL Plating a dilution plate is highly recommended to verify colony forming units and lack of bacterial contamination 2 Grow at 30 C with shaking overnight baffle flask work best to increase aeration and increase growth Take 10x representation of library diversity from culture and pellet If you diversity is 10 clones then a 10x representation would be 10 yeast That means at 2 x 107 yeast OD oo unit you need 500 ODoo mLs For example if your OD is 5 0 ODgoo MmI then you need 100 mls of the culture to obtain 10 yeast Generally the culture should be freshly saturated or be 4 OD600 mL 3 Resuspend the cell pellet in 5 CAA at 0 5 OD mL and incubate at 20 C with shaking for 1 to 2 doublings as determined by OD This will generally take 12 to 16 hours 4 Wash the yeast once in wash buffer The yeast are now ready to be labeled with biotinylated antigen and enriched on a magnetic column You can also store the cells by placing the flask at 4 C for up to a week with minimal degradati
5. 1 EBY100 100 uL aliquot in 1596 glycerol Thaw rapidly at 30 C and streak on to YPD plate Plate 30 C for 24 hours Make your own freezer stocks 2 YVH10 100 uL aliquot in 15 glycerol Thaw rapidly at 30 C and streak on to YPD plate Plate 30 C for 24 hours Make your own freezer stocks 3 pPNL6 plasmid 100 uL of 100 ng mL Transform into coli and select for Ampicillin resistant colonies Isolate plasmid for use 4 pPNL9 plasmid 100 uL of 100 ng mL Transform into coli and select for Ampicillin resistant colonies Isolate plasmid for use 5 Control R3b 2 scFv in EBY100 100 uL aliquot in 15 glycerol Thaw rapidly at 30 C and streak on to SDCAA plate Plate 30 C for 48 hours Make your own freezer stocks 6 Control biotinylated antigen 100 uL of 10 uM stock in PBS 1 BSA Store at 20 C Not to be used to select on library 7 scFv library aliquot Approximately a 2 mL aliquot containing at least 10 yeast Thaw quickly at 30 C and resuspend in 100mls of YPD and incubate for 90 minutes 30 C to help the cells recover you should do a dilution plate at this point dilution on YPD Pellet cells and resuspend in 2 L of 2x SDCAA media see manual Dilution 1 2000 of 2 L culture should give 500 colonies on plate Grow plate at 30 C for 48 hours Replica plate the colonies onto SDCAA plate You will probably see about 2 of the colonies do not grow Count colonies to determine starting titer of liquid culture
6. ms gt A 2 en n scFv 32 Plasmids Strains and Growth Conditions 1 GAL1 10 820 622 PNL20 PCR for primer 645 821 Eco RI 821 849 Aga2p signal peptide 902 849 AGA2 1107 1 10Jinker 1124 5273 ColE1 ori 6092 ers 1125 1136 N A 1136 pPNL6 rev 1155 Surface Expression 25 Mn Vector 1137 HA tag 1163 4388 AmpR 5245 1164 linker 1229 6466 bp 1225 Nhe 1 1225 1230 8 1412 N Select on 4 HUTor 1413 tag 1445 SD CAA 1414 Bam HI 1414 1426 Hin dill 1426 3739 cen6 ars4 4254 1461 Not 1 1461 3338 Bsp EI 3338 1482 pnl20 seq Rev primer 1507 1512 PNL20PCR rev primer 1539 1473 terminator 1765 2690 Hin dlll 2690 2535 TRP1 3236 EBY100 Leu BJ5465 is MATa It has the auxotrophic ura3 52 a Ty element insertion with no detectable background reversion frequency trpl an amber point mutation leu25200 his35200 pep4 HIS3 prbd1 6R canl GAL EBY100 has genomic insertion of AGA1 regulated by GAL promoter with a URA3 selectable marker The scFv library is in this strain Growth EBY 100 with pPNL6 would be grown on in on SD CAA Ura Trp EBY 100 without a plasmid add Trp to SD CAA or YPD 33 PNL6 rev Primer 51 101 151 201 251 301 SS 401 451 501 Pst Eco RI Nhe pnl9 primer pnl 9 for Hin dill Pst C myc tag HA tag BamHI 645 3 linker Not VH PstI Eco RI VL PNL6 for prim
7. Grow liquid culture to saturation 4 8 OD oo mL 24 to 48 hours and freeze down aliquots representing 10 cells for future use 2L x 4 8000 OD mls which 16 library aliquots 500 OD aliquot Our results show 1 1 5 x 10 yeast grow on YPD plates and only 2 5 of these do not grow when replica plated onto SDCAA 1 Introduction This manual was created to help guide users of the scFv library described in an article published in the February 2003 issue of Nature Biotechnology titled Flow cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library The purpose of the manual is not to be all inclusive of every protocol associated with the potential uses of the library and subsequent clones but to provide useful techniques relevant references and data figures demonstrating the employment of the described techniques It is also clearly stated here and in the MTA the following Any MATERIAL delivered pursuant to this Agreement is understood to be experimental in nature and may have hazardous properties THE PROVIDER MAKES NO REPRESENTATIONS AND EXTENDS NO WARRANTIES OF ANY KIND EITHER EXPRESSED OR IMPLIED THERE ARE NO EXPRESS OR IMPLIED WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE OR THAT THE USE OF THE MATERIAL WILL NOT INFRINGE ANY PATENT COPYRIGHT TRADEMARK OR OTHER PROPRIETARY RIGHTS Unless prohibited by law Recipient assumes all liability for claims for
8. H O 39 X Primers 10 uM each 2 0 2 mM each Template X Platinum Taq Gibco 5U pL 0 5 Cycle 95 C 5 minutes 95 C 30 seconds 50 C 30 seconds 72 C 45 seconds repeat 29 or 34 cycles 72 C 5 minutes Note These primers PNL6 for and rev will not hybridize or amplify a segment of DNA from the starting pPNL6 vector The primers anneal to part of the cloned scFv gene and to part of the starting vector Therefore only scFv library clones will be amplified 26 Yeast Colony PCR Primers PNL6 Forward GTACGAGCTAAAAGTACAGTG PNL6 Reverse TAGATACCCATACGACGTIC Prepare microfuge tubes or PCR tubes containing 20 uL 0 1 SDS Use pipette tip to transfer yeast colony to tube or pellet 100 uL of cells from a 1 to 3 day old liquid culture and then add 20 uL 0 1 SDS Try for 1 x 10 cells a medium sized colony Err toward having too much as opposed to not having enough Pipette up and down Vortex on high for 10 seconds Heat at 95 C for 5 minutes spin 30 seconds on high and add 1 to 2 uL of supernatant into 50 uL PCR reaction Typically the samples are heated in an MJ thermocycler Reaction and conditions see below OTHER NOTES Cell age is critical Plates are 1 to 7 days old Anything more than 7 days is far less successful You can also use a broth culture just spin down enough cells to see a small pellet approximately the size of a colony discard supernatant wash with water and proceed like a colony PCR
9. ACTACGCTGG TGGTGGTGGT TCTGCTA PNL9rev GGGTTAGGGA TAGGCTTACC CTGTTGTTCT AGAATTCCG PNL9 Secretion vector colony PCR of scFv insert for sequencing or insert check Gall fo AATATACCTCTATACTTTAACGTC CYCI rev GCGTGAATGTAAGCGTGAC Gallb for sequencing primer AATATACCTCTATACTTTAACGTCAAGG For sequencing PCR amplicons from PNL6 and PNL9 Long Reads PNL6 only Rev Seq P2 CCG CCG AGC TAT TAC AAG TC For Seq P2 TCT GCA GGC TAG TGG TGG TG NOTE This sequencing primer can read all the way through the heavy and light chain without having to reverse transcribe the sequencing information before querying the Vbase data base http www mrc cpe cam ac uk vbase ok php to determine the heavy and light chain usage However you must put in only half the sequence at a time Short Reads PNL6 or PNL9 These are useful for sequencing of colony PCR of gap repaired scFv into secretion vector or surface expression vector G4SL GTT CCG GAG GCG GCG GTT C G4SH AAC CAC CAC CGC CGC TGC C 25 3 7 2 PCR Conditions for different Reactions using different templates A Purified Plasmid pPNL6 based scFv amplification Primers PNL6 Forward GTACGAGCTAAAAGTACAGTG PNL6 Reverse TAGATACCCATACGACGTTC Standard PCR Conditions for pNL6 for and rev Primer Pairs using MJ DNA Engine Conc in Stock Conc uL reaction reaction 10 x Buffer 10x 5 MgCl 50 mM 1 5 1 5 mM dNTPs 10 mM 1 0 2 mM
10. Once the cells have been lysed keep them on ice they can be used successfully for a few hours if kept on ice However we have had little or no success using the lysed cells 1 day later Yield Typical yield is 20 to 25 ug uL Total of 800 ng to 1 ug for a 40 reaction We typically load 3 or 4 uL on a gel to check concentration and size This is enough material to do a BstNI digest See Below for fingerprint analysis and sequencing with G4SH and G4SL primers If you are just looking for positives for inserts cut the volumes in half Yeast Colony PCR Conditions uL Conc in Stock Conc reaction reaction 10 x Buffer 10x 5 1x MgCl 50 mM 1 5 1 5 mM dNTPs 10 mM 1 0 2 mM H O 37 X Primers 10 uM each 2 0 2 mM each Template X 10 triton x100 2uL Platinum Ta Gibco 4 5U uL 0 5 Cycle 95 C 5 minutes 95 C 30 seconds 50 C 30 seconds 72 C 45 seconds cycle 30x 72 C 5 minutes 27 NOTE Increase the annealing temperature by 5 C when using genomic DNA or plasmid template in PCR reactions C PCR conditions to subclone scFv from pPNL6 into pPNL9 from plasmid or colony Primers note pPNL9 reverse has a 1 base mismatch T to G noted in bold below This still allows amplification from pPNL6 that has scFv cloned into it not the parental vector without scFv and changes a lysine to a glutamine to remove potential cryptic proteolytic cleavage site PNL9for GACGTTCCAG A
