Home

Affy Technical Manual

1. 2 1 41 Step 2 Second Strand cDNA Synthesis 2 1 43 701025 Rev 5 2 1 3 SECTION 2 Eukaryotic Sample and Array Processing Alternative Protocol for One Cycle cDNA Synthesis from Purified Poly A mRNA 2 1 44 Step 1 First Strand cDNA Synthesis 2 1 44 Step 2 Second Strand cDNA Synthesis 2 2 Connor This Chapter Contains z Complete One Cycle Target Labeling Assay with 1 to 15 ug of total RNA or 0 2 to 2 ug of poly A mRNA z Complete Two Cycle Target Labeling Assay with 10 to 100 ng of total RNA CHAPTER 1 Eukaryotic Target Preparation Introduction AFFYMETRIX This chapter describes the assay procedures recommended for eukaryotic target labeling in expression analysis using GeneChip brand probe arrays Following the protocols and using high quality starting materials a sufficient amount of biotin labeled cRNA target can be obtained for hybridization to at least two arrays in parallel The reagents and protocols have been developed and optimized specifically for use with the GeneChip system Depending on the amount of starting material two procedures are described in detail in this manual Use the following table to select the most appropriate labeling protocol for your samples Total RNA as Starting Material mRNA as Starting Material Protocol 1 g 15 g 0 2 ug 2 ug One Cycle Target Labeling 10 ng 100 ng N A Two Cycle Target La
2. 5 B 8 SECTION 5 Appendices Can results from different laboratories and different times be compared with each other directly and how do you control the variables in this type of experiment Array results can potentially be compared directly However it is important to check the following important elements before doing so 1 Experimental design strategy should be the same at various sites 2 Identical target labeling protocols should be followed and yields from cDNA and IVT reactions should be within the same range as specified for that study 3 Scanners are adjusted to the same PMT setting 4 Same algorithm parameters are used 5 Similar results from 3 5 ratios background noise and scaling factors Check arrays for scratches and even hybridization staining 6 Comparability of results obtained from different operators should be evaluated before including their results in the same study Affymetrix Microarray Suite MAS is on the C drive which is low on space How can I create more room on the hard drive The library and data files can be moved to another drive then deleted from the C drive After moving the files remember to change your library file default settings in MAS to the appropriate directory by clicking on the Tools tab and then select Defaults in the drop down menu then File locations tab in the Defaults window What is the difference between scaling and normalization when I scale or norm
3. EDTA Disodium Salt 0 5 M solution 100 mL Sigma Aldrich P N E7889 EDTA 0 5 M pH 8 0 Invitrogen Life Technologies P N 15575 020 Enzo BioArray HighYield RNA Transcript Labeling Kit Affymetrix P N 900182 Ethidium Bromide Sigma Aldrich P N E8751 Expression Control Clones American Type Culture Collection ATCC pGIKS bioB pGIKS bioC pGIKS bioD pGIKS cre pGIBS lys pGIBS phe AFFYMETRIX ATCC 87487 ATCC 87488 ATCC 87489 ATCC 87490 ATCC 87482 ATCC 87483 5 A 9 Appendices 5 A 10 SECTION 5 Appendices pGIBS thr ATCC 87484 pGIBS trp ATCC 87485 pGIBS dap ATCC 87486 G GeneChip Eukaryotic Hybridization Control Kit Affymetrix P N 900299 Glycogen Ambion P N 9510 Glycogen 20 mg mL Roche Molecular Biochemical P N 901393 Goat IgG Reagent Grade Sigma Aldrich P N 15256 H HCI IN solution VWR Scientific Products P N MK638860 Herring Sperm DNA Promega Corporation P N D1811 Hybridization Oven 640 Affymetrix P N 800139 I ImmunoPure NeutrAvidin Pierce Chemical P N 31000 ImmunoPure Streptavidin Pierce Chemical P N 21125 L 10 bp and 100 bp ladder Invitrogen Life Technologies P N 10821 015 and15628 019 respectively M Magnesium acetate MgOAc Sigma Aldrich P N M2545 MasterPure RNA Purification Kit Epicentre Technologies P N MCR85102 MEGAscript T3 Kit Ambion P N 1338 MEGAscript T7 Kit Ambion P N 1334 MES Free Acid Monohydrate SigmaUltra Sigma Aldrich P N M5
4. You should always use the recommended quantity of cRNA described in this manual Please refer to Table 2 3 1 for detailed instructions on the amount of cRNA needed for different array formats Although there is a tolerance for some variation in guantity we have found that hybridization of significantly less cRNA results in reduced sensitivity particularly for low copy transcripts How long can I store my eukaryotic cRNA target after its first hybridization Assuming no RNase contamination cRNA targets can be stored for at least one year at 80 C without significant loss of signal intensity The fact that the cRNA is fragmented prior to hybridization reduces the effects of any subsequent degradation What parameters should I use to QC my GeneChip probe array data Quality assessments are critical in obtaining highly reproducible GeneChip probe array results QC procedures should be performed at various key checkpoints 1 RNA sample quality As described in this manual the quality of starting RNA is very important Ratio of 260 280 absorbance values as well as appearance of samples by gel electrophoresis are suggested methods to detect any degradation of your RNA samples 2 Target labeling Various QC protocols described in this manual can be employed at different stopping points of the assay For example gel electrophoresis after cDNA synthesis if using poly A mRNA as starting material after CRNA synthesis and after fragmen
5. Phase Lock Gels form an inert sealed barrier between the aqueous and organic phases of phenol chloroform extractions The solid barrier allows more complete recovery of the sample aqueous phase and minimizes interface contamination of the sample PLG s are sold as pre measured aliquots in 1 5 mL tubes to which sample and phenol chloroform are directly added AFFYMETRIX s Pellet the Phase Lock Gel 1 5 mL tube with PLG I heavy in a microcentrifuge at 2 12 000 x g for 20 seconds Dilute the linearized plasmid to final volume of 150 uL with TE and add equal volume of 25 24 1 Phenol chloroform isoamyl alcohol saturated with 10 uM tris HCI pH 8 01 1 mM EDTA Vortex Transfer the mix to the PLG tube and microcentrifuge at 2 12 000 x g for 2 minutes Transfer the top aqueous phase to a new 1 5 mL tube Add 0 1 volumes 15 uL of 3M NaOAc and 2 5 volumes 375 uL of absolute ethanol to the samples Vortex Immediately centrifuge at 2 12 000 x g in a microcentrifuge at room temperature for 20 minutes Carefully remove supernatant Wash pellet with 0 5 mL of 80 ethanol then centrifuge at 2 12 000 x g at room temperature for 5 minutes 3 21 Prokaryotic 3 2 8 SECTION 3 Prokaryotic Sample and Array Processing 9 Remove the supernatant very carefully and air dry the pellet 10 Resuspend DNA pellet in 15 uL of RNase free water 11 Quantify the DNA by absorbance at 260 nm 50 ug mL of DNA for 1 absorbance unit
6. 5 716 785 5 891 636 6 291 170 and 5 545 522 or to purchase another licensed kit AFFYMETRIX 2 1 19 Eukaryotic 2 1 20 SECTION 2 Eukaryotic Sample and Array Processing Recommend 1200 gt T 2 800 o 2 amp 400 oa 0 T T T T T T 1 50 000 1 16 667 1 10 000 1 7 142 1 25 000 1 12 500 1 8 333 Relative Ratio Figure 2 14 Poly A RNA spikes amplified using a complex human J urkat total RNA sample Evaluation was performed using MAS 5 0 software The Poly A RNA Control Stock and Poly A Control Dil Buffer are provided with the kit to prepare the appropriate serial dilutions based on Table 2 1 8 This is a guideline when 10 50 or 100 ng of total RNA is used as starting material For other intermediate starting sample amounts calculations are needed in order to perform the appropriate dilutions to arrive at the same proportionate final concentration of the spike in controls in the samples m The dilution scheme outlined below is different from the previous protocol developed for the Small Sample Target Labeling vil Closely adhere to the recommendation below to obtain the desired final concentrations of the controls m Use non stick RNase free microfuge tubes to prepare the dilutions Table 2 18 Serial Dilutions of Poly A RNA Control Stock Starting Serial Dilutions Volume to Add Amount of A into 50 uM T7 Total RNA Second Third Fourth Oligo dT Primer 10 ng 1 20 1 50
7. C to 8 C and shield from light 2X Stain Buffer final 1X concentration 100 mM MES 1M Nat 0 05 Tween 20 For 250 mL 41 7 mL 12X MES Stock Buffer see Section 3 Chapter 3 92 5 mL 5M NaCl 2 5 mL 10 Tween 20 113 3 mL water Filter through a 0 2 um filter Store at 2 C to 8 C and shield from light 10 mg mL Goat IgG Stock Resuspend 50 mg in 5 mL 150 mM NaCl Store at 4 C 1 mg mL Streptavidin Stock Resuspend 5 mg in 5 mL of PBS Store at 4 C CHAPTER 4 Prokaryotic Arrays Washing Staining and Scanning Experiment and Fluidics Station Setup Step 1 Defining File Locations Before working with Affymetrix Microarray Suite it is important to define where the program stores and looks for files Launch Microarray Suite from the workstation and select Tools Defaults File Locations from the menu bar The File Locations window displays the locations of the following files z Probe Information library files mask files z Fluidics Protocols fluidics station scripts z Experiment Data exp dat cel and chp files are all saved to location selected here Verify that all three file locations are set correctly and click OK Contact Affymetrix Technical Support if you have any questions regarding this procedure Step 2 Entering Experiment Information AFFYMETRIX To wash stain and scan a probe array an experiment must first be defined in Microarray Suite Select Run Experiment Inf
8. Centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube and immediately place the tubes at 42 C Incubate for 1 hour at 42 C Heat the sample at 70 C for 10 minutes to inactivate the RT enzyme then cool the sample for at least 2 minutes at 4 C After the 2 minute incubation at 4 C centrifuge the tube briefly 5 seconds to collect the reaction at the bottom of the tube and immediately proceed to Step 3 First Cycle Second Strand cDNA Synthesis on page 2 1 24 Cooling the sample at 4 C is required before proceeding to the next step Adding the First Cycle Second Strand Master Mix directly to solutions that are at 70 C will compromise enzyme activity 2 1 23 Eukaryotic 2 1 24 SECTION 2 Eukaryotic Sample and Array Processing Step 3 First Cycle Second Strand cDNA Synthesis Recommenda Two Cycle cDNA Synthesis Kit is used for this step The following program can be used as a reference to perform the First cycle Second strand cDNA synthesis reaction in a thermal cycler For the 16 C incubation turn the heated lid function off If the heated lid function cannot be turned off leave the lid open Use the heated lid for the 75 C incubation 16 C 2 hours 75 C 10 minutes 4 C hold In a separate tube assemble the First Cycle Second Strand Master Mix It is recommended to prepare this First Cycle Second Strand Master Mix immediately before use Prepare this First Cycle Second
9. If probe array was stored at 4 C warm to room temperature before scanning Refer to the Microarray Suite or GCOS online help and the appropriate scanner user s manual for more information on scanning The scanner uses a laser and is equipped with a safety interlock system Defeating the interlock system may result in exposure to hazardous laser light You must have read and be familiar with the operation of the scanner before attempting to scan a probe array Please refer to the Microarray Suite User s Guide P N 08 0081 or to the GeneChip Scanner 3000 quick reference card P N 08 0075 Handling the GeneChip Probe Array IMPORI AFFYMETRIX Before you scan the probe array follow the directions in this section on handling the probe array If necessary clean the glass surface of the probe array with a non abrasive towel or tissue before scanning Do not use alcohol to clean glass Before scanning the probe array cartridge apply Tough Spots to each of the two septa on the probe array cartridge to prevent the leaking of fluids from the cartridge during scanning Apply the spots just before scanning Do not use them in the hyb process 1 On the back of the probe array cartridge clean excess fluid from around septa 2 Carefully apply one Tough Spots to each of the two septa Press to ensure that the spots remain flat If the Tough Spots do not apply smoothly that is if you observe bumps bubbles tears or cur
10. Inthe Edit Protocol dialog box under Protocol Name click the arrow to open a list of protocols Click the protocol to be changed The name of the protocol is displayed in the Protocol Name text box The conditions for that protocol are displayed on the right side of the Edit Protocol dialog box 3 Select the item to be changed and input the new parameters as needed keeping parameters within the ranges shown below in Table 3 4 8 Table 3 4 8 Valid Ranges for Wash Stain Parameters Parameter Valid Range Wash Temperature for Al B A2 orA3 C 15 to 50 Number of Wash Cycles for Al B A2 or A3 0 to 99 Mixes Wash Cycle for A1 B A2 or A3 15 to 50 Stain Time seconds 0 to 86 399 Stain Temperature C 15 to 50 Holding Temperature C 15 to 50 CAUTI Wash Al corresponds to Post Hyb Wash 1 in Table 3 4 6 Wash B corresponds to Post Hyb Wash 2 in Table 3 4 6 Wash A2 corresponds to Post Stain Wash in Table 3 4 6 Wash A3 corresponds to Final Wash in Table 3 4 6 To return to the default values for the protocol selected click the Defaults button Once all the protocol conditions are modified as desired change the name of the edited protocol in the Protocol Name box If the protocol is saved without entering a new Protocol Name the original protocol parameters will be overwritten Click Save then close the dialog box Enter 0 zero for hybridization time if hybridization step is not requ
11. follows using a non stick RNase free microfuge tube The following recipe is sufficient for 10 samples Table 2 L9 Preparation of T7 Oligo dT Primer Poly A Controls Mix Component Volume T7 Oligo dT Primer 50 uM 2 uL Diluted Poly A RNA controls See Table 2 18 2 uL RNase free Water 16 uL Total Volume 20 pL AFFYMETRIX 2 1 21 Eukaryotic 2 1 22 SECTION 2 Eukaryotic Sample and Array Processing Step 2 First Cycle First Strand cDNA Synthesis Two Cycle cDNA Synthesis Kit is used for this step 1 Briefly spin down all tubes in the Kit before using the reagents 2 Perform all of the incubations in thermal cyclers The following program can be used as a reference to perform the First Cycle First Strand cDNA synthesis reaction in a thermal cycler the 4 C holds are for reagent addition steps 70 C 6 minutes 4 C hold 42 C 1 hour 70 C 10 minutes 4 C hold 1 Mix total RNA sample and the T7 Oligo dT Primer Poly A Controls Mix Table 2 110 Preparation of Total RNA Sample T7 Oligo dT Primer Poly A Controls Mix Component Volume Total RNA sample variable 10 100 ng T7 Oligo dT Primer Poly A Controls Mix 2 UL RNase free Water variable Total Volume 5pL a Place total RNA sample 10 to 100 ng in a 0 2 mL PCR tube b Add 2 uL of the T7 Oligo dT Primer Poly A Controls Mix See Step 1 Preparation of Poly A RNA Controls for Two Cycle cDNA Synthesis Spike in Controls on pag
12. with three wash lines of the fluidics station in distilled water 8 Run the Prime protocol Fluidics Station 400 or the Prime 450 protocol Fluidics Station 450 with wash lines in distilled water instead of wash buffers A and B 9 Run the Shutdown protocol Fluidics Station 400 or the Shutdown_450 protocol Fluidics Station 450 with wash lines in distilled water 10 Run the Prime protocol Fluidics Station 400 or the Prime_450 protocol Fluidics Station 450 with wash lines in distilled water instead of wash buffers A and B 11 Run the Shutdown protocol Fluidics Station 400 or the Shutdown_450 protocol Fluidics Station 450 with distilled water At the end of each step the fluidics station will indicate a ready status The fluidics station should not be used until this entire procedure steps 1 11 is complete Section 5 Appendices 701042 Rev 2 ag sa Contents Section 5 Appendices Appendix A Supplier and Reagent Reference List 5 A 3 Appendix B FAOs amp Troubleshooting 5 B 3 Appendix C List of Controls on GeneChip Probe Arrays 5 C 3 Appendices 701042 Rev 2 701043 Rev 3 Section 5 Appendix A Supplier and Reagent Reference List Affymetrix Technical Support o bilo de be D ga dar Os 5 A 4 Supplier Contact Information u 2 04 ere Be o o be 5 A 5 Reagents and Materials Quick List 5 A 7 Racet Liste cane dob 4 8S SOR
13. 44 0 1189 795 234 Belgium 32 8 732 1611 Brinkmann Instruments www brinkmann com 800 421 9988 see web site for nearest distributor Cambrex www cambrex com 800 341 1574 see web site for nearest distributor Cole Parmer www coleparmer com 800 323 4340 44 0 1815 747 556 33 0 3 88 67 14 14 49 0 785 17069 CLONTECH www clontech com 800 662 CLON 44 0 1256 476 500 33 0 1 34 60 24 24 49 0 622 134170 Epicentre Technologies www epicentre com 800 284 8474 44 0 1223 366 500 33 0 1 30 46 39 00 49 0 515 29020 Eppendorf 5 Prime www 5prime com 800 533 5703 303 440 3705 Invitrogen Life Technologies www invitrogen com 800 955 6288 00 800 5345 5345 Toll free for Europe Millipore Corp www millipore com 800 645 5476 44 0 1923 816 375 33 0 1 30 12 70 00 49 0 619 64940 Molecular Probes www probes com 541 465 8300 44 0 1223 316 855 33 0 4 70 03 88 55 49 0 551 371062 New England Biolabs www neb com 800 632 5227 44 0 800 318 846 33 0 1 34 60 24 24 49 0 800 2465 227 Novagen www novagen com 800 207 0144 44 0 800 622 935 33 0 1 30 46 39 00 49 0 800 6931 000 Operon Technologies oligos giagen com 800 688 2248 00800 67 673377 Pierce Chemical www piercenet com 800 874 3723 44 0 1244 382 525 33 0 4 70 03 88 55 49
14. 5 0 2 5 0 0 Fluorescence 34 33 si Time seconds Figure 2 L7 Fragmented cRNA Bioanalyzer electropherogram for fragmented labeled cRNA from HeLa total RNA This ss si ss 73 electropherogram displays the nucleotide size distribution for 150 ng of fragmented labeled cRNA resulting from one round of amplification The average size is approximately 100 nt CHAPTER 1 Eukaryotic Target Preparation Alternative Protocol for One Cycle cDNA Synthesis from Total RNA This protocol is a supplement to instructions provided in the Invitrogen Life Technologies SuperScript Choice system Please note the following before proceeding m Read all information and instructions that come with reagents and kits z Use the GeneChip T7 Oligo dT Promoter Primer Kit for priming first strand cDNA synthesis in place of the oligo dT or random primers provided with the SuperScript Choice kit The GeneChip T7 Oligo dT Promoter Primer Kit provides high quality HPLC purified T7 Oligo dT Primer which is essential for this reaction T7 Oligo dT Primer 5 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG dT gt 4 3 Step 1 First Strand cDNA Synthesis Starting material High quality total RNA 5 0 ug 20 0 ug v4 Note For smaller amounts of starting material please refer to the alternative protocol for i target labeling described in Small Sample Target Labeling Assay Version ll available at www affymetrix co
15. Eukaryotic Poly A RNA Control Kit Affymetrix P N 900433 Two Cycle cDNA Synthesis a GeneChip Expression 3 Amplification Reagents Two Cycle cDNA Synthesis Kit 30 reactions Affymetrix P N 900432 z GeneChip Eukaryotic Poly A RNA Control Kit Affymetrix P N 900433 z MEGAscript High Yield Transcription Kit Ambion Inc P N 1334 Cleanup of Double Stranded cDNA m GeneChip Sample Cleanup Module 30 eukaryotic reactions Affymetrix P N 900371 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Synthesis of Biotin Labeled cRNA GeneChip Expression 3 Amplification Reagents for IVT Labeling 30 reactions Affymetnx P N 900449 IVT cRNA Cleanup and Quantification z GeneChip Sample Cleanup Module Affymetrix P N 900371 z 10X TBE Cambrex P N 50843 cRNA Fragmentation z GeneChip Sample Cleanup Module Affymetrix P N 900371 Miscellaneous Reagents Absolute ethanol stored at 20 C for RNA precipitation store ethanol at room temperature for use with the GeneChip Sample Cleanup Module 80 ethanol Stored at 20 C for RNA precipitation store ethanol at room temperature for use with the GeneChip Sample Cleanup Module SYBR Green II Cambrex P N 50523 or Molecular Probes P N S7586 optional Pellet Paint Novagen P N 69049 3 optional Glycogen Ambion P N 9510 optional 3M Sodium Acetate NaOAc Sigma Aldrich P N S7899 Ethidium Bromide Sigma Aldrich P N E8751 1N NaOH 1N HCl Miscell
16. New England BioLabs P N R0189S m Phase Lock Gel Brinkmann Instruments P N 955 15 415 z Phenol chloroform isoamyl alcohol Ambion P N 9732 z MEGAscript T3 Kit Ambion P N 1338 Miscellaneous Reagents m NaAcetate NaOAc 3M z Absolute Ethanol z 80 Ethanol z RNeasy Mini Kit QIAGEN P N 74104 a TE 1X BioWhittaker Molecular Applications Cambrex P N 16 013B 3 2 5 Prokaryotic CHAPTER 2 Preparation of Control Spike In Transcripts Bacterial Plasmid DNA Preparation Grow E coli bacterial cultures containing recombinant plasmids according to established protocols a minimum 50 mL of culture volume is recommended Prepare plasmid DNA from overnight cultures using standard procedures or commercial kits We have obtained reliable results using QIAGEN Plasmid Kits for plasmid DNA isolation Linearization of Plasmid DNA Preparation In a 50 uL reaction volume digest 10 ug of plasmid with the restriction enzyme Not I according to the enzyme manufacturer s recommendations Analyze 50 ng of the uncut and linearized plasmid by gel electrophoresis on a 1 agarose gel Complete digestion of the plasmid is required for IVT Repeat restriction enzyme digestion if necessary Purification of Linearized Plasmid DNA Purify the linearized plasmid from restriction enzymes and potential RNase contaminants before proceeding to IVT using the following Phase Lock Gel PLG phenol chloroform extraction procedure
17. P N 2696 Nuclease free Water Ambion P N 9930 z NaOH IN solution VWR Scientific Products P N MK469360 z HCl 1N solution VWR Scientific Products P N MK638860 z QlAquick PCR Purification Kit QIAGEN P N 28104 m 10X One PhorAll Buffer Amersham Pharmacia Biotech P N 27 0901 02 Deoxyribonuclease DNase I Amersham Pharmacia Biotech P N 27 0514 01 z Enzo BioArray Terminal Labeling Kit Affymetrix P N 900181 EDTA 0 5M pH 8 0 Invitrogen Life Technologies P N 15575 020 Gel Shift Assay z Novex XCell SureLock Mini Cell Invitrogen Life Technologies P N El0001 z 4 20 TBE Gel LO mm 12 well Invitrogen Life Technologies P N EC62252 z Sucrose Gel Loading Dye 5X Amresco P N E 274 10X TBE Running Buffer z SYBR Gold Molecular Probes P N S 11494 z 10 bp and 100 bp DNA ladder Invitrogen Life Technologies P N 10821 015 and 15628 019 respectively z ImmunoPure NeutrAvidin Pierce Chemical P N 31000 z 1M Tris pH 70 Ambion P N 9850G z PBS pH 72 Invitrogen Life Technologies P N 20012 027 AFFYMETRIX NE 3 1 5 Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing Reagent Preparation 10 mM dNTP mix For 1000 uL 100 uL 100 mM dATP 100 uL 100 mM dCTP 100 uL 100 mM dGTP 100 uL 100 mM dTTP 600 uL Nuclease free H O Store at 20 C in a non frost free freezer 75 ng uL Random Primers For 1000 uL 25 uL 3 ug uL Random Primers 975 uL Nuclease free H O Store at 20 C in
