Flp-In™ System - Thermo Fisher Scientific
Contents
1. Continued on next page Overview Continued TM Diagram of the The figure below illustrates the major features of the Flp In System as described Flp In System on the previous page For a brief description about FRT sites and the mechanism of Flp mediated recombination see the next page and published reviews Craig 1988 Sauer 1994 1 pFRT lacZeo is stably 4 Integration of the expression transfected into the mammalian cells of interest to generate the Zeocin resistant Flp In Host Cell Line s Expression of lacZ and Zeocin fusion gene ATG rR lacZ Zeocin Amp pUC ori Flp In Host Cell Line The pcDNAS FRT expression vector pOG44 containing your gene of interest GOI is y pcDNA5 FRT cotransfected with pOG44 into the Flp In Host Cell Line P Am UC ori Flp la Host Cell Line gt _ gt gt ER The Flp recombinase Sy expressed from pOG44 Zs catalyzes a homologous recombination event between the FRT sites in the host cells and the peDNAS FRT expression vector A pcDN AS FRT y z Expression Z Vector zo dA construct allows transcription of the gene of interest GOI and confers hygromycin resistance and Zeocin sensitivity to the cells Expression of your gene Fe lacZ Zeocin Expression of hygromycin pUC ori Amp Amp pUC ori Pcmv ATG Gn Hygromycin Flp In2. Expression Cell Line Continued on next page Overview Continued Flp Recombinase Mediated DNA Recombination FRT Sites In the Flp In System integration of your peDNA 5 FRT expression construct into the genome occurs via Flp recombinase mediated intermolecular DNA recombination The hallmarks of Flp mediated recombination are listed below e Recombination occurs between specific FRT sites see below on the interacting DNA molecules e Recombination is conservative and requires no DNA synthesis the FRT sites are preserved following recombination and there is minimal opportunity for introduction of mutations at the recombination site e Strand exchange requires only the small 34 bp minimal FRT site see below For more information about the Flp recombinase and conservative site specific recombination refer to published reviews Craig 1988 Sauer 1994 Note If your cell line contains multiple integrated FRT sites Flp mediated intramolecular recombination may also occur Intramolecular recombination may result in e Excision of the intervening DNA if the FRT sites are directly repeated Le integration of multiple FRT sites on the same DNA strand e DNA inversion if the sites are in opposing orientations e Deletion of genomic sequences As described above Flp recombinase mediated recombination occurs between specific FRT sites The FRT site originally isolated from Saccharomyces cerevisiae serve
3. and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating DNA using the PureLink or S N A P Miniprep or Midiprep Kit page vii or CsCl gradient centrifugation For established cell lines e g HeLa COS 1 consult original references or the supplier of your cell line for the optimal method of transfection We recommend that you follow exactly the protocol for your cell line Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen amp Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1989 Felgner amp Ringold 1989 and electroporation Chu et al 1987 Shigekawa amp Dower 1988 Invitrogen offers the Calcium Phosphate Transfection Kit and Lipofectamine 2000 Reagent page vii for mammalian cell transfection For more information refer to our web site at www invitrogen com or contact Technical Support page 26 Continued on next page Generating Stable Flp In Host Cell Lines Continued Zeocin Note Determination of Zeocin Sensitivity Effect of Zeocin on Sensitive and Resistant Cells TM The pFRT lacZeo plasmid contains a lacZ Zeocin fusion gene under the control of the SV40 early promoter Expression of the l
4. Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Limited Label License No 64 Flp In System TM Use of the Flp In System and its components System is covered under a number of different licenses including those detailed below Life Technologies Corporation Life Technologies has a license to sell the Flp In System and its components System to scientists for research purposes only under the terms described below Use of the System for any Commercial Purpose as defined below requires the user to obtain commercial licenses as detailed below Before using the System please read the terms and conditions set forth below Your use of the System shall constitute acknowledgment and acceptance of these terms and conditions If you do not wish to use the System pursuant to these terms and conditions please contact Life Technologies Technical Services within 10 days to return the unused and u
5. also contains the hygromycin resistance gene with a FRT site embedded in the 5 coding region The hygromycin resistance gene lacks a promoter and the ATG initiation codon For more information about the peDNA 5 FRT vector refer to the vector manual TM The third major component of the Flp In System is the pOG44 plasmid which constitutively expresses the Flp recombinase Broach et al 1982 Broach amp Hicks 1980 Buchholz et al 1996 under the control of the human CMV promoter For more information about pOG44 and the FLP gene see the Appendix pages 24 25 TM The pOG44 plasmid and the pcDNA 5 FRT vector containing your gene of interest are cotransfected into the Flp In host cell line Upon cotransfection the Flp recombinase expressed from pOG44 mediates a homologous recombination event between the FRT sites integrated into the genome and on pcDNA 5 FRT such that the pcDNA 5 FRT construct is inserted into the genome at the integrated FRT site see diagram next page Insertion of pcDNA 5 FRT into the genome at the FRT site brings the SV40 promoter and the ATG initiation codon from pFRT lacZeo into proximity and frame with the hygromycin resistance gene and inactivates the lacZ Zeocin fusion gene Thus stable Flp In expression cell lines can be selected for hygromycin resistance Zeocin sensitivity lack of B galactosidase activity and expression of the recombinant protein of interest see diagram next page
6. carries a point mutation flp F70L that results in a change in amino acid 70 from phenylalanine to leucine Buchholz et al 1996 For more information about the properties of the flp F70L protein refer to page 15 and Buchholz et al 1996 23 Technical Support Web Resources Visit the Invitrogen web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our web site www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail E mail eurotech invitrogen com jpinfo invitrogen com MSDS Certificate of Analysis Limited Warranty 26 MSDSs
7. cell line of choice you may wish to generate a Flp In host cell line containing multiple integrated FRT sites In theory cotransfection of your pcDNA 5 FRT construct and pOG44 into these cells will allow integration of your gene of interest into multiple genomic loci Note that the presence of multiple integrated FRT sites in the genome may increase the occurrence of chromosomal rearrangements or unexpected recombination events in your host cell line As mentioned previously we recommend that you transfect your mammalian cell line with a limiting amount of pFRT lacZeo plasmid We generally use 250 ng to 2 ug of plasmid DNA per 4 x 10 cells for transfection but the amount of plasmid DNA may vary due to the nature of the cell line the transfection efficiency of your cells and the method of transfection used When transfecting your mammalian cell line of choice we suggest that you try a range of plasmid DNA concentrations e g 0 25 0 5 1 2 5 ng ml DNA to optimize transfection conditions for your cell line We generally use electroporation to transfect cells but other methods of transfection are suitable For a protocol to electroporate cells refer to Current Protocols in Molecular Biology Unit 9 3 Ausubel et al 1994 Note that if you use calcium phosphate or lipid mediated transfection methods the amount of total DNA required for transfection is typically higher than for electroporation usually between 10 and 20 pg DNA De