11. damages against it by third parties which may arise from the use storage or disposal of the Material except that to the extent permitted by law the Provider shall be liable to the Recipient when the damage is caused by the gross negligence or willful misconduct of the Provider Creating affinity reagents to important biomolecules is one of the most critical yet one of the most challenging tasks facing biologists This chapter describes the implementation of a yeast surface display library of scFv Single Chain Fragment Variable antibodies as a method to solve part of this problem The methodology was originally described by Feldhaus et al 1 The scFv library is specifically designed to display full length scFv antibodies whose expression on the yeast cell surface can be monitored with either C terminal HA and N terminal c myc epitope tags These epitope tags allow monitoring of clones or libraries of scFv clones for surface expression of full length scFv by flow cytometry The extra cellular surface display of scFv by Saccharomyces cerevisiae also allows the detection of appropriately labeled antigen antibody interactions by flow cytometry As a eukaryote S cerevisiae offers the advantage of post translational modifications and processing of mammalian proteins and therefore is well suited for expression of human derived antibody fragments In addition the short doubling time of S cerevisiae allows the rapid analysis and isolation of antigen spec
12. were obtained for all We have repeated this QC at least twice No we will not provide you the EGF Can I just use flow cytometric sorting or just use magnetic beads to get my Antigen specific clones A Yes however we believe combining the two is the most powerful way to screen the complete diversity of the library In our paper HEL was isolated using the Macs system only 42 4 I would like to do a test selection on the library with an antigen I know will work What do you suggest A Hen Egg lysozyme HEL was used as test antigen by Dane Wittrups group and 3 high affinity scFv clones were identified HEL is cheap and is easily biotinylated I do not recommend using the 378p peptide that was included as a control as we did not include enough antigen for an entire selection We have used a number of types antigens that are published in the Nature Biotech paper any of these would work well 43 Changes to this revision from 030305 1 The following note was added to primers section on page 27 PCR conditions to subclone scFv from pPNL6 into pPNL9 from plasmid or colony Primers note pPNL9 reverse has a base mismatch T to noted in bold below This still allows amplification from pPNL6 with and scFv present and changes a lysine to a glutamine to remove potential cryptic proteolytic cleavage site One should note that these primers will not hybridize to the pPNL6 parental vector but only to the pPNL6 with scFv insert
13. 00ul of buffer and store on ice in dark until analyzed by flow cytometry 10 Gather 10 000 events for a bivariate plot using the fluorescence channels that look at Alexa 488 Emission 525 usually FL1 on Becton Dickinson and Coulter Brand flow cytometers and Phycoerythrin Emission 550nm FL2 on Becton Dickinson and Coulter Brand flow cytometers 11 Collect the statistical information from the dual c myc antigen population 12 Plot the MFI against the concentration of antigen and use a nonlinear least squares to fit the curve such as found in Kaleidgraph or GraphPad and determine the Kp using the following equation m2 m0 m3 m0 where MFI at given antigen concentration m0 Antigen concentration ml MFI of no antigen control m2 MFI at saturation and m3 Kp If values are generated values of 0 998 and greater will give Kp values accurate within 30 3 6 Sorting of mutagenic scFv library for isolation of higher affinity clones Boder et al developed a methodology for generation and isolating higher affinity mutants of a specific scFv This was demonstrated by the maturation from nanomolar to femtomolar binding Kp for an scFv 4 The construction of a mutagenized library can be done several ways and will not be covered here 6 12 13 However there are several guidelines one should follow The number of mutations per clone will affect the number of mutants that can display function full length scFv Th
14. 10 clones to be rapidly generated and screened in about 2 weeks by selecting the brightest antigen binding fraction of the population using decreasing amounts of antigen relative to the KD of the starting parental clone The screening involves 3 to 4 rounds of flow cytometry sorting however the flow cytometric sorting protocol is slightly different for a library based on a mutagenized clone than for a non immune library and each will be described separately in section 3 4 and 3 6 respectively One of the real strengths of the yeast display system is the speed of characterizing the binding affinity of the clones 8 A brief and greatly simplified version is described in this Section 3 6 Additional useful resources to complement the protocols in this Manual Yeast transformation http www umanitoba ca faculties medicine biochem gietz Trafo html Saccharomyces cerevisiae Chapter 13 In Current Protocols in Molecular Biology M Ausubel R Brent R E Kingston D D Moore J G Seidman K Struhl eds John Wiley and Sons Inc New York 1993 Methods in Enzymology Volume 350 Guide To Yeast Genetics and Molecular Cell Biology C Guthrie and G R Fink eds Academic Press San Diego CA 2002 2 Materials 2 1 Media and Agar Plates In making the medias we add the following components in the following order which appears to help with solubility of some components Add amino acids to water then the sugars then
15. AC F 5 5 V G Y Y F Q H W G G T L TTTAGTACTT CGGTGGGTTA TTACTTCCAG CACTGGGGCC AAATCATGAA GCCACCCAAT AATGAAGGTC GTGACCCCGG TCCCATGGCA EcoRI BamHI V T V S S G I L G S GGTCACCGTC TCCTCAGGAA TTCTAGGATC CCAGTGGCAG AGGAGTCCTT AAGATCCTAG GCCACCGCCA CCGTCGCCGC G G S G G G G Ss 0 FP V L T O S BP GTGGTGGTTC CGGAGGCGGC GGTTCTCAGC CTGTGCTGAC CACCACCAAG GCCTCCGCCG CCAAGAGTCG GACACGACTG AGTCAGTGGG S V S G G V T XS S G 5 G G G G S G G CGGTGGCGGT GGCAGCGGCG 34 551 TCAGTGTCTG GGACCCCCGG GCAGAGGGTC ACCATCTCTT GTTCTGGAAG AGTCACAGAC CCTGGGGGCC CGTCTCCCAG TGGTAGAGAA S S N I G N N H V Y W Y 0 Q L P 6 601 CTGGTACCAG GTCGAGGTTG GACCATGGTC GTTGAGGGTC T A P K L L I Y R D N R R L S G 651 GAACGGCCCC ATAATCGGCG GCTCTCAGGG CTTGCCGGGG GTTTGAGGAG TATTAGCCGC CGAGAGTCCC V P D R 5 6 S 55 G S A S L A 701 GTCCCTGACC GATTCTCTGG CTCCAAGTCG GGCACCTCAG CCTCCCTGGC CAGGGACTGG CTAAGAGACC GAGGTTCAGC CCGTGGAGTC GGAGGGACCG I S G I R S D D E A E Y F C A A W TSI CATCAGTGGG CTCCGGTCCG ACGATGAGGC TGAGTATTTC TGTGCAGCAT GTAGTCACCC GAGGCCAGGC TGCTACTCCG ACTCATAAAG ACACGTCGTA D A S L S G L Y V F G G T K L 801 GGGATGCCAG CCTGAGTGGT CTCTACGTGT TCGGCGGAGG
16. ATTAGTACAA AGTAGATATC GGCTCCAAGT CGACGATGAG CCGAGGTTCA GCTGCTACTC GTCTCTACGT CTAGAACAAC CAGAGATGCA GATCTTGTTG TACGCGTACC CCTAGAGGGC ATGCGCATGG GGATCTCCCG CTCCCCCCAC GTCTAGGTCC GAGGGGGGTG CAGATCCAGG ATTTAT TAAATA pPNL9 sequence ctagtacggattagaagccgccgagcgggtgacagccectccgaaggaagactctcctccgtgcgtcctcgtcttcaccggtcgc gttcetgaaacgcagatgtgcetcgcgccgcactgctccgaacaataaagattctacaatactagcttttatggttatgaagagga aaaattggcagtaacctggccccacaaaccttcaaatgaacgaatcaaattaacaaccataggatgataatgcgattagttttttag ccttatttctggggtaattaatcagcgaagcgatgatttttgatctattaacagatatataaatgcaaaaactgcataaccactttaact aatactttcaacattttcggtttgtattacttcttattcaaatgtaataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggactactagcagctgtaatacgactcactatagggaatattaagcttatgagatttccttcaa tttttactgctgttttattcgcagcatcctccgcattagctgctecagtcaacactacaacagaagatgaaacggcacaaattccggc tgaagctgtcatcggttactcagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtt tataaatactactattgccagcattgctgctaaagaagaaggggtatctctcgagaaaagagaggctgaagcttacccatacgac gttccagactacgctggtggtggtggttctgctagcgcggccgcggcetcaggggcctccggaattctagaacaacagggtaa gcctatccctaaccctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgatcctag agggecgcatcatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttaga caacctgaagtctagetccctatttatttttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttctgtacagac gcgtgtacgcatgtaacattatactgaaaaccttgcttgagaagettttgggacgctcgaaggctttaatttgca
17. C 15 seconds 50 C 30 seconds 72 C 60 seconds repeat 39 cycles 72 C 5 minutes 28 3 7 3 BsiNI Digest for Fingerprint analysis of scFv inserts The digest uses amplicons from the PCR reaction using pPNL6 for and rev primers on either plasmid or colony PCR 1 Use approximately 400ng of DNA straight form the PCR reaction into the BstN1 digest This is usually about 20ul of the PCR reaction above BstN1 Digestion 20ul of PCR amplicons 2 5ul of 10x NEB Buffer 2 0 25ul 100x BSA 2 25ul of ddH20 25ul reaction Incubate at 60 C for lhour Run all of it on a 2 5 NuSieve Gel containing Ethidium Bromide 25ul L of 10mg ml stock of EtBr in the gel and using a sample loading buffer containing tartrazine dye for sample tracking and not the standard blue dyes The blue dyes can often hide the faint bands of the digest making them harder to see Take a picture and analyze the different banding patterns to identify unique clones Note This analysis to identify unique or different clones is not recommended to identify different clones isolated from a mutagenic library The figure below shows several different banding patterns indicating unique clones The outside lanes are 50 base pair standards 29 3 7 4 Gap Repair Cloning of scFv into Secretion Vector or Creating Mutagenized Libraries for Molecular Evolution The standard TRAFCO yeast transformation method is used as can be found at http www umanitoba ca fa
18. CCTTGAG AAGAGGTTGT TCCGGAACTC PstI ATTATGCAGA AAGAACCAGT TAATACGTCT EcoRI TGTCTATTAT AGCACTGGGG ACAGATAATA TCGTGACCCC BamHI TCCGGTGGCG GCCTGTGCTG AGGCCACCGC CGGACACGAC TCACCATCTC TACTGGTACC VH6 1246 bp molecule 5628 bp CTGTCATCGG CCATTTTCCA GACAGTAGCC GGTAAAAGGT TGCCAGCATT CTGAAGCTTA ACGGTCGTAA GACTTCGAAT GCTAGCAAGG GCAGACCCTC CGATCGTTCC CGTCTGGGAG ACAATGTTGC TGGCTGGGAA TGTTACAACG ACCGACCCTT GTCTGTGAGA TCTCCCTGCA CAGACACTCT AGAGGGACGT TGTGCAAGAG CCAGGGTACC ACACGTTCTC GGTCCCATGG GTGGCAGCGG ACTCAGTCAC CACCGTCGCC TGAGTCAGTG TGTCGTGTTT GCTGCTAAAG CCCATACGAC CGACGATTTC GGGTATGCTG PstI TACAGCTGCA ATGTCGACGT AGTGAGTGGA TTGGAACTGG GGACATACCG AACCTTGACC CCTGTATGGC GGTCGAATAA GCTGAACTCT CCAGCTTATT CGACTTGAGA GGTTTAGTAC CTGGTCACCG CCAAATCATG GACCAGTGGC CGGTGGTGGT CCTCAGTGTC GCCACCACCA GGAGTCACAG AGCAGCTCCA AGGAACGGCC 39 TTAGAAGGGG TAACGGGTTA AATCTTCCCC ATTGCCCAAT AAGAAGGGGT GTTCCAGACT TTCTTCCCCA CAAGGTCTGA GCAGTCAGGT GTGGCTTCTC CGTCAGTCCA CACCGAAGAG ATCAGGCAGT CGGGTCCAAG TAGTCCGTCA GCCCAGGTTC CCATCAACGC GTGACTCCCG GGTAGTTGCG CACTGAGGGC TTCGGTGGGT TCTCCTCAGG AAGCCACCCA AGAGGAGTCC TCCGGAGGCG TGGGACCCCC AGGCCTCCGC ACCCTGGGGG ACATCGGAAA CCCAAACTCC gt gt ATTTCGATGT TTGTTTA