18. RNA using the One Cycle Kit This electropherogram displays the nucleotide size distribution for 400 ng of labeled cRNA resulting from one round of amplification The average size is approximately 1580 nt 35 30 j 25 g 5 20 o j t D G 15 IL 10 5 7 in ON 0 s Ls Baan EEE iiei aala a PEA EEIE E i kor Bl 29 34 39 u 49 si 59 54 69 T4 79 84 Time seconds 14 Figure 2 L6 Biotin labeled cRNA from Two Cycle cDNA Synthesis Kit Bioanalyzer electropherogram for labeled cRNA from HeLa total RNA using the Two Cycle Kit This electropherogram displays the nucleotide size distribution for 400 ng of labeled cRNA resulting from two rounds of amplification The average size is approximately 850 nt 2 1 38 CHAPTER 1 Eukaryotic Target Preparation Fragmenting the cRNA for Target Preparation Sample Cleanup Module is used for this step Fragmentation of cRNA target before hybridization onto GeneChip probe arrays has been shown to be critical in obtaining optimal assay sensitivity Affymetrix recommends that the cRNA used in the fragmentation procedure be sufficiently concentrated to maintain a small volume during the procedure This will minimize the amount of magnesium in the final hybridization cocktail Fragment an appropriate amount of cRNA for hybridization cocktail and gel analysis refer to the Eukaryotic Target Hybridization chapter in
19. Repeat IVT Image Array Quality Low or absent Oligo B2 Addition of control Oligo B2 and hybridization hybridization washing or staining Make sure that the Control Oligo B2 has been added to the hybridization cocktail at the correct concentration Also check the makeup of the hybridization buffer the stain solution and hybridization temperature Dim Corners In need of fluidics maintenance Bleach the fluidics as recommended and change the peristaltic pump tubing If the problem persists call Affymetrix Technical Support Dim Arrays Hybridization problems Check the signal from control Oligo B2 to see if the signals are also weak If it appears to be a hybridization issue check all hybridization reagents and equipment settings before running another assay Test arrays can be useful for troubleshooting this issue Sample preparation problems Re check each of the quality control procedures recommended in the manual such as absorbance measurement and running an aliquot on gel to ensure that there is no significant loss of sample during target preparation due to manipulation of the sample or RNase contamination Also see above for low cRNA yield Leaking septa Leaking septa are most often created during the array filling with a pipette Be sure to use pipette tips without a beveled end When filling the arrays be careful to push the pipette tip straight through the septum and maintain a con
20. Rev 3 Section 3 Prokaryotic Sample and Array Processing Chapter 1 Prokaryotic Target Preparation Chapter 2 Preparation of Control Spike In Transcripts Chapter 3 Prokaryotic Target Hybridization Chapter 4 Prokaryotic Arrays Washing Staining and Scanning 3 3 3 3 4 3 Prokaryotic 701030 Rev 3 Section 3 Chap er Prokaryotic Target Preparation Reagents and Materials Required 3 19 Reagent Preparation Lis de suis wk ar es dd nine ehe en 3 1 6 Total RNA TSOATTOM s 23 SOA o RO aaa Sls CDNA Synthesis a sa 2 52 parane chur des Seo or A E a 3 1 8 Step l CDNA Synthesis ce cae da dre ben pe Rens SOR RAED OEE 3 1 8 step 2 Removal Of RNA a y a wale bt ee oh ee ies ek eed 3 1 9 Step 3 Purification and Quantitation of cDNA 3 1 9 CDNA Fragmentation s soa s bob da oye Gade RP A OO 3 1 10 TermmallEabeline LL 266 ss ba hd E b A b BEES 3 1 LI This Chapter Contains This chapter describes the assay procedures recommended for use with the GeneChip P aeruginosa Genome Array and the GeneChip E coli Antisense Genome Array The assay utilizes reverse transcriptase and random hexamer primers to produce DNA complementary to the RNA The cDNA products are then fragmented by DNase I and labeled with terminal transferase and biotinylated ddUTP at the 3 termini Prokaryotic This protocol 1s presented as a recommendation only and has no
21. Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions in the LCD window on the fluidics station If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the appropriate User s Guide for your GeneChip Fluidics Station 400 450 or 250 3 4 11 Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing Table 3 4 5 Fluidics Protocols Standard Format for E coli Antisense Array ProkGE WS 2 gt Modified FlexMidi_euk2v3 for P aeruginosa Array FlexMidi_euk2v3 Post Hyb 10 cycles of 2 mixes cycle with Wash 10 cycles of 2 mixes cycle with Wash 10 cycles of 2 mixes cycle with Wash Wash 1 Buffer A at 30 C Buffer A at 25 C Buffer A at 25 C Post Hyb 4 cycles of 15 mixes cycle with Wash 4 cycles of 15 mixes cycle with Wash 4 cycles of 15 mixes cycle with Wash Wash 2 Buffer B at 50 C Buffer B at 50 C Buffer B at 45 C Stain Stain the probe array for 600 seconds Stain the probe array for 600 seconds in Stain the probe array for 10 minutes in SAPE Solution M ix at 25 C Streptavidin Solution Mix at 25 C in Streptavidin Solution Mix at 25 C Post Stain 10 cycles of 4 mixes cycle with Wash 10 cycles of 4 mixes cycle with Wash 10 cycles of 4 mixes cycle with Wash Wash Buffer A at 30 C Buffer A at 30 C Buffer A at 30 C and Stai Stain the probe array for 300 seconds Stain the probe array for 600 s
22. Synthesis 2 1 16 Step 3 Second Strand cDNA Synthesis 2 1 18 Two Cycle cDNA Synthesis 4 44 4132 2 1 19 Step 1 Preparation of Poly A RNA Controls for Two Cycle cDNA Synthesis Spike in Controls 2 1 19 Step 2 First Cycle First Strand cDNA Synthesis 2 1 22 Step 3 First Cycle Second Strand cDNA Synthesis 2 1 24 Step 4 First Cycle IVT Amplification of cRNA 2 1 25 Step 5 First Cycle Cleanup of CRNA 2 1 26 Step 6 Second Cycle First Strand cDNA Synthesis 2 1 28 Step 7 Second Cycle Second Strand cDNA Synthesis 2 1 30 Cleanup of Double Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays 2 1 32 Synthesis of Biotin Labeled cRNA for Both the One Cycle and Two Cycle Target Labeling Assays 2 1 34 Cleanup and Quantification of Biotin Labeled cRNA 2 1 36 Step 1 Cleanup of Biotin Labeled CRNA 2 1 36 Step 2 Quantification of the cRNA 2 1 37 Step 3 Checking Unfragmented Samples by Gel Electrophoresis 2 1 38 Fragmenting the cRNA for Target Preparation 2 1 39 Alternative Protocol for One Cycle cDNA Synthesis from Total RNA 2 1 41 Step 1 First Strand cDNA Synthesis
23. a non frost free freezer 2 mg mL NeutrAvidin Resuspend 10 mg NeutrAvidin in 5 mL PBS solution Store at 4 C CHAPTER 1 Prokaryotic Target Preparation Total RNA Isolation As starting material for the cDNA synthesis procedure total RNA can be isolated by using standard procedures for bacterial RNA isolation or various commercial RNA isolation kits For Pseudomonas aeruginosa and E coli we have successfully used the QIAGEN RNeasy Mini Purification Kit Caution should be used to minimize chromosomal DNA contamination during the isolation due to the high sensitivity of the assay It is suggested that no more than 1 X 10 cells are applied to a single purification column Also use the lysozyme at a concentration of 1 mg mL and not the recommended 400 ug mL Additional DNase I treatment may be required to eliminate DNA contamination when the bacterial culture is grown at high density After purification RNA concentration is determined by absorbance at 260 nm on a spectrophotometer 1 absorbance unit 40 ug mL RNA The A 4 A55 ratio should be approximately 2 0 with ranges between 1 8 to 2 1 considered acceptable We recommend checking the quality of RNA by running it on an agarose gel prior to starting the assay The 23S and 16S rRNA bands should be clear without any obvious smears Any indication of the presence of chromosomal DNA contamination high molecular weight bands or smears on the gel would require additional DNase trea
24. at 260 nm 74 Note The quality of DNA template can be monitored by the Aggo Azg9 ratio which should be between 1 8 and 2 0 for pure DNA In vitro Transcription IVT to Produce Control Sense Transcripts Use MEGAscript T3 Kit for the IVT reaction 1 To make up the reaction mix follow the procedures in the instruction manual provided by Ambion v Note No tracer is involved in this assay 2 Incubate the reaction for 4 hours at 37 C 3 Clean up the reaction product with RNeasy mini column a Quantify the transcript by absorbance at 260 nm 40 ug mL RNA 1 absorbance unit at 260 nm v Note It is recommended to examine the quality and integrity of the IVT product on an agarose gel The expected IVT product sizes are shown in Table 3 2 1 D IMPORI Aliquot and freeze the IVT transcripts at 80 C Avoid repeated freeze thaw cycles CHAPTER 2 Preparation of Control Spike In Transcripts Preparing the Control Transcript Mix AFFYMETRIX 1 Prepare stock solutions for each of the five transcripts at 650 pM for each transcript Use Table 3 2 1 to calculate the amount of transcript needed Table 3 2 1 Conversions for Preparing Control Transcript Mix Control RNA Size kb Molecular Weight pmoles ug lys 1 330 000 3 03 phe 132 435 600 2 30 dap 184 607200 165 thr 198 653 400 153 2 Mix egual volumes of the 650 pM stocks for all four transcripts for a final concentration of 130 pM for each t
25. automate the washing and staining of GeneChip P aeruginosa and GeneChip E coli Antisense Genome Arrays m Instructions for scanning probe arrays using the GeneArray Scanner or the GeneChip Scanner 3000 After completing the procedures described in this chapter the scanned probe array image dat file is ready for analysis as explained in the enclosed GeneChip Expression Analysis Data Analysis Fundamentals booklet P N 701190 701033 Rev 3 3 4 3 CHAPTER 4 Prokaryotic Arrays Washing Staining and Scanning Reagents and Materials Required AFFYMETRIX a The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate sections Appendix A contains a master list of all reagents used in this manual z Water Molecular Biology Grade BioWhittaker Molecular Applications Cambrex P N 51200 z Distilled water Invitrogen Life Technologies P N 15230 147 z Acetylated Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 a R Phycoerythrin Streptavidin Molecular Probes P N S 866 NaCl 5M RNase free DNase free Ambion P N 9760G PBS pH 7
26. be performed place wash lines into a bottle filled with deionized water Choose Shutdown or Shutdown_450 for all modules from the drop down Protocol list in the Fluidics Station dialog box Click the Run button for all modules The Shutdown protocol is critical to instrument reliability Refer to the appropriate Fluidics Station User s Guide for more information After Shutdown protocol is complete flip the ON OFF switch of the fluidics station to the OFF position To maintain the cleanliness of the fluidics station and obtain the highest quality image and data possible a weekly bleach protocol and a monthly decontamination protocol are highly recommended Please refer to Section 4 Fluidics Station Maintenance Procedures for further detail 2 3 17 Eukaryotic 2 3 18 SECTION 2 Eukaryotic Sample and Array Processing Customizing the Protocol There may be times when the fluidics protocols need to be modified Modification of protocols must be done before downloading the protocol to the fluidics station Protocol changes will not affect runs in progress For more specific instructions refer to the Microarray Suite GCOS online help 1 Select Tools Edit Protocol from the menu bar gt The Edit Protocol dialog box appears 2 Select the protocol to be changed from the Protocol Name drop down list gt The name of the protocol is displayed in the Protocol Name box The conditions for that protocol are displayed on the
27. begin priming In GCOS select the All Modules check box then click Run CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Probe Array Wash and Stain AFFYMETRIX After 16 hours of hybridization remove the hybridization cocktail from the probe array and fill the probe array completely with the appropriate volume of Non Stringent Wash Buffer Wash Buffer A as given in Table 2 2 2 on page 2 2 8 If necessary at this point the probe array can be stored at 4 C for up to 3 hours before proceeding with washing and staining Equilibrate the probe array to room temperature before washing and staining This protocol is recommended for use with probe arrays with probe cells of 24 um or smaller This procedure takes approximately 90 minutes to complete Preparing the Staining Reagents Prepare the following reagents Volumes given are sufficient for one probe array SAPE Stain Solution Streptavidin Phycoerythrin SAPE should be stored in the dark at 4 C either foil wrapped or kept in an amber tube Remove SAPE from the refrigerator and tap the tube to mix well before preparing stain solution Do not freeze SAPE Always prepare the SAPE stain solution fresh on the day of use Table 2 3 1 SAPE Solution Mix Components Volume Final Concentration 2X Stain Buffer 600 0 uL 1X 50 mg mL BSA 48 0 uL 2 mg mL 1 mg mL Streptavidin Phycoerythrin SAPE 12 0 uL 10 pg mL DI H 0 540 0 uL Total 1200 pL M
28. caps Label the collection tubes with the sample name During centrifugation some column caps may break resulting in loss of sample information Centrifugation with open caps allows complete drying of the membrane CHAPTER 1 Eukaryotic Target Preparation 8 Transfer spin column into a new 1 5 mL Collection Tube supplied and pipet 13 uL of RNase free Water directly onto the spin column membrane Ensure that the water is dispensed directly onto the membrane Centrifuge 1 minute at maximum speed lt 25 000 x g to elute The average volume of eluate is 11 uL from 13 uL RNase free Water 9 To determine cRNA yield for samples starting with 50 ng or higher remove 2 uL of the cRNA and add 78 uL of water to measure the absorbance at 260 nm Use 600 ng of cRNA in the following Step 6 Second Cycle First Strand cDNA Synthesis Reaction For starting material less than 50 ng or if the yield is less than 600 ng use the entire eluate for the Second Cycle First Strand cDNA Synthesis Reaction Samples can be stored at 20 C for later use or proceed to Step 6 Second Cycle First Strand cDNA Synthesis described next AFFYMETRIX ANS 2 1 27 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Step 6 Second Cycle First Strand cDNA Synthesis Two Cycle cDNA Synthesis Kit is used for this step v Note The following program can be used as a reference to perform the Second Cycle First Strand cDNA synthesis reaction
29. due to the high GC content of P aeruginosa 5 Avoid stress to the motor load probe arrays in a balanced configuration around axis Rotate at 60 rpm 6 Hybridize for 16 hours During the latter part of the 16 hour hybridization proceed to Section 3 Chapter 4 Prokaryotic Arrays Washing Staining and Scanning to prepare reagents required immediately after completion of hybridization 3 3 7 Prokaryotic 701033 Rev 3 Section 3 Chap er i Prokaryotic Arrays Washing Staining and Scanning Reagents and Materials Required 2 s ea 4 444 444444 444444 nn 3 4 5 Reagent Prepatation sages za aus zus dahin RAR OS EHS ak 3 4 6 Experiment and Fluidics Station SeWp 4 002565 eee G05 Baa na 3 4 7 step is Defiming File Loeatians s s Are soma ui edge ae bin 3 4 7 Step 2 Entering Experiment Information 3 4 7 Step 3 Preparing the Fluidics Station s 3 4 8 Probe Array Wash and Stan is s 440 00 28s ee Oe eae na BER Eh ew 3 4 9 Probe Array San ic u s sh ka u aug Khan das Ga HORS Bazar ek 3 4 15 Handling the GeneChip Probe Array i ss 4 225 0 A b use nassen 3 4 15 Scanning R Probe Artay a a4 NA SR ka a re ehe 3 4 16 Shutting Down the Fluidics Station 3 4 17 Customizins the Protocol u beh das deed LENS apa red 3 4 18 Prokaryotic This Chapter Contains m Instructions for using the Fluidics Station 400 or 450 250 to
30. have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate sections Appendix A contains a master list of all reagents used in this manual z Water Molecular Biology Grade BioWhittaker Molecular Applications Cambrex P N 51200 z Acetylated Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 z Hering Sperm DNA Promega Corporation P N D1811 m Micropure Separator Millipore P N 42512 optional z Control Oligo B2 3 nM Affymetrix P N 900301 can be ordered separately m NaCl 5M RNase free DNase free Ambion P N 9760G z MES Free Acid Monohydrate SigmaUltra Sigma Aldrich P N M5287 z MES Sodium Salt Sigma Aldrich P N M5057 z EDTA Disodium Salt 0 5M solution 100 mL Sigma Aldrich P N E7889 Miscellaneous Reagents z Tough Spots Label Dots USA Scientific P N 9185 optional z 100 DMSO Sigma Aldrich P N D2650 Surfact Amps X 100 Tween 20 10 Pierce Chemical P N 28320 Miscellaneous Supplies z Hybridization Oven 640 Affymetrix P N 800138 110V or 800139 220V z Sterile RNase free microcentrifuge vials 15 mL USA Scientific P N 1415 2600 or equivalent Micropipettors P 2
31. insert that comes with each array package Please refer to the hybridization protocols in the respective sections of this manual for more detail Is there a possibility of contaminating the fluidics station with RNase when gene expression genotyping and health management applications are being performed on a shared station It is extremely important to change the vials each time a sample is removed or loaded onto a probe array This prevents cross contamination as well as sample loss RNase contamination is not an issue with gene expression applications due to the fact that the cRNA sample is fragmented prior to hybridization and is removed prior to array processing on the fluidics station I have a bubble in the array How do I get rid of it After the final wash on the fluidics station if the door is still open place the array in the probe array holder and close the door The fluidics module will automatically run a drain and fill protocol with buffer A If one cycle does not remove the bubble repeat the process and try again If this doesn t work or the door has already been closed manually drain the array and refill with buffer A What are the safe stopping points in the assay It is safe to stop work after each of the major steps in the sample preparation process first strand cDNA synthesis second strand synthesis IVT fragmentation or after preparing the hybridization cocktail If possible work with extracted RNA samples imm
32. isolated from total RNA using OIAGEN s Oligotex mRNA Kit A single round of poly A mRNA selection provides mRNA of sufficient purity and yield to use as a template for cDNA synthesis Two rounds of poly A mRNA selection will result in significantly reduced yield and are not generally recommended Isolation of RNA from Arabidopsis Total RNA TRIzol Reagent from Invitrogen Life Technologies have been used to isolate total RNA from Arabidopsis Follow the instructions provided by the supplier and when necessary use the steps outlined specifically for samples with high starch and or high lipid content Poly A mRNA Arabidopsis poly A mRNA has been successfully isolated using QIAGEN s Oligotex products However other standard isolation products are likely to be adequate AFFYMETRIX Eukaryotic 2 1 10 SECTION 2 Eukaryotic Sample and Array Processing Isolation of RNA from Mammalian Cells or Tissues EI Total RNA High quality total RNA has been successfully isolated from mammalian cells such as cultured cells and lymphocytes using the RNeasy Mini Kit from QIAGEN If mammalian tissue is used as the source of RNA it is recommended to isolate total RNA with a commercial reagent such as TRIzol If going directly from TRizol isolated total RNA to cDNA synthesis it may be beneficial to perform a second cleanup on the total RNA before starting After the ethanol precipitation step in the TRIzol extraction procedure perfo
33. mixture 8 Remove the buffer solution from the probe array cartridge and fill with appropriate volume Table 2 2 2 of the clarified hybridization cocktail avoiding any insoluble matter at the bottom of the tube 9 Place probe array into the Hybridization Oven set to 45 C Avoid stress to the motor load probe arrays in a balanced configuration around the axis Rotate at 60 rpm 10 Hybridize for 16 hours During the latter part of the 16 hour hybridization proceed to Section 2 Chapter 3 to prepare reagents required immediately after completion of hybridization Plastic cartridge __ Notch Septa Front Probe array on glass substrate Figure 2 2 1 GeneChip Probe Array 2 gt de G x gt m 701028 Rev 4 Section 2 N Eukaryotic Arrays Washing Staining and Scanning Reagents and Materials Required 2 3 5 Reagent Preparation ES es aa Ba we BN a eee us 2 3 6 9 Experiment and Fluidics Station Setup 2 3 7 E Step 1 Defining File Locations 2 3 7 fr Step 2 Entering Experiment Information 2 3 7 Step 3 Preparing the Fluidics Station 2 3 8 Probe Array Wash and Stain 2 2 2 oo en 2 3 9 Probe Array Scan 2 3 15 Handling the GeneChip Probe Array 2 3 15 Scanning the Pr
34. noise ratio SNR meaning that genes for transcripts present at very low levels in the sample may be incorrectly called as Absent High background creates an overall loss of sensitivity in the experiment What are masks Masks are rarely used features in MAS There are three types of mask files Image mask files You may want to use an image mask if there is a large visible aberration on an image You define the image mask based on the physical location of the image Probe pairs included in the mask are excluded from the analysis Image masks are associated with a given dat cel file and cannot be used on other images Probe mask files Probe masks are defined by the probe set and probe pair number Probe pairs included in this type of probe mask are excluded from the analysis when the probe mask is used Probe masks can be applied across a data set For a detailed description please refer to Affymetrix Microarray Suite User s Guide P N 701099 A second type of probe mask defines a select group of probe sets that can be used in normalization or scaling Please refer to Affymetrix Microarray Suite User s Guide where this type of probe set mask file is described If I realign the grid how do I create a new cel file If manual adjustment of the grid is necessary the corresponding cel file present at the time of adjustment will no longer be a valid representation of the realigned image data Microarray Suite automatically detects this