8. have identified single integrants proceed to screen the clones for P galactosidase expression You may assay for B galactosidase expression by activity assay using cell free lysates Miller 1972 or by staining the cells for activity Invitrogen offers the B Gal Assay Kit and the f Gal Staining Kit page vii for fast and easy detection of B galactosidase expression Select those clones expressing the highest levels of galactosidase if desired to use as the TM host cell lines for your pcDNA 5 FRT expression construct 13 Generating Stable Flp In Expression Cell Lines Introduction Important N geo 7 QE Nous I Note 14 Once you have established your Flp In host cell line you may cotransfect your pcDNA 5 FRT construct and the pOG44 expression plasmid into the host cell line to generate a stable Flp In expression cell line Integration of the pcDNA 5 FRT construct into the genome will occur at the FRT site in the Flp In host cells The pcDNA 5 EFRT plasmid contains the hygromycin resistance gene to allow selection of stable cell lines see Important below For more information about the pcDNA 5 FRT plasmid and generating the pcDNA 5 FRT expression construct refer to the vector manual For more information about the pOG44 plasmid see below TM The hygromycin resistance gene in the pcDNA 5 FRT vector lacks an ATG initiation codon and a promoter to drive expression of th
9. itia iin oe E AE EEE E Rn abba eiii 25 T echmical Support restei earr A eli A handed Eee 26 Purchaser Notifica a a o a E E 27 A sepesi aa E E a E R Ea RERA 29 iii iv Kit Contents and Storage Types of Kits System Components Shipping Storage TM The Flp In System manual is supplied with the kits listed below The Core System includes vectors and primers for sequencing The Complete System includes the Core System plus selection agents See below for a detailed TM description of the contents of each Flp In System Product Catalog no Flp In Complete System K6010 01 Flp In Core System K6010 02 The following table shows the components associated with each Flp In system listed above Catalog no Components K6010 01 K6010 02 pcDNA 5 FRT Expression Vector Y Y pcDNA 5 FRT CAT Positive Control Vector pOG44 Plasmid Vector pFRT lacZeo Target site Vector CMV Forward Primer 21 mer BGH Reverse Primer 18 mer Hygromycin B A S S S S STENT Ss SI SESS TM Zeocin Selection Reagent The components supplied with Catalog nos K6010 01 and K6010 02 are shipped as described in the table below Upon receipt store each component as listed below Note The components of K6010 01 are shipped in 2 boxes Box 1 contains vectors primers TM and hygromycin Box 2 contains Zeocin Item Shipping Storage Ve
10. our web site at www invitrogen com or contact Technical Support see page 26 3 Prepare a glycerol stock of each plasmid for long term storage below Once you have identified the correct clone be sure to purify the colony and make a glycerol stock for long term storage It is also a good idea to keep a DNA stock of yer plasmid at 20 C Streak the original colony out on an LB plate containing 50 ug ml ampicillin Incubate the plate at 37 C overnight 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 pg ml ampicillin Grow the culture to mid log phase OD soo 0 5 0 7 Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C Generating Stable Flp In Host Cell Lines Introduction Important Plasmid Preparation Methods of Transfection TM Before you can create a stable Flp In cell line s expressing your gene of interest you will first need to generate a stable mammalian cell line containing an integrated FRT site Flp In host cell line The following section provides guidelines and instructions to generate stable Flp In host cell lines by transfection using the pFRT lacZeo plasmid For a map and a description of the features of pFRT lacZeo refer to the Appendix pages 22 23 TM TM Several Flp In host cell lines which stably express the lacZ Zeocin fusion gene from pFRT lacZeo or pFRT lacZeo2 and which contain a
11. single integrated FRT site are available from Invitrogen see table below If you wish to express your gene of interest in one of the cell lines listed below you may want to use one of Invitrogen s Flp In cell lines as the host to establish your stable expression cell line For more information refer to our web site at www invitrogen com or contact Technical Support page 26 We have observed down regulation of the viral CMV promoter and subsequent loss of gene expression when pcDNA 5 FRT based expression constructs are introduced into Flp In 3T3 or Flp In BHK cells If you will be cloning your gene of interest into a p DNA 5 FRT based expression construct we recommend that you do not use 313 or BHK cells to create your Flp In host cell line Alternatively if you prefer to use 3T3 or BHK cells to create your Flp In host cell line we recommend that you clone your gene of interest into a pEF5 FRT based expression plasmid e g pEF5 FRT V5 D TOPO or pEF5 FRT V5 DEST Loss of gene expression due to down regulation of the promoter is not observed in these cell lines when using pEF5 FRT based expression constructs For more information about the pEF5 FRT V5 D TOPO or pEF5 FRT V5 DEST vectors visit our web site at www invitrogen com or contact Technical Support page 26 Plasmid DNA for transfection into eukaryotic cells must be very clean and free from phenol and sodium chloride Contaminants will kill the cells
12. 88 Sauer 1994 to facilitate integration of the gene s of interest into a specific site in the genome of mammalian cells TM In the Flp In System three different vectors are used to generate isogenic stable mammalian cells lines expressing your gene s of interest The first major component of the Flp In System is the pFRT lacZeo target site vector that is used to generate a Flp In host cell line The vector contains a lacZ Zeocin fusion gene whose expression is controlled by the SV40 early promoter see the Appendix pages 22 23 for more information A FRT site has been inserted just downstream of the ATG initiation codon of the lacZ Zeocin fusion gene The FRT site see page 4 for more information serves as the binding and cleavage site for the Flp recombinase The pFRT lacZeo plasmid is transfected into the mammalian cell line of interest and cells are selected for Zeocin resistance Zeocin resistant clones are screened to identify those containing a single integrated FRT site The resulting Flp In host cell line contains an integrated FRT site and expresses the lacZ Zeocin fusion gene see the diagram next page Note Integration of the pFRT lacZeo plasmid into the genome is random TM TM The second major component of the Flp In System is the pcDNA 5 FRT expression vector into which the gene of interest will be cloned Expression of the gene of interest is controlled by the human CMV promoter The vector
13. Cl Bring the volume to 1 liter and autoclave for 20 minutes on liquid cycle Store at room temperature or at 4 C Zeocin Zeocin Molecular Weight Formula and Structure Applications of Zeocin Handling Zeocin Zeocin is a member of the bleomycin phleomycin family of antibiotics isolated from Streptomyces Antibiotics in this family are broad spectrum antibiotics that act as strong anti bacterial and anti tumor drugs They show strong toxicity against bacteria fungi including yeast plants and mammalian cells Baron et al 1992 Drocourt et al 1990 Mulsant et al 1988 Perez et al 1989 The Zeocin resistance protein has been isolated and characterized Calmels et al 1991 Drocourt et al 1990 This protein the product of the Sh ble gene Streptoalloteichus hindustanus bleomycin gene is a 13 7 kDa protein that binds Zeocin and inhibits its DNA strand cleavage activity Expression of this protein in TM eukaryotic and prokaryotic hosts confers resistance to Zeocin The formula for Zeocin is CsoHsgoN21021S3 and the molecular weight is 1 535 The diagram below shows the structure of Zeocin H CONH2 MW 1 535 Zeocin is used for selection in mammalian cells Mulsant et al 1988 plants Perez et al 1989 yeast Baron et al 1992 and prokaryotes Drocourt et al 1990 Typically Zeocin concentrations ranging from 50 to 1000 pg ml are used for selectio