19. CTACGCTGG TGGTGGTGGT TCTGCTA PNL9rev GGGTTAGGGA TAGGCTTACC CTGTTGTTCT AGAATTCCG NOTE It is critical to use a proofreading thermal stable polymerase such HiFi Platinum Tag for the amplification This be done using colony PCR if a 5 C lower annealing temperature is used PCR conditions to subclone scFv from pPNL6 into pPNL9 Conc in Stock Conc y L reaction reaction 10 x Buffer 10x 5 MgSO 50 mM 1 5 1 5 mM dNTPs 10 mM 1 0 2 mM H O 39 X Primers 10 uM each 2 0 2 mM each Template x HiFi Platinum Ta ma N SUME 09 Cycle 95 C 5 minutes 95 C 30 seconds 55 C 30 seconds 68 C 30 seconds repeat 30 cycles 68 C 5 minutes D Mutagenic PCR These conditions are used to amplify a specific insert and incorporate random point mutations The mutagenized amplicon is subsequently cloned by Gap Repair into linearized pPNL6 to create a mutagenized library of the clone 105 10 diverse Screening for improved affinity clones is discussed under affinity maturation SuL 10x Tag Buffer SuL 2mM dNTP 1 mM ATP Final concentration in rx 0 2 and 0 1mM 2 5 Primer 1 PNL 6rev 10 uM final 0 5 uM 2 5uL Primer 2 PNL 6 for 10 uM final 0 5 uM 1 5 50mM MgCl2 1 5 mM final concentration luL Platinum Tag enzyme NOT HI FI Final 2 5 U 2 5uL 4mM MnSO4 Final concentration 0 2 mM X template 31 5 HO 50 uL total volume Cycle 95 C 5 minutes 95
20. Events 10000 Region Total XMean Y Mean R1 73 53 934 21 1004 98 Figure 7 Kp determination using flow cytometry and nonlinear least squares fit 1200 y m1 m2 MO m3 m0 o Value 1000 59 065 30 611 800 e 934 13 43 673 21 096 5 2127 8 600 14715 0 99389 lt 400 200 0 100 0 100 200 300 400 500 600 Antigen concentration 24 3 7 Molecular protocols for analysis of clones and subcloning Primers for PCR Amplification and Sequencing of scFv NOTE Anytime you are going to amplify and subclone an scFv it is very important to use Platinum Tag HiFi or another proofreading thermal stable polymerase Do NOT use HiFi for mutagenic PCR PCR Amplification of scFv from PNL6 surface expression vector PNL6 Forward GTACGAGCTAAAAGTACAGTG PNL6 Reverse TAGATACCCATACGACGTTC Note The primers above PNL6 for and rev will not hybridize or amplify a segment of DNA from the starting pPNL6 vector The primers anneal to part of the cloned scFv gene and to part of the starting vector Therefore only scFv library clones will be amplified PCR amplification of scFv for GAP Repair into secretion vector It works best if the template is either purified plasmid or PNL6for rev amplicons The underlined area is the homology between the PNL6 amplicon and the primer i e the primer binding site You can also amplify from a genomic prep Use HiFi Tag a proofreading enzyme PNL9for GACGTTCCAG
21. IS3 prbd1 6R canl GAL EBY 100 has genomic insertion of AGA1 regulated by GAL promoter with a URA3 selectable marker The scFv library is displayed in this strain 2 pPNL6 plasmid Plasmid that our scFv library is cloned into as a fusion protein to AGA2 Selects for ability to grow in the absence of tryptophan in yeast and on ampicillin in E coli 3 YVHIO Ura Trp is 5464 and is MAT alpha The other markers ura3 52 Ty element insertion with no detectable background reversion frequency trp1 an amber point mutation leu25200 11836200 pep4 HIS3 prbd1 6R can1 GAL 10 has the yeast PDI gene integrated in tandem with the endogenous copy and is under the constitutive glyceraldehydes GADPH promoter with Leu2 as a selectable marker This strain is used to secrete and purify the scFv 4 pPNL9 should be selected on SD CAA Trp This is the plasmid we subclone our scFv into for secretion and purification Induction media is the same as for pPNL6 except Trp is added 2 3 Materials for Flow Cytometry and Magnetic bead enrichment 1 Miltenyi LS Macs columns and streptavidin magnetic beads and anti biotin magnetic beads with manual magnetic separator 2 Anti HA 12 5 antibody Anti c myc antibody 9E10 200ug ml Amersham pPNL6 derived libraries or anti V5 mAb pYD1 libraries Goat anti mouse GaM Alexa 488 conjugated Molecular Probes Goat anti mouse GaM Alexa 633 conjugated Molecular Probes G
22. Log Y Parameter FL4 H antigen SA 633 Lc Quad UL UR LL LR 96 Total X Mean 1 93 9 27 77 75 310 47 19 71 4 22 0 60 43 96 142 58 2521 77 6 43 10 68 88 5 103 104 ge a PE 100 10 i10 102 10 8 8 Sample ID GaM488 SAPE Acquisition Date 22 Jan 03 Total Events 20000 X Parameter FL1 H Myc GaM488 Log Y Parameter FL2 H Streptavidin PE Lot Quad 96 Total X Mean Y Mean UL 2 11 13 76 217 47 UR 76 73 234 55 1384 01 LL 21 04 5 96 5 59 LR 0 10 249 55 17 69 T GaMPEISA647 2 m To E v es 3 5 a E i 100 o 10 10 MyciGaM PE 1 Sample ID GaMPE SA647 Acquisition Date 22 Jan 03 Total Events 20000 X Parameter FL2 H Myc GaM PE Lot Y Parameter FL4 H Streptavidin Alex Quad UL UR LL LR 96 Total 1 28 77 37 20 65 0 70 7 36 310 67 4 46 107 39 602 13 4801 63 16 41 25 90 20 GaMPEINA FITC in FIT 102 104 ravid Neyt 00 10 o 102 10 Myc GaM PE Sample ID FITC Acquisition Date 22 Jan 03 Total Events 20000 X Parameter FL2 H Myc GaM PE Log Y Parameter FL1 H Neutravidin FITC Log Quad Total UL 0 65 UR 177 09 LL 21 81 LR 0 46 XMean Y Mean 15 02 36 80 319 88 161 59 5 02 4 58 75 22 12 91 GaM633INA PE in PE 2 103 104 1 10 10 102 10 4 1 10 alexah33 S
23. TAA TAAAGCTACA AACAAATATT ATCTCTCGAG ACGCTGGTGG TAGAGAGCTC TGCGACCACC CCAGGACTGG CGGGGACAGT GGTCCTGACC GCCCCTGTCA CCCCGTCGAG TGGTATAATG GGGGCAGCTC ACCATATTAC AGACACATCC AGGACACGGC TCTGTGTAGG TCCTGTGCCG TATTACTTCC AATTCTAGGA ATAATGAAGG TTAAGATCCT GCGGTTCTCA GGGCAGAGGG CGCCAAGAGT CCCGTCTCCC TAATCATGTT TCATCTATAG 1000 1100 1200 1300 CGGGCACCTC CCTATTAGCC GCCCGTGGAG EcoRI GCTGAGTATT GTTCGGCGGA CGACTCATAA CAAGCCGCCT AGGGTAAGCC GGTCATCATC AACAAGACCT TCGTTGAGGG CGGCTCTCAG AGCCTCCCTG GCCGAGAGTC TCGGAGGGAC TCTGTGCAGC GGGACCAAGC AGACACGTCG CCCTGGTTCG TATCCCTAAC ACCATCACCA ATAGGGATTG TGGTAGTGGT AATTAGTTAT ACCGAAAAGG TTAATCAATA TGGCTTTTCC TCGTCGAGGT TCCTTGCCGG GGGTCCCTGA GCCATCAGTG CCCAGGGACT CGGTAGTCAC ATGGGATGCC TCACCGTCCT TACCCTACGG AGTGGCAGGA CCTCTCCTCG TTGAGTTTAA GGAGAGGAGC AACTCAAATT GTCACGCTTA AAGGAGTTAG CAGTGCGAAT TTCCTCAATC ATGTTAGTAT TACAATCATA TGTAGCCTTT GGGTTTGAGG CCGATTCTCT GGCTCCGGTC GGCTAAGAGA CCGAGGCCAG AGCCTGAGTG ATCCGGAATT TCGGACTCAC TAGGCCTTAA GTCTCGATTC ACCCGCTGAT CAGAGCTAAG TGGGCGACTA CATTCACGCC ACAACCTGAA GTAAGTGCGG TGTTGGACTT TAAGAACGTT ATTCTTGCAA
24. Yeast Display scFv Antibody Library User s Manual Pacific Northwest National Laboratory Richland WA 99352 http www sysbio org dataresources index stm Revision Date MF031112 Contents Materials Accompanying Manual pg 3 Introduction pg 4 5 Materials needed pg 6 7 Methods pg 7 14 Growth and induction pg 7 8 Magnetic Bead enrichment pg 8 9 Fluorescent cell staining and sorting pg 10 11 Equilibrium Kinetics Affinity Determination by Flow Cytometry pg 12 13 Sorting Mutagenic libraries for higher affinity clones pg 14 15 References pg 15 16 Figures pg 17 24 Molecular Protocols pg 25 29 PCR primers Pg 25 Colony PCR pg 27 PCR for subcloning from pPNL6 to pPNL9 pg 27 28 Mutagenic PCR pg 28 BstN1 digest and finger print analysis pg 29 Gap Repair Cloning of scFv into Secretion Vector pg 30 Secretion and Purification of scFv pg 31 32 Plasmid maps and Sequence of pPNL6 and pPNL9 pg 33 41 Frequently asked questions pg 42 43 Changes to this revision pg 44 Materials included NOTE Before using the library use the control scFv and antigen to become familiar with the processes of growth induction staining and flow cytometry analysis Do not use the library until you have used the control successfully Your data should closely approximate Figures 4 and 6 for the control scFv Before screeningn the library with your antigen the library induction should resemble Figure 2 for HA and myc staining
25. aaaaaaatttcaaagaaaccgaaatcaaaaaaaagaataaaaaaaaaatgatgaattgaattg aaaagctagcttatcgatgggtccttttcatcacgtgctataaaaataattataatttaaattttttaatataaatatataaattaaaaatag aaagtaaaaaaagaaattaaagaaaaaatagtttttetttteegaagatgtaaaagactetagggggatcgccaacaaatactacct tttatcttgctcttcctgctctcaggtattaatgccgaattgtttcatcttgtctgtgtagaagaccacacacgaaaatcctgtgattttac attttacttatcgttaatcgaatgtatatctatttaatctgcttttcttgtctaataaatatatatgtaaagtacgctttttgttgaaattttttaa acctttgtttatttttttttcttcattccgtaactcttctaccttctttatttactttctaaaatccaaatacaaaacataaaaataaataaacac agagtaaattcccaaattatteccatcattaaaagatacgaggcgcgtgtaagttacaggcaagcgatccgtccgccggcgaacgt ggcgagaaaggaagggaagaaagcgaaaggagcgggggctagggcggtgggaagtgtaggggtcacgctgggcgtaac caccacacccgccgcgettaatggggcgctacagggcgcgtggggatgatcca 41 Frequently asked questions FAQS These are questions and answers that are also posted on the web page http www biomolecular org resources index html You should check in periodically to check for updates and revisions 1 Some proteins we use seem to stick to all the yeast Why A Before starting any selection we routinely check the protein of interest for binding to a single scFv clone that is not induced the control sent with the library the library not induced and the library in the induced state You should see no labeling in any case If there is labeling it could be binding to the yeast surface or the scFv in a nonspecific fashion We have the most reproducible results and experi