35. position Temperature will ramp up to 50 C 7 Connect tubing to needles If you are using the Fluidics Station 450 250 If you are using the FS 450 250 connect one end of the plastic tubing to each of the three needles The proper technique is to press down on the cartridge lever until the needles extend a convenient distance from the module then slip the tube on as you hold the cartridge lever down with the free hand as shown in Figure 4 12 Take care not to bend or break the needles If you are using the Fluidics Station 400 If you are using the FS 400 connect one end of the plastic tubing to each needle at the bottom of each module 4 1 5 F S Maintenance SECTION 4 Fluidics Station Maintenance Procedures Figure 4 12 Inserting tubes on the needles Take care not to break or bend the needles 8 Insert the other ends into 0 525 sodium hypochlorite solution at least 500 mL for all four modules as shown in Figure 4 13 v Note Remove cartridges before you start the bleach protocol CHAPTER 1 Fluidics Station Maintenance Procedures AFFYMETRIX Figure 4 13 The tubes extending from the modules to the bleach bottle Note that the probe array cartridges must be removed before the protocol can begin Ensure that all the tube ends remain immersed in the bleach solution by tamping down on the tubes using a dowel or similar object as shown in Figure 4 14 ES Maintenance SECTION 4 Fluidics S
36. prepare the target a final concentration of 10 DMSO needs to be added in the hybridization cocktail for optimal results Table 2 2 1 Hybridization Cocktail for Single Probe Array Gomponsnt 49 Format Standard 100 Format 169 Format Mini Array Final P 64 Format Array Midi Array 400 Format Micro Array Concentration Fragmented cRNA 15 ug 10 ug 5 ug 0 05 ug pL Control Oligonucleotide B2 5 ul 3 3 uL 1 7 UL 50 pM 3 nM 20X Eukaryotic Hybridization 15 uL 10 uL 5 ul 1 5 5 25 and Controls bioB bioC bioD cre 100 pM respectively Herring Sperm DNA 3 uL 2 UL 1 UL 0 1 mg mL 10 mg mL BSA 3 UL 2 uL 1 UL 0 5 mg mL 50 mg mL 2X Hybridization Buffer 150 uL 100 uL 50 uL 1X DMSO 30 pL 20 uL 10 uL 10 H20 to final volume of 300 UL to final volume to final volume of 100 uL of 200 uL Final volume 300 pL 200 pL 100 uL Please refer to specific probe array package insert for information on array format Please see Section 2 Chapter 1 for amount of adjusted fragmented cRNA to use when starting from total RNA Note that the addition of DMSO is different from previous recommendations Follow this protocol for best results on arrays when using the GeneChip IVT Labeling Kit IMPOR It is imperative that frozen stocks of 20X GeneChip Eukaryotic Hybridization Controls are heated to 65 C for 5 minutes to completely resuspend the cRNA before aliquotting 2 Equilibrate probe array to room te
37. right side of the Edit Protocol dialog box 3 Select the items to be changed and input the new parameters as needed keeping the parameters within the ranges shown below in Table 2 3 8 Table 2 3 8 Valid Ranges for Wash Stain Parameters Wash Temperature for A1 B A2 or A3 C 15 to 50 Number of Wash Cycles for A1 B A2 or A3 0 to 99 Mixes Wash cycle for A1 B A2 or A3 1 to 99 Stain Time seconds 0 to 86399 Stain Temperature C 5 to 50 Holding Temperature C 5 to 50 e Wash A1 corresponds to Post Hyb wash 1 in Table 2 3 5 e Wash B corresponds to Post Hyb wash 2 in Table 2 3 5 e Wash A2 corresponds to Post Stain Wash in Table 2 3 Wash A3 corresponds to Final Wash in Table 2 3 5 a Toreturn to the default values for the protocol selected click the Defaults button 5 After allthe protocol conditions are modified as desired change the name of the edited protocol in the Protocol Name box Ifthe protocol is saved without entering a new Protocol Name the original protocol parameters will be overwritten 6 Click Save then close the dialog box Enter 0 zero for hybridization time if hybridization step is not required Likewise enter 0 zero for the stain time if staining is not required Enter 0 zero for the number of wash cycles if a wash solution is not required Section 3 Prokaryotic Sample and Array Processing 701029 Rev 3 pP Contents 701029
38. situation either on initial reopening of the readjusted dat file or during the analysis process Once the readjusted dat file is opened the cel file is automatically created The user does not need to carry out any overt steps to accomplish this 5 B 9 Appendices 5 B 10 SECTION 5 Appendices How do I add additional probe sets in the rpt file Use the Report Settings dialog on the short cut menu in Microarray Suite to open the Expression Report You may add any probe sets desired by simply typing in the probe set name s you wish to add this can also be accomplished by cutting and pasting from a text file Keep in mind that the probe set name must be entered exactly as it appears in the analysis file including the suffixes such as 12345 s a Why can I not analyze data files stored on a CD Files in CD ROM format are copied to the hard drive in read only mode MAS requires that this attribute be removed To do this open NT Explorer and select the file s you copied from the CD Click the right mouse button and select Properties Clear the Read only check box near the bottom of the Properties screen and click OK How can the mismatch probe cell have a higher intensity than its corresponding perfect match probe cell There could be a number of causes for this It is possible that this probe sequence has high homology with another unknown sequence resulting in a high mismatch to perfect match ratio Another possibility
39. to close the washblock For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 4 Fluidics Station Maintenance Procedures Table 3 4 6 If bubbles are present Return the probe array to the probe array holder Engage the washblock by gently pushing up on the cartridge lever to the engage position The fluidics station will drain the probe array and then fill it with a fresh volume of the last wash buffer used When it is finished the LCD window will display EJ ECT CARTRIDGE Again remove the probe array and inspect it for bubbles If no bubbles are present it is ready to scan Proceed to Probe Array Scan on page 3 4 15 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash A non stringent buffer manually using a micropipette Excessive washing will result in a loss of signal intensity If you are using the Fluidics Station 400 Washing and Staining the Probe Array 3 AFFYMETRIX Insert the appropriate probe array into the designated module of the fluidics station while the cartridge lever is in the EJECT position When finished verify that the cartridge lever is returned to the ENGAGE position Remove any microcentrifuge tube remaining in the sample holder of the fluidics station module s being used Place a microcentrifuge tube containing the streptavidin solution into the sample holder maki
40. tube 2 1 28 CHAPTER 1 Eukaryotic Target Preparation 3 Transfer 9 uL of Second Cycle First Strand Master Mix to each cRNA random primer sample from Step 6 Second Cycle First Strand cDNA Synthesis on page 2 1 28 substep 1 for a final volume of 20 uL Mix thoroughly by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube and place the tubes at 42 C immediately 4 Incubate for 1 hour at 42 C then cool the sample for at least 2 minutes at 4 C After the incubation at 4 C centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube 5 Add 1 uL of RNase H to each sample for a final volume of 21 uL Mix thoroughly by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube and incubate for 20 minutes at 37 C 6 Heat the sample at 95 C for 5 minutes Cool the sample for at least 2 minutes at 4 C then proceed directly to Step 7 Second Cycle Second Strand cDNA Synthesis on page 2 1 30 AFFYMETRIX 2 1 29 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Step 7 Second Cycle Second Strand cDNA Synthesis Two Cycle cDNA Synthesis Kit is used for this step v4 Note The following program can be used as a reference to perform the Second Cycle 7 Second Strand cDNA Synthesis reaction in a thermal cycler For the 16 C incubations turn the heated lid
41. you are using the GeneArray Scanner click the Options button to check for the correct pixel value and wavelength of the laser beam z Pixel value 3 um z Wavelength 570 nm If you are using the GeneChip Scanner 3000 pixel resolution and wavelength are preset and cannot be changed CHAPTER 4 Prokaryotic Arrays Washing Staining and Scanning Open the sample door on the scanner and insert the probe array into the holder Do not force the probe array into the holder Close the sample door of the scanner If you are using the GeneChip Scanner 3000 do not attempt to close the door by hand The door closes automatically through the User Interface when start scan is selected or the scanner goes into stand by mode Click OK in the Start Scanner dialog box The scanner begins scanning the probe array and acquiring data When Scan in Progress is Selected from the View menu the probe array image appears on the screen as the scan progresses Shutting Down the Fluidics Station AFFYMETRIX a After removing a probe array from the probe array holder the LCD window displays the message ENGAGE WASHBLOCK If you are using the FS 400 engage the washblock by firmly pushing up on the cartridge lever to the ENGAGE position If you are using the FS 450 gently lift up the cartridge lever to engage or close the washblock gt The fluidics station automatically performs a Cleanout procedure The LCD window indicates t
42. 1 50 1 10 2 UL 50 ng 1 20 1 50 1 50 1 2 2 UL 100 ng 1 20 1 50 1 50 2 UL Avoid pipetting solutions less than 2 uL in volume to maintain precision and consistency when preparing the dilutions For example to prepare the poly A RNA dilutions for 10 ng of total RNA 1 Add2 uL of the Poly A Control Stock to 38 uL of Poly A Control Dil Buffer to prepare the First Dilution 1 20 2 Mix thoroughly and spin down to collect the liquid at the bottom of the tube 3 Add 2 uL of the First Dilution to 98 uL of Poly A Control Dil Buffer to prepare the Second Dilution 1 50 4 Mix thoroughly and spin down to collect the liquid at the bottom of the tube CHAPTER 1 Eukaryotic Target Preparation 5 Add2 uL of the Second Dilution to 98 uL of Poly A Control Dil Buffer to prepare the Third Dilution 1 50 6 Mix thoroughly and spin down to collect the liquid at the bottom of the tube 7 Add2yuL of the Third Dilution to 18 uL of Poly A Control Dil Buffer to prepare the Fourth Dilution 1 10 8 Use the Fourth Dilution to prepare the solution described next v Not a The first dilution of the poly A RNA controls 1 20 can be stored in a non frost free freezer at 20 C up to six weeks and frozen thawed up to eight times Preparation of T7 Oligo dT Primer Poly A Controls Mix Prepare a fresh dilution of the T7 Oligo dT Primer from 50 uM to 5 uM The diluted poly A RNA controls should be added to the concentrated T7 Oligo dT Primer as
43. 2 Invitrogen Life Technologies P N 20012 027 m 20X SSPE 3 M NaCl 0 2M NaH PO 0 02M EDTA BioWhittaker Molecular Applications Cambrex P N 51214 z Goat IgG Reagent Grade Sigma Aldrich P N 5256 z Anti streptavidin antibody goat biotinylated Vector Laboratories P N BA 0500 z 10 surfact Amps20 Tween 20 Pierce Chemical P N 28320 a Bleach 5 25 Sodium Hypochlorite VWR Scientific P N 21899 504 or equivalent z ImmunoPure Streptavidin Pierce Chemical P N 21125 Miscellaneous Supplies m Sterile RNase free microcentrifuge vials 15 mL USA Scientific P N 1415 2600 or equivalent m Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent z Sterile barrier pipette tips and non barrier pipette tips z Tygon Tubing 0 04 inner diameter Cole Parmer P N H 06418 04 z Tough Spots Label Dots USA Scientific P N 9185 3 4 5 Prokaryotic 3 4 6 SECTION 3 Prokaryotic Sample and Array Processing Reagent Preparation Wash A Non Stringent Wash Buffer 6X SSPE 0 01 Tween 20 For 1 000 mL 300 mL of 20X SSPE 1 0 mL of 10 Tween 20 699 mL of water Filter through a 0 2 um filter Store at room temperature Wash B Stringent Wash Buffer 100 mM MES 0 1M Na 0 01 Tween 20 For 1 000 mL 83 3 mL of 12 X MES Stock Buffer see Section 3 Chapter 3 for reagent preparation 5 2 mL of 5M NaCl 1 0 mL of 10 Tween 20 910 5 mL of water Filter through a 0 2 um filter Store at 2
44. 2241 96850 Promega Corporation www promega com 800 356 9526 44 0 800 378 994 33 0 8 00 48 79 99 49 0 621 85010 Proligo www gensetoligos com 800 995 0308 33 0 1 43 56 59 00 QIAGEN www qiagen com 800 426 8157 44 0 1293 422 911 33 0 1 60 92 09 20 49 0 210 3892 230 AFFYMETRIX 5 A 5 Appendices SECTION 5 Appendices Supplier U S United Kingdom France Germany Rainin 800 472 4646 44 0 1582 456 666 see web site for nearest distributor www rainin com Roche Molecular 800 262 1640 44 0 1273 480 444 33 0 4 76 76 30 87 49 0 621 75985 68 Biochemical biochem roche com Sigma Aldrich 800 325 3010 44 0 1202 733 114 33 0 4 74 82 28 88 49 0 896 5131130 www sigma aldrich com USA Scientific 800 522 8477 U S 352 237 6288 www usascientific com Vector Laboratories 800 227 6666 44 0 1733 237 999 44 86 22 75 49 0 9342 39499 or www vectorlabs com 0800 253 9472 VWR Scientific Products 800 932 5000 www vwrsp com 908 757 4045 5 A 6 APPENDIX A Supplier and Reagent Reference List Reagents and Materials Quick List Reagent Vendor P N tis PS Volume in Kit Rxns per Kit First Strand cDNA Synthesis T7 Oligo dT Primer 50 UM Affymetrix 900375 2 UL 300 uL 150 DEPC Water Ambion 9920 Variable 500 uL 5x First Stran
45. 287 MES Sodium Salt Sigma Aldrich P N 5057 MMLYV Reverse Transcriptase New England BioLabs P N M0253L MMLYV Reverse Transcriptase Buffer 10X New England BioLabs P N M0253L MOPS Sigma Aldrich P N M3183 N NaCl 5 M RNase free DNase free Ambion P N 9760G NaOH IN Solution VWR Scientific Products P N MK469360 Novex XCell SureLock Mini Cell Invitrogen Life Technologies P N EI0001 Nuclease free Water Ambion P N 9930 Nucleotides labeled Biotin 11 CTP and Biotin 16 UTP Enzo P N 42818 CTP and P N 42814 UTP Nucleotides Biotin 11 CTP Sigma Aldrich P N B7048 Nucleotides Biotin 16 UTP Roche Molecular Biochemicals P N 1388908 Nucleotides Biotin 16 UTP Sigma Aldrich P N B6923 APPENDIX A Supplier and Reagent Reference List O Oligo B2 Control Control Oligo for the antisense probe array HPLC purified 5 bio GTCGTCAAGATGCTACCGTTCAGGA 3 Oligotex Direct mRNA Kit QIAGEN P N 72012 72022 or 72041 Oligotex mRNA Kit QIAGEN P N 70022 70042 or 70061 P PBS pH 7 2 Invitrogen Life Technologies P N 20012 027 Pellet Paint Novagen P N 69049 3 PEO Iodoacetyl Biotin 50 mg Pierce Chemical P N 21334ZZ Phase Lock Gel Brinkmann Instruments P N 955 15 415 Phenol chloroform isoamyl alcohol Ambion P N 9732 Phycoerythrin Streptavidin Molecular Probes P N S 866 Polynucleotide Kinase T4 New England BioLabs P N 201L Potassium acetate KOAc Sigma Aldrich P N P5708 Primer T7 dT 4 Genset C
46. E WRITTEN INSTRUCTIONS PROVIDED THEREWITH THAT BUYER PURCHASES FROM AFFYMETRIX AFX OR ITS AUTHORIZED REPRESENTATIVE THE PURCHASE OF ANY PRODUCT S DOES NOT BY ITSELF CONVEY OR IMPLY THE RIGHT TO USE SUCH PRODUCT S IN COMBINATION WITH ANY OTHER PRODUCT S IN PARTICULAR I NO RIGHT TO MAKE HAVE MADE OR DISTRIBUTE OTHER PROBE ARRAYS IS CONVEYED OR IMPLIED BY THE PROBE ARRAYS II NO RIGHT TO MAKE HAVE MADE IMPORT DISTRIBUTE OR USE PROBE ARRAYS IS CONVEYED OR IMPLIED BY THE INSTRUMENTS OR SOFTWARE AND III NO RIGHT TO USE PROBE ARRAYS IN COMBINATION WITH INSTRUMENTS OR SOFTWARE IS CONVEYED UNLESS ALL COMPONENT PARTS HAVE BEEN PURCHASED FROM AFX OR ITS AUTHORIZED REPRESENTATIVE FURTHERMORE PROBE ARRAYS DELIVERED HEREUNDER ARE LICENSED FOR ONE 1 TIME USE ONLY AND MAY NOT BE REUSED THE PRODUCTS DO NOT HAVE FDA APPROVAL NO PATENT LICENSE IS CONVEYED TO BUYER TO USE AND BUYER AGREES NOT TO USE THE PRODUCTS IN ANY SETTING REQUIRING FDA OR SIMILAR REGULATORY APPROVAL OR EXPLOIT THE PRODUCTS IN ANY MANNER NOT EXPRESSLY AUTHOIRZED IN WRITING BY AFX IN ADVANCE PROBE ARRAYS INSTRUMENTS SOFTWARE AND REAGENTS ARE LICENSED FOR RESEARCH USE ONLY AND NOT FOR USE IN DIAGNOSTIC PROCEDURES NO RIGHT TO MAKE HAVE MADE OFFER TO SELL SELL OR IMPORT OLIGONUCLEOTIDE PROBE ARRAYS OR ANY OTHER PRODUCT IN WHICH AFFYMETRIX HAS PATENT RIGHTS IS CONVEYED BY THE SALE OF PROBE ARRAYS INSTRUMENTS SOFTWARE OR REAGENTS HEREUNDER THIS LIMITED LICENSE PERMITS ONL
47. ES SE serien ae 5 A 9 Appendices 701043 Rev 3 5 A 3 SECTION 5 Appendices Affymetrix Technical Support Affymetrix provides technical support via phone or e mail To contact Affymetrix Technical Support Affymetrix Inc 3380 Central Expressway Santa Clara CA 95051 USA Tel 1 888 362 2447 1 888 DNA CHIP Fax 1 408 731 5441 E mail support affymetrix com Affymetrix UK Ltd Voyager Mercury Park Wycombe Lane Wooburn Green High Wycombe HP10 OHH United Kingdom Tel 44 0 1628 552550 Fax 44 0 1628 552585 E mail supporteurope affymetrix com Affymetrix J apan K K Mita NN Bldg 16 Floor 4 1 23 Shiba Minato ku Tokyo 108 0014 Japan Tel 81 0 3 5730 8200 Fax 81 0 3 5730 8201 E mail supportjapan affymetrix com www affymetrix com 5 A 4 APPENDIX A Supplier and Reagent Reference List Supplier Contact Information Supplier Ambion www ambion com U S 800 888 8804 United Kingdom 44 0 1993 706 500 France 33 0 1 42 53 14 53 Germany 49 0 692 88082 Amersham Pharmacia Biotech www apbiotech com 800 323 9750 44 0 800 515 313 33 0 1 69 35 67 00 49 0 761 49030 Amresco www amresco inc com 800 448 4442 44 0 1582 745 000 33 0 4 70 03 88 55 49 0 551 506860 ATCC www atcc org 800 638 6597 U S 703 365 2700 BioWhittaker Molecular Applications Cambrex www cambrex com 800 341 1574
48. Fragmented and labeled total F coli RNA Lane 5 Fragmented and labeled total F coli RNA with avidin Lane 6 100 bp DNA Ladder gt Cad _ Figure 3 L2 Gel shift assay for monitoring E coli target labeling efficiency o sd a ae Prepare a NeutrAvidin solution of 2 mg mL in PBS Place a 4 to 20 TBE gel into the gel holder and load system with 1X TBE Buffer For each sample to be tested remove two 150 to 200 ng aliguots of fragmented and biotinylated sample to fresh tubes Add 5 ul of 2 mg mL NeutrAvidin to each tube Mix and incubate at room temperature for 5 minutes Add loading dve to all samples to a final concentration of 1X loading dye Prepare 10 bp and 100 bp DNA ladders 1 uL ladder 7 uL water 2 uL loading dye for each lane Carefully load samples and two ladders on gel Each well can hold a maximum of 20 uL Run the gel at 150 volts until the front dye red almost reaches the bottom The electrophoresis takes approximately 1 hour 10 While the gel is running prepare at least 100 mL of a 1X solution of SYBR Gold for staining SYBR Gold are light sensitive Therefore use caution and shield the staining solution from light Prepare a new batch of stain at least once a week 11 After the gel is complete break open cartridge and stain the gel in 1X SYBR Gold for 10 minutes 12 Place the gel on the UV light box and produce an image following standard procedure Be sure to use the appr
49. GENE EXPRESSION MONITORING GeneChip Expression Analysis Technical M anual For Research Use Only Not for use in diagnostic procedures AFFYMETRIX m 701021 Rev 4 m Trademarks Affymetrix GeneChip EASI AM 4 lt LP HuSNP GenFlex Jaguar MicroDB NetAffx CustomExpress Flying Objective Tools To Take You As Far As Your Vision and The Way Ahead are trademarks owned or used by Affymetrix Inc GeneArray is a registered U S trademark of Agilent Technologies Inc Enzo is a registered trademark of Enzo Biochem Inc and BioArray is a trademark of Enzo Biochem Inc QIAGEN is a registered trademark of QIAGEN GmbH Hilden Germany Limited License EXCEPT AS EXPRESSLY SET FORTH HEREIN NO RIGHT TO COPY MODIFY DISTRIBUTE MAKE DERIVATIVE WORKS OF PUBLICLY DISPLAY MAKE HAVE MADE OFFER TO SELL SELL USE OR IMPORT PROBE ARRAYS OR ANY OTHER PRODUCT IS CONVEYED OR IMPLIED WITH THE PROBE ARRAYS INSTRUMENTS SOFTWARE REAGENTS OR ANY OTHER ITEMS PROVIDED HEREUNDER EXCEPT FOR CERTAIN ARRAYS AND REAGENTS DESIGNATED AS ANALYTE SPECIFIC REAGENTS SEE APPLICABLE PACKAGE INSERT WHICH ARE LICENSED FOR USE AS ANALYTE SPECIFIC REAGENTS OR RESEARCH USE ALL PRODUCTS INCLUDING THE PROBE ARRAYS INSTRUMENTS SOFTWARE AND REAGENTS DELIVERED HEREUNDER ARE LICENSED TO BUYER FOR RESEARCH USE ONLY THIS LIMITED LICENSE PERMITS ONLY THE USE BY BUYER OF THE PARTICULAR PRODUCT S IN ACCORDANCE WITH TH
50. P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier pipette tips and non barrier pipette tips 3 3 5 Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing Reagent Preparation 12X MES Stock 1 22M MES 0 89M Na For 1 000 mL 70 4g MES free acid monohydrate 193 39 MES Sodium Salt 800 mL of Molecular Biology Grade water Mix and adjust volume to 1 000 mL The pH should be between 6 5 and 6 7 Filter through a 0 2 um filter Do not autoclave store at 2 C to 8 C and shield from light Discard solution if yellow 2X Hybridization Buffer 50 mL final 1X concentration is 100mM MES 1M Na 20 mM EDTA 0 01 Tween 20 For 50 mL 8 3 mL of 12X MES Stock 17 7 mL of 5M NaCl 4 0 mL of 0 5M EDTA 0 1 mL of 10 Tween 20 19 9 mL of water Store at 2 C to 8 C and shield from light CHAPTER 3 Prokaryotic Target Hybridization Prokaryotic Target Hybridization AFFYMETRIX After determining that the fragmented cDNA is labeled with biotin prepare the hybridization solution mix The minimum amount of cDNA product required for target hybridization is 1 ug The solution is stable for approximately 6 to 8 hours at 4 C The following protocol can be used for freshly prepared or frozen hybridization cocktail Re use of prokaryotic sample has not been thoroughly tested and therefore is not recommended 1 Prepare the following hybridization solution mix Table 3 3 1 Hybridizati
51. Primer cDNA aynthosis 73 retry mmm 5 25 hours s TTTTIT AAAAA m 3 gt 111011 TTTIT ms Products Used TT nu Cleanup of double stranded CDNA 4 05 hours Module Biotinylated Biotin Inbeling of antisense cRNA 47 Ricon oldat 4 hours NT Analog a ee L s ludu hubu s Cleanup of biotinylated cRNA 0 5 hours ss Module Fragmentabon 1 hour ur E 4 ER Hybridization controls Hybridization 16 hours en pr Ne Fa aa troptavidin Washing Staining 4 wien 1 5 hours r Scanning 4 lt 12 minutes TTTTT ana 7 11777 J DNA 17 promoter Biotin U Pseudouriding Figure 2 L1 GeneChip Eukaryotic Labeling Assays for Expression Analysis 2 1 6 CHAPTER 1 Eukaryotic Target Preparation Reagents and Materials Required EI AFFYMETRIX The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual Do not store enzymes in a frost free freezer Total RNA Isolation z TRIzol Reagent Invitrogen Life Technologies P N 15596 018 z RNeasy Mini Kit QIAGEN P N 74104 Poly A