14. GH polyadenylation signal As a result your Flp In expression cell lines should exhibit the following phenotype e Hygromycin resistance e Zeocin sensitivity e Lack of B galactosidase activity e Expression of the gene of interest TM The pcDNA 5 FRT CAT plasmid is provided as a positive control vector for mammalian cell transfection and expression and may be used to assay for expression levels in your Flp In expression cell line If you have several different Flp In host cell lines cell lines containing FRT sites integrated at different genomic loci you may want to use the pcDNA 5 FRT CAT control vector to compare protein expression levels from the various genomic loci For more information about pcDNA 5 FRT CAT refer to the pcDNA 5 FRT vector manual TM The pcDNA 5 FRT vector contains the E coli hygromycin resistance gene HPH Gritz amp Davies 1983 for selection of transfectants with the antibiotic hygromycin B Palmer et al 1987 When added to cultured mammalian cells hygromycin B acts as an aminocyclitol to inhibit protein synthesis by disrupting translocation and promoting mistranslation Hygromycin B liquid is supplied with the Flp In Complete System and is also available separately from Invitrogen see page vii e Hygromycin B is light sensitive Store the liquid stock solution at 4 C protected from exposure to light e Hygromycin Bis toxic Do not ingest solutions containin
15. Material Safety Data Sheets are available on our web site at www invitrogen com msds The Certificate of Analysis CofA provides detailed quality control information for each product The CofA is available on our website at www invitrogen com cofa and is searchable by product lot number which is printed on each box Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore
16. Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 Many E coli strains are suitable for the propagation of the pFRT lacZeo and pOG44 vectors We recommend that you propagate the pFRT lacZeo and pOG44 vectors in E coli strains that are recombination deficient recA and endonuclease A deficient endA For your convenience TOP10 E coli are available as chemically competent or electrocompetent cells from Invitrogen page vii You may use any method of choice for transformation Chemical transformation is the most convenient for many researchers Electroporation is the most efficient and the method of choice for large plasmids Continued on next page Propagation and Maintenance of Plasmids Continued Maintenance of Plasmids Preparing a Glycerol Stock The pFRT lacZeo and pOG44 vectors contain the ampicillin gene to allow selection of the plasmid using ampicillin see pages 22 25 for more information about each vector To propagate and maintain the pFRT lacZeo and pOG44 plasmids we recommend using the following procedure 1 Use 10 ng of the vector to transform a recA endA E coli strain like TOP10 DH5a JM109 or equivalent 2 Select transformants on LB agar plates containing 50 100 ug ml ampicillin For fast and easy microwaveable preparation of Low Salt LB agar containing ampicillin imMedia Amp Agar is available from Invitrogen page vii For more information visit
17. acZ Zeocin fusion gene allows selection of stable integrants using Zeocin antibiotic The resulting stable integrants can then be screened by assaying for expression of B galactosidase For more information about preparing and handling Zeocin refer to the Appendix page 21 The pFRT lacZeo2 plasmid contains a lacZ Zeocin fusion gene under the control of a truncated SV40 promoter and is available separately from Invitrogen page vii The minimal activity of the promoter allows for isolation of clones that have FRT sites integrated in the most transcriptionally active genomic loci For details visit our web site at www invitrogen com or contact Technical Support page 26 To successfully generate a stable cell line containing an integrated FRT site and expressing the lacZ Zeocin fusion protein you need to determine the minimum concentration of Zeocin required to kill your untransfected mammalian cell line Typically concentrations ranging from 50 1000 pg ml Zeocin are sufficient to kill most untransfected mammalian cell lines with the average being 100 400 pg ml We recommend that you test a range of concentrations see protocol below to ensure that you determine the minimum concentration necessary for your cell line Refer to the Appendix page 21 for instructions on how to prepare and store TM Zeocin 1 Plate or split a confluent plate so the cells will be approximately 25 confluent Prepare a set of 7 pl
18. an use this cell line to isolate a stable cell line expressing your gene of interest from the pcDNA 5 FRT plasmid see the next section TM Note The Flp In host cell line should be maintained in medium containing the appropriate amount of Zeocin until generation of your Flp In expression cell line Once you have obtained Zeocin resistant foci you will need to expand the cells and isolate genomic DNA You may use any standard protocol to isolate genomic DNA from your cells Protocols may be found in Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Cloning A Laboratory Manual Sambrook et al 1989 For easy isolation of genomic DNA the Easy DNA Kit page vii is available from Invitrogen Contact Technical Support for more information page 26 Continued on next page Generating Stable Flp In Host Cell Lines Continued Screening Clones by Southern Blot Analysis What You Should See Assay for B Galactosidase Activity You can use Southern blot analysis to determine the number of integrated FRT sites present in each of your Zeocin resistant clones When performing Southern blot analysis you should consider the following factors e Probe We recommend that you use a fragment of the lacZ gene 100 to 500 bp as the probe to screen your samples Mammalian cells do not contain an endogenous lacZ gene therefore a lacZ probe should allow you to identify those clones whi
19. andy A Abremski K Egan J B Ljungquist E H Hoess R H Kahn M L Kalionis B Narayana S V L and Pierson L S 1986 The Integrase Family of Site Specific Recombinases Regional Similarities and Global Diversity EMBO J 5 433 440 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Baron M Reynes J P Stassi D and Tiraby G 1992 A Selectable Bifunctional b Galactosidase Phleomycin resistance Fusion Protein as a Potential Marker for Eukaryotic Cells Gene 114 239 243 Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Broach J R Guarascio V R and Jayaram M 1982 Recombination Within the Yeast Plasmid 2mu Circle is Site specific Cell 29 227 234 Broach J R and Hicks J B 1980 Replication and Recombination Functions Associated with the Yeast Plasmid 2 mu Circle Cell 21 501 508 Buchholz F Ringrose L Angrand P O Rossi F and Stewart A F 1996 Different Thermostabilities of FLP and Cre Recombinases Implications for Applied Site specific Recombination Nuc Acids Res 24 4256 4262 Calmels T Parriche M Burand H and Tiraby G 1991 High Efficiency Transforma
20. ates Allow cells to adhere overnight 2 The next day substitute culture medium with medium containing varying concentrations of Zeocin 0 50 100 250 500 750 and 1000 pg ml Zeocin 3 Replenish the selective media every 3 4 days and observe the percentage of surviving cells 4 Note the percentage of surviving cells at regular intervals to determine the appropriate concentration of Zeocin that kills the cells within 1 2 weeks after TM addition of Zeocin TMy Zeocin s method of killing is quite different from other antibiotics including hygromycin G418 and blasticidin Cells do not round up and detach from the plate Sensitive cells may exhibit the following morphological changes to Zeocin exposure e Vast increase in size similar to the effects of cytomegalovirus infecting permissive cells e Abnormal cell shape e Presence of large empty vesicles in the cytoplasm breakdown of the endoplasmic reticulum and Golgi apparatus or other scaffolding proteins e Breakdown of plasma and nuclear membrane appearance of many holes Eventually these cells completely break down and only strings of protein remain Zeocin resistant cells should continue to divide at regular intervals to form distinct colonies There should not be any distinct morphological changes in Zeocin resistant cells when compared to cells not under selection with Zeocin For more TM information about Zeocin and its m