26. ached usually in 3 days Subculture a 10x representation of the library diversity and expand 100 fold by growth in selective non inducing media 6 Freeze down several 10x aliquots of library in 30 glycerol and store at 80 C NOTE We find our transformation frequency is very similar for Gap Repair and using super coiled plasmid 30 3 8 Secretion and Purification of scFv Antibodies One of the appeals with recombinant antibodies is the ability to apply standard molecular manipulations to the antibody gene of interest This allows researchers to move the isolated scFv gene into a variety of expression vectors allowing a wide spectrum of purification tags and organisms E coli S cerevisiae Pichia pastoris insect and mammalian can be used The protocol listed below is to be used with scFv transferred into the pPNL9 secretion vector using S cerevisiae YVH10 cells for purification through the 6His tag Inoculate 50 mL SD CAA Trp Culture at 30 C until saturated o n OD gt 3 mL Spin cells and resuspend in 50 mL YEP G R containing antibiotic 0 1 dex Induce 20 to 30 check for optimal production for 16 to 72 hours Check OD Check for bacterial contamination Check pH of supernatant Because culture supernatant contains ingredients that prohibit 6xHis IMAC purification do the following Spin cells transfer supernatant to new tube Adjust supernatant pH to 7 with 10x NaH PO pH 7 6 Dialyze or use microconcentrat
27. add a 10x solution of buffer pH should be 6 25 We filter sterilize all selective media NOTE YPED cultures saturate between 8 to 10 ODeoo mL while SD CAA cultures saturate between 3 to 5 ODgoo mL Rich Non Selective Media YEPD or YPD Yeast Extract Peptone Dextrose 10 g L yeast extract 20 g L peptone 20 g L dextrose Filter sterilize or autoclave Selective Growth SD CAA 5 g L casamino acids ade ura trp 20 g L dextrose 1 7 g L YNB Yeast Nitrogen Base w out ammonium sulfate amino acids Difco Becton Dickinson Difco YNB 233520 5 3g L ammonium sulfate 10 19 g L Na HPO4 7H 0 8 56 g L NaH PO4 H Note For 2x SDCAA we add 10g of casamino acids and 3 4g of yeast nitrogen base 10 6g ammonium sulfate This formulations can give greater cell numbers for growing the library up and freezing it down Generally cell densities between 6 8OD ml Selective scFv Induction SG R CAA Same as selective media except substitute the following sugars for Dextrose 20 g L galactose 20 g L raffinose 1 g L dextrose Plates Buy or make them yourself TEKNOVA is our supplier YEPD same as above but add 20g L of Agar SDA HUT Synthetic Defined Agar Histidine Uracil Tryptophan 2 2 Strains amp Plasmids 1 EBY100 InVitrogen Leu Trp BJ5465 is MATa It has the auxotrophic ura3 52 Ty element insertion with no detectable background reversion frequency trpl an amber point mutation leu26200 his35200 pep4 H
28. affinities between 1nM 100nM 10 yeast sample 5 x 10 scFv If you have an idea of what your affinity is you can omit the first 2 or last antigen concentrations For example 100nM affinity you do not need the 1 and 0 5nM antigen concentrations For a 5nM affinity you do not need the 500nM or 100nM concentrations You are striving to do a series of 2 5 fold dilutions at 5 10x over to 5 10 below Ka Concentration of Antigen Volume of antigen solution of molecules of antigen 500nM 100ul 3x10 100nM 100ul 6 x 10 50nM 100ul 3 x 10 25nm 100ul 1 5 x 10 10nM 100ul 6 x 10 5nM 100ul 3x10 500 3x10 0 5nM 500ul 1 5 x 10 30x excess 0 1nM 1ml 6 x 10 10x excess 13 4 Incubate the samples atroom temperature for 30 minutes This allows ample time for the binding reaction to come to eguilibrium The system comes to eguilibrium within couple of minutes at a concentration of 1 log above or below the concentration at Kp 5 Put samples on ice for 5 minutes The decrease in temperature greatly decreases the off rate For a 25 C decrease in temperature a 50 100 fold decrease in off rate is seen 11 6 Wash sample 2x with 500ul ice cold buffer 7 Resuspend sample in 100ul of a 1 200 dilution of secondary reagents goat anti mouse Alexa 488 and of streptavidin PE 8 Incubate on ice for 30 minutes Pellet cells and wash 1x with 500ul ice cold buffer 9 Resuspend in 5
29. agaagtaagttggccgc agtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactc aaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataatagtgtatcacatagca gaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgt aacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgcc gcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttectttttcaatggetaataactgatataattaaattga agctctaatttgtgagtttagtatacatgcatttacttataatacagttttttagttttgctggccgcatcttctcaaatatgcttcccagcc tgcttttctgtaacgttcaccctctaccttagcatcccttccctitgcaaatagtcctcttccaacaataataatgtcagatcctgtagag accacatcatccacggttctatactgttgacccaatgcgtcteccttgtcatctaaacccacaccgggtgtcataatcaaccaatcgt aaccttcatctcttccacccatgtctctttgagcaataaagccgataacaaaatctttgicgctcticgcaatgtcaacagtaccctta gtatattctccagtagatagesagcccttgcatgacaattctgctaacatcaaaagecctctaggttcctttgttacttcttctgccge ctgcttcaaaccgctaacaatacctgggcccaccacaccgtgtgcattcgtaatgtctgcccattctgctattctgtatacacccgc agagtactgcaatttgactgtattaccaatgtcagcaaattttctgtcttcgaagagtaaaaaattgtacttggcggataatgcetttag cggcttaactgtgccctccatggaaaaatcagtcaagatatccacatgtgtttttagtaaacaaattttgggacctaatgcttcaacta actccagtaattccttggtggtacgaacatccaatgaagcacacaaetttetttgcttttcgtgcatgatattaaatagcttggcagca acaggactaggatgagtagcagcacettccttatatgtagctttcgacatgatttatcttcgtttcectgcagetttttgttctgtgcagtt gggttaagaatactgggcaatttcatgtttcttcaacactacatatgcgtatatataccaatctaagtctgtgctecttecttcgttcttcc ttctgttcggagattaccgaatc
30. agctgcggcect gcattaatgaatcggccaacgcgcggggagaggeggetttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgc tcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcagg aaagaacatgtgagcaaaaggccagcaaaagcccaggaaccgtaaaaaggccgcgttgctggcetttttccataggctccgcc cccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccc cctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggc getttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttca gcccgaccgctgcgcettatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccact ggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagg acagtatttgetatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgc tggtagcggtgetttttttetttecaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacgggg tctgacgctcagtggaacgaaaactcacgettaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaatta 40 aaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcag cgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagcgcttaccatctggccccag tgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgc agaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagttt gcgcaacgttgttggcattgctacaggcatcgtggtgtcactctcgtcgtttgetatgecttcattcagctccggttcccaacgatca aggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtc
31. ample ID GaM633 NA Acquisition Date 22 Jan 03 Total Events 20000 X Parameter FL4 H myc GaM alexa633 Lo Y Parameter FL2 H NeutrAvidin PE Log Quad UL UR LL LR Total 0 60 76 70 21 79 0 92 X Mean Y Mean 19 71 75 69 554 27 330 34 7 98 4 61 1319 72 11 27 Panel Fold difference of myc expression and antigen binding using different detection reagents over background Mean Fluorescence Intensity MFI of yeast auto fluorescence Fold Difference in MFI for myc expression 80 s 2 70 60 2 2 50 40 5 5 E 20 3 10 488 488 GaMPE GaMPE GaMPE GaMAlexa 633 Huorescent Reagent Fold Difference MFI for Antigen binding S 2 450 s 2 400 2 350 300 9 8 250 9 200 9 150 ag 100 9 50 0 amp amp 9 5 RY RY 5 S S N N N S AS AS S S 5 RN 55 55 R na eR eR 3 3 e E Fluorescent Reagent 21 Figure 5 Sorting of R2 output from second magnetic bead enrichment column to create R3 output and then R4 output The no antigen control shows that when antigen is present there are many more dual positive yeast and provides confidence that what you are sorting is actually binding your antigen and not the detection reagent Round 3 selection 1 sort Sort Gate 0 1 104 103 Ages 18 10 m
32. caactatatgcgagcaaatcccetcaccaactttagaatcgacgccgtactctttgtcaacgactactat tttggccaacgggaaggcaatgcaaggagtttttgaatattacaaatcagtaacetttgtcagtaattgcggttctcacccctcaaca actagcaaaggcagccccataaacacacagtatgtttttaaggacaatagctcgacgattgaaggtagatacccatacgacgttc cagactacgctctgcaggctagtggtggtggtggttctggtggtggtggttctggtggtggtggttctgctagctgcggtggcgg cggtactagcaaaatttctcattttttgaaaatggaatctttgaattttattagagctcatactccatatattaatatttacaattgtgaacc agctaatccatctgaaaaaaattctccatctactcaatattgttattctattcaatcttcccaggtcgactgcgggggcggatccgaa caaaagcttatttetgaagaagacttgtaatagctcggcggccgcatcgagatctgataacaacagtgtagatgtaacaaaatcga ctttgttcccactgtacttttagctcgtacaaaatacaatatacttttcatttctccgtaaacaacatgttttcccatgtaatatccttttctat ttttcgttccgttaccaactttacacatactttatatagctattcacttctatacactaaaaaactaagacaattttaattttgctgcctgcc atatttcaatttgttataaattcctataatttatcctattagtagctaaaaaaagatgaatgtgaatcgaatcctaagagaattgagctcc aattegccctatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaactta atcgccttgcagcacatccccccttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgc agcctgaatggcgaatggcgcgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgacc gctacacttgccagcgccctagcgcccgctcetttcgctttcttcccttcetttctcgccacgttcgccggctttccccgtcaagctct aaatcgggggctccetttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtag tgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaaca acactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgag
33. ctgatttaacaaa aatttaacgcgaattttaacaaaatattaacgtttacaatttcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgc aggcaagtgcacaaacaatacttaaataaatactactcagtaataacctatttcttagcatttttgacgaaatttgctattttgttagagt cttttacaccatttgtctccacacctccgcttacatcaacaccaataacgccatttaatctaagcgcatcaccaacattttctggcgtc agtccaccagctaacataaaatgtaagctttcggggctctcttgccttccaacccagtcagaaatcgagttccaatccaaaagttca cctgtcccacctgcttctgaatcaaacaagggaataaacgaatgaggtttctgtgaagctgcactgagtagtatgttgcagtcttttg gaaatacgagtcttttaataactggcaaaccgaggaactcttgetattcttgccacgactcatctccatgcagttggacgatatcaat gccgtaatcattgaccagagccaaaacatcctccttaggttgattacgaaacacgccaaccaagtatttcggagtgcctgaactat ttttatatgcttttacaagacttgaaattttccttgcaataaccgggtcaattgttctctttctattgeecacacatataatacccagcaag tcagcatcggaatctagagcacattctgcggcetctgtgctctgcaagccgcaaactttcaccaatggaccagaactacctgtga aattaataacagacatactccaagctgcctttgtgtgcttaatcacgtatactcacgtgctcaatagtcaccaatgccctccctcttgg ccctctccttttcttttttcgaccgaattaattcttaatcggcaaaaaaagaaaagectccggatcaagattgtacgtaaggtgacaag ctatttttcaataaagaatatcttccactactgccatctggcgtcataactgcaaagtacacatatattacgatgctgtctattaaatgct tcctatattatatatatagtaatgtcgtttatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacc cgccaacacccgctgacgcgccetgacgggettgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagc tgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttatagettaatgtc atgataataatggtttettaggacggatcgcttgcctgtaacttacacgcgcctcgtatcttttaatgatggaataatttgggaatttact 36 ctgtgtttatttatttttatgttttetat