52. Section 2 1 The Fragmentation Buffer has been optimized to break down full length cRNA to 35 to 200 base fragments by metal induced hydrolysis The following table shows suggested fragmentation reaction mix for CRNA samples at a final concentration of 0 5 ug uL Use adjusted cRNA concentration as described in Step 2 Quantification of the cRNA on page 2 1 37 The total volume of the reaction may be scaled up or down dependent on the amount of cRNA to be fragmented Table 2 118 Sample Fragmentation Reaction by Array Format Component 49 64 Format 100 Format cRNA 20 pg 1 to 21 uL 15 ug 1 to 21 uL 5X Fragmentation Buffer 8 uL 6 UL RNase free Water variable to 40 uL final volume to 30 uL final volume Total Volume 40 pL 30 pL Please refer to specific probe array package insert for information on array format 2 Incubate at 94 C for 35 minutes Put on ice following the incubation 3 Save an aliquot for analysis on the Bioanalyzer A typical fragmented target is shown in Figure 2 1 7 The standard fragmentation procedure should produce a distribution of RNA fragment sizes from approximately 35 to 200 bases 4 Store undiluted fragmented sample RNA at 20 C until ready to perform the hybridization as described in the Eukaryotic Target Hybridization chapter in Section 2 AFFYMETRIX 2 1 39 Eukaryotic 2 1 40 SECTION 2 Eukaryotic Sample and Array Processing N 12 5 A 10 0 7 5
53. Staining and Scanning 2 4 3 SECTION 3 Prokaryotic Sample and Array Processing Chapter 1 Prokaryotic Target Preparation 3 13 Chapter 2 Preparation of Control Spike In Transcripts 3 2 3 Chapter 3 Prokaryotic Target Hybridization 3 3 3 Chapter 4 Prokaryotic Arrays Washing Staining and Scanning 3 4 3 SECTION 4 Chapter 1 Fluidics Station Maintenance Procedures 4 1 3 Prokaryotic Eukaryotic ES Maintenance Appendices iii iv CONTENTS SECTION 5 Appendices Appendix A Supplier and Reagent Reference List Appendix B FAOs amp Troubleshooting Appendix C List of Controls on GeneChip Probe Arrays Appendix D Technical Bulletins Appendix E Probe Array Information 5 A 3 5 B 3 5 C 3 5 D 3 5 E 3 Section 1 GeneChip Expression Analysis Overview 701022 Rev 2 ig a Contents Section 1 Chapter 1 GeneChip Expression Analysis Overview 1 13 701022 Rev 2 701023 Rev 3 Section 1 Chap er GeneChip Expression Analysis Overview Introduction and Objectives e 4 4 44 nennen nenn ne 1 1 4 Explanation of GeneChip Probe Arrays 1 1 4 GeneChip Expression Analysis Overview 1 1 5 Presautions s tae o A AO Ar AA re b A K R 1 1 6 TerminolodY z s pob sas ah ee de SN ak le O aa LEI Interferinp Conditions s pi 00 a a O a ie Dio 1 1 7 Instruments LS Le de o rare Lae References 24 5 4 smic ete s
54. Strand Master Mix for at least 4 reactions at one time for easier and more accurate pipetting a Prepare sufficient First Cycle Second Strand Master Mix for all samples When there are more than 2 samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 12 is for a single reaction Table 2 112 Preparation of First Cycle Second Strand M aster Mix Component Volume RNase free Water 4 8 uL Freshly diluted M gCl gt 175 mM 4 0 uL dNTP 10 mM 0 4 uL E coli DNA Polymerase I 0 6 uL RNase H 0 2 uL Total Volume 10 0 pL Make a fresh dilution of the M gCl each time Mix 2 uL of MgCl gt 1M with 112 uL of RNase free Water b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the solution at the bottom of the tube Add 10 uL of the First Cycle Second Strand Master Mix to each sample from Step 2 First Cycle First Strand cDNA Synthesis reaction for a total volume of 20 uL Gently flick the tube a few times to mix and then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube Incubate for 2 hours at 16 C then 10 minutes at 75 C and cool the sample at least 2 minutes at 4 C Turn the heated lid function off only for the 16 C incubation After the 2 minute incubation at 4 C centrifuge the tube briefly 5 seconds to collect th
55. Y THE USE OF THE PARTICULAR PRODUCT S THAT THE USER HAS PURCHASED FROM AFFYMETRIX Patents Products may be covered by one or more of the following patents and or sold under license from Oxford Gene Technology U S Patent Nos 5 445 934 5 744 305 6 261 776 6 291 183 5 700 637 5 945 334 6 346 413 and 6 399 365 and EP 619 321 373 203 and other U S or foreign patents Software products may be covered by one or more of the following patents U S Patent Nos 5 733 729 5 795 716 5 974 164 6 066 454 6 090 555 6 185 561 and 6 188 783 and other U S or foreign patents Fluidics Station products may be covered by U S Patent No 6 114 122 and 6 391 623 6 422 249 and other U S or foreign patents Scanner products may be covered by one or more of the following patents U S Patent Nos 5 578 832 5 631 734 5 834 758 5 936 324 5 981 956 6 025 601 6 141 096 6 171 793 6 185 030 6 201 639 6 207 960 6 218 803 6 225 625 6 252 236 6 335 824 6 403 320 6 407 858 6 472 671 and 6 490 533 and other U S or foreign patents Copyright 1999 2003 Affymetrix Inc All rights reserved Contents 701021 Rev 4 SECTION 1 Overview Chapter 1 GeneChip Expression Analysis Overview 1 13 SECTION 2 Eukaryotic Sample and Array Processing Chapter 1 Eukaryotic Target Preparation 2 1 3 Chapter 2 Controls for Eukaryotic Arrays 2 2 3 Chapter 3 Eukaryotic Target Hybridization 2 3 3 Chapter 4 Eukaryotic Arrays Washing
56. age 2 1 24 for a final volume of 50 uL Gently flick the tube a few times to mix then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube 3 Incubate for 16 hours at 37 C After the 16 hour incubation at 37 C centrifuge the tube briefly 5 seconds to collect the reaction at the bottom of the tube The sample is now ready to be purified in Step 5 First Cycle Cleanup of cRNA on page 2 1 26 Alternatively samples may be stored at 20 C for later use AFFYMETRIX 2 1 25 Eukaryotic 2 1 26 SECTION 2 Eukaryotic Sample and Array Processing Step 5 First Cycle Cleanup of CRNA IMPORI Recommenda Sample Cleanup Module is used for this step Reagents to be Supplied by User a Ethanol 96 100 v v a Ethanol 80 v v All other components needed for cleanup of cRNA are supplied with the GeneChip Sample Cleanup Module BEFORE STARTING please note m VI cRNA Wash Buffer is supplied as a concentrate Before using for the first time add 20 mL of ethanol 96 100 as indicated on the bottle to obtain a working solution and checkmark the box on the left hand side of the bottle label to avoid confusion m VT cRNA Binding Buffer may form a precipitate upon storage If necessary redissolve by warming in a water bath at 30 C and then place the buffer at room temperature m All steps of the protocol should be performed at room temperature During the procedure work without
57. alize my data to all genes on the array With scaling you select an arbitrary target intensity and scale the average intensity of all genes minus the highest 2 and lowest 2 Signal values on each array within a data set to that number This enables you to compare multiple arrays within a data set The scaling factor remains the same for a particular array as long as you use the same arbitrary target intensity for scaling Scaling can be performed independent of the comparison analysis On the other hand normalization can only be done when performing a comparison analysis It compares an experimental array with a baseline array and normalizes the average intensity of all genes minus the highest 2 and lowest 2 Signal values of the experimental array to the corresponding average intensity of the baseline array when running a comparison analysis in MAS The normalization factor for a particular array changes when you change the comparison baseline array How important is it to evaluate the value of the Scaling Factor between different arrays Scaling Factor is the multiplication factor applied to each Signal value on an array A Scaling Factor of 1 0 indicates that the average array intensity is equal to the Target Intensity Scaling Factors will vary across different samples and there are no set guidelines for any particular sample type However if they differ by too much within a set of experiments approximately 3 fold or more this indicat
58. als 1 5 mL USA Scientific P N 1415 2600 or equivalent Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier pipette tips and non barrier pipette tips Heatblock 2 2 5 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Reagent Preparation 12X MES Stock Buffer 1 22M MES 0 89M Na For 1 000 mL 64 61g of MES hydrate 193 3g of MES Sodium Salt 800 mL of Molecular Biology Grade water Mix and adjust volume to 1 000 mL The pH should be between 6 5 and 6 7 Filter through a 0 2 um filter IMPOR Do not autoclave Store at 2 C to 8 C and shield from light Discard solution if yellow 2X Hybridization Buffer Final 1X concentration is 100 mM MES 1M Na 20 mM EDTA 0 01 Tween 20 For 50 mL 8 3 mL of 12X MES Stock Buffer 17 7 mL of 5M NaCl 4 0 mL of 0 5M EDTA 0 1 mL of 10 Tween 20 19 9 mL of water Store at 2 C to 8 C and shield from light 2 2 6 CHAPTER 2 Eukaryotic Target Hybridization Eukaryotic Target Hybridization Please refer to the table below for the necessary amount of cRNA required for appropriate probe array format These recipes take into account that it is necessary to make extra hybridization cocktail due to a small loss of volume 10 20 uL during each hybridization 1 Mix the following for each target scaling up volumes for hybridization to multiple probe arrays IMPOR If using the GeneChip IVT Labeling Kit to
59. ample and Array Processing Table 2 119 Reverse Transcriptase Volumes for First Strand cDNA Synthesis Reaction Total RNA pg SuperScript II RT pL 200U pL 5 0 to 8 0 10 8 1 to 16 0 2 0 16 1 to 20 0 3 0 v Not a The combined volume of RNA DEPC treated H O and SuperScript II RT should not exceed 11 uL as indicated in Table 2 1 20 Table 2 120 First Strand cDNA Synthesis Components Final Concentration Volume or Amount in Reaction 1 Primer Hybridization DEPC treated H20 variable for final reaction volume of 20 uL Incubate at 70 C for 10 minutes T7 Oligo dT Primer 50 JM 2 HL 100 pmol Quick spin and put on ice RNA variable 5 0 to 20 ug 5 0 to 20 ug 2 Temperature Adjustment 5X First Strand cDNA buffer 4 uL 1X Add to the above tube and mix well 0 1 M DTT 2 uL 10 mM DTT Incubate at 42 C for 2 minutes 10 mM dNTP mix 1 UL 500 M each 3 First Strand Synthesis SuperScript II RT variable See Table 2 119 200 U to 1000 U Add to the above tube and mix well 200 U uL Incubate at 42 C for 1 hour Total Volume 20 pL v Not a The above incubations have been changed from the SuperScript protocols and are done at 42 C 2 1 42 CHAPTER 1 Eukaryotic Target Preparation Step 2 Second Strand cDNA Synthesis 1 Place First Strand reactions on ice Centrifuge briefly to bring down condensation on sides of tube 2 Add to the First Strand synthesis tube the reagents listed in the following Secon
60. aneous Supplies Sterile RNase free microcentrifuge vials 15 mL USA Scientific P N 1415 2600 or equivalent Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier RNase free pipette tips Tips must be pointed not rounded for efficient use with the probe arrays Beveled pipette tips may cause damage to the array septa and cause leakage Mini agarose gel electrophoresis unit with appropriate buffers UV spectrophotometer Bioanalyzer Non stick RNase free microfuge tubes 0 5 mL and 15 mL Ambion P N12350 and P N 12450 respectively Alternative Protocol for One Cycle cDNA Synthesis GeneChip T7 Oligo dT Promoter Primer Kit 5 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG dT 3 50 uM HPLC purified Affymetrix P N 900375 SuperScript II Invitrogen Life Technologies P N 18064 014 or SuperScript Choice System for cDNA Synthesis Invitrogen Life Technologies P N 18090 019 SuperScript Choice System contains in addition to SuperScript II Reverse Transcriptase other reagents for cDNA synthesis However not all components provided in the Choice System are used in the GeneChip cDNA synthesis protocol E coli DNA Ligase Invitrogen Life Technologies P N 18052 019 E coli DNA Polymerase Invitrogen Life Technologies P N 18010 025 E coli RNaseH Invitrogen Life Technologies P N 18021 071 T4 DNA Polymerase Invitrogen Life Technologies P N 18005 025 5X Second strand buffer Invitro
61. are using the Agilent GeneArray Scanner or 10 minutes if you are using the GeneChip Scanner 3000 If probe array was stored at 4 C warm to room temperature before scanning Refer to the Microarray Suite online help and the appropriate scanner user s manual for more information on scanning The scanner uses a laser and is equipped with a safety interlock system Defeating the interlock system may result in exposure to hazardous laser light You must have read and be familiar with the operation of the scanner before attempting to scan a probe array Please refer to the Microarray Suite User s Guide P N 08 0081 or to the GeneChip Scanner 3000 quick reference card P N 08 0075 Handling the GeneChip Probe Array IMPORI AFFYMETRIX Before you scan the probe array follow the directions in this section on handling the probe array If necessary clean the glass surface of probe array with a non abrasive towel or tissue before scanning Do not use alcohol to clean glass Before scanning the probe array cartridge follow this procedure to apply Tough Spots to the probe array cartridge to prevent the leaking of fluids from the cartridge during scanning Apply the spots just before scanning Do not use them in the hyb process 1 On the back of the probe array cartridge clean excess fluid from around septa 2 Carefully apply one Tough Spot to each of the two septa Press to ensure that the spots remain flat If the Tou
62. ary files mask files m Fluidics Protocols fluidics station scripts z Experiment Data exp dat cel and chp files are all saved to location selected here 3 Verify that all three file locations are set correctly and click OK Contact Affymetrix Technical Support if you have any questions regarding this procedure Step 2 Entering Experiment Information AFFYMETRIX To wash stain and scan a probe array an experiment must first be registered in GCOS or Microarray Suite Please follow the instructions detailed in the Setting Up an Experiment section of the appropriate GCOS or Microarray Suite User s Guide The fields of information required for registering experiments in Microarray Suite are m Experiment Name m Probe Array Type In GCOS three additional fields are required z Sample Name z Sample Type m Project Sample templates Experiment templates and array barcodes can also be employed in GCOS to standardize and simplify the registration process Please see the GCOS User s Guide for more information The Project Sample Name and Experiment Name fields establish a sample hierarchy that organizes GeneChip gene expression data in GCOS In terms of the organizational structure the Project 1s at the top of the hierarchy followed by Sample Name and then Experiment Name PROJECT V SAMPLE V EXPERIMENT Eukaryotic 2 3 8 SECTION 2 Eukaryotic Sample and Array Process
63. ault path set in MAS After putting the computer on When networking computers the name of the the network the probe array computer is often changed to correspond to an descriptions are not available organization s standard conventions This and a SQL error message results in a breakdown of the connection appears between MAS and the Microsoft Data Engine MSDE After the computer is renamed uninstall MAS and MSDE and reinstall MAS Microarray Suite is on the C drive and it s filling up The library and protocol files can be moved or dragged to another larger drive Remember to change the default path for the library and protocol files in MAS and modify this path for each log in name In addition GeneChip data should always be stored locally on the largest available drive on the workstation The gene descriptions show up This is a result of different security settings for some users and not for between users and administrators of the others workstation Call Affymetrix Technical Support for information on how to change the registry to correct this 701045 Rev 3 Section 5 ra List of Controls on GeneChip Probe Arrays Table 5 C 1 Control Genes on GeneChip probe arrays Origin of Organism Control Gene Name Utility for GeneChip Experiments Associated Affymetrix Products Eukaryotic synthetic B2 Oligo Grid alignment Control Oligo B2 P N Arra
64. beling The One Cycle Eukaryotic Target Labeling Assay experimental outline is represented in Figure 2 1 1 Total RNA 1 ug to 15 ug or mRNA 0 2 ug to 2 ug is first reverse transcribed using a T7 Oligo dT Promoter Primer in the first strand cDNA synthesis reaction Following RNase H mediated second strand cDNA synthesis the double stranded cDNA is purified and serves as a template in the subsequent in vitro transcription IVT reaction The IVT reaction is carried out in the presence of T7 RNA Polymerase and a biotinylated nucleotide analog ribonucleotide mix for complementary RNA cRNA amplification and biotin labeling The biotinylated cRNA targets are then cleaned up fragmented and hybridized to GeneChip expression arrays For smaller amounts of starting total RNA in the range of 10 ng to 100 ng an additional cycle of cDNA synthesis and IVT amplification is required to obtain sufficient amounts of labeled cRNA target for analysis with arrays The Two Cycle Eukaryotic Target Labeling Assay experimental outline is also represented in Figure 2 1 1 After cDNA synthesis in the first cycle an unlabeled ribonucleotide mix is used in the first cycle of IVT amplification The unlabeled cRNA is then reverse transcribed in the first strand cDNA synthesis step of the second cycle using random primers Subsequently the T7 Oligo dT Promoter Primer is used in the second strand cDNA synthesis to generate double stranded cDNA template containing T7 pro
65. cal sample 3 Sample evaporation can lead to changes in the salt concentration of the solution which can affect the stringency conditions for hybridization How many times can I scan an array before the data is affected It is always best to capture the data on the initial scan Scanning bleaches the fluorophore and will result in reduction in signal intensity of 10 20 with each scan of the GeneArray Scanner and 3 5 with each scan of the GeneChip Scanner 3000 Therefore subsequent scans will not give signals equivalent to the initial scan How often do I need to do maintenance on the fluidics station With normal use e g 20 arrays module week we recommend the following schedule Every week the needle bleaching protocol i e Bleach fluidic protocol should be performed on a monthly basis the full fluidics bleaching protocol i e Monthly Decontamination protocol should be performed and the peristaltic pump tubing replaced Please refer to Section 4 Fluidics Station Maintenance Procedures for more detail AFFYMETRIX r 5 B 5 Appendices 5 B 6 SECTION 5 Appendices What fluidic script do I use The appropriate fluidic script is specific to the array format and the organism eukaryotic or prokaryotic and the model of Fluidics Station being used Scripts for FS 450 and FS 250 are identified by a 450 suffix Information on the array format and appropriate script is contained in the package
66. cation of FlexM idi_euk2v3 for GeneChip P aeruginosa Array GeneChip P aeurginosa Genome Array requires a modification to the FlexMidi_euk2v3 or the FlexMidi_euk2v3_450 protocol See below for details The FlexMidi_euk2v3 or the FlexMidi_euk2v3_450 fluidics protocol must be modified Please follow the instructions carefully to make the modifications Additionally it is highly recommended that you save your new P aeruginosa fluidic protocol under a different name to avoid confusion 1 Modify and save the fluidic protocol for the assay a Modify the fluidic protocol by using Tools Edit Protocol drop down list and selecting FlexMidi_euk2v3 or the FlexMidi euk2v3 450 within the Protocol Name window b Change the following parameters Enter the new parameters by highlighting the default values and typing in the new values 1 wash Al temperature from 30 C to 25 C 1i 2nd Stain Time seconds from 300 to 600 and 111 3rd Stain Time seconds from 300 to 600 Save the modified fluidic protocol by highlighting FlexMidi euk2v3 or the FlexMidi euk2v3 450 within the Protocol Name window and typing over with an assigned protocol name e g Pae cDNA Click Save The new fluidics protocol should be present in the Protocol drop down list and is used in the subseguent steps Select the name of the newly modified protocol e g Pae cDNA from the Protocol drop down list in the Fluidics Station dialog box Select
67. coli DNA Polymerase 4 uL 40U 2 U uL E coli RNase H luL 2U Final Volume 150 pL 3 Gently tap tube to mix Then briefly spin in a microcentrifuge to remove condensation and incubate at 16 C for 2 hours in a cooling waterbath 4 Add2uL 10 U T4 DNA Polymerase 5 Return to 16 C for 5 minutes 6 Add 10 uL 0 5M EDTA 7 Proceed to cleanup procedure for cDNA Cleanup of Double Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays on page 2 1 32 or store at 20 C for later use AFFYMETRIX AM 2 1 45 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing 2 1 46 2 gt de G x gt m 701027 Rev 4 Section 2 N f Eukaryotic Target Hybridization 701027 Rev 4 Reagents and Materials Required 2 2 3 Re gent Preparati n n un ee Bes A a k 2 2 6 Eukaryotic Target Hybridization Como onen 2 251 This Chapter Contains m Detailed steps for preparing the eukaryotic hybridization mix containing labeled target and control cRNA m Instructions for hybridizing the target mix to a eukaryotic GeneChip probe array After completing the procedures described in this chapter the hybridized probe array is ready for washing staining and scanning as detailed in Section 2 Chapter 3 2 2 3 2 4 gt 4 7 W SECTION 2 Eukaryotic Sample and Array Processing 2 2 4 CHAPTER 2 Eukaryotic Target Hybridiza
68. contains probe sets for several B subtilis genes that are absent in eukaryotic samples lys phe thr and dap These poly A RNA controls are in vitro synthesized and the polyadenylated transcripts for these B subtilis genes are pre mixed at staggered concentrations The concentrated Poly A Control Stock can be diluted with the Poly A Control Dil Buffer and spiked directly into the RNA samples to achieve the final concentrations referred to as a ratio of copy number summarized below Table 2 17 Final Concentrations of Poly A RNA Controls in Samples Final Concentration Poly A RNA Spike ratio of copy number lys 1 100 000 phe 1 50 000 thr 1 25 000 dap 1 7500 The controls are then amplified and labeled together with the samples Examining the hybridization intensities of these controls on GeneChip arrays helps to monitor the labeling process independently from the quality of the starting RNA samples Typical GeneChip array results from these poly A Spike in Controls are shown in Figure 2 1 4 For Drosophila Genome Arrays P N 900335 and 900336 and Yeast Genome S98 Arrays P N 900256 and 900285 the 3 AFFX r2 Bs probe sets are not available Note that the data shown here may not be representative of those obtained using the previous generation AFFX Spike in transcript name X probe sets on the GeneChip arrays listed above 2 Users who do not purchase this Kit may be required to obtain a license under U S Patent Nos