21. ative Flp recombinase Buchholz et al 1996 Studies have shown that the Flp recombinase expressed from pOG44 possesses only 10 of the activity at 37 C of the native Flp recombinase Buchholz et al 1996 TM When generating Flp In expression cell lines it is important to remember that you are selecting for a relatively rare recombination event since you want recombination and integration of your peDNA 5 FRT construct to occur only through the FRT site and for a limited time In this case using a highly inefficient Flp recombinase is beneficial and may decrease the occurrence of other undesirable recombination events Continued on next page 15 Generating Stable Flp In Expression Cell Lines Continued Note Positive Control Hygromycin B 16 TM Reminder Integration of the pcDNA 5 FRT construct into the genome via the FRT sites will result in the following events see page 3 for a diagram e Insertion of the hygromycin resistance gene downstream of the SV40 early promoter and the ATG initiation codon provided by pFRT lacZeo e Insertion of the plasmid containing the CMV promoter your gene of interest and the BGH polyadenylation signal upstream of the lacZ Zeocin fusion gene e Disruption of the functional lacZ Zeocin transcriptional unit caused by loss of the SV40 early promoter and the ATG initiation codon and insertion of the cassette containing the CMV promoter gene of interest and the B
22. ch contain pFRT lacZeo DNA To label the probe we generally use a standard random priming kit e g Ambion DECAprime II Kit Catalog no 1455 Other random priming kits are suitable TM e Restriction digest When choosing a restriction enzyme to digest the genomic DNA we recommend choosing an enzyme that cuts at a single known site outside of the lacZ gene in the pFRT lacZeo vector Hybridization of the lacZ probe to digested DNA should then allow you to detect a single band containing the lacZ gene from pFRT lacZeo We generally use Hind III to digest genomic DNA from the Zeocin resistant clones pFRT lacZeo contains a single Hind III site within the FRT site e Protocol You may use any Southern blotting protocol of your choice Refer to Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Cloning A Laboratory Manual Sambrook et al 1989 for detailed protocols If you digest genomic DNA from your transfectants with Hind III and use a lacZ fragment as a probe in your Southern analysis you should be able to easily distinguish between single and multiple FRT integrants e DNA from single integrants should contain only one hybridizing band corresponding to a single copy of the integrated pFRT lacZeo plasmid e DNA from multiple integrants should contain more than one hybridizing band If the pFRT lacZeo plasmid integrates into multiple chromosomal locations the bands may be of varying sizes Once you
23. ctors e pcDNA 5 FRT Expression Vector e pcDNA 5 FRT CAT Positive Control Vector e pOG44 Plasmid Vector e pFRT lacZeo Target site Vector Wet ice Store all vectors at 20 C Primers e CMV Forward Primer 21 mer e BGH Reverse Primer 18 mer Wet ice Store all primers at 20 C Hygromycin B K6010 01 only Wet ice Store at 4 C protected from light Zeocin K6040 01 only Wet ice Store at 20 C protected from light Continued on next page Kit Contents and Storage Continued TM Kit Contents Both the Flp In Complete and the Flp In Core Systems include the following components Note that the vectors are supplied in suspension Product Quantity Composition pcDNA 5 FRT Expression Vector 20 ug 40 ul of 0 5 ug ul vector in 10 mM Tris HCl 1 mM EDTA pH 8 0 pcDNA 5 FRT CAT Positive Control 20 ug 40 ul of 0 5 ug pl vector in 10 mM Tris HCl 1 mM EDTA pH 8 0 pOG44 Expression Vector 20 ug 40 ul of 0 5 ug ul vector in 10 mM Tris HCl 1 mM EDTA pH 8 0 pFRT lacZeo Vector 20 pg 40 ul of 0 5 ug ul vector in 10 mM Tris HCl 1 mM EDTA pH 8 0 CMV Forward Primer 21 mer 2 ug lyophilized in TE pH 8 0 BGH Reverse Primer 18 mer 2 ug lyophilized in TE pH 8 0 Zeocin K6010 01 only 1g 100 mg ml Hygromycin B K6010 01 only 1g 100 mg ml Primer Sequences The sequence of each primer is provided below Prime
24. e cells are too dense the antibiotic will not kill the cells Antibiotics work best on actively dividing cells 4 Plate the trypsinized cells in the presence of hygromycin immediately at the predetermined concentration for your cell line rather than waiting for the cells to attach and then adding antibiotic This will ensure that ONLY the true transfectants survive and the untransfected cells die off very quickly 5 Feed the cells with selective medium every 3 4 days until foci can be identified 6 Pick 5 20 hygromycin resistant foci and expand the cells Verify that the pcDNA 5 FRT construct has integrated into the FRT site by testing each TM clone for Zeocin sensitivity and lack of P galactosidase activity 7 Select those clones that are hygromycin resistant Zeocin sensitive and lacZ then assay for expression of your gene of interest We have observed that in cells where the FRT site has integrated into a very transcriptionally active locus in the host cell genome seen more commonly in Flp in CHO and Flp in 293 cells but can happen in Flp in 3T3 cells and any other Flp in host cell line there is some read through transcription and translation of the lacZ Zeocin ORF post Flp in even though the lacZ Zeocin ORF does not have a bonafide promoter and ATG In such cases the hygromycin resistant clones would also be lacZ positive and Zeocin resistant To make sure that the integration is FRT site specific and not rand
25. e gene Transfection of pcDNA 5 FRT plasmid alone into a Flp In host cell line will not confer hygromycin resistance to the cells containing the plasmid The ATG initiation codon and the SV40 promoter required for expression of the hygromycin resistance gene are brought into proximity and frame with the gene only through Flp recombinase mediated recombination between the FRT sites in the pcDNA 5 FRT plasmid and the Flp In host cell line If you wish to express your gene of interest in one of the cell lines listed in the table below you may want to use one of Invitrogen s Flp In host cell lines For more information visit our web site at www invitrogen com or contact Technical Support page 26 If you are generating Flp In expression cell lines using the Flp In 3T3 or Flp In BHK cell line we recommend that you clone your gene of interest into a pEF5 FRT based expression plasmid e g pEF5 FRT V5 D TOPO or pEF5 FRT V5 DEST We have observed down regulation of the viral CMV promoter and subsequent loss of gene expression when pcDNA 5 FRT based expression constructs are introduced into Flp In 3T3 or Flp In BHK cells Continued on next page Generating Stable Flp In Expression Cell Lines Continued pOG44 Plasmid Flp Recombinase Important You will cotransfect the pOG44 plasmid and your pcDNA 5 FRT construct into TM your Flp In host cell line to generate stable cell lines that ex
26. echanism of action see Appendix page 21 Continued on next page Generating Stable Flp In Host Cell Lines Continued Transfection Considerations 10 Once you have determined the appropriate Zeocin concentration to use you are ready to transfect the pFRT lacZeo plasmid into your mammalian cell line of choice to generate the Flp In host cell line You will need to consider the following factors Insertion of the FRT site into the genome Integration of the pFRT lacZeo plasmid containing the FRT site into the genome will occur randomly Subsequent integration of the peDNA 5 FRT expression plasmid containing your gene of interest will occur through Flp recombinase mediated recombination at the genomic FRT site Transfection efficiency of your cell line The aim of most users will be to create stable cell lines containing a single integrated FRT site single integrants see Note on the next page The probability of obtaining stable integrants containing a single FRT site or multiple FRT sites depends on the transfection efficiency of your cell line and the amount of DNA transfected To increase the likelihood of obtaining single integrants lower the transfection efficiency by limiting the amount of plasmid DNA that you transfect see Recommendation next page Selection of foci You will select for stable transfectants by plating cells in medium containing Zeocin Zeocin resistant foci can then be screened b