34. culties medicine biochem gietz Trafo html 1 Prepare vector for cloning by linearization by double restriction digesting pPNL6 Not1 Nhe1 pPNL9 Notl Sfil 2 Treat digest with phenol chloroform isoamyl alcohol and ethanol precipitate vector Resuspend in water This removes Sfil and does not precipitate the insert 3 PCR amplify scFv insert PCR Platinum Tag HiFi or mutagenic non proofreading Taq from pPNL6 based clone using the following primers pPNL6 cloning PNL6 for rev under mutagenic conditions to create sublibrary pPNL9 cloning PNL9 for rev for subcloning into secretion vector from pPNL6 surface expressed clone Note PCR amplification with PNL9 for rev primers works best with either purified plasmid or a PCR template generated with pNL6for rev primers Use a 1 1000 dilution of the amplicon from the PNL6for rev PCR reaction for template in the PNL9for rev PCR 4 Transform yeast using standard LiAc TRAFCO methodology Mix linearized vector and PCR amplified insert at a 1 3 Vector Insert molar ratio 1 10 gives greater number of Transformants Transform a linearized vector only for a control 5 Selective plates take 3 to 5 days for colonies to appear If creating a library grow in liquid culture take an ODgoo reading at the beginning and set up a dilution plate to determine total number of transformants The starting liquid culture should be below 0 5 OD mL and the ODgoo should be checked daily until 5 to 10 OD mL is re
35. e library of 10 diversity 1 Resuspend 1 x 10 yeast from induced culture in 10 mL wash buffer 2 Add one or more biotinylated antigens at 100 nM final concentration Incubate at 25 C RT for 30 minutes followed by or 5 to 10 minutes on ice All subsequent steps should be done with ice cold buffer or at 4 C Pellet cells 3000x g for 3 minutes and wash 3x with 50 mL wash buffer 4 Resuspend cell pellet in 5 mL wash buffer with 200 uL of Macs streptavidin magnetic micro beads or anti biotin magnetic micro beads from Miltenyi Alternating between these beads during subsequent rounds of selection decreases the chance of obtaining secondary reagent specific clones 5 Incubate on ice for 10 minutes with gentle mixing by inversion every 2 minutes 6 Pretreat Miltenyi LS column loaded into magnet by flowing 3 mL of ice cold wash buffer through it using gravity 7 Add 40 mL wash buffer pellet cells and resuspend in 50 mL wash buffer Make sure it is a single cell suspension by vortexing and passing cells through a cell strainer cap tube Falcon Cat 352235 immediately prior to loading onto Miltenyi LS column 8 Add the 7mls cell suspension that s was just put through the cell strainer cap to the column After each 7 mL of cells have entered the column and the flow has stopped remove the column from magnet and immediately put back into magnet This rearranges the iron beads in the column and allows the cells that are physically
36. e number of mutations per clone will also affect the likely hood of finding a clone of increased affinity 5 A library of 10 to 107 different mutants can easily be screened using the methodology below Protocol for higher affinity clone isolation is as follows 1 Grow and induce library with a minimum of 10x coverage 2 Stain no more than 10 cells takes about 3 hours to sort at 10 000 events sec 3 Label yeast with anti c myc to identify full length scFv antibody clones The mutagenesis will induce a larger number of stops and truncated proteins At the same time add antigen at the Kp of the parental clone Incubate for 30 minutes at room 14 10 11 12 temperature followed by 5 minutes before centrifugation and washing cells twice Resuspend cell pellet in secondary reagents Incubate on in the dark for 30 minutes Wash once and resuspend Run sample on sorter Sort entire sample for the brightest 1 0 of c myc positive antigen binding population Expect 5 to 20 of the cells to express c myc positive scFv and of these 10 to 20 will bind antigen Cells will either be plated on selective plates that contain antibiotics or grown in selective liquid media about 5 mL SD CAA The antibiotics can be any or all of the following pen strep 10 mg mL used at 100 ug mL ampicillin kanamycin 10 mg mL used at 10 to 20 ug mL Plates are incubated at 30 C for 1 to 2 days Colonies are pooled and then induced
37. eagents that work well to label biotinylated antigens and anti c myc mAb 1 Add 5 uL 9e10 anti c myc antibody 200ug ml to the 500 uL containing 1 10 x 107 yeast eluted from the magnetic column 2 Incubate for 30 minutes on ice Pellet in microfuge on high for 10 seconds Wash 2x with 500 uL buffer 3 Add 1 200 dilution of secondary reagents goat anti mouse Alexa 488 and of streptavidin PE NOTE It is important to use different secondary antigen labeling reagents streptavidin Alexa 633 or neutravidin PE between flow cytometric sorts to eliminate or reduce secondary reagent specific scFv Figure 4 shows several combinations of fluorescent reagents that can be used if secondary reagent binders are obvious 4 ncubate 30 minutes on ice pellet the cells and wash 2x 500ul ice cold wash buffer 5 Resuspend cells in 1 mL of buffer and keep on ice in the dark until sorting 3 4 Flow cytometry sorting of antigen specific scFv clones from non immune library 3 4 1 Sort gate decision Sorting from a non immune library that has gone through two rounds of enrichment on magnetic beads should allow you to see antigen binding yeast at a frequency of 1 1000 to 1 5000 cells The sort gate is set in one of the following two manners The first method is based on sorting the top 0 196 of the brightest antigen binders that are also c myc positive These may or may not be an obvious or distinct population Generally for the first sort round 3 of selec
38. ence with peptides and secreted proteins However we have also obtained antigen specific scFv to a variety of cytoplasmic proteins We recommend trying different selection buffers to decrease or eliminate the nonspecific binding For example 0 1 tween PBS No EDTA etc I have gone through five rounds of selection and all I got were secondary reagents binders or nothing What s wrong A It could be a large number of possibilities The most common reasons are listed below e Did you check that the sorter was set up properly Did the flow cytometer operator show you what was sorted by rerunning that sample or doing a test sort of labeled beads Did you set up a dilution plate from the sorted cells Was the number what you expected We generally see about a 40 70 plating efficiency from the number of cells sorted e Do you know your antigen is biotinylated How We use the Pierce HABA methodology to determine moles of biotin per mole of antigen and strive for a 1 2 moles of biotin mole of antigen e Try increasing the concentration of antigen up to 1uM e There is also the possibility there are no binders to your protein e Note we have never not obtained a streptavidin binder if we go through five rounds of selection e You may want to try a test selection using Biotinylated EGF The quality of the aliquot of the library you received was checked by doing a multiplex screen using biotinylated EGF and f3 other peptide antigens Binders
39. er user manual scFv surface construct pPNL6 R Y P Y D V P 990 bp D Y A L 0 A S G G G TAGATACCCA TACGACGTTC CAGACTACGC TCTGCAGGCT AGTGGTGGTG ATCTATGGGT ATGCTGCAAG GTCTGATGCG AGACGTCCGA G S G G G N S G G G G S A S hel K V GTGGTTCTGG TGGTGGTGGT TCTGGTGGTG GTGGTTCTGC TAGCAAGGTA AGACCACCAC ATCGTTCCAT PstI Q L Q S G P CAGCTGCAGC AGTCAGGTCC GTCGACGTCG TCAGTCCAGG J E ACTCACCTGT GGCTTCTCCG TGAGTGGACA CCGAAGAGGC N W I R Q S GGAACTGGAT CAGGCAGTCC GTCCGTCAGG G F 5 G D s 5 G L V K P 5 AGGACTGGTG TCCTGACCAC TTCGGGAGCG N N GGGACAGTTT CTCCAACAAC CCCTGTCAAA GAGGTTGTTG P S R G L E W CCGTCGAGAG GCCTTGAGTG GGCAGCTCTC CGGAACTCAC 0 T N V A W L G R GCTGGGAAGG CGACCCTTCC T Y R G S K W ACATACCGCG TGTATGGCGC CCAGGTTCAC Y N D Y A E S V R G GTATAATGAT PSI N Q F S L Q L R I I N A D T 5 K TCGAATAACC ATCAACGCAG ACACATCCAA GAACCAGTTC TCCCTGCAGC TAGTTGCGIC TGTGTAGGTT AGGGACGTCG N S V T P E D T A V Y Y A R G TGAACTCTGT GACTCCCGAG GACACGGCTG TCTATTATTG TGCAAGAGGG ACTTGAGACA CTGAGGGCTC CTGTGCCG
40. exity x Round Ag specific coverage cells Total per round of Selection Output N and type Complexity complexity screened cells selection output Complexity RI dee Magnetic 10 1 10 10x 10 107 5 1x 107 110 x 500x beads R2 5 Magnetic 1 x 10 5 10 1000x 1000 10 500 1 107 a 2300 500x beads R3 N Cell 1 x 107 5 105 0 500 1 x107 250 1x 10 2000 sorter R4 2 5 10 x 1000 1000 Cell 250 x 104 2 5 100 1000x 25 000 10 12500 1000 to 1000 2000 sorter about 50x R4output sorter 5x 10 5 to 9 10 analysis 19 Figure 4 Different fluorescent reagents that be employed to detect c myc expression and biotinylated antigen binding Panel A Bivariate flowcytometric analysis Panel B Comparison of MFI Mean Fluorescence Intensity is shown 030122 Analysis of different detection reagents for antigen and Myc tag scFv 378 R3b2 clone used for analysis GaMHSSINA PE rAvidin PE i 10 104 Meut 10 10 Sample ID GaM488 NA PE Acquisition Date 22 Jan 03 Total Events 20000 X Parameter FL1 H Myc GaM488 Loi Y Parameter FL2 H NeutrAvidin PE L Quad Total X Mean Y Mean UL 1 58 21 76 111 83 UR 77 33 282 69 374 02 LL 20 94 6 61 5 35 LR 0 14 168 10 21 24 T GaMPE SA633 e oo g O a 2 a o ol 4 10 10 10 MyotGaM PE Sample ID GaMPE SA633 Acquisition Date 22 Jan 03 Total Events 20000 X Parameter FL2 H Myc GaM PE