69. ction v Note If the color of the mixture is orange or violet add 10 UL of 3M sodium acetate pH 5 0 and mix The color of the mixture will turn to yellow 3 Apply 500 uL of the sample to the cDNA Cleanup Spin Column sitting in a 2 mL Collection Tube supplied and centrifuge for 1 minute at gt 8 000 x g gt 10 000 rpm Discard flow through 4 Reload the spin column with the remaining mixture and centrifuge as above Discard flow through and Collection Tube 5 Transfer spin column into a new 2 mL Collection Tube supplied Pipet 750 uL of the cDNA Wash Buffer onto the spin column Centrifuge for 1 minute at gt 8 000 x g gt 10 000 rpm Discard flow through v4 Note cDNA Wash Buffer is supplied as a concentrate Ensure that ethanol is added to the z cDNA Wash Buffer before use see IMPORTANT note above before starting 6 Open the cap of the spin column and centrifuge for 5 minutes at maximum speed lt 25 000 x g Discard flow through and Collection Tube Recommendal Label the collection tubes with the sample name During centrifugation some column caps may break resulting in loss of sample information Place columns into the centrifuge using every second bucket Position caps over the adjoining bucket so that they are oriented in the opposite direction to the rotation 2 1 32 CHAPTER 1 Eukaryotic Target Preparation AFFYMETRIX 8 i e if the microcentrifuge rotates in a clockwise direction orie
70. d Strand Final Reaction Composition Table Table 2 1 21 Table 2 121 Second Strand Final Reaction Composition Final Concentration or voume Amount in Reaction DEPC treated water 91 uL 5X Second Strand Reaction Buffer 30 uL 1X 10 mM dNTP mix 3 uL 200 uM each 10 U uL E coli DNA Ligase luL 10 U 10 U uL E coli DNA Polymerase 4 uL 40U 2 U uL E coli RNase H 1 UL 2U Final Volume 150 pL 3 Gently tap tube to mix Then briefly spin in a microcentrifuge to remove condensation and incubate at 16 C for 2 hours in a cooling waterbath 4 Add 2uL 10 U T4 DNA Polymerase 5 Return to 16 C for 5 minutes 6 Add 10 uL 0 5M EDTA 7 Proceed to cleanup procedure for cCDNA Cleanup of Double Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays on page 2 1 32 or store at 20 C for later use AFFYMETRIX s a 2 1 43 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Alternative Protocol for One Cycle cDNA Synthesis from Purified Poly A mRNA This protocol is a supplement to instructions provided in the Invitrogen Life Technologies SuperScript Choice system Please note the following before proceeding m Read all information and instructions that come with reagents and kits z Use the GeneChip T7 Oligo dT Promoter Primer Kit for priming first strand CDNA synthesis in place of the oligo dT or random primers provided with the SuperScript Choice kit The GeneC
71. d Reagent Reference List Reagent List A Acetic Acid Glacial Sigma Aldrich P N A6283 Acetylated Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561020 Ammonium Acetate 7 5 M Sigma Aldrich P N A2706 Anti streptavidin antibody goat biotinylated Vector Laboratories P N BA 0500 Antibody goat Anti streptavidin biotinylated 0 5 mg Vector Laboratories P N BA 0500 Antibody IgG Goat Reagent Grade 50 mg Sigma Aldrich P N 15256 y S ATP 20 umoles Roche Molecular Biochemical P N 1162306 B Bleach 5 25 Sodium Hypochlorite VWR Scientific Products P N 21899 504 Bovine Serum Albumin BSA solution 50 mg mL Acetylated Invitrogen Life Technologies P N 15561020 C CHROMA SPIN 100 Columns in Swing Bucket Format CLONTECH P N K1302 1 Control Oligo B2 30 nM Affymetrix P N 900301 D dATP dCTP dGTP dTTP Amersham Pharmacia Biotech P N 27 2035 01 Deoxyribonuclease I DNase I Amersham Pharmacia Biotech P N 27 0514 01 DMSO Hybrid Max Sigma Aldrich P N D2650 DNA Herring Sperm Promega Corporation P N D1811 DNA Ligase E coli Invitrogen Life Technologies P N 18052 019 DNA Polymerase E coli Invitrogen Life Technologies P N 18010 025 DNA Polymerase T4 Invitrogen Life Technologies P N 18005 025 dNTP 10 mM Invitrogen Life Technologies P N 18427 013 DTT 100 mM Epicentre Technologies P N M4410K supplied with MMLV Reverse Transcriptase E
72. d cDNA Buffer Invitrogen Supplied with SS II RT 4uL 1 mL 250 0 1M DTT Invitrogen Supplied with SS II RT 2 uL 250 uL 125 10 mM dNTP Mix Invitrogen 18427 013 1 uL 100 uL 100 SuperScript II RT Invitrogen 18064 014 1 2 or 3 uL 50 uL 10 000 U 50 25 or 16 Second Strand cDNA Synthesis DEPC Water Ambion 9920 91 uL 500 mL 5 494 5x Second Strand cDNA Buffer Invitrogen 10812 014 30 uL 500 uL 16 10 mM dNTP Mix Invitrogen 18427 013 3 uL 100 uL 33 E coli DNA Ligase Invitrogen 18052 019 1 uL 10 uL 100 U 10 E coli DNA Polymerase Invitrogen 18010 025 4 uL 100 uL 1 000 U 25 E coli RNase H Invitrogen 18021 071 1 uL 60 uL 120 U 60 T4 DNA Polymerase Invitrogen 18005 025 2 UL 50 uL 250 U 25 0 5M EDTA Invitrogen 15575 020 10 uL 400 mL 4X 100 40 000 cDNA Cleanup GeneChip Sample Cleanup Module Affymetrix 900371 30 IVT Reaction Enzo BioArray RNA Labeling Kit Affymetrix 900182 10 Distilled or Deionized Water ss a Ss S CRNA Cleanup GeneChip Sample Cleanup Module Affymetrix 900371 30 cRNA Fragmentation GeneChip Sample Cleanup Module Affymetrix 900371 gt 30 110 mM dNTP Mix used for both 1st and 2nd Strand reactions for a total of 4 uL per reaction Each tube of dNTP Mix contains 100 uL so each tube is sufficient for 25 reactions 2 Note The GeneChip Sample Cleanup Module contains reagents and columns for both the cDNA and the IVT cRNA cleanup 3 Note 5x Fragmentation Buffer is incl
73. e 2 1 19 c Add RNase free Water to a final volume of 5 uL d Gently flick the tube a few times to mix then centrifuge the tubes briefly 5 seconds to collect the solution at the bottom of the tube e Incubate for 6 minutes at 70 C f Cool the sample at 4 C for at least 2 minutes Centrifuge briefly 5 seconds to collect the sample at the bottom of the tube 2 In a separate tube assemble the First Cycle First Strand Master Mix a Prepare sufficient First Cycle First Strand Master Mix for all of the total RNA samples When there are more than 2 samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 11 is for a single reaction CHAPTER 1 Eukaryotic Target Preparation AFFYMETRIX Table 2 L11 Preparation of First Cycle First Strand Master Mix Component Volume 5X 15t Strand Reaction Mix 2 0 HL DTT 0 1M 10 uL RNase Inhibitor 0 5 uL dNTP 10 mM 0 5 uL SuperScript Il 10 uL Total Volume 5 0 uL b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the solution at the bottom of the tube Transfer 5 uL of First Cycle First Strand Master Mix to each total RNA sample T7 Oligo dT Primer Poly A Controls Mix as in Table 2 1 10 from the previous step for a final volume of 10 uL Mix thoroughly by gently flicking the tube a few times
74. e best possible working condition we recommend that the following decontamination protocol be performed on your fluidics station at least once a month in addition to the weekly cleaning described above The protocol reguires approximately 2 hours to run This protocol ensures that all of the tubing associated with the station is kept thoroughly clean Keeping this tubing as clean as possible ensures that array images will be optimized and high quality results will be obtained 1 Prepare 2 liters of 0 525 sodium hypochlorite solution using distilled water Mix well 2 Place all three wash lines of the fluidics station in 1 liter of 0 525 sodium hypochlorite solution 3 Run the Prime protocol page 2 4 8 on all four modules with wash lines in 0 525 sodium hypochlorite solution instead of wash buffers A and B a Run the Shutdown protocol page 2 4 20 on all four modules with wash lines in 0 525 sodium hypochlorite solution instead of distilled water 5 Follow Bleach Protocol as described on page 4 1 4 with the following change in Step 3 place the three wash lines of the fluidics station in 1 liter of 0 525 sodium hypochlorite solution instead of distilled water 6 Change intake tubing and peristaltic tubing if required as described in the Fluidics Station 400 User s Guide or the Fluidics Station 450 250 User s Guide 7 Run the Bleach protocol Fluidics Station 400 or the Bleach_450 protocol Fluidics Station 450
75. e cDNA CHAPTER 1 Eukaryotic Target Preparation Table 2 L17 IVT Reaction Template cDNA variable see table above RNase free Water variable to give a final reaction volume of 40 uL 10X IVT Labeling Buffer 4 uL IVT Labeling NTP Mix 12 uL IVT Labeling Enzyme Mix 4 uL Total Volume 40 pL 0 5 to 1 ug of the 3 Labeling Control can be used in place of the template cDNA sample in this reaction as a positive control for the IVT components in the kit 3 Carefully mix the reagents and collect the mixture at the bottom of the tube by brief 5 seconds microcentrifugation 4 Incubate at 37 C for 16 hours To prevent condensation that may result from water bath style incubators incubations are best performed in oven incubators for even temperature distribution or in a thermal cycler Overnight IVT reaction time has been shown to maximize the labeled cRNA yield i with high guality array results Alternatively if a shorter incubation time 4 hours is desired 1 uL 200 units of cloned T7 RNA polymerase can be purchased directly from Ambion P N 2085 can be added to each reaction and has been shown to produce adequate labeled cRNA yield within 4 hours The two different incubation protocols generate comparable array results and users are encouraged to choose the procedure that best fits their experimental schedule and process flow 5 Store labeled cRNA at 20 C or 70 C if not purifying immediately Alternativ
76. e mt eR SES N e alee oH 1 1 7 Limitations s sure A da Ose oe ae b tdi es 1 1 7 This Chapter Contains z An overview of GeneChip Expression Analysis z A summary of the procedures covered in the remainder of the manual 701023 Rev 3 1 1 3 SECTION 1 GeneChip Expression Analysis Overview Introduction and Objectives Welcome to the Affymetrix GeneChip Expression Analysis Technical Manual This manual is a technical guide for using GeneChip expression analysis probe arrays All protocols included in this manual have been used successfully by scientists at Affymetrix or have been recommended by our collaborators during the development of particular products The field of mRNA gene expression monitoring is rapidly evolving and periodic technical updates to this manual will reflect the newest protocols and information for using GeneChip probe arrays This manual applies to all GeneChip expression products As an Affymetrix GeneChip user your feedback is welcome Please contact our technical support team with any input on how we can improve this resource Explanation of GeneChip Probe Arrays GeneChip probe arrays are manufactured using technology that combines photolithography and combinatorial chemistry Tens to hundreds of thousands of different oligonucleotide probes are synthesized on each array Each oligonucleotide is located in a specific area on the array called a probe cell Each probe cell contains millio
77. e reaction at the bottom of the tube Proceed to Step 4 First Cycle IVT Amplification of cRNA on page 2 1 25 No cDNA cleanup is required at this step CHAPTER 1 Eukaryotic Target Preparation Step 4 First Cycle IVT Amplification of CRNA MEGAscript T7 Kit Ambion Inc is used for this step v Not a The following program can be used as a reference to perform the First cycle IVT Amplification of cRNA reaction in a thermal cycler 37 C 16 hours 4 C hold 1 Ina separate tube assemble the First Cycle IVT Master Mix at room temperature a Prepare sufficient First Cycle IVT Master Mix for all of the samples When there are more than 2 samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 13 is for a single reaction Table 2 113 Preparation of First Cycle IVT Master Mix Component Volume 10X Reaction Buffer 5 pL ATP Solution 5 uL CTP Solution 5 uL UTP Solution 5 uL GTP Solution 5 uL Enzyme Mix 5 uL Total Volume 30 pL b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the solution at the bottom of the tube 2 Transfer 30 uL of First Cycle IVT Master Mix to each cDNA sample At room temperature add 30 uL of the First Cycle VT Master Mix to each 20 uL of cDNA sample from Step 3 First Cycle Second Strand cDNA Synthesis on p
78. e to perform the first strand cDNA synthesis reaction in a thermal cycler the 4 C holds are for reagent addition steps 70 C 10 minutes 4 C hold 42 C 2 minutes 42 C 1 hour 4 C hold 1 Mix RNA sample diluted poly A RNA controls and T7 Oligo dT Primer Table 2 L3 RNA T7 Oligo dT Primer Mix Preparation for 1 to 8 ug of total RNA or 0 2 to 1 ug of mRNA Component Volume Sample RNA variable Diluted poly A RNA controls 2 uL T7 Oligo dT Primer 50 uM 2 uL RNase free Water variable Total Volume 12 pL Table 2 14 RNA T7 Oligo dT Primer Mix Preparation for 8 1 to 15 ug of total RNA or gt 1 ug of MRNA Component Volume Sample RNA variable Diluted poly A RNA controls 2 uL T7 Oligo dT Primer 50 uM 2 uL RNase free Water variable Total Volume TL pL a Place total RNA 1 ug to 15 ug or mRNA sample 0 2 ug to 2 ug in a 0 2 mL PCR tube b Add 2 uL of the appropriately diluted poly A RNA controls See Step 1 Preparation of Poly A RNA Controls for One Cycle cDNA Synthesis Spike in Controls on page 2 1 13 c Add 2 uL of 50 uM T7 Oligo dT Primer d Add RNase free Water to a final volume of 11 or 12 uL see Table 2 1 3 and Table 2 1 4 e Gently flick the tube a few times to mix and then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube 2 1 16 CHAPTER 1 Eukaryotic Target Preparation f Incubate the reaction for 10 minutes at 70 C g Cool t
79. econds in Stain the probe array for 10 minutes tain in antibody solution mix at 25 C antibody solution mix at 25 C in antibody solution Mix at 25 C rd Stai Stain the probe array for 300 seconds Stain the probe array for 600 seconds in Stain the probe array for 10 minutes 3 Stain in SAPE Solution at 25 C SAPE Solution at 25 C in SAPE Solution at 25 C Final 15 cycles of 4 mixes cycle with Wash 15 cycles of 4 mixes cycle with Wash 15 cycles of 4 mixes cycle with Wash Wash Buffer A at 30 C The holding Buffer A at 30 C The holding Buffer A at 30 C The holding as temperature is 25 C temperature is 25 C temperature is 25 C a FlexMidi euk2v 450 for the FS 450 250 b prokGE_ws2_450 for the FS 450 250 If you are using the Fluidics Station 450 250 Washing and Staining the Probe Array 1 Insert the appropriate probe array into the designated module of the fluidics station while the cartridge lever is down or in the eject position When finished verify that the cartridge lever is returned to the up or engaged position 2 Remove any microcentrifuge vial s remaining in the sample holder of the fluidics station module s being used 3 If prompted to Load Vials 1 2 3 place the three experiment sample vials the microcentrifuge vials into the sample holders 1 2 and 3 on the fluidics station a Place one vial containing streptavidin phycoerythrin SAPE solution mix in sample holder 1 b Place one vial containi
80. ediately rather than freezing them Although it is common practice to use stored frozen RNA samples in the process eliminating freeze thaws will most likely yield higher quality cRNA APPENDIX B FAQs amp Troubleshooting Data Analysis AFFYMETRIX I have observed on occasion that multiple _at probe sets are mapped to the same gene but give different expression results How do I reconcile the difference There are various reasons why this happens With increasing knowledge of the genome the unique probe sets _at probe sets that were initially designed may turn out to represent subclusters that have collapsed into a single cluster in a later design Therefore it may seem that multiple unique _at probe sets now correspond to a single gene Different results from the probe sets could be observed due to the following reasons 1 They represent splice variants or may cross hybridize to different members that belong to a highly similar gene family or transcripts with different poly A sites 2 One probe set is more 5 than the other 3 One probe set is better designed than the other TM In these cases it is important to use the resources available on the NetAffx Analysis Center www affymetrix com to understand if any of the above scenarios apply Other expression analysis techniques may also be used to confirm which probe set reflects the transcript level more accurately What 3 5 ratio for control genes f
81. edures are carried out by the Fluidics Station A modified FlexMidi euk2v3 fluidic script FlexMidi euk2v3 450 if you are using the FS 450 is used for the GeneChip P aeruginosa Genome Array and the ProkGE WS2 fluidic script ProkGE WS2 450 if you are using the FS 450 is used for the GeneChip E coli Antisense Genome Array The procedures take approximately 75 and 90 minutes respectively to complete The use of streptavidin in the first part of the stain procedure enhances the overall signal Preparing the Staining Reagents 1 Prepare the following stain and wash solutions the day of the procedure The solutions are stable for approximately 6 to 8 hours at 4 C Volumes given are sufficient for one probe array Streptavidin Phycoerythrin SAPE should be stored in the dark at 4 C either foil wrapped or kept in an amber tube Remove SAPE from refrigerator and tap the tube to mix well before preparing stain solution Do not freeze SAPE Always prepare the SAPE stain solution immediately before use Table 3 4 1 Streptavidin Solution M ix Vial 1 Components Volume Final Concentration 2X MES Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 uL 2 mg mL 1 mg mL Streptavidin 6 0 uL 10 ug mL DI H 0 270 0 UL Total Volume 600 HL 3 4 9 Prokaryotic 3 4 10 SECTION 3 Prokaryotic Sample and Array Processing Table 3 4 2 Antibody Solution M ix Vial 2 Components Volume Final C
82. ely proceed to Cleanup and Quantification of Biotin Labeled cRNA on page 2 1 36 AFFYMETRIX a 2 1 35 Eukaryotic 2 1 36 SECTION 2 Eukaryotic Sample and Array Processing Cleanup and Quantification of Biotin Labeled cRNA Sample Cleanup Module is used for cleaning up the Biotin Labeled cRNA Reagents to be Supplied by User a Ethanol 96 100 v v a Ethanol 80 v v All other components needed for cleanup of biotin labeled cRNA are supplied with the GeneChip Sample Cleanup Module Step 1 Cleanup of Biotin Labeled cRNA IMPO a BEFORE STARTING please note It is essential to remove unincorporated NTPs so that the concentration and purity of cRNA can be accurately determined by 260 nm absorbance DO NOT extract biotin labeled RNA with phenol chloroform The biotin will cause some of the RNA to partition into the organic phase This will result in low yields m Save an aliquot of the unpurified IVT product for analysis by gel electrophoresis m VT cRNA Wash Buffer is supplied as a concentrate Before using for the first time add 20 mL of ethanol 96 100 as indicated on the bottle to obtain a working solution and checkmark the box on the left hand side of the bottle label to avoid confusion IVT cRNA Binding Buffer may form a precipitate upon storage If necessary redissolve by warming in a water bath at 30 C and then place the buffer at room temperature All steps of the protocol should be perfor
83. emperature is 25 C temperature is 25 C e Wash Buffer A non stringent wash buffer e Wash Buffer B stringent wash buffer When using the Fluidics Station 450 or 250 add _450 at the end of the fluidics script s name AFFYMETRIX Ca 2 3 11 Eukaryotic 2 3 12 SECTION 2 Eukaryotic Sample and Array Processing FS 450 If you are using the Fluidics Station 450 250 Washing and Staining the Probe Array In the Fluidics Station dialog box on the workstation select the correct experiment name from the drop down Experiment list gt The Probe Array Type appears automatically In the Protocol drop down list select the appropriate antibody amplification protocol to control the washing and staining of the probe array format being used Table 2 3 3 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions in the LCD window on the fluidics station If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the appropriate Fluidics Station User s Guide or Quick Reference Card P N 08 0093 for the FS 450 250 fluidics stations Insert the appropriate probe array into the designated module of the fluidics station while the cartridge lever is in the down or eject position When finished verify that the cartridge lever is returned to the up or engaged position Remove any microcentrifuge vial remaining in the
84. en Life Technologies P N 15596 018 Tubes Sterile RNase free microcentrifuge 1 5 mL USA Scientific P N 1415 2600 Tubing Tygon 0 04 inner diameter Cole Parmer P N H 06418 04 Tween 20 10 Pierce Chemical P N 28320 V Vacuum filter units 1 liter capacity 0 20 um or 0 45 um Corning P N 25988 1L W Water DEPC Treated Ambion P N 9902 Water Distilled Invitrogen Life Technologies P N 15230147 Water Molecular Biology Grade BioWhittaker Molecular Applications Cambrex P N 51200 701044 Rev 3 Section 5 Appendix B FAOs amp Troubleshooting FAQs This section contains frequently asked questions related to GeneChip expression analysis Sample Preparation 701044 Rev 3 What is the minimum amount of total RNA I can use for each microarray experiment We currently recommend 5 ug of total RNA for our standard eukaryotic expression arrays Reducing the amount of starting material used in the standard assay may result in a subsequent decrease in sensitivity Additionally a Technical Note GeneChip Eukaryotic Small Sample Target Labeling Assay Version II is available on www affymetrix com describing a small sample target labeling protocol and reporting results from Affymetrix using this protocol on reduced starting material Contact Affymetrix Technical Support for any questions concerning this alternative protocol What is the least amount of labeled eukaryotic cRNA target I can put on an array
85. enerate comparable results relative to the previously recommended phenol chloroform extraction for cDNA purification Highly concordant results have been obtained during our product development process by comparing global array hybridization results obtained from samples cleaned up with both protocols The concordance was determined based on the overall signal intensity as well as the qualitative calls However due to the different mechanisms associated with each cleanup procedure there will be minor differences in the data obtained For example cDNA cleanup column reduces the recovery of fragments of 100 nucleotides or less whereas these fragments are retained in the phenol chloroform method However we do believe these differences are minor in magnitude Customers are encouraged to perform their own comparisons and analysis to determine when to adopt the Sample Cleanup Module into their laboratories Hybridization Washing and Staining What happens if the hybridization time is extended beyond 16 hours The standard gene expression hybridization time is 14 16 hours at 45 C At high temperatures or with longer incubation times the sample will evaporate Loss of sample is undesirable for several reasons 1 Low volume of hybridization solution in the probe array can lead to dry spots that will show up as uneven hybridization and thus compromise data 2 Sample loss compromises the possibility of repeating the experiment with the identi