27. f transformants in E coli pUC origin Permits high copy number replication and growth in E coli 23 Map of pOG44 Vector Map of pOG44 pOG44 is a 5785 bp vector that expresses the Flp recombinase under the control of the human CMV promoter as previously described O Gorman et al 1991 The vector contains a synthetic intron to enhance expression of the FLP gene Note that the vector does not contain an antibiotic resistance marker to allow stable selection in mammalian cells The figure below summarizes the features of the pOG44 vector The complete sequence for pOG44 is available for downloading from our web site at www invitrogen com or by contacting Technical Support page 26 Comments for pOG44 5785 nucleotides CMV promoter bases 234 821 Synthetic intron bases 871 1175 FLP ORF bases 1202 2473 SV40 late polyadenylation signal bases 2597 2732 pUC origin bases 3327 3993 complementary strand bla promoter bases 4999 5097 complementary strand Ampicillin b a resistance gene bases 4138 4998 complementary strand 24 Features of pOG44 Vector Features of pOG44 The table below describes the relevant features of pOG44 All features have been functionally tested Feature Benefit Human cytomegalovirus CMV Permits high level expression of the FLP gene Andersson immediate early promoter et al 1989 Boshart et al 1985 Nelson et al 1987 Synthetic intron Hybrid f
28. g the drug e Wear gloves a laboratory coat and safety glasses or goggles when handling hygromycin B and hygromycin B containing solutions Continued on next page Generating Stable Flp In Expression Cell Lines Continued Preparing and Storing Hygromycin B Determination of Hygromycin Sensitivity Important TM Hygromycin B Flp In Complete System only is supplied as a 100 mg ml stock solution in autoclaved deionized water and is filter sterilized The solution is brown in color The stability of hygromycin B is guaranteed for six months if stored at 4 C Medium containing hygromycin is stable for up to six weeks To successfully generate a stable cell line expressing your gene of interest from pcDNA 5 FRT you need to determine the minimum concentration of hygromycin B required to kill your untransfected Flp In host cell line Typically concentrations ranging from 10 to 400 pg ml hygromycin B are sufficient to kill most untransfected mammalian cell lines We recommend that you test a range of concentrations see protocol below to ensure that you determine the minimum concentration necessary for your Flp In host cell line 1 Plate or split a confluent plate so the cells will be approximately 25 confluent Prepare a set of 7 plates Allow cells to adhere overnight 2 The next day substitute culture medium with medium containing varying concentrations of hygromycin B 0 10 50 100 200 400 600
29. he aforementioned research Each such officer employee and student must be informed of these terms and conditions and agree in writing to be bound by same You may not distribute the System or the vectors or host strains contained in it to others You may not transfer modified altered or original material from the System to a third party without written notification to and written approval from Life Technologies You may not assign sub license rent lease or otherwise transfer any of the rights or obligations set forth herein except as expressly permitted by Life Technologies This product is licensed under U S Patent Nos 5 654 182 and 5 677 177 and is for research purposes only Inquiries about licensing for commercial or other uses should be directed to The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Department of Intellectual Property and Technology Transfer Phone 858 453 4100 ext 1703 Fax 858 450 0509 Email mwhite salk edu References Andersson S Davis D L Dahlb ck H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Andrews B J Proteau G A Beatty L G and Sadowski P D 1985 The FLP Recombinase of the 2 Micron Circle DNA of Yeast Interaction with its Target Sequences Cell 40 795 803 Argos P L
30. ids Res 18 937 947 Jayaram M 1985 Two micrometer Circle Site specific Recombination The Minimal Substrate and the Possible Role of Flanking Sequences Proc Natl Acad Sci USA 82 5875 5879 Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor Laboratory Cold Spring Harbor New York Mulsant P Tiraby G Kallerhoff J and Perret J 1988 Phleomycin Resistance as a Dominant Selectable Marker in CHO Cells Somat Cell Mol Genet 14 243 252 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 O Gorman S Fox D T and Wahl G M 1991 Recombinase Mediated Gene Activation and Site Specific Integration in Mammalian Cells Science 251 1351 1355 Continued on next page 29 References Continued Palmer T D Hock R A Osborne W R A and Miller A D 1987 Efficient Retrovirus Mediated Transfer and Expression of a Human Adenosine Deaminase Gene in Diploid Skin Fibroblasts from an Adenosine Deficient Human Proc Natl Acad Sci U S A 84 1055 1059 Perez P Tiraby G Kallerhoff J and Perret J 1989 Phleomycin Resistance as a Dominant Selectable Marker for Plant Cell Transformation Plant Mol Biol 13 365 373 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Seco
31. invitrogen Flp In System For Generating Stable Mammalian Expression Cell Lines by Flp Recombinase Mediated Integration Catalog nos K6010 01 K6010 02 Version E 9 November 2010 25 0306 Table of Contents Kit Contents and Storage unnnnnnenenenenensesenenrnenenenrenenenenenenenenenseneneneneneneneeneneneneneneeneneneneneneneneneesenenenenene v Accessory PrOdUCtS vitral Ta een di O ia ales vii INtrOductiOn sssssssssssssssscscscssssssssenesessssssssesesesesesessssensaeaesesssesssesseseaeseseseseenesesesesesssnsasssssneneacaeaeaeseseseeseaeseseaeseseneneaes 1 Ol Winnie us el BR es nei aot era tied iten 1 Metho scscsssssersesesssssescsssssnsncacnesesssssssseseseaescsesssssnsacseaeseseseseesesesesesesesesssneaeaeacaesenesessesesesesesesssneneaeaeacaesessseeseseseaeaese 6 Propagation and Maintenance of Plasmids nnn nanne neen nuneneneneseneenenenenenenenenenensenenenenenenrenenen 6 Generating Stable Flp In Host CALLS A A A A A Ad 8 Generating Stable Flp In Expression Cell Lines estereo erosiones 14 Appendix nesesenonenenesrsvenenenenenenenenenenenensnvenenenenenenenenenenenvenevenenenenenenenenenenenvevevenenenenenenenenenenvenevenenenenenenenenenenenve 20 Recipes andas polos Renbaan 20 LEO UA AAA AAA AAA AAA ee rei 21 Map of pERT lacZeo Vectorial 22 Feat res of pERT lacZeo Vector AAA NS 23 Map of POG44 Vector nana ee A E e a RE aE EE Ear Tee E R SSA 24 Features of pOG44 Vector anssen e
32. ircularized The pOG44 plasmid should be circularized to minimize the possibility of the plasmid integrating into the genome Continued on next page 17 Generating Stable Flp In Expression Cell Lines Continued Note Selection of Stable Flp In Expression Cell Lines Note 18 Your gene of interest will be expressed from pcDNA 5 FRT under the control of the human CMV promoter Once you have generated the Flp In expression cell line note that your recombinant protein should be expressed constitutively Once you have determined the appropriate hygromycin concentration to use for selection in your Flp In host cell line you can generate a stable cell line expressing your pcDNA 5 FRT construct Reminder Following cotransfection your Flp In expression clones should become sensitive to Zeocin see Note on page 14 therefore your selection medium should not contain Zeocin 1 Cotransfect your mammalian Flp In host cells with a 9 1 ratio of pOG44 pcDNA 5 FRT plasmid DNA see previous page using the desired protocol Remember to include a plate with no pOG44 as a Flp recombination control a plate of untransfected cells as a negative control and the pcDNA 5 FRT CAT plasmid as a positive control 2 24 hours after transfection wash the cells and add fresh medium to the cells 3 48 hours after transfection split the cells into fresh medium such that they are no more than 25 confluent If th