41. he dilution plate of sorted cells into S GR CAA induction media 6 Make glycerol stock of at least 10x representation of the sub library diversity from the SD CAA culture for storage in case subsequent steps need to be repeated The glycerol stock is the yeast in a 15 glycerol solution and be stored at 80 C The cell concentration in the glycerol stock can be from 1 ODgoo ml up to 100 ODeoo ml Bop 3 4 3 Second Sort Round 4 selection At this point your diversity is generally under 100 000 Therefore staining 2 x 10 yeast gives you 200 fold coverage of your diversity You also expect to see clones that bind your antigen at a frequency of 1 10 Cells are stained as before with all controls Control 1 Unstained Control 2 488 only Control 3 SA PE only Control 4 anti myc GaM488 Control 5 anti myc GaM488 SAPE Sample anti myc GaM488 Antigen SAPE A number of controls listed above should be done with the induced R3 sub library output prior to the 4 round of selection Control 5 will help distinguish antigen detection reagents specific binders from true antigen binders Analyze at least 100 000 events to allow patterns to emerge in the bivariate plot SA PE positive clones that do not have the c myc tag can be easily removed during the subsequent sort by setting the selection gate to isolate only c myc positive antigen binding cells If the SA PE positive clones from control 5 are also c m
42. ific scFv antibodies Yeast display based on the platform created by Dane Wittrup at Massachusetts Institute of Technology uses the a agglutinin yeast adhesion receptor to display recombinant proteins on the surface of S cerevisiae 2 3 In S cerevisiae the a agglutinin receptor acts as an adhesion molecule to stabilize cell cell interactions and facilitate fusion between mating and haploid yeast cells The receptor consists of two proteins Agal and Aga2 Agal is secreted from the cell and becomes covalently attached to b glucan in the extra cellular matrix of the yeast cell wall Aga2 binds to Agal through two disulfide bonds presumably in the golgi and after secretion remains attached to the cell via Agal The yeast display system takes advantage of the association of Agal and Aga2 proteins to display a recombinant scFv on the yeast cell surface The gene of interest is cloned into the pYD1 vector InVitrogen or a derivative of it in frame with the AGA2 gene The resulting construct is transformed into the 100 S cerevisiae strain containing a chromosomal integrant of the AGA gene Expression of both the Aga2 fusion protein from pYD1 and the Agal protein in the 100 host strain is regulated by the GALI promoter a tightly regulated promoter that does not allow any detectable scFv expression in absence of galactose Upon induction with galactose the Agal protein and the Aga2 fusion protein associate within the secre
43. ing 100 uL of YPD media 3 After sorting plate the cells on SD CAA Pen Strep No dilution plate is required when less than 1000 yeast are plated We generally see a 50 80 plating efficiency 4 Incubate plates at 30 C for 24 to 48 hours 5 Pick individual colonies into SD CAA media We will generally pick 10 different clones These may all be the same or ten unique clones The number of unique clones will be determine either by sequencing or BstN1 finger printing of PCR amplified scFv genes 9 6 Subculture 100ul into 1ml of SGR CAA Grow at 20 C for 16 hours to induce expression of scFv 3 5 Clone validation and affinity determination This verifies the individual clones from the previous sort are true antigen binders and that they express full length scFv as determined by myc expression Each sample needs to be stained with antigen and without antigen No Ag anti myc GaM488 SAPE Plus Antigen anti myc GaM488 Antigen SAPE 3 5 1 Flow cytometric staining of individual clones 1 Prepare 1 2 x10 yeast by washing the induced yeast 1x with 1ml of buffer 2 Resuspend yeast in 100ul containing lul of anti c myc mAb and for plus antigen stain biotinylated antigen generally 100nM 3 Incubate for 30 minutes at room temperature followed by 5 minutes on ice Pellet in microfuge high for 10 seconds Wash 2x with 500 uL of ice cold buffer 4 Resuspend pellet in 100ul of 1 200 dilution of secondary reagents goat anti mo
44. oat anti mouse GaM PE Molecular Probes Streptavidin R phycoerythrin SAPE Molecular Probes Streptavidin Alexa 633 Molecular Probes NeutrAvidin Alexa 633 Molecular Probes 10 Biotinylated purified antigens 2 ug Kilodalton of antigen 11 Penicillin Streptomycin Gibco BRL100x tissue culture grade 12 Wash Buffer Buffer PBS 0 5 BSA 2 mM EDTA gt 3 Methods The methods below are divided into 8 categories 1 Growth and induction for scFv expression of libraries or clones 2 Magnetic bead enrichment of biotinylated antigen binding yeast 3 Fluorescent staining for both antigen binding and scFv expression of the library 4 Flow cytometric sorting of library 5 Clone validation and subsequent affinity determination 6 Sorting of mutagenic scFv library for isolation of higher affinity clones 7 Molecular protocols for analysis of clones and subcloning and 8 secretion purification of scFv Many of the techniques growth and induction conditions and staining protocols are very similar between non immune libraries immune libraries or mutagenized scFv clone libraries The major differences between the various library types are both the diversity of the libraries number of different antibody clones present and the frequency of antigen binding clones within that diversity 3 1 Growth and Induction of Surface Expression of scFv NOTE Cell numbers are generally determined by OD soo reading on
45. on following the addition of galactose N terminal HA and C terminal c myc epitopes for simplified detection of the displayed scFv antibody with an Anti c myc 9e10 or Anti HA 12CA5 Antibody auxotrophic marker and CEN ARS origin for selection and maintenance in S cerevisiae Figure 1 Display of scFv Antibody Library Using pPNL6 A The GAL1 10 regulated scFv surface expression construct G4S 3 linker Gal 1 10 HA tag promoter Aga2 terminator scFv Aga2p linker scFv fusion ORF B The scFv Aga2 fusion protein surface expression Fluorescent or Biotinylated Antigen gt 88 Cell Wall YY Plasma Membrane Saccharomyces cerevisiae 17 Figure 2 Flow cytometric analysis of scFv library expression on yeast The red histogram represents the background auto fluorescence The blue histogram represents the HA epitope tag positive cells 60 to 70 of the yeast in the scFv library will be HA epitope tag positive The green histogram represents the c myc expressing yeast and represents 35 40 of the total 2 2 z Unstained induced library n N terminal HA epitope tag expression a 04 zT C terminal c myc expression 3 On 40 18 Figure 3 Isolation of scFv through sequential enrichment A Schematic of generalized scFv library screen Day 1 All Ag Mag beads R1 Growth Induction Day 2 All Ag Mag Beads R2a gt Sorter R2b Growth Induction Da
46. on of c myc expression level or positive cells as determined by flow cytometry However the yeast do become sticky and tend to clump more which may affect selections and viability is often reduced by 50 3 1 2 Individual scFv Clones 1 Start a 1 5 mL SD CAA culture from a single isolated yeast colony 2 Grow at 30 C with shaking overnight 3 Pellet enough cells to start a 1 5 mL culture at 0 5 ODeoo m in induction media SG R CAA 4 Resuspend cell pellet in S GR CAA at 0 5 ODeoo mL and incubate at 20 C with shaking for 1 to 2 doublings as determined by This will generally take 12 to 16 hours 5 Wash cells once in wash buffer before staining for flow cytometry or store the cells by placing the flask at 4 C for up to a week See 3 1 1 for notes about 4 C storage of induced cultures See section 3 5 for flow cytometric staining of individual clones for HA Myce and antigen binding 3 2 Magnetic Bead Enrichment Using Miltenyi Macs LS Columns for two rounds of magnetic bead enrichment Note Biotinylated antigens can be generated in a variety of ways We find the Pierce NHS Biotinylation kit and the HABA system to quantify the number of biotin molecule of protein to be robust and easy We strive to obtain 2 3 biotin protein molecule More biotin protein is not desirable due to concerns about blocking the epitope antibody interaction site 3 2 1 Process for enrichment of antigen specific clones from non immun
47. or to exchange buffer into 1x PBS ideally want 6000x change in buffer Optimize supernatant before IMAC purification 0 5 M NaCl and 0 05 Tween 20 Remove 500 uL aliquot for analysis onput fraction Add Qiagen Ni NTA agarose beads to supernatant capacity 0 5 to 1 mg mL bead slurry typically use 200 uL slurry purification Mix 4 C for 2 hours Spin agarose beads 3000 RPM for 3 to 5 minutes Remove 500 uL aliquot flow through fraction Wash 10 mL 0 5 M NaCl 0 05 Tween 20 pH 7 with NaH 2PO4 Mix 5 to 10 minutes at 4 C Spin 3000 RPM Transfer supernatant to new tube keep until gel analysis Remove 500 uL aliquot wash fraction Elution 250 uL elution buffer 2xPBS 300 mM NaCl 200 mM imidiazole Mix 20 to 30 minutes at 4 Spin transfer eluted scFv supernatant to new tube using 20 gauge syringe Repeat for 2 to 4 total elution fractions Keep beads for analysis Analysis Concentrate onput FT and wash fractions 10x with microcon Visualize purification purity with 4 to 12 Bis Tris gel Invitrogen Pool appropriate elution fractions and dialyze into 1x PBS to remove imidiazole typically 2x 0 5 mL scFv to 2 L PBS 31 Quantify purified fraction We generally obtain gt 100 ug purified scFv 50 mL induction culture 2 10 mg L yield Figure 8 SDS Page of 6 His purified scFv n N 2 T n n e 9 lt a N p o i N Cm SN s VO 9 gt A a O Be n g S S o So lt SL