86. eotides on the surface of the probe arrays are called probes because they probe or interrogate the sample Target The target is the labeled nucleic acid that is being interrogated It is hybridized to the probes on the array Probe Cell Specific areas on the probe array that contain oligonucleotides of a specific sequence Interfering Conditions C AUTI i Wear powder free gloves throughout procedure Take steps to minimize the introduction of exogenous nucleases Water used in the protocols below is molecular biology grade nuclease free Proper storage and handling of reagents and samples is essential for robust performance All laboratory equipment used to prepare the target during this procedure should be calibrated and carefully maintained to ensure accuracy as incorrect measurement of reagents may affect the outcome of the procedure Instruments The Affymetrix GeneChip Expression Analysis Technical Manual is designed for use in a system consisting of a Fluidics Station a Hybridization Oven 640 and a Scanner References 1 Sambrook J Fritsch E F Maniatis T Molecular Cloning A Laboratory Manual v 1 Cold Spring Harbor Laboratory Press Cold Spring Harbor NY p 21 52 1989 2 See www affymetrix com for current GeneChip technology references Limitations The results of the assay kit are dependent upon the quality of the input RNA subsequent proper handling of nucleic acids and other reagents z T
87. es wide variation in the dat files Therefore the analyzed data in the chp file should be treated with caution APPENDIX B FAQs amp Troubleshooting AFFYMETRIX Should I always anticipate the hybridization controls bioB bioC bioD and cre to be called as Present The four transcripts are added to the hybridization cocktail at staggered concentrations At 1 5 pM bioB is at the detection limit for most expression arrays and is anticipated to be called Present at least 70 of the time In contrast the other controls should be called Present all of the time with increasing Signal values bioC bioD and cre respectively Absent calls or relatively low Signal values indicate a potential problem with the hybridization reaction or subsequent washing and staining steps Check to see if the hybridization cocktail was prepared correctly if the recommended hybridization temperature and Fluidic Protocol were used and make sure the SAPE staining solution did not deteriorate Other than qualitative calls and Signal values the 3 5 ratio data for these controls are not as informative since they do not relate to the quality of the samples and data What does high background mean A high background implies that impurities such as cell debris and salts are binding to the probe array in a nonspecific manner and that these substances are fluorescing at 570 nm the scanning wavelength This nonspecific binding causes a low signal to
88. f dap thr phe and lys genes from B subtilis These genes have been cloned into Stratagene pBluescript as an Xho I to Not I insert 5 to 3 respectively see Section 2 Chapter 2 Controls for Eukaryotic Arrays pGIBS lysATCC 87482 pGIBS pheATCC 87483 pGIBS thrATCC 87484 pGIBS dapATCC 87486 Xho I Not I T3 5 3 T7 These clones can be digested with the Not I restriction enzyme to produce linear template DNA for the subsequent in vitro transcription IVT to produce sense RNA by T3 RNA polymerase as control molecules Bacteria containing these recombinant plasmids can be obtained from the American Type Culture Collection ATCC CHAPTER 2 Preparation of Control Spike In Transcripts Reagents and Materials Required AFFYMETRIX a The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual z Expression Control Clones American Type Culture Collection ATCC z PGIBS lys ATCC 87482 z pGIBS phe ATCC 87483 a PGIBS thr ATCC 87484 z pGIBS dap ATCC 87486 z Not restriction Endonuclease
89. f the National Academy of Sciences of the USA 98 5093 5098 2001 When I follow your recommended protocol of isolating total RNA from mammalian tissues first using TRIzol reagents then with RNeasy columns I sometimes see a reduced recovery off the RNeasy columns TRIzol reagents and RNeasy columns are based on very different principles for nucleic acids purification RNeasy columns exclude certain contaminants that may give rise to a falsely higher spectrophotometric reading including carried over phenol and transcripts shorter than 200 nucleotides in length These shorter transcripts include the 5S rRNA and tRNA molecules that may account for 10 or more of the total RNA isolated To verify that the RNA of interest has been cleaned up efficiently during column purification it may be helpful to run aliquots of your samples on a gel or perform some gene specific real time PCR quantitation In addition you can estimate how much total RNA you anticipate to recover since the yield is highly dependent on tissue type These reference numbers can be obtained through your own experience or can be found in published literature for example the RNeasy Mini HandBook www giagen com literature handbooks rna rnamini 1016272HBRNY 062001WW pdf If you continue to observe significant loss of material on RNeasy columns please contact QIAGEN Technical Support directly APPENDIX B FAQs amp Troubleshooting Does the GeneChip Sample Cleanup Module g
90. fragmentation reaction 0 6 U for each ug of cDNA can be used as a starting point for the titration 2 Incubate the reaction at 37 C for 10 minutes 3 Inactivate DNase I at 98 C for 10 minutes 4 The fragmented cDNA is applied directly to the terminal labeling reaction Alternatively the material can be stored at 20 C for later use v Not a To examine the fragmentation result load 200 ng of the product on a 4 to 20 i acrylamide gel and stain with SYBR Gold The majority of the fragmented cDNA should be in the 50 to 200 base pairs range 3 1 10 CHAPTER 1 Prokaryotic Target Preparation Terminal Labeling Use Enzo BioArray Terminal Labeling Kit with Biotin ddUTP Affymetrix P N 900181 to label the 3 termini of the fragmentation products IMPOR Follow the volumes and amounts below rather than the package insert The reaction volume has been modified to be compatible with that required for the subsequent hybridization 1 Prepare the following reaction mix Table 3 14 Terminal Label Reaction Components 100 Format Midi 49 Format Standard 5X Reaction Buffer 12 uL 20 uL 10X CoCl gt 6 uL 10 uL Biotin ddUTP 1 UL 1 UL Terminal Deoxynucleotide 2 uL 2 uL Transferase Fragmentation Product 39 uL Up to 50 uL 15 6 p9 Total Volume 60 pL 100 pL Please refer to specific probe array package insert for information on array format 2 Incubate the reaction at 37 C for 20 to 60 minute
91. function off If the heated lid function cannot be turned off leave the lid open The 4 C holds are for reagent addition steps 70 C 6 minutes 4 C hold 16 C 2 hours 4 C hold 16 C 10 minutes 4 C hold 1 Add 4 uL of diluted T7 Oligo dT Primer to each sample a Make a fresh dilution of the T7 Oligo dT Primer final concentration 5 uM Mix 2 uL of T7 Oligo dT Primer 50 uM with 18 uL of RNase free Water b Add 4 uL of diluted T7 Oligo dT Primer to the sample from Step 6 Second Cycle First Strand cDNA Synthesis substep 6 on page 2 1 29 for a final volume of 25 uL c Gently flick the tube a few times to mix and then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube d Incubate for 6 minutes at 70 C e Cool the sample at 4 C for at least 2 minutes Centrifuge briefly 5 seconds to collect sample at the bottom of the tube IMPORI Cooling the samples at 4 C is required before proceeding to the next step Adding the Second Strand Master Mix directly to solutions that are at 70 C will compromise enzyme activity Recommenda It is recommended to prepare the Second Cycle Second Strand Master Mix immediately before use 2 In a separate tube assemble the Second Cycle Second Strand Master Mix a Prepare sufficient Second Cycle Second Strand Master Mix for all of the samples When there are more than two samples it is prudent to include additional material to compen
92. g Troubleshooting Problem Likely Cause Solution Sample Quality High 3 5 ratio Most often caused by degradation of the RNA Start with a fresh sample and minimize the during the isolation process possibility of RNase activity Look for the presence of Ribosomal RNA bands on a non denaturing agarose gel Low cRNA yield Low RNA quality which interferes with reverse It sometimes helps to do a Trizol based isolation transcription and subsequent labeling followed by cleanup with an RNeasy column For samples with a high lipid content such as brain use procedures to reduce the lipid content prior to the reverse transcription reaction Enzo BioArray HighYield RNA Transcript Labeling Kit Apparent insufficient volume in The reagent tubes are opened before The small volume may be expelled by opening The reagent tubes centrifugation tubes should be centrifuged briefly before use to ensure that reagents remain at the bottom of the tube Precipitation in the reaction After many freeze thaw cycles a precipitate Centrifuge briefly to remove precipitate before use buffer may form The precipitate formation does not interfere with the reaction Low yield Poor quality template Check starting material quality Loss in enzyme activity Repeat IVT Incorrect DTT concentration due to DTT Repeat IVT precipitation prior to addition to the IVT reaction Reaction temperature is not set appropriately
93. gen Life Technologies P N 10812 014 10 mM NTP Invitrogen Life Technologies P N 18427 013 0 5M EDTA CHAPTER 1 Eukaryotic Target Preparation Total RNA and mRNA Isolation for One Cycle Target Labeling Assay Protocols are provided for preparing labeled cRNA from either total RNA or purified poly A mRNA It was found that results obtained from samples prepared by both of these methods are similar but not identical Therefore to get the best results it is suggested to only compare samples prepared using the same type of RNA material Please review precautions and interfering conditions in Section 1 D IMPOR The quality of the RNA is essential to the overall success of the analysis Since the most appropriate protocol for the isolation of RNA can be source dependent we recommend using a protocol that has been established for the tissues or cells being used In the absence of an established protocol using one of the commercially available kits designed for RNA isolation is suggested When using a commercial kit follow the manufacturer s instructions for RNA isolation Isolation of RNA from Yeast Total RNA Good quality total RNA has been isolated successfully from yeast cells using a hot phenol protocol described by Schmitt et al Nucl Acids Res 18 3091 3092 1990 Poly A mRNA Affymetrix recommends first purifying total RNA from yeast cells before isolating poly A mRNA from total RNA Good quality mRNA has been successfully
94. gh Spots do not apply smoothly that is if you observe bumps bubbles tears or curled edges do not attempt to smooth out the spot Remove the spot and apply a new spot See Figure 3 4 1 3 4 15 Prokaryotic 3 4 16 SECTION 3 Prokaryotic Sample and Array Processing Figure 3 4 1 Applying Tough Spots to the probe array cartridge 3 Insert the cartridge into the scanner and test the autofocus to ensure that the Tough Spots do not interfere with the focus If you observe a focus error message remove the spot and apply a new spot Ensure that the spots lie flat Scanning the Probe Array Select Run gt Scanner from the menu bar Alternatively click the Start Scan icon in the tool bar gt The Scanner dialog box appears with a drop down list of experiments that have not been run Select the experiment name that corresponds to the probe array to be scanned A previously run experiment can also be selected by using the Include Scanned Experiments option box After selecting this option previously scanned experiments appear in the drop down list By default for the Agilent GeneArray Scanner only after selecting the experiment the number 2 is displayed in the Number of Scans box to perform the recommended 2X image scan For the GeneChip Scanner 3000 only one scan is required Once the experiment has been selected click the Start button gt A dialog box prompts you to load a sample into the scanner If
95. he One Cycle and Two Cycle Target Labeling Assays on page 2 1 32 Alternatively immediately freeze the sample at 20 C for later use Do not leave the reaction at 4 C for long periods of time 2 1 31 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Cleanup of Double Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays Sample Cleanup Module is used for cleaning up the double stranded cDNA Reagents to be Supplied by User m Ethanol 96 100 v v All other components needed for cleanup of double stranded cDNA are supplied with the GeneChip Sample Cleanup Module D IMPORI BEFORE STARTING please note m cDNA Wash Buffer is supplied as a concentrate Before using for the first time add 24 mL of ethanol 96 100 as indicated on the bottle to obtain a working solution and checkmark the box on the left hand side of the bottle label to avoid confusion m All steps of the protocol should be performed at room temperature During the procedure work without interruption m f cDNA synthesis was performed in a reaction tube smaller than 1 5 mL transfer the reaction mixture into a 1 5 or 2 mL microfuge tube not supplied prior to addition of cDNA Binding Buffer 1 Add 600 uL of cDNA Binding Buffer to the double stranded cDNA synthesis preparation Mix by vortexing for 3 seconds 2 Check that the color of the mixture is yellow similar to cDNA Binding Buffer without the cDNA synthesis rea
96. he progress of the Cleanout procedure When the fluidics station LCD window indicates REMOVE VIALS the Cleanout procedure is complete Remove the sample microcentrifuge vial s from the sample holder s If no other hybridizations are to be performed place wash lines into a bottle filled with deionized water Select Shutdown or Shutdown_450 for all modules from the drop down Protocol list in the Fluidics Station dialog box Click the Run button for all modules The Shutdown protocol is critical to instrument reliability Refer to the appropriate Fluidics Station User s Guide for more information After Shutdown protocol is complete flip the ON OFF switch of the fluidics station to the OFF position To maintain the cleanliness of the fluidics station and obtain the highest quality image and data possible a weekly bleach protocol and a monthly decontamination protocol are highly recommended Please refer to Section 4 Fluidics Station Maintenance Procedures for further detail 3 4 17 Prokaryotic 3 4 18 SECTION 3 Prokaryotic Sample and Array Processing Customizing the Protocol There may be times when the fluidic protocols need to be modified Modification of protocols must be done before downloading the protocol to the fluidics station Protocol changes will not affect runs in progress For more specific instructions refer to the Microarray Suite online help 1 Select Tools Edit Protocol from the menu bar 2
97. he results should be evaluated by a qualified individual 2 IMPOR Do not store enzymes in a frost free freezer AFFYMETRIX Overview Section 2 Eukaryotic Sample and Array Processing 701024 Rev 2 Contents 701024 Rev 2 Section 2 Eukaryotic Sample and Array Processing Chapter 1 Eukaryotic Target Preparation Chapter 2 Controls for Eukaryotic Arrays Chapter 3 Eukaryotic Target Hybridization Chapter 4 Eukaryotic Arrays Washing Staining and Scanning 2 2 3 2 3 3 2 4 3 Eukaryotic Section 2 Chapter 1 701025 Rev 5 Section 2 N Eukaryotic Target Preparation Intr duetion sice Lo Go pt ne A c ge ie 2 1 5 Reagents and Materials Required 2 1 7 Total RNA and mRNA Isolation for One Cycle Target Labeling Assay 2 1 9 Isolation of RNA from Yeast 2 1 9 Z Isolation of RNA from Arabidopsis 2 1 9 Isolation of RNA from Mammalian Cells or Tissues 2 1 10 Precipitatio1 OP RNA 5 in eo ae ah ad ere Nadal are 2 1 10 z Quantification of RNA 2 1 11 Total RNA Isolation for Two Cycle Target Labeling Assay 2 1 12 One Cycle cDNA Synthesis 2 1 13 Step 1 Preparation of Poly A RNA Controls for One Cycle cDNA Synthesis Spike in Controls 2 1 13 Step 2 First Strand cDNA
98. he sample at 4 C for at least 2 minutes h Centrifuge the tube briefly 5 seconds to collect the sample at the bottom of the tube 2 In a separate tube assemble the First Strand Master Mix a Prepare sufficient First Strand Master Mix for all of the RNA samples When there are more than 2 samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 5 is for a single reaction Table 2 L5 Preparation of First Strand Master Mix 5X 1 Strand Reaction Mix 4 uL DTT 0 1M 2uL dNTP 10 mM 1 UL Total Volume 7 pL b Mix well by flicking the tube a few times Centrifuge briefly 5 seconds to collect the master mix at the bottom of the tube 3 Transfer 7 uL of First Strand Master Mix to each RNA T7 Oligo dT Primer mix for a final volume of 18 or 19 uL Mix thoroughly by flicking the tube a few times Centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube and immediately place the tubes at 42 C 4 Incubate for 2 minutes at 42 C 5 Add the appropriate amount of SuperScript II to each RNA sample for a final volume of 20 uL For 1 to 8 Lg of total RNA 1 UL SuperScript Il For 8 1 to 15 ug of total RNA 2 uL SuperScript II For every ug of MRNA add 1 uL SuperScript II For mRNA quantity less than 1 ug use 1 UL SuperScript II Mix thoroughly by flicking the tube a few times Centr
99. hip T7 Oligo dT Promoter Primer Kit provides high quality HPLC purified T7 Oligo dT Primer which is essential for this reaction a tis recommended that each step of this protocol is checked by gel electrophoresis T7 Oligo dT Primer 5 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG dT 94 3 Step 1 First Strand cDNA Synthesis Starting material High quality poly A mRNA 0 2 ug to 2 0 ug v Note When using the GeneChip Sample Cleanup Module for the cDNA and IVT cRNA cleanup steps there is a potential risk of overloading the columns if greater than the recommended amount of starting material is used Before starting cDNA synthesis the correct volumes of DEPC treated H O and Reverse Transcriptase RT must be determined These volumes will depend on both the concentration and total volume of mRNA that is being added to the reaction For every ug of mRNA you will need to add 1 uL of SuperScript II RT 200 U uL For mRNA quantity lt 1 ug use 1 UL of SuperScript II RT Synthesis reactions should be done in a polypropylene tube RNase free IMPOR Use Table 2 1 22 for variable component calculations Determine volumes of mRNA and SuperScript Il RT required and then calculate the amount of DEPC treated H O needed in the Primer Hybridization Mix step to bring the final First Strand Synthesis reaction volume to 20 uL 4 Users who do not purchase the GeneChip T7 Oligo dT Promoter Primer Kit may be required to obtain a license unde
100. hybridize shut down the fluidics station following the procedure outlined in the section Shutting Down the Fluidics Station on page 4 17 For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 4 Fluidics Station Maintenance Procedures Table 3 4 7 If bubbles are present Return the probe array to the probe array holder Latch the probe array holder by gently pushing it up until a light click is heard Engage the washblock by firmly pushing up on the cartridge lever to the ENGAGE position The fluidics station will drain the probe array and then fill it with a fresh volume of the last wash buffer used When it is finished the LCD window displays EJ ECT CARTRIDGE again remove the probe array and inspect it again for bubbles If no bubbles are present it is ready to scan Proceed to Probe Array Scan on page 3 4 15 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash A non stringent buffer manually using a micropipette Excessive washing will result in a loss of signal intensity CHAPTER 4 Prokaryotic Arrays Washing Staining and Scanning Probe Array Scan A WARN The scanner is also controlled by Affymetrix Microarray Suite The probe array is scanned after the wash protocols are complete Make sure laser is warmed up prior to scanning by turning the laser on at least 15 minutes before use if you
101. ifuge briefly 5 seconds to collect the reaction at the bottom of the tube and immediately place the tubes at 42 C 6 Incubate for 1 hour at 42 C then cool the sample for at least 2 minutes at 4 C D IMPOR Cooling the samples at 4 C is required before proceeding to the next step Adding the Second Strand Master Mix directly to solutions that are at 42 C will compromise enzyme activity After incubation at 4 C centrifuge the tube briefly 5 seconds to collect the reaction at the bottom of the tube and immediately proceed to Step 3 Second Strand cDNA Synthesis AFFYMETRIX 2 1 17 Eukaryotic 2 1 18 SECTION 2 Eukaryotic Sample and Array Processing Step 3 Second Strand cDNA Synthesis One Cycle cDNA Synthesis Kit is used for this step The following program can be used as a reference to perform the second strand cDNA synthesis reaction in a thermal cycler 16 C 2 hours 4 C hold 16 C 5 minutes 4 C hold 1 Ina separate tube assemble Second Strand Master Mix It is recommended to prepare Second Strand Master Mix immediately before use a Prepare sufficient Second Strand Master Mix for all of the samples When there are more than 2 samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 6 is for a single reaction Table 2 16 Preparation of Second Strand Master Mix Compo
102. in a thermal cycler the 4 C holds are for reagent addition steps 70 C 10 minutes 4 C hold 42 C 1 hour 4 C hold 37 C 20 minutes 95 C 5 minutes 4 C hold 1 Mix cRNA and diluted random primers a Make a fresh dilution of the Random Primers final concentration 0 2 ug uL Mix 2 uL of Random Primers 3 ug uL with 28 uL RNase free Water b Add 2 uL of diluted random primers to purified cRNA from Step 5 First Cycle Cleanup of cRNA substep 9 on page 2 1 27 and add RNase free Water for a final volume of 11 uL c Incubate for 10 minutes at 70 C d Cool the sample at 4 C for at least 2 minutes Centrifuge briefly 5 seconds to collect the sample at the bottom of the tube 2 In a separate tube assemble the Second Cycle First Strand Master Mix a Prepare sufficient Second Cycle First Strand Master Mix for all of the samples When there are more than two samples it is prudent to include additional material to compensate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 14 is for a single reaction Table 2 114 Preparation of Second Cycle First Strand M aster Mix Component Volume 5X 1 Strand Reaction Mix 4 uL DTT 0 1M 2 uL RNase Inhibitor 1 UL dNTP 10 mM 1 uL SuperScript Il 1 UL Total Volume 9 pL b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the solution at the bottom of the