33. log no Flp In 293 Human embryonic kidney 1 x 10 cells frozen R750 07 Flp In CV 1 African Green Monkey kidney 1 x 10 cells frozen R752 07 Flp In CHO Chinese Hamster ovary 1 x 10 cells frozen R758 07 Flp In BHK Baby hamster kidney 1 x 10 cells frozen R760 07 Flp In 3T3 Mouse NIH Swiss embryonic 1 x 10 cells frozen R761 07 fibroblast Flp In Jurkat Human T cell leukemia 1 x 10 cells frozen R762 07 viii Overview Introduction System Components Advantages of the Flp In System Introduction TM The Flp In System allows integration and expression of your gene of interest in mammalian cells at a specific genomic location The Flp In System involves introduction of a Flp Recombination Target ERT site into the genome of the mammalian cell line of choice An expression vector containing your gene of interest is then integrated into the genome via Flp recombinase mediated DNA recombination at the FRT site O Gorman et al 1991 TM The major components of the Flp In System include TM e A Flp In target site vector pFRT lacZeo for generation of a host cell line containing an integrated FRT site see pages 22 23 for more information e An expression plasmid containing a FRT site linked to the hygromycin resistance gene for Flp recombinase mediated integration and selection of a stable cell line expressing your gene of interest under the cont
34. n in mammalian cells Before transfection we recommend that you first test the sensitivity of your mammalian host cell to Zeocin as natural resistance varies among cell lines TM e Store Zeocin at 20 C and thaw on ice before use e Zeocin is light sensitive Store drug plates and medium containing drug in the dark e Wear gloves a laboratory coat and safety glasses or goggles when handling solutions containing Zeocin e Zeocin is toxic Do not ingest or inhale solutions containing the drug 21 Map Map of of pFRT lacZeo Vector pFRT lacZeo is a 8106 bp vector that expresses a fusion protein containing pFRT lacZeo B Galactosidase and the Zeocin resistance marker under the control of SV40 22 TM early promoter Note that neither the lacZ gene nor the Zeocin resistance gene contains its native ATG initiation codon The ATG initiation codon is placed directly upstream of a FRT site and allows expression of the lacZ Zeocin fusion gene in cells The figure below summarizes the features of the pFRT lacZeo The complete sequence for pFRT lacZeo is available for downloading from our web site at www invitrogen com or by contacting Technical Support page 26 Comments for pFRT lacZeo 8106 nucleotides SV40 early promoter and origin bases 278 604 ATG initiation codon bases 609 611 FRT site bases 614 661 lacZ Zeocin fusion gene LacZ ORF no ATG bases 675 3722 Zeocin re
35. nd Ed Cold Spring Harbor Laboratory Press Plainview New York Sauer B 1994 Site Specific Recombination Developments and Applications Curr Opin Biotechnol 5 521 527 Senecoff J F Bruckner R C and Cox M M 1985 The FLP Recombinase of the Yeast 2 micron Plasmid Characterization of its Recombination Site Proc Natl Acad Sci USA 82 7270 7274 Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 1999 2008 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 30 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
36. nomic DNA 12 selection you can generate a stable cell line with pFRT lacZeo 1 Transfect mammalian cells with pFRT lacZeo using the desired protocol Remember to include a plate of untransfected cells as a negative control 2 24 hours after transfection wash the cells and add fresh medium to the cells 3 48 hours after transfection split the cells into fresh medium such that they are no more than 25 confluent If the cells are too dense the antibiotic will not kill the cells Antibiotics work best on actively dividing cells 4 Incubate the cells at 37 C for 2 3 hours until they have attached to the culture dish 5 Remove the medium and add fresh medium containing Zeocin at the pre determined concentration required for your cell line 6 Feed the cells with selective medium every 3 4 days until foci can be identified 7 Pick at least 20 Zeocin resistant foci and expand each clone to test for the number of integrated FRT sites Isolate genomic DNA and use Southern blot analysis to distinguish between single and multiple integrants see below and the next page Select the single integrants and proceed to the next step 8 Screen the single integrants for P galactosidase activity see the next page Select those clones which exhibit the highest levels of B galactosidase TM expression if desired to use as your Flp In host cell line s TM 9 Once you have obtained a stable Flp In host cell line you c
37. nopened System for a full refund Otherwise please complete the User Registration Card and return it to Life Technologies Life Technologies grants you a non exclusive license to use the enclosed System for research purposes only The System is being transferred to you in furtherance of and reliance on such license You may not use the System or the materials contained therein for any Commercial Purpose without licenses for such purpose Commercial Purpose includes any use of the System or Expression Products in a Commercial Product any use of the System or Expression Products in the manufacture of a Commercial Product any sale of the System or Expression Products any use of the System or Expression Products to facilitate or advance research or development of a Commercial Product and any use of the System or Expression Products to facilitate or advance any research or development program the results of which will be applied to the development of a Commercial Product Expression Products means products expressed with the System or with the use of any vectors or host strains in the System Commercial Product means any product intended for sale or commercial use Continued on next page 27 Purchaser Notification Continued Limited Label License No 64 Flp In Sys tem continued 28 Access to the System must be limited solely to those officers employees and students of your entity who need access to perform t
38. om we recommend doing a parallel control transfection with no pOG44 present This should yield no surviving clones upon hygromycin selection indicating that all the hygromycin resistant clones obtained in the presence of pOG44 are indeed Flp recombinase dependent and hence have the gene of interest integrated at the FRT site Also a Southern blot analysis of these clones will help verify that they do indeed have proper FRT integration of the gene of interest despite the expression of lacZ although this is usually not necessary As long as you see hygromycin resistant clones 9ost Flp in we recommend you select assay them for expression of your gene of interest Continued on next page Generating Stable Flp In Expression Cell Lines Continued Polyclonal Selection Assay for CAT Protein If you use a single integrant as your Flp In host cell line all of the hygromycin resistant foci that you obtain after cotransfection of p DNA 5 FRT and pOG44 and selection with hygromycin should in theory be isogenic i e pcDNA 5 FRT should integrate into the same genomic locus in every clone therefore all clones should be identical Having isogenic clones should allow you to perform polyclonal selection and screening of your hygromycin resistant cells If you wish you do not need to pick and screen separate foci for expression of your protein of interest After hygromycin selection simply pool the foci and screen the entire
39. pending on the amount of pFRT lacZeo plasmid that you use for transfection you may need to supplement your plasmid DNA with carrier DNA e g salmon sperm DNA To obtain stable transfectants we recommend that you linearize the pFRT lacZeo plasmid before transfection While linearizing the vector may not improve the efficiency of transfection it increases the chances that the vector does not integrate in a way that disrupts the ATG FRT lacZ Zeocin cassette or other elements necessary for expression in mammalian cells The table below lists unique sites that may be used to linearize your construct prior to transfection Other restriction sites are possible Note We generally use Sca I to linearize pFRT lacZeo Enzyme Restriction Location Supplier Site bp Tth111 1 125 Backbone Many Apa I 5617 Backbone Invitrogen Catalog no 15440 019 Swa I 6075 Backbone New England Biolabs Sigma Takara Xmn I 6487 Ampicillin gene Many Sca I 6606 Ampicillin gene Invitrogen Catalog no 15436 017 Bsa 1 7021 Ampicillin gene New England Biolabs Eam1105 I 7087 Ampicillin gene AGS Fermentas Takara Sap 1 8092 Backbone New England Biolabs Angewandte Gentechnologie Systeme Continued on next page 11 Generating Stable Flp In Host Cell Lines Continued Selection of Stable Once you have determined the appropriate Zeocin concentration to use for Integrants Isolation of Ge