48. protein in vitro by DNA shuffling Nature 370 389 TL Orr Weaver and JW Szostak 1983 Yeast recombination the association between double strand gap repair and crossing over Proc Natl Acad Sci U S A 80 4417 JJ VanAntwerp and KD Wittrup 2000 Fine affinity discrimination by yeast surface display and flow cytometry Biotechnol Prog 16 31 JD Marks HR Hoogenboom TP Bonnert J McCafferty AD Griffiths and G Winter 1991 By passing immunization Human antibodies from V gene libraries displayed on phage J Mol Biol 222 581 AD Griffiths M Marget JD Marks JM Bye MJ Embleton J McCafferty M Baier KP Holliger BD Gorick NC Hughes Jones HR Hoogenboom and G Winter 1993 Human anti self antibodies with high specifcity from phage display libraries The EMBO Journal 12 725 ME Mummert and EWJr Voss 1996 TRansition State Theory and secondary forces in antigen antibody complexes Biochemistry 35 8045 IA Lorimer and I Pastan 1995 Random recombination of antibody single chain Fv sequences after fragmentation with DNasel in the presence of Mn2 Nucleic Acids Res 23 3067 H Zhao and FH Arnold 1997 Optimization of DNA shuffling for high fidelity recombination Nucleic Acids Res 25 1307 16 1 Features of the pPNL6 Vector The pPNL6 vector containing the scFv library offers several key features that make it easy to display proteins of interest on S cerevisiae These include GALI promoter for strong inducible expressi
49. r site PNL9For 824 Secretion Vector 822 Nhe 1 822 pPNL9 112 806 linker 850 4884 bp M 3131 URA3 gene 4034 829 Not 1 829 Select on HUL or 843 Sfi 1 843 SD CAA Trp 849 Bsp EI 849 851 PNL9 gap repair site 888 853 Eco RI 853 869 V5 epitope tag 910 2228 Amp R 3085 920 6 his 937 966 30seqrev primer 989 987 CYC1 Rev primer 1005 1381 ColE1 origin 2200 YVH10 Ura Trp is BJ5464 and is MAT alpha The other markers are ura3 52 element insertion with no detectable background reversion frequency trp1 an amber point mutation leu25200 11536200 pep4 HIS3 prbd1 6R canl GAL YVHIO has the yeast PDI gene integrated in tandem with the endogenous copy and is under the constitutive glyceraldehydes GADPH promoter with Leu2 as a selectable marker This strain is used to secrete and purify the scFv Growth YVH10 with pPNL9 should be selected on SD CAA Trp 10 strain without a plasmid should be grown on The media SD CAA must contain TRP and URA It can also be grown on YPD 38 BamHI 698 Psi 330 EcoRI 690 EcoRI 1086 ha tag 51 570 V5 epitope tag 264 6 his 100 200 300 400 500 600 700 800 N Fragment of of scFv in secretion vector CCGGCTGAAG TGCTGTTTTG GGCCGACTTC ACGACAAAAC HindIII ATACTACTAT AAAAGAGAGG TATGATGATA TGGTGGTTCT TGAAGCCCTC ACCACCAAGA ACTTCGGGAG TTCTCCAACA AGG
50. taatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtca gaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgettgcaaacaaaaaaaccaccgcta ccagcggtgetttgttteccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatac tgtccttctagtgtagccgtagttageccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttacca gtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcggg ctgaacgggggegttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattga gaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggteggaacaggagagcgcacga gggagcttccaggggggaacgcctggtatctttatagtcctgtcggegtttcgccacctcetgacttgagcgtegatttttgtgatectc gtcaggggggccgagcctatggaaaaacgccagcaacgcggcctttttacggttcetggcettttgctggccttttgctcacatgt tctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccg agegcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcatta atgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttacctcactcattaggc accccaggctttacactttatgcttccggctcctatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgac catgattacgccaagctcggaattaaccctcactaaagggaacaaaagctgggtacc 37 1 Spe 1 1 6 Gal 1 promoter 456 266 pnl20 PCRfor 289 419 Gal1B for seq primer 446 419 Gal1 for PCR primer 442 507 Hin 911 507 4225 cen ars 4740 512 alpha prepro leader 805 ps my 756 Xho 1 756 4209 Nhe 1 4209 775 Hin dlll 775 g 779 HA tag 805 788 Gap repai
51. the parental thus the parental clone is no longer present in the sort gate window One may be sorting at a frequency of less than 1 10 000 and only sort out 1000 yeast However in two selection cycles less than 1 week time we routinely obtain clones with improved affinity It is often useful to run the original clone side by side with your new mutants to verify even slight differences in Kp 3 fold differences in Kp are easily seen 1 Reference List MJ Feldhaus RW Siegel LK Opresko JR Coleman JM Feldhaus YA Yeung JR Cochran P Heinzelman D Colby J Swers C Graff HS Wiley and KD Wittrup 15 10 11 12 13 2003 Flow cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library Nat Biotechnol 21 163 ET Boder and KD Wittrup 1998 Optimal screening of surface displayed polypeptide libraries Biotechnol Prog 14 55 ET Boder and KD Wittrup 1997 Yeast surface display for screening combinatorial polypeptide libraries Nat Biotechnol 15 553 ET Boder KS Midelfort and KD Wittrup 2000 Directed evolution of antibody fragments with monovalent femtomolar antigen binding affinity Proc Natl Acad Sci USA 97 10701 PS Daugherty G Chen BL Iverson and G Georgiou 2000 Quantitative analysis of the effect of the mutation frequency on the affinity maturation of single chain Fv antibodies Proc Natl Acad Sci U S A 97 2029 WP Stemmer 1994 Rapid evolution of a
52. tic column Resuspend cells eluted from the column in 500 uL buffer for subsequent staining for sorting by flow cytometry Continue to Section 3 3 3 3 Fluorescent Staining of Cells from Macs Column Before Flow Cytometric Cell Sorting It is important to note that at the start of each round of selection you should stain your library for anti HA 12CAS anti c myc 9e10 and secondary only controls This establishes several important baselines 1 Were my yeast properly induced 2 What percent are expressing c myc ie full length scFv 3 Do my secondary reagents bind non specifically 4 Am I enriching for secondary reagent binders Therefore if you are going to use streptavidin PE to label antigen bound cells you should add just streptavidin PE to your induced cells to see if it binds The control for goat anti mouse reagents should be stained and analyzed no anti c myc antibody should be added We will generally see very little labeling of the aliquot lt 0 1 If you see labeling try other secondary reagents i e Neutravidin streptavidin or anti biotin mAb to minimize enriching for secondary reagent binders NOTE The following protocol is for staining up to 5 x 10 cells in 500 uL wash buffer To stain less yeast decrease the volume proportionally yet keep the reagent concentration the same Most secondary reagents should be tittered in your lab for the most appropriate dilutions Figure 4 shows several combinations of secondary r
53. tion most or all of the cells coming off the magnetic column should be sorted In figure 5 panel A the population is obvious however this is not always the case depending upon enrichment ratios and sometimes antigen binding cells must be sorted on faith The second method relies on staining the same sub library in the presence and absence of antigen It is often very clear where to set the sort gate at this point An example of sorting is presented in Figure 5 10 The sort criteria are usually less stringent for the first flow cytometric sort Sort more slowly less coincidence aborts and on an enrich mode The rate of more slowly is dependent upon the sorter you are using A skilled operator should be able to provide guidance 3 4 2 First sort Round 3 selection 1 Sort yeast into eppendorf tubes containing 100 uL of YPD media The YPD helps the yeast recover We let them set in the YPD media for about an hour before growth on selectable media 2 After sorting plate the cells on SD CAA Pen Strep and an appropriate dilution plate Note Yeast do not grow very well in liquid culture when grown at low cell densities lt 10 Therefore when we sort out less than 10 000 yeast we generally will plate them Incubate plates at 30 C for 24 to 48 hours Scrape colonies together and then grow for several hours in SD CAA media 5 Subculture at least 10 representation of sub library diversity determined from t
54. tory pathway and the epitope tagged scFv antibody is displayed on the cell surface Figure la and b Figure 2 shows the HA and c myc epitope staining patterns for an scFv antibody library Molecular interactions with the scFv antibody can be easily assayed by incubating the cells with a ligand of interest Figure 1C Figure 3 graphically depicts a generalized scheme for enriching and identifying antigen specific binders within a non immune scFv library A combination of two rounds of selection using magnetic particles followed by two rounds of flow cytometric sorting will generally allow recovery of clones of interest Yeast surface display of scFv antibodies has also been successfully utilized to isolate higher affinity clones from small 1x10 mutagenic libraries generated from a unique antigen binding scFv clone 4 Mutagenic libraries are constructed by amplifying the parental scFv gene one wants to obtain higher affinity variants of using error prone PCR to incorporate 3 to 7 point mutations scFv 5 6 The material is cloned into the surface expression vector using the endogenous homologous recombination system present in yeast known as Gap Repair 7 Gap repair is an endogenous homologous recombination system in S cerevisiae that allows gene insertion in chromosomes or plasmids at exact sites by utilizing as little as 30 base pair regions of homology between your gene of interest and its target site This allows mutated libraries of 1 10 x