103. in labeled cRNA For the IVT amplification step using unlabeled ribonucleotides in the First Cycle of the Two Cycle cDNA Synthesis Procedure a separate kit is recommended MEGAscript T7 Kit Ambion Inc Use only nuclease free water buffers and pipette tips Store all reagents in a 20 C freezer that is not self defrosting Prior to use centrifuge all reagents briefly to ensure that the solution is collected at the bottom of the tube The Target Hybridizations and Array Washing protocols have been optimized specifically for this IVT Labeling Protocol Closely follow the recommendations described below for maximum array performance 1 Use the following table to determine the amount of cDNA used for each IVT reaction following the cDNA cleanup step Table 2 116 IVT Reaction Set Up Starting Material Volume of cDNA to use in IVT Total RNA 10 to 100 ng all 12 uL 10 to 8 0 ug all 12 uL 8 1 to 15 ug 6 uL mRNA 0 2 to 0 5 ug all 12 uL 0 6 to 10 Lg 9 uL 1 to 2 0 ug 6 uL 2 Transfer the needed amount of template cDNA to RNase free microfuge tubes and add the following reaction components in the order indicated in the table below If more than one IVT reaction is to be performed a master mix can be prepared by multiplying the reagent volumes by the number of reactions Do not assemble the reaction on ice since spermidine in the 10X IVT Labeling Buffer can lead to precipitation of the templat
104. ing Step 3 Preparing the Fluidics Station The Fluidics Station 400 or 450 250 is used to wash and stain the probe arrays It is operated using GCOS Microarray Suite Setting Up the Fluidics Station 1 Turn on the Fluidics Station using the toggle switch on the lower left side of the machine 2 Select Run Fluidics from the menu bar gt The Fluidics Station dialog box appears with a drop down list for selecting the experiment name for each of the fluidics station modules A second drop down list is accessed for choosing the Protocol for each of the fluidics station modules Refer to the Fluidics Station Users Guide for instructions on connecting and addressing multiple fluidics stations Priming the Fluidics Station Priming ensures that the lines of the fluidics station are filled with the appropriate buffers and the fluidics station is ready for running fluidics station protocols Priming should be done z when the fluidics station is first started m when wash solutions are changed m before washing if a shutdown has been performed m if the LCD window instructs the user to prime 1 To prime the fluidics station select Protocol in the Fluidics Station dialog box 2 Choose Prime or Prime_450 for the respective modules in the Protocol drop down list 3 Change the intake buffer reservoir A to Non Stringent Wash Buffer and intake buffer reservoir B to Stringent Wash Buffer a ForMAS click Run for each module to
105. interruption 1 Add 50 uL of RNase free Water to the IVT reaction and mix by vortexing for 3 seconds 2 Add 350 uL IVT cRNA Binding Buffer to the sample and mix by vortexing for 3 seconds 3 Add 250 uL ethanol 96 100 to the lysate and mix well by pipetting Do not centrifuge 4 Apply sample 700 uL to the IVT cRNA Cleanup Spin Column sitting in a2 mL Collection Tube Centrifuge for 15 seconds at gt 8 000 x g gt 10 000 rpm Discard flow through and Collection Tube 5 Transfer the spin column into a new 2 mL Collection Tube supplied Pipet 500 uL IVT cRNA Wash Buffer onto the spin column Centrifuge for 15 seconds at gt 8 000 x g gt 10 000 rpm to wash Discard flow through IVT cRNA Wash Buffer is supplied as a concentrate Ensure that ethanol is added to the IVT cRNA Wash Buffer before use see IMPORTANT note above before starting 6 Pipet 500 uL 80 v v ethanol onto the spin column and centrifuge for 15 seconds at gt 8 000 x g gt 10 000 rpm Discard flow through 7 Open the cap of the spin column and centrifuge for 5 minutes at maximum speed lt 25 000 x g Discard flow through and Collection Tube Place columns into the centrifuge using every second bucket Position caps over the adjoining bucket so that they are oriented in the opposite direction to the rotation i e if the microcentrifuge rotates in a clockwise direction orient the caps in a counterclockwise direction This avoids damage of the
106. ired Likewise enter 0 zero for the stain time if staining is not required Enter 0 zero for the number of wash cycles if a wash solution is not required Section 4 Fluidics Station Maintenance Procedures 701040 Rev 2 Contents Section 4 Chapter 1 Fluidics Station Maintenance Procedures 4 13 u u 701040 Rev 2 701041 Rev 3 Section 4 Chap er s Fluidics Station Maintenance Procedures Weekly Fluidics Station Cleanout 4 1 4 Ble ch Protocol 34 4 oe eae oh bat RER r 4 1 4 4 1 10 Monthly Fluidics Station Decontamination Protocol This Section Contains z weekly fluidics station bleach protocol z monthly fluidics station decontamination protocol uw LE 701041 Rev 3 SECTION 4 Fluidics Station Maintenance Procedures Weekly Fluidics Station Cleanout Bleach Protocol A cleaning protocol is recommended for fluidics station maintenance if the antibody staining procedure is used Choose Bleach or Bleach_450 for all modules from the drop down list in the Fluidics Station dialog box Click the Run button for all modules and follow LCD instructions This protocol is designed to eliminate any residual SAPE antibody complex that may be present in the fluidics station tubing and needles We recommend running this protocol at least o
107. is Due to the differences in the RNA species between eukaryotic and prokaryotic organisms different target labeling protocols have been optimized Sections 2 and 3 provide detailed protocols for target preparation hybridization array washing and staining for eukaryotic and prokaryotic arrays respectively Please refer to the sections in this manual for detailed protocols appropriate for your arrays Step 1 Target Preparation This manual describes procedures for preparing biotinylated target from purified eukaryotic and prokaryotic RNA samples suitable for hybridization to GeneChip expression probe arrays These procedures are recommendations only For more information on these procedures please contact Affymetrix Technical Support at 1 888 DNA CHIP or 44 0 1628 552550 in Europe For eukaryotic samples using protocols in this manual Section 2 double stranded cDNA is synthesized from total RNA or purified poly A messenger RNA isolated from tissue or cells An in vitro transcription IVT reaction is then done to produce biotin labeled cRNA from the cDNA The cRNA is fragmented before hybridization For prokaryotic samples Section 3 describes a detailed protocol to isolate total RNA followed by reverse transcription with random hexamers to produce cDNA After fragmentation by DNase I the cDNA is end labeled with biotin by terminal transferase Step 2 Target Hybridization A hybridization cocktail is prepared including the fragmen
108. is a mutation or set of mutations in the sequence of the target transcript which causes specific binding to the Mismatch Regardless of the cause the built in redundancy using multiple probe pairs to represent a single sequence on the probe array mitigates any significant impact on the final interpretation of the data There are too many files showing in the file window in Microarray Suite What can I do By placing files for projects in their own directories and changing the default settings for data in Microarray Suite appropriately you can manage large numbers of files In addition with the Windows 2000 operating system users can specify their own directory defaults in Microarray Suite while logging on and create their own directories for data To do so each user should have a unique logon name and organize files in subdirectories for example by project user date or lab Each user can then set the data default to a subdirectory of choice Experimental Design Which is greater sample or assay variability Sample variability which arises mainly from biological heterogeneity is certainly higher than assay variability and has been estimated to be at least 10 fold greater We recommend that researchers run multiple samples per data point to account for sample to sample variability In addition carefully design the experiment in order to minimize potential variation associated with the samples APPENDIX B FAQs amp Troubleshootin
109. ix well and divide into two aliguots of 600 uL each to be used for stains 1 and 3 Eukaryotic 2 3 10 SECTION 2 Eukaryotic Sample and Array Processing Antibody Solution Table 2 3 2 Antibody Solution Mix Components Volume Final Concentration 2X Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 uL 2 mg mL 10 mg mL Goat IgG Stock 6 0 uL 0 1 mg mL 0 5 mg mL biotinylated antibody 3 6 uL 3 ug mL DI H20 266 4 uL Total 600 uL Table 2 3 3 Fluidics Scripts for 11 um Feature Size Eukaryotic Arrays Format Using GeneChip IVT Labeling Kit EukGE WS2v5 EukGE WS2v5 Midi_euk2v3 Mini_euk2v3 Micro_1v1 Using all other labeling kits EukGE WS2v4 EukGE WS2v4 Midi euk2v3 Mini euk2v3 Micro 1V1 When using the Fluidics Station 450 or 250 add 450 at the end of the fluidics scrip s name Table 2 3 4 Fluidics Scripts for gt 18 um Feature Size Eukaryotic Arrays Format Using GeneChip IVT Labeling Kit EukGE WS2v4 EukGE WS2v4 Midi euk2v3 Mini euk2v3 Micro 1v1 Using all other labeling kits EukGE WS2v4 EUkGEWS2v4 Midi euk2v3 Mini euk2v3 Micro 1V1 When using the Fluidics Station 450 or 250 add 450 at the end of the fluidics scrip s name CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Table 2 3 5 Fluidics Protocols Antibody Amplification for Eukaryotic Targets protocols for the Fluidics Station 450 250 will have _450 as a suffix EukGE WS2
110. l of RNA 1 Add 20 uL of IN NaOH and incubate at 65 C for 30 minutes 2 Add 20 uL of IN HCI to neutralize Step 3 Purification and Quantitation of cDNA 1 Use QIAquick Column to clean up the cDNA synthesis product for detailed protocol see OIAguick PCR Purification Kit Protocols provided by the supplier Elute the product with 40 uL of EB Buffer supplied with OIAguick kit 2 Quantify the purified cDNA product by 260 nm absorbance 1 0 Azs unit 33 ug mL of single stranded DNA v Not a Typical yields of cDNA are 3 to 7 ug A minimum of 1 5 ug of cDNA is required for subsequent procedures to obtain sufficient material to hybridize onto the array and to perform necessary quality control experiments AFFYMETRIX Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing cDNA Fragmentation 1 Prepare the following reaction mix Table 3 1 3 Fragmentation Reaction Components Volume Concentration 10X One PhorAll Buffer 5 uL 1X cDNA 40 uL 3 7 ug DNase see note below X uL 0 6 U ug of cDNA Nuclease free H O Up to 50 uL Total Volume 50 pL Dilute DNase to 0 6 U uL in 1X One Phor All Buffer Prepare fresh dilution each time immediately before use a IMPOR It is anticipated that DNase enzyme activity may vary from lot to lot A titration assay is strongly recommended for each new lot of enzyme to determine the dosage of the DNase unit of DNase I per ug of cDNA to be used in the
111. le Integrity of total RNA samples can also be assessed qualitatively on an Agilent 2100 Bioanalyzer Refer to Figure 2 12 for an example of good quality total RNA sample 2 1 11 Eukaryotic 2 1 12 SECTION 2 Eukaryotic Sample and Array Processing F 20 Fluorescence u o het 7 A DR O Aa x gt r t l l 29 34 39 44 49 54 59 64 69 Time seconds a N A Figure 2 L2 Electropherogram from the Agilent 2100 Bioanalyzer for HeLa Total RNA For a high quality total RNA sample two well defined peaks corresponding to the 18S and 28S ribosomal RNAs should be observed similar to a denaturing agarose gel with ratios approaching 2 1 for the 28S to 18S bands Total RNA Isolation for Two Cycle Target Labeling Assay Several commercial kits and protocols are currently available for total RNA isolation from small samples tissues biopsies LCM samples etc Select the one that is suitable for processing of your samples and follow the vendor recommended procedures closely since high quality and high integrity starting material is essential for the success of the assay CHAPTER 1 Eukaryotic Target Preparation One Cycle cDNA Synthesis Step 1 Preparation of Poly A RNA Controls for One Cycle cDNA Synthesis Spike in Controls Eukaryotic Poly A RNA Control Kit is used for this step Designed specifically to provide exogenous positive controls to monitor the en
112. led edges do not attempt to smooth out the spot Remove the spot and apply a new spot See Figure 2 3 1 2 3 15 Eukaryotic 2 3 16 SECTION 2 Eukaryotic Sample and Array Processing Figure 2 3 1 Applying Tough Spots to the probe array cartridge 3 Insert the cartridge into the scanner and test the autofocus to ensure that the Tough Spots do not interfere with the focus If you observe a focus error message remove the spot and apply a new spot Ensure that the spots lie flat Scanning the Probe Array Select Run Scanner from the menu bar Alternatively click the Start Scan icon in the tool bar The Scanner dialog box appears with a drop down list of experiments that have not been run Select the experiment name that corresponds to the probe array to be scanned A previously run experiment can also be selected by using the Include Scanned Experiments option box After selecting this option previously scanned experiments appear in the drop down list By default for the GeneArray Scanner only after selecting the experiment the number 2 is displayed in the Number of Scans box to perform the recommended 2X image scan For the GeneChip Scanner 3000 only one scan is required Once the experiment has been selected click the Start button gt A dialog box prompts you to load an array into the scanner If you are using the GeneArray Scanner click the Options button to check for the correct pixel value a
113. lly 2 In the Protocol drop down list select the appropriate antibody amplification protocol to control the washing and staining of the probe array format being used Table 2 3 3 3 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions on the LCD window on the fluidics station a If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the Fluidics Station 400 User s Guide Fluidics Station 400 Video In Service CD P N 900374 or Quick Reference Card P N 08 0072 5 Insert the appropriate probe array into the designated module of the fluidics station while the cartridge lever is in the EJECT position When finished verify that the cartridge lever is returned to the ENGAGE position 6 Remove any microcentrifuge vials remaining in the sample holder of the fluidics station module s being used 7 When the LCD window indicates place the microcentrifuge vial containing 600 uL of streptavidin phycoerythrin SAPE stain solution into the sample holder Verify that the metal sampling needle is in the vial with its tip near the bottom 8 When the LCD window indicates replace the microcentrifuge vial containing the streptavidin phycoerythrin SAPE stain solution with a microcentrifuge vial containing antibody stain solution into the sample holder making sure that the metal sampling needle is in the vial with its tip near the botto
114. m 9 When the LCD window indicates replace the microcentrifuge vial containing the antibody stain solution with a microcentrifuge vial containing 600 uL of streptavidin AFFYMETRIX r 2 3 13 Eukaryotic 2 3 14 SECTION 2 Eukaryotic Sample and Array Processing phycoerythrin SAPE stain solution into the sample holder Verify that the metal sampling needle is in the vial with its tip near the bottom gt The Fluidics Station dialog box and the LCD window display the status of the washing and staining as they progress When the wash is complete the LCD window displays the message EJECT CARTRIDGE Atthe end ofthe run or at the appropriate prompt remove microcentrifuge vial containing stain and replace with an empty microcentrifuge vial Remove the probe arrays from the fluidics station modules by first moving the probe array holder lever to the EJECT position Check the probe array window for large bubbles or air pockets z If bubbles are present proceed to Table 2 3 7 m If the probe array has no large bubbles it is ready to scan on the GeneChip Scanner 3000 or GeneArray Scanner ENGAGE wash block and proceed to Probe Array Scan on page 2 3 15 If you do not scan the arrays right away keep the probe arrays at 4 C and in the dark until ready for scanning If there are no more samples to hybridize shut down the fluidics station following the procedure outlined in the section Shutting Down the Fluidics Statio
115. m v Note When using the GeneChip Sample Cleanup Module for the cDNA and IVT cRNA cleanup steps there is a potential risk of overloading the columns if greater than the recommended amount of starting material is used After purification the RNA concentration is determined by absorbance at 260 nm on a spectrophotometer one absorbance unit 40 ug mL RNA The Aa Ass ratio should be approximately 2 0 with ranges between 1 9 to 2 1 considered acceptable We recommend checking the quality of the RNA by running it on an agarose gel prior to starting the assay The rRNA bands should be clear without any obvious smearing patterns from degradation Before starting cDNA synthesis the correct volumes of DEPC treated H O and Reverse Transcriptase RT must be determined These volumes will depend on both the concentration and total volume of RNA that is being added to the reaction IMPORI Use Table 2 1 19 and Table 2 1 20 for variable component calculations Determine the volumes of RNA and SuperScript II RT required in Table 2 1 19 then calculate the amount of DEPC treated H 0 needed in Step 1 Table 2 1 20 to bring the final First Strand Synthesis volume to 20 uL 3 Users who do not purchase the GeneChip T7 Oligo dT Promoter Primer Kit may be reguired to obtain a license under U S Patent Nos 5 716 785 5 891 636 6 291 170 and 5 545 522 or to purchase another licensed kit AFFYMETRIX 2 1 41 Eukaryotic SECTION 2 Eukaryotic S
116. mRNA Isolation z Oligotex Direct mRNA Kit isolation of MRNA from whole cells QIAGEN P N 72012 72022 or 72041 z Oligotex mRNA Kit isolation of MRNA from total RNA QIAGEN P N 70022 70042 or 70061 cee QIAGEN P N 79654 Required only for use with QIAGEN Oligotex Direct Kit m DEPC Treated Water Ambion P N 9920 One Cycle Target Labeling and Control Reagents m One Cycle Target Labeling and Control Reagents Affymetrix P N 900493 A convenient package containing all required labeling and control reagents to perform 30 one cycle labeling reactions Contains 1 IVT labeling Kit 1 One Cycle cDNA Synthesis Kit 1 Sample Cleanup Module 1 Poly A RNA Control Kit and 1 Hybridization Controls Each of these components may be ordered individually described below as well as in this complete kit Two Cycle Target Labeling and Control Reagents z Two Cycle Target Labeling and Control Reagents Affymetrix P N 900494 A convenient package containing all required labeling and control reagents to perform 30 two cycle labeling reactions Contains 1 IVT labeling Kit 1 Two Cycle cDNA Synthesis Kit 2 Sample Cleanup Modules 1 Poly A RNA Control Kit and 1 Hybridization Controls Each of these components may be ordered individually described below as well as in this complete kit One Cycle cDNA Synthesis z GeneChip Expression 3 Amplification Reagents One Cycle cDNA Synthesis Kit 30 reactions Affymetrix P N 900431 z GeneChip
117. med at room temperature During the procedure work without interruption Add 60 uL of RNase free Water to the IVT reaction and mix by vortexing for 3 seconds Add 350 uL IVT cRNA Binding Buffer to the sample and mix by vortexing for 3 seconds Add 250 uL ethanol 96 100 to the lysate and mix well by pipetting Do not centrifuge Apply sample 700 uL to the IVT cRNA Cleanup Spin Column sitting in a 2 mL Collection Tube Centrifuge for 15 seconds at gt 8 000 x g gt 10 000 rpm Discard flow through and Collection Tube Transfer the spin column into a new 2 mL Collection Tube supplied Pipet 500 uL IVT cRNA Wash Buffer onto the spin column Centrifuge for 15 seconds at gt 8 000 x g gt 10 000 rpm to wash Discard flow through v Note IVT cRNA Wash Buffer is supplied as a concentrate Ensure that ethanol is added to the IVT cRNA Wash Buffer before use see IMPORTANT note above before starting Pipet 500 uL 80 v v ethanol onto the spin column and centrifuge for 15 seconds at gt 8 000 x g gt 10 000 rpm Discard flow through Open the cap of the spin column and centrifuge for 5 minutes at maximum speed lt 25 000 x g Discard flow through and Collection Tube CHAPTER 1 Eukaryotic Target Preparation Recommenda Place columns into the centrifuge using every second bucket Position caps over the adjoining bucket so that they are oriented in the opposite direction to the rotation i e if the microcentrifuge
118. moter sequences The resulting double stranded cDNA is then amplified and labeled using a biotinylated nucleotide analog ribonucleotide mix in the second IVT reaction The labeled cRNA is then cleaned up fragmented and hybridized to GeneChip expression arrays Alternative One Cycle cDNA Synthesis protocols are also included at the end of this chapter for reference Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing GeneChip Eukaryotic Target Labeling Assays for Expression Analysis One Cycle Target Labeling Two Cycle Target Labeling for 1 15 ug total RNA or 0 2 2 ug MRNA for 10 100 ng total RNA Approximate Total ANA Sample Experiment Tima STTITTITITITT aaa 3 Poly A ANA rae Poly A RNA Controls s Les Comro addition Produc scuba T OligoldT Primer Used Total RNA Sample Experiment Time 11 cycle 1 strand ye X a 15 hours So o smmm e N me um do s 00000000000 FTIT mms Control addition 1 cycle 2 strand 2 hours s T7 OligoldT Primer CONA myat EN a 14 strand 3 TTTTT mmm 5 hours TTTTEUTUUIT ER y o A 3501000000000 TTTIT ms STTTTTTTTTTY aan 3 Un tabeled ose S LLLEIU LUD 0 TT mmm s Merde invio Z Aibonodeotce Ovamiaht Synthesis j 3 LLLLLELLLLE vuvuu s s SONA svudh dia hu 15 cycle Cleanup of 08 hours STITITITIIIT Annn ms N RL SIE IDOL DL TYTIY mm s 204 cycle 14 strond Random t ZONA synihosie d 2 Primers sets s TUTTI Aaaaa 3 s LLLLLELELLE vuuuu s 204 cycle 2 strand T OligoldT
119. mperature immediately before use v Not a It is important to allow the arrays to equilibrate to room temperature completely Specifically if the rubber septa are not equilibrated to room temperature they may be prone to cracking which can lead to leaks 3 Heat the hybridization cocktail to 99 C for 5 minutes in a heat block AFFYMETRIX 22 Eukaryotic 2 2 8 SECTION 2 Eukaryotic Sample and Array Processing a Meanwhile wet the array by filling it through one of the septa see Figure 2 2 1 for location of the probe array septa with appropriate volume of 1X Hybridization Buffer using a micropipettor and appropriate tips Table 2 2 2 It is necessary to use two pipette tips when filling the probe array cartridge one for filling and the second to allow venting of air from the hybridization chamber 5 Incubate the probe array filled with 1X Hybridization Buffer at 45 C for 10 minutes with rotation Table 2 2 2 Probe Array Cartridge Volumes Array Hybridization Volume Total Fill Volume 49 Format Standard 200 uL 250 uL 64 Format 200 uL 250 uL 100 Format Midi 130 uL 160 uL 169 Format Mini 80 uL 100 uL 400 Format Micro 80 uL 100 uL 6 Transfer the hybridization cocktail that has been heated at 99 C in step 3 to a 45 C heat block for 5 minutes 7 Spin hybridization cocktail s at maximum speed in a microcentrifuge for 5 minutes to remove any insoluble material from the hybridization
120. n on page 2 3 17 v Note For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 4 Fluidics Station Maintenance Procedures Table 2 3 7 If Bubbles are Present Return the probe array to the probe array holder Latch the probe array holder by gently pushing it up until a light click is heard Engage the wash block by firmly pushing up on the cartridge lever to the ENGAGE position The fluidics station will drain the probe array and then fill it with a fresh volume of the last wash buffer used When it is finished the LCD window displays EJECT CARTRIDGE again remove the probe array and inspect it again for bubbles If no bubbles are present it is ready to scan Proceed to Probe Array Scan on page 2 3 15 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash Buffer A non stringent buffer manually using a micropipette Excessive washing will result in a loss of signal intensity CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Probe Array Scan The scanner is also controlled by Affymetrix Microarray Suite or GCOS The probe array is scanned after the wash protocols are complete Make sure the laser is warmed up prior to scanning by turning it on at least 15 minutes before use if you are using the Agilent GeneArray Scanner or 10 minutes if you are using the Affymetrix GeneChip Scanner 3000
121. nce a week 1 Prepare 1 liter of 0 525 sodium hypochlorite solution using distilled water Shake well Each fluidics station with four modules requires at least 500 mL of the 0 525 sodium hypochlorite solution 2 Cut tubing If you are using the Fluidics Station 450 250 If you are using the FS 450 or FS 250 cut three pieces of tubing with each piece at least 2 5 3 feet in length Tygon tubing 0 04 for each module of each fluidics station for a total of 6 tubes for the FS 250 or 12 tubes for the FS 450 These can be reused for subsequent BLEACH runs If you are using the Fluidics Station 400 If you are using the FS 400 cut four pieces of tubing at least 2 5 3 feet in length 3 Place all three wash lines these are not the tubing on the needles but the supply lines from the reagent bottles on the side of the station of each fluidics station in 1 liter of distilled water The BLEACH protocol requires at least 550 mL of distilled water 4 Choose Fluidics from the Run menu Alternatively click the down arrow Protocol list on the toolbar 5 Choose Bleach or Bleach_450 for the respective modules in the Protocol drop down list 6 Disengage the washblock for each module by pressing down on the cartridge lever CHAPTER 1 Fluidics Station Maintenance Procedures PSO AFFYMETRIX Wash blocks disengaged with cartridge levers down Figure 4 1 1 Disengaged washblocks showing cartridge levers in the down
122. nd wavelength of the laser beam m Pixel value 3 um m Wavelength 570 nm If you are using the GeneChip Scanner 3000 pixel resolution and wavelength are preset and cannot be changed CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Open the sample door on the scanner and insert the probe array into the holder Do not force the probe array into the holder Close the sample door of the scanner Click OK in the Start Scanner dialog box gt The scanner begins scanning the probe array and acquiring data When Scan in Progress is selected from the View menu the probe array image appears on the screen as the scan progresses Shutting Down the Fluidics Station AFFYMETRIX After removing a probe array from the probe array holder the LCD window displays the message ENGAGE WASHBLOCK If you are using the FS 400 latch the probe array holder by gently pushing up until a light click is heard Engage the washblock by firmly pushing up on the cartridge lever to the ENGAGE position If you are using the FS 450 gently lift up the cartridge lever to engage or close the washblock gt The fluidics station automatically performs a Cleanout procedure The LCD window indicates the progress of the Cleanout procedure When the fluidics station LCD window indicates REMOVE VIALS the Cleanout procedure is complete Remove the sample microcentrifuge vial s from the sample holder s If no other hybridizations are to
123. nent Volume RNase free Water 91 uL 5X 2 4 Strand Reaction Mix 30 uL dNTP 10 mM 3uL E coli DNA ligase luL E coli DNA Polymerase I 4 uL RNase H 1 uL Total Volume 130 pL b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the solution at the bottom of the tube 2 Add 130 uL of Second Strand Master Mix to each first strand synthesis sample from Step 2 First Strand cDNA Synthesis for a total volume of 150 uL Gently flick the tube a few times to mix and then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube 3 Incubate for 2 hours at 16 C 4 Add2 uL of T4 DNA Polymerase to each sample and incubate for 5 minutes at 16 C 5 After incubation with T4 DNA Polymerase add 10 uL of EDTA 0 5M and proceed to Cleanup of Double Stranded cDNA for Both the One Cycle and Two Cycle Target Labeling Assays on page 2 1 32 Do not leave the reactions at 4 C for long periods of time CHAPTER 1 Eukaryotic Target Preparation Two Cycle cDNA Synthesis Step 1 Preparation of Poly A RNA Controls for Two Cycle cDNA Synthesis Spike in Controls Eukaryotic Poly A RNA Control Kit is used for this step Designed specifically to provide exogenous positive controls to monitor the entire eukaryotic target labeling process a set of poly A RNA controls are supplied in the GeneChip Eukaryotic Poly A RNA Control Kit Each eukaryotic GeneChip probe array
124. ng sure that the metal sampling needle is in the tube with its tip near the bottom gt The Fluidics Station dialog box and the LCD window display the status of the washing and staining as they progress 3 4 13 Prokaryotic 3 4 14 SECTION 3 Prokaryotic Sample and Array Processing When the LCD window indicates replace the microcentrifuge tube containing the streptavidin stain with a microcentrifuge tube containing antibody stain solution into the sample holder making sure that the metal sampling needle is in the tube with its tip near the bottom When the LCD window indicates replace the microcentrifuge tube containing antibody solution with the microcentrifuge tube containing the SAPE solution When the protocol is complete the LCD window displays the message EJECT CARTRIDGE Remove microcentrifuge tube containing stain and replace with an empty microcentrifuge tube Remove the probe arrays from the fluidics station modules by first moving the cartridge lever to the EJECT position Check the probe array window for large bubbles or air pockets z If bubbles are present refer to Table 3 4 7 z f the probe array has no large bubbles it is ready to scan on the GeneChip Scanner 3000 or the GeneArray Scanner ENGAGE washblock and proceed to Probe Array Scan on page 3 4 15 If you do not scan the arrays right away keep the probe arrays at 4 C and in the dark until ready for scanning If there are no more samples to
125. ng the anti streptavidin biotinylated antibody in sample holder 2 c Place one vial containing the streptavidin phycoerythrin SAPE solution in sample holder 3 d Press down on the needle lever to snap needles into position and to start the run The run begins The Fluidics Station dialog box at the workstation terminal and the LCD window display the status of the washing and staining as the protocol progresses 3 4 12 CHAPTER 4 Prokaryotic Arrays Washing Staining and Scanning When the protocol is complete the LCD window displays the message EJECT CARTRIDGE Remove the probe arrays from the fluidics station modules by first pressing down the cartridge lever to the eject position Lift up on the needle lever to disengage the needles from the microcentrifuge vials Remove the three empty microcentrifuge vials from the needle holders Check the probe array window for large bubbles or air pockets z If bubbles are present refer to Table 3 4 6 z If the probe array has no large bubbles it is ready to scan on the GeneArray Scanner or the GeneChip Scanner 3000 Pull up on the cartridge lever to close the washblock and proceed to Probe Array Scan on page 3 4 15 If there are no more samples to hybridize shut down the fluidics station following the procedure in Shutting Down the Fluidics Station on page 3 4 17 Keep the probe arrays at 4 C and in the dark until ready for scanning 10 Lift up on the cartridge lever
126. nlabeled total RNA Using an estimate of 100 carryover use the formula below to determine adjusted cRNA yield adjusted cRNA yield RNA total RNA y RNAn amount of cRNA measured after IVT ug total RNA starting amount of total RNA ug y fraction of cDNA reaction used in IVT Example Starting with 10 ug total RNA 50 of the cDNA reaction is added to the IVT giving a yield of 50 ug CRNA Therefore adjusted CRNA yield 50 ug cRNA 10 ug total RNA 0 5 cDNA reaction 45 0 ug Use adjusted yield in Fragmenting the cRNA for Target Preparation on page 2 1 39 Please refer to the Eukaryotic Target Hybridization chapter in Section 2 for the amount of cRNA required for one array hybridization experiment The amount varies depending on the array format Please refer to the specific probe array package insert for information on the array format 2 1 37 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Step 3 Checking Unfragmented Samples by Gel Electrophoresis Gel electrophoresis of the IVT product is done to estimate the yield and size distribution of labeled transcripts The following are examples of typical cRNA products examined on an Agilent 2100 Bioanalyzer Fluorescence 5 o Be 54 69 2 5 s si s9 39 Time seconds 0 0 gm 24 29 34 Figure 2 15 Biotin labeled cRNA from One Cycle cDNA Synthesis Kit Bioanalyzer electropherogram for labeled cRNA from HeLa total
127. ns of copies of a given oligonucleotide Probe arrays are manufactured in a series of cycles Initially a glass substrate is coated with linkers containing photolabile protecting groups Then a mask is applied that exposes selected portions of the probe array to ultraviolet light Illumination removes the photolabile protecting groups enabling selective nucleoside phosphoramidite addition only at the previously exposed sites Next a different mask is applied and the cycle of illumination and chemical coupling is performed again By repeating this cycle a specific set of oligonucleotide probes is synthesized with each probe type in a known location The completed probe arrays are packaged into cartridges During the laboratory procedure described in this manual biotin labeled RNA or DNA fragments referred to as the target are hybridized to the probe array The hybridized probe array is stained with streptavidin phycoerythrin conjugate and scanned by the GeneChip Scanner 3000 or the GeneArray Scanner The amount of light emitted at 570 nm is proportional to the bound target at each location on the probe array CHAPTER 1 GeneChip Expression Analysis Overview GeneChip Expression Analysis Overview The following major steps outline GeneChip expression analysis 1 Target Preparation 2 Target Hybridization 3 Experiment and Fluidics Station Setup a Probe Array Washing and Staining 5 Probe Array Scan 6 Data Analys
128. nt the caps in a counterclockwise direction This avoids damage of the caps Centrifugation with open caps allows complete drying of the membrane Transfer spin column into a 1 5 mL Collection Tube and pipet 14 uL of cDNA Elution Buffer directly onto the spin column membrane Incubate for 1 minute at room temperature and centrifuge 1 minute at maximum speed lt 25 000 x g to elute Ensure that the cDNA Elution Buffer is dispensed directly onto the membrane The average volume of eluate is 12 uL from 14 uL Elution Buffer We do not recommend RNase treatment ofthe cDNA prior to the in vitro transcription and labeling reaction the carry over ribosomal RNA does not seem to inhibit the reaction We do not recommend gel analysis for cDNA prepared from total RNA Ouantifying the amount of double stranded cDNA by absorbance at 260 nm is not recommended The primer can contribute significantly to the absorbance and subtracting the theoretical contribution of the primer based on the amount added is not practical After cleanup please proceed to Synthesis of Biotin Labeled cRNA for Both the One Cycle and Two Cycle Target Labeling Assays on page 2 1 34 2 1 33 Eukaryotic 2 1 34 SECTION 2 Eukaryotic Sample and Array Processing Synthesis of Biotin Labeled cRNA for Both the One Cycle and Two Cycle Target Labeling Assays GeneChip IVT Labeling Kit is used This kit is only used for the IVT labeling step for generating biot
129. o from the menu bar Alternatively click the New Experiment icon on the tool bar gt The Experiment Information dialog box appears allowing the experiment name to be defined along with several other parameters such as probe array type sample description and comments Type in the Experiment Name In the Probe Array Type box click the arrow and select the experiment name as indicated below a Paeruginosa select Pae Gla from the drop down list m E coli select Ecoli Antisense from the drop down list Experiment name and probe array type are reguired Complete as much of the other information as desired The protocol information at the bottom of the dialog box is imported to the experiment information dialog box after the hybridization and scan have been completed Save the experiment by selecting Save The name of the experiment is used by Microarray Suite to access the probe array type and data for the sample while it is being processed Data files generated for the sample are automatically labeled to correspond to the experiment name Microarray Suite automatically fills in the Protocol section of this dialog box with information on array processing from the fluidics station Close the Experiment Information dialog box 3 4 7 Prokaryotic 3 4 8 SECTION 3 Prokaryotic Sample and Array Processing Step 3 Preparing the Fluidics Station The Fluidics Station 400 450 or 250 is used to wash and stain the probe arrays It i
130. obe Arrays na a en Rene 2 3 16 Shutting Down the Fluidics Station 2 3 17 Customizing the Protocol 2 3 18 This Chapter Contains Instructions for using the Fluidics Station 400 and 450 250 to automate the washing and staining of eukaryotic GeneChip expression probe arrays m Instructions for scanning probe arrays using the GeneArray Scanner or the GeneChip Scanner 3000 After completing the procedures described in this chapter the scanned probe array image dat file is ready for analysis as explained in the enclosed GeneChip Expression Analysis Data Analysis Fundamentals booklet P N 701190 701023 Rev 4 2 3 3 SECTION 2 Eukaryotic Sample and Array Processing 2 3 4 CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Reagents and Materials Required AFFYMETRIX The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier information in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual a Water Molecular Biology Grade BioWhittaker Molecular Applications Cambrex P N 51200
131. on Cocktail for Single Probe Array 3 Components 100 Format Midi 49 Format Standard nn 2X MES Hybridization Buffer 65 uL 100 0 uL 1X 3 nM B2 Control Oligo 2 2 uL 3 3 UL 50 pM 10 mg mL Herring Sperm DNA 13 uL 2 0 uL 0 1 mg mL 50 mg mL BSA 13 uL 2 0 uL 0 5 mg mL 100 DMSO 9 2 uL 7 Fragmented and Labeled cDNA 51 uL Up to 92 7 UL 15 6 0 ug Molecular Biology Grade Water To a final volume of 130 UL To a final volume of 200 uL Total Volume 130 pL 200 uL Please refer to specific probe array package insert for information on array format 2 Equilibrate probe array to room temperature immediately before use It is important to allow the arrays to normalize to room temperature completely Specifically if the rubber septa are not equilibrated to room temperature they may be prone to cracking which leads to leaks 3 Add the indicated amount of hybridization solution mix to the probe array Refer to specific probe array package insert for information on array format It is necessary to use two pipette tips when filling the probe array cartridge one for filling and the second to allow venting of air from the hybridization chamber 4 Place probe array in the hybridization oven set at the temperatures indicated below m P aeruginosa 50 C m E coli Antisense 45 C The hybridization temperature of 50 C is higher than that used for other expression assays The increased hybridization temperature is required
132. oncentration 2X MES Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 uL 2 mg mL 10 mg mL Normal Goat IgG 6 0 uL 0 1 mg mL 0 5 mg mL Biotin Anti streptavidin 6 0 uL 5 ug mL DI H 0 264 0 uL Total Volume 600 HL Table 3 4 3 SAPE Solution Mix Vial 3 Components Volume Final Concentration 2X MES Stain Buffer 300 0 uL 1X 50 mg mL BSA 24 0 uL 2 mg mL 1 mg mL Streptavidin 6 0 uL 10 ug mL Phycoerythrin DI H20 270 0 uL Total Volume 600 HL 2 In the Fluidics Station dialog box on the workstation select the correct experiment name from the drop down Experiment list The probe array type will appear automatically Array Fluidics Protocol m GeneChip E coli Antisense Genome Array ProkGE WS2 if using FS 450 ProkGE WS 450 m GeneChip P aeruginosa Genome Array Modified FlexM idi_euk2v3 See Table 3 4 4 If using FS 450 FlexM idi euk2v3 450 Fluidics protocols are specific to array format and content Follow procedures below for specific arrays 3 Choose Run in the Fluidics Station dialog box to begin the washing and staining Follow the instructions in the LCD window on the fluidics station when using the Fluidics Station 400 If you are unfamiliar with inserting and removing probe arrays from the fluidics station modules please refer to the appropriate User s Guide for your GeneChip Fluidics Station 400 450 or 250 CHAPTER 4 Prokaryotic Arrays Washing Staining and Scanning AFFYMETRIX a Table 3 4 4 Modifi
133. opriate filter for SYBR Gold 701031 Rev 3 Section 3 Chap er Preparation of Control Spike In Transcripts 701031 Rev 3 OVEITIEW re ne a ee ee ade Dh dee op Bok 3 2 4 Reagents and Materials Required 224 444 4 das sum ran 32 3 Bacterial Plasmid DNA Preparation nn 327 Linearization of Plasmid DNA Preparation 4 4 344 04 su 5624 me ta sa 3 2 1 Purification of Linearized Plasmid DNA 3 241 Preparing the Control Transcript MIX s s aia due aus nues ee ma 3 29 In vitro Transcription IVT to Produce Control Sense Transcripts 3 2 8 This Chapter Contains z Detailed steps for producing full length control spike sense RNA After completing the procedures described in this chapter the control sense transcripts can be added to purified prokaryotic RNA samples prior to enrichment and labeling procedure as described in Section 3 Chapter 1 3 2 3 Prokaryotic 3 24 SECTION 3 Prokaryotic Sample and Array Processing Overview This chapter describes protocols used to generate sense RNA controls from B subtilis genes These control transcripts can be spiked into P aeruginosa or E coli total RNA used for target preparation at a predetermined concentration to monitor labeling hybridization and staining efficiency To be used as control for assay performance GeneChip P aeruginosa and E coli Antisense Genome Arrays contain probe sets with sequences o
134. or example GAPDH and Actin should I anticipate to obtain on GeneChip probe arrays In addition to the conventional probe sets designed to be within the most 3 600 bases of a transcript additional probe sets in the 5 region and middle portion M of the transcript have also been selected for certain housekeeping genes including GAPDH and Actin Signal intensity ratio of the 3 probe set over the 5 probe set is often referred to as the 37 5 ratio This ratio gives an indication of the integrity of your starting RNA efficiency of first strand cDNA synthesis and or in vitro transcription of CRNA The signal of each probe set reflects the sequence of the probes and their hybridization properties A 1 1 molar ratio of the 3 to 5 transcript regions will not necessarily give a signal ratio of 1 There is no single threshold cutoff to assess sample quality for all of the diverse organisms and tissues This is due to the presence of different isoforms of these house keeping genes and their different expression patterns in various tissues and organisms Although we routinely refer to a threshold ratio of less than 3 for the most common tissues such as mammalian liver and brain this may not be applicable to all situations It may be more appropriate to document the 3 5 ratios within a particular study and flag the results that deviate therefore representing an unusual sample that deserves further investigation 5 B 7 Appendices
135. orp HPLC purified 5 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG T 24 3 Q Qiashredder QIAGEN P N 79654 R R Phycoerythrin Streptavidin Molecular Probes P N S 866 Ribonuclease H RNase H E coli Epicentre Technologies P N RO601K RNA DNA Mini Column Kit QIAGEN P N 14123 RNase H E coli Invitrogen Life Technologies P N 18021 021 or Epicentre Technologies P N RO601K RNeasy Mini Kit QIAGEN P N 74104 74106 S Second strand buffer 5X Invitrogen Life Technologies P N 10812 014 Sodium Acetate 3 M pH 5 2 Sigma Aldrich P N S7899 Sodium Hypochlorite Sigma Aldrich P N 7681 52 9 SSPE 20X BioWhittaker Molecular Applications Cambrex P N 51214 Streptavidin ImmunoPure Pierce Chemical P N 21125 Sucrose Gel Loading Dye 5X Amresco P N E 274 SUPERaseeIn Ambion P N 2696 SuperScript II RT Invitrogen Life Technologies P N 18064 071 SuperScript Choice system Invitrogen Life Technologies P N 18090 019 SYBR Gold Molecular Probes P N S 11494 SYBR Green II Cambrex P N 50523 or Molecular Probes P N S7586 AFFYMETRIX 5 A 11 Appendices 5 A 12 SECTION 5 Appendices T TBE 10X Cambrex P N 50843 TBE Gel 4 20 1 0 mm 12 well Invitrogen Life Technologies P N EC62252 TE 1X BioWhittaker Molecular Applications Cambrex P N 51235 Tough Spots Label Dots USA Scientific P N 9185 Tris pH 7 0 1M Ambion P N 9850G Trizma Base Sigma Aldrich P N T1503 TRIzol Reagent Invitrog
136. r U S Patent Nos 5 716 785 5 891 636 6 291 170 and 5 545 522 or to purchase another licensed kit 2 1 44 CHAPTER 1 Eukaryotic Target Preparation Table 2 L22 First Strand cDNA Synthesis Components Final Concentration Reagents in Reaction Volume or Amount in Reaction 1 Primer Hybridization DEPC treated H O variable for final reaction volume of 20 uL Incubate at 70 C for 10 minutes T7 Oligo dT Primer 50 uM 2 uL 100 pmol Quick spin and put on ice mRNA variable 0 2 to 2 pg 0 2 to 2 Lg 2 Temperature Adjustment 5X First Strand cDNA buffer 4 uL 1X Add to the above tube and mix well 0 1 M DIT 2 uL 10 mM Incubate at 37 C for 2 minutes