40. pg ml hygromycin B 3 Replenish the selective media every 3 4 days and observe the percentage of surviving cells 4 Note the percentage of surviving cells at regular intervals to determine the appropriate concentration of hygromycin that kills the cells within 1 2 weeks after addition of hygromycin TM Because correct integration of your pcDNA 5 FRT construct into the genome is dependent on Flp recombinase the expression levels of Flp recombinase in the cell will determine the efficiency of the recombination reaction Flp recombinase levels must be sufficiently high to mediate recombination at the FRT sites single recombination event and overcome the low intrinsic activity of the enzyme see previous page We have varied the ratio of pOG44 and pcDNA 5 FRT expression plasmid that we cotransfect into mammalian Flp In host cells to optimize the recombination efficiency We recommend that you cotransfect your Flp In host cell line with a ratio of at least 9 1 w w pOG44 pcDNA 5 FRT expression plasmid Note that this ratio may vary depending on the nature of the cell line You may want to determine this ratio empirically for your cell line TM When transfecting your Flp In host cell line be sure to use supercoiled pOG44 and pcDNA 5 FRT plasmid DNA Flp mediated recombination between the FRT site on pcCDNA 5 FRT and the integrated FRT site in the Flp In host cell line will only occur if the p DNA 5 FRT plasmid is c
41. pofectamine 2000 Transfection Reagent 15 ml 11668 500 1 5 ml 11668 019 imMedia Amp Agar 20 pouches 0601 20 The amount supplied is sufficient to perform 25 Western blots using 10 ml working solution per reaction PP P 8 8 P Continued on next page vii Accessory Products Continued Flp In Additional Flp In expression vectors are available from Invitrogen For more Expression information about the features of each vector refer to our web site at Vectors www invitrogen com or contact Technical Support page 26 Product Amount Catalog no pcDNA 5 FRT V5 His 1 kit K6020 01 TOPO TA Expression Kit pSecTag FRT V5 His 1 kit K6025 01 TOPO TA Expression Kit pEF5 FRT V5 Directional 1 kit K6035 01 TOPO Expression Kit pEF5 FRT V5 DEST 6 ug supplied as 40 ul of 150ng ul vector V6020 20 Gateway Vector Pack in 10 mM Tris HCl 1 mM EDTA pH8 0 Flp In Host Cell For your convenience Invitrogen has available several mammalian Flp In host Lines cell lines that stably express the lacZ Zeocin fusion gene from pFRT lacZeo or pFRT lacZeo2 Each cell line contains a single integrated FRT site as confirmed by Southern blot analysis The cell lines should be maintained in medium containing Zeocin For more information visit our web site at www invitrogen com or contact Technical Support see page 26 Cell Line Source Amount Cata
42. population of cells for expression of your protein of interest The CAT protein expressed from the peDNA 5 FRT CAT control plasmid is approximately 32 kDa in size You may assay for CAT expression using your method of choice For Western blot analysis you may use CAT Antiserum available from Invitrogen for detection see page vii for ordering information Other commercial kits are available for assaying CAT expression 19 Recipes LB Luria Bertani Medium and Plates Phosphate Buffered Saline PBS 20 Appendix Composition 10 g Tryptone 5 g Yeast Extract 10 g NaCl pH 7 0 1 Combine the dry reagents above and add deionized distilled water to 950 ml 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes at 15 psi Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes at 15 psi 3 After autoclaving cool to 55 C add antibiotic i e 50 100 ug ml ampicillin and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 137 mM NaCl 2 7 mM KCl 10 mM Na HPO 1 8 mM KH gt PO 1 Dissolve the following in 800 ml of deionized water 8 g NaCl 0 2 g KCl 1 44 g NaHPO 0 24 g KH2PO Adjust pH to 7 4 with concentrated H
43. press your protein of interest Cotransfection of pOG44 and pcDNA 5 FRT allows expression of Flp recombinase and integration of the pcDNA 5 EFRT plasmid into the genome via the FRT sites Once the pcDNA 5 FRT construct has integrated into the genome the Flp recombinase is no longer required In fact the continued presence of Flp recombinase would be detrimental to the cells because it could TM mediate excision of your pcDNA 5 FRT construct The pOG44 plasmid lacks an antibiotic resistance marker for selection in mammalian cells Thus the plasmid and therefore Flp recombinase expression will gradually be lost from transfected cells as they are cultured and selected in hygromycin The FLP gene was originally isolated from the Saccharomyces cerevisiae 2 plasmid Broach et al 1982 Broach Hicks 1980 see the Appendix page 25 for more information When tested in mammalian cells the Flp recombinase has been shown to possess optimum recombination activity near 30 C and relatively low activity at 37 C a result consistent with its physiological role in yeast Buchholz et al 1996 The FLP gene in pOG44 is further limited in its activity because it contains a point mutation that encodes a Flp recombinase with a phenylalanine to leucine amino acid substitution at position 70 Buchholz et al 1996 The resulting Flp recombinase flp F70L exhibits increased thermolability at 37 C in mammalian cells when compared to the n
44. r Sequence pMoles Supplied CMV Forward Primer 21 mer 5 CGCAAATGGGCGGTAGGCGTG 3 306 BGH Reverse Primer 18 mer 5 TAGAAGGCACAGTCGAGG 3 358 vi Accessory Products Additional The products listed in this section are intended for use with he Flp In Systems Products For more information refer to our web site at www invitrogen com or contact Technical Support page 26 Product Amount Catalog no pFRT lacZeo 20 ug supplied as 40 ul of 0 5 pg pl vector V6015 20 in 10 mM Tris HCl 1 mM EDTA pH 8 0 pFRT lacZeo2 20 ug supplied as 40 ul of 0 5 ug ul vector V6022 20 in 10 mM Tris HCI 1 mM EDTA pH 8 0 pOG44 20 ug supplied as 40 ul of 0 5 ug ul vector V6005 20 in 10 mM Tris HCI 1 mM EDTA pH 8 0 T7 Promoter Primer 2 ug lyophilized N560 02 One Shot Kit 10 reactions C4040 10 TOP10 Chemically Competent Cells 20 reactions C4040 03 40 reactions C4040 06 One Shot Kit 10 reactions C4040 50 TOP10 Electrocompetent Cells 20 reactions C4040 52 S N A P Miniprep Kit 100 reactions K1900 01 PureLink HiPure Plasmid Miniprep Kit 100 preps K2100 03 PureLink HiPure Plasmid Midiprep Kit 15 200 reactions K2100 04 Easy DNA Kit K1800 01 Zeocin lg R250 01 58 R250 05 Hygromycin B 1g R220 05 B Gal Assay Kit 100 reactions K1455 01 B Gal Staining Kit 1 kit K1465 01 CAT Antiserum 50 ul R902 25 Calcium Phosphate Transfection Kit 75 reactions K2780 01 Li
45. ragment which contains sequences derived from the adenovirus major late region and an IgG variable region Huang amp Gorman 1990 O Gorman et al 1991 and functions to enhance expression of the FLP gene FLP ORF Encodes a temperature sensitive Flp recombinase Buchholz et al 1996 that mediates conservative recombination via FRT sites O Gorman et al 1991 SV40 late polyadenylation signal Permits efficient transcription termination and polyadenylation of mRNA pUC origin Permits high copy number replication and growth in E coli bla promoter Allows expression of the ampicillin bla resistance gene Ampicillin bla resistance gene Allows selection of transformants in E coli P lactamase FLP Gene The FLP gene was originally isolated from the Saccharomyces cerevisiae 2 plasmid Broach et al 1982 Broach amp Hicks 1980 and encodes a site specific recombinase that is a member of the integrase family of recombinases Argos et al 1986 The Flp recombinase mediates a site specific recombination reaction between interacting DNA molecules via the pairing of interacting FRT sites For more information about site specific recombination refer to page 4 and published reviews Craig 1988 Sauer 1994 The native FLP gene encodes a protein of 423 amino acids with a calculated molecular weight of 49 kDa The FLP gene expressed from pOG44 encodes a temperature sensitive Flp recombinase which