55. trapped between the beads to pass through With the column back in the magnet add 1 ml of wash buffer and let flow through then another 7 mL of cells onto column Repeat column removal procedure between each loading of cells It will take about 30 minutes to load all 50 mL of cells 9 Once all of the cells have been loaded on the column wash the column with 3 mL of wash buffer Make sure the upper loading chamber is washed of all residual cells This wash removes the cells in the void volume of the column Remove column from magnet and immediately replace as before Repeat this wash 2 additional times 10 Once the column has stopped dripping remove the column from magnet and then add 7 mL of wash buffer and use the plunger to push all remaining cells out into a 15 mL conical tube We generally elute about 1 3 x 10 cells Pellet cells and resuspend as follows If Round 1 selection Resuspend yeast in 200 mL of selection media SD CAA with pen strep Plate a dilution to get accurate number of yeast eluted from the first column This is the Rloutput diversity Incubate culture to saturation 10 yeast Approximately 24hours Induce as above in SG R CAA This allows maximal expansion of library and of your clone of interest for subsequent repeat of magnetic bead enrichment Use anti biotin magnetic beads Miltenyi as above for second round of selection This is the R2output If Round 2 selection second enrichment on magne
56. ttggattttagaaagtaaataaagaaggtagaagagttacggaatgaagaaaaaaaaataaa caaaggtttaaaaaatttcaacaaaaagcgtactttacatatatatttattagacaagaaaagcagattaaatagatatacattcgatt aacgataagtaaaatgtaaaatcacaggattttcgtgtetgetcttctacacagacaagatgaaacaattcggcattaatacctgag agcaggaagagcaagataaaaggtagtatttgttggcgatccccctagagtcttttacatcttcggaaaacaaaaactattttttcttt aatttctttttttactttctatttttaatttatatatttatattaaaaaatttaaattataattatttttatagcacgtgatgaaaaggacccaggt ggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataacc ctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgccecttattcccttttttecggcattttgc cttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttggetgcacgagtgggttacatcgaact ggatctcaacagcggtaagatcettgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggc gcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcacc agtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggc caacttacttctgacaacgatcggaggaccgaaggagctaaccgctttttttcacaacatgggggatcatgtaactcgcettgatc gttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcg caaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacca cttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagc actggggccagatggtaagccctcccgtatcgtagttatctacacgacgggcagtcaggcaactatggatgaacgaaatagaca gatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttca tttt
57. use Alexa 488 and of streptavidin PE Note Figure 6 shows several combinations of fluorescent reagents that can be used Incubate 30 minutes on ice pellet the cells and wash 2X in cold buffer 6 Resuspend cells in 1 mL of buffer and keep on ice in the dark analysis by flow cytometry 3 5 2 Affinity determination using equilibrium binding titration curves to determine equilibrium dissociation constants Kp Due to the initial selections being done at 100nM the vast majority of clones identified from a non immune library will be in the 1nM 100nM affinity range The lower the concentration of antigen in the initial selection the lower the affinity range will be and fewer unique clones are generally isolated Once antigen binding has been verified we 12 determine clone uniqueness by utilizing a DNA fingerprint of the PCR amplified scFv restriction digested with BstN1 9 10 This limits the number of clones we need to determine the Kp for as many clones will may be identical as demonstrated by identical BstN1 fingerprints obtained above This range of affinities can be determined on the yeast surface by measuring the amount of antigen bound at different concentration at equilibrium The technique relies on measuring the mean fluorescence intensity MFI of the bound antigen at and variety of concentrations of antigen on the c myc positive yeast Kp is measured by determining at what concentration of antigen is half of the scF
58. v on the surface of the yeast cell bound to antigen Therefore measuring the MFI of the yeast when no antigen is bound and determining the concentration of antigen that gives the maximal MFI is needed This is easily accomplished by setting up a series of antigen concentrations in which to label the yeast with and then measuring the MFI of the antigen binding population by flow cytometry The MFI obtained using flow cytometry with each of the antigen concentrations tested is then plotted against the antigen concentration and using a nonlinear least squares curve to fit the data the Kp is determined See Figures 6 amp 7 Staining 10 yeast antigen concentration represents approximately 10 to 10 antigen binding sites scFv in the sample We assume 10 scFv yeast and 50 express scFv You want to maintain at least 10x excess of number of molecules of antigen over the number of scFv molecules This is non depleting ligand conditions We routinely prepare 12 clones using a 96 well micro titer plate format choosing 8 concentrations of antigen which include a no antigen control for background 1 Label 10 induced yeast with 100ul of a 1 100 dilution on the c myc mAb 200ug ml for 30minutes on ice 2 Add 10ul 10 yeast directly into the antigen concentrations see step 3 below This uses very little c myc antibody 1ul 100ul of 10 cells 3 The following concentrations and volumes will allow for an accurate Kg to be measured for
59. y 4 Sorter R3 Growth Induction Day 6 Sorter individual Antigen s R4 Ag1 Ag2 Ag4 Ag5 Ag6 Day 9 Individual clone analysis and verification B Enrichment factor and recovery of antigen specific clones using a combination of magnetic bead enrichment and flow cytometric cell sorting It is important to use at least 10 fold coverage of the starting complexity library to fully screen the library After two rounds of enriching using magnetic beads the 500 Ag specific cells would theoretically be present a total of 5 x 10 non specific cells Using the Miltenyi Macs system described in this manual we find that from 10 cells loaded onto the column the background is consistently around 0 5 to 5 x 10 cells based on regardless of scFv expression or number of antigen binding cells The cell sorter greatly reduces the complexity from 107 to 104 to 10 total cells depending on the stringency of sort gates and total number of cells sorted By the second or third round of flow cytometric sorting it s usually apparent if an Ag specific clone is present at a frequency greater than 1 10 000 It is always important to have a sample prepared that has been stained with all secondary regents but without antigen 1 anti c myc GaM PE streptavidin Alexa 633 Recovery of Enrichment Ag specific Original Clone cells based on Selection Frequency Library Ag specific 50 recovery Compl
60. yc positive then careful examination of control 5 to the antigen containing sample may allow a different subpopulations to be visualized in the dual positive quadrant of the bivariate plot The population that is present in the antigen containing sample and not in the no antigen control can be specifically isolated However you may also see the percent dual positive population change from 2 in the no antigen control to 4 or more in the antigen containing sample These antigen binder are able to be identified in one of two manners First after sorting with SA PE individual clones can be subsequently screened for antigen binding specificity The number of clones to analyze will be dictated on the 11 relative differences in the percent positive between control 5 and the antigen containing sample Second the secondary reagent used to detect antigen positive cells can be changed to anti biotin mAb or neutravidin both labeled with an appropriate fluorescent dye This prevents those clones in the library that specifically bind streptavidin from contaminating the selection process altogether However make sure to repeat control 5 with whatever secondary reagent you intend to use to detect antigen binding 1 Sort on purity mode if an antigen specific population is obvious Sorting a few hundred to a thousand yeast cells at this point will generally suffice to give an antigen positive clone 2 Sort yeast into eppendorf tubes contain
61. ycriamb3 Round 4 selection 2 sort No Antigen 5 Plus Antigen 19 104 104 22 Figure 6 Kp determination using flow cytometry R3b 2 no antigen 0 102 10 MyciGaM PE File R3b 2 no antigen Total Events 10000 Region 96 Total X Mean Y Mean R1 75 89 712 29 3 50 T R3b 2 5 nM 101 102 10 MyciGaM PE File R3b 2 5 nM Total Events 10000 Region Yo Total X Mean Y Mean R1 78 32 759 32 294 88 T 2 125 nM 101 102 10 PE File R3b 2 125 nM Total Events 10000 Region Total X Mean Y Mean R1 77 58 1042 96 839 12 R3b 2 0 5 nM 2 e 2 SN oo e O E o f ja M Sse NL 109 10 10 103 104 PE File R3b 2 0 5 nM Total Events 10000 Region Yo Total X Mean Y Mean R1 74 07 68925 77 37 T R3b 2 10 nM o 0 102 103 MyciGaM PE File R3b 2 10 nM Total Events 10000 Region Total X Mean Y Mean R1 78 57 715 84 376 33 T R3b 2 250 nM gt Er si 409 10 102 103 10 File R3b 2 250 nM Total Events 10000 Region Total X Mean Y Mean R1 76 25 925 85 924 46 23 T R3b 2 1 nM e 10 Myc GaM PE File R3b 2 1 nM Total Events 10000 Region Total X Mean Y Mean R1 77 92 661 16 121 76 R3b 2 62 5 nM File R3b 2 62 5 nM Total Events 10000 Region Total X Mean Y Mean R1 75 92 982 43 687 89 T R3b 2 500 nM 2 File R3b 2 500 nM Total

Yeast Display scFv Antibody Library User`s Manual

Contents

Download Pdf Manuals

Related Search

Related Contents