46. rol of the human cytomegalovirus CMV immediate early enhancer promoter e A Flp recombinase expression plasmid pOG44 for expression of the Flp recombinase under the control of the human CMV promoter see pages 24 25 for further information e A control expression plasmid containing the chloramphenicol acetyl transferase CAT gene which when cotransfected with pOG44 into your Flp TM In host cell line expresses CAT For specific information on the expression vector and the corresponding positive TM control vector containing the CAT gene refer to the pcDNA 5 FRT vector manual TM Use of the Flp In System to generate stable expression cell lines provides a number of advantages as described below e Once the Flp In host cell line containing an integrated FRT site has been created subsequent generation of Flp In cell lines expressing the gene s of interest is rapid and efficient TM e The Flp In System allows the generation of isogenic stable cell lines TM e The Flp In System permits polyclonal selection of stable expression cell lines Continued on next page Overview Continued Description of the Flp In System The Flp In System streamlines the generation of stable mammalian expression cell lines by taking advantage of a Saccharomyces cerevisine derived DNA recombination system This DNA recombination system uses a recombinase Flp and site specific recombination Craig 19
47. s as a binding site for Flp recombinase and has been well characterized Gronostajski amp Sadowski 1985 Jayaram 1985 Sauer 1994 Senecoff et al 1985 The minimal FRT site consists of a 34 bp sequence containing two 13 bp imperfect inverted repeats separated by an 8 bp spacer that includes an Xba I restriction site see figure below An additional 13 bp repeat is found in most FRT sites but is not required for cleavage Andrews et al 1985 While Flp recombinase binds to all three of the 13 bp repeats strand cleavage actually occurs at the boundaries of the 8 bp spacer region see figure below for cleavage sites CS Andrews et al 1985 Senecoff et al 1985 Minimal FRT site CS 5 GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAAC TTC EN Xba CS CS cleavage site Continued on next page Overview Continued Experimental Outline To create a stable Flp In cell line expressing your gene of interest at a site specific genomic locus you will perform the following steps 1 Transfect the Flp In target site vector pFRT lacZeo into the mammalian cell line of choice to generate your Flp In host cell line s see figure below Clone your gene of interest into the pcDNA 5 FRT expression vector Co transfect your pcDNA 5 FRT construct and the Flp recombinase expression vector pOG44 into your Flp In host cell line to generate your TM Flp In expression cell line see figure below 4 A
48. sistance gene no ATG bases 3810 4181 SV40 early polyadenylation signal bases 5102 5425 bla promoter bases 6201 6299 Ampicillin bla resistance gene bases 6300 7160 pUC origin bases 7305 7978 Continued on next page Features of pFRT lacZeo Vector Features of pFRT lacZeo The table below describes the relevant features of pFRT lacZeo All features have been functionally tested Feature Benefit SV40 early promoter and origin Permits efficient high level expression of the lacZ Zeocin fusion gene in mammalian cells and episomal replication in cells expressing the SV40 large T antigen ATG initiation codon Allows translation initiation of the lacZ Zeocin fusion protein Flp Recombination Target FRT site Encodes a 34 bp 14 bp non essential sequence that serves as the binding and cleavage site for Flp recombinase Gronostajski amp Sadowski 1985 Jayaram 1985 Senecoff et al 1985 TM lacZ Zeocin fusion gene Encodes a fusion protein containing B Galactosidase and the Zeocin resistance marker to permit selection of stable mammalian cell lines with Zeocin and screening by P galactosidase activity assay SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA bla promoter Allows expression of the ampicillin bla resistance gene Ampicillin bla resistance gene P lactamase Allows selection o
49. ssay for expression of your recombinant protein of interest Note The positive control vector containing the CAT gene can be cotransfected into your Flp In host cell line with pOG44 to demonstrate that the system is working properly 1 Transfect pFRT lacZeo into the mammalian cell line of interest to generate the Flp In Host Cell Line Select cells that exhibit Zeocin resistance and P galactosidase activity Psvao Amp pUC ori EEE Fip In Host Cell Line Gene of Interest Se Gene of Interest 2 Ligate the gene of interest into the pcDNAS FRT peDNAS FRT expression vector Expression Vector 3 Cotransfect the expression vector and pOG44 into the Flp In Host Cell Line Select for hygromycin resistant cells Psvao Pcmv BGH pA ATG DS Hygromycin Gene of Interest PETIT y Flp In We Expression Cell Line 4 Assay for expressed protein Methods Propagation and Maintenance of Plasmids Introduction General Molecular Biology Techniques E coli Strain Transformation Method The following section contains guidelines for maintaining and propagating the pFRT lacZeo and pOG44 vectors For information about maintaining and TM propagating the pcDNA 5 FRT expression vector refer to the vector manual For assistance with E coli transformations restriction enzyme analysis DNA biochemistry and plasmid preparation refer to Molecular Cloning A Laboratory Manual
50. tion of Tolypocladium geodes Conidiospores to Phleomycin Resistance Curr Genet 20 309 314 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Craig N L 1988 The Mechanism of Conservative Site Specific Recombination Ann Rev Genet 22 77 105 Drocourt D Calmels T P G Reynes J P Baron M and Tiraby G 1990 Cassettes of the Streptoalloteichus hindustanus ble Gene for Transformation of Lower and Higher Eukaryotes to Phleomycin Resistance Nucleic Acids Res 18 4009 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L a and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Gritz L and Davies J 1983 Plasmid Encoded Hygromycin B Resistance The Sequence of Hygromycin B Phosphotransferase Gene and its Expression in E coli and S Cerevisiae Gene 25 179 188 Gronostajski R M and Sadowski P D 1985 Determination of DNA Sequences Essential for FLP mediated Recombination by a Novel Method J Biol Chem 260 12320 12327 Huang M T F and Gorman C M 1990 Intervening Sequences Increase Efficiency of RNA 3 Processing and Accumulation of Cytoplasmic RNA Nuc Ac
51. y Southern blot analysis to identify single integrants To increase the chances of obtaining single integrants we recommend you pick foci from plates that have been transfected with the least amount of plasmid DNA Chromosomal position effects Because integration of the pFRT lacZeo plasmid into the genome occurs randomly expression levels of the lacZ Zeocin fusion gene will be dependent on the transcriptional activity of the surrounding sequences at the integration site i e chromosomal position effect Once you have obtained single integrants you may want to screen the Zeocin resistant clones for those expressing the highest B galactosidase levels Those clones expressing the highest levels of P galactosidase should contain single FRT sites which have integrated into the most transcriptionally active regions Antibiotic concentration Single integrants will express only a single copy of the lacZ Zeocin fusion gene and therefore may be more sensitive to Zeocin selection than multiple integrants If you have previously used your mammalian cell line for transfection and Zeocin selection you may need to TM use lower concentrations of Zeocin to obtain single integrants Continued on next page Generating Stable Flp In Host Cell Lines Continued Note NN MENS 7 bas a Possible Sites for Linearization of pFRT acZeo If you want to increase the expression levels of your gene of interest in the
Download Pdf Manuals
Related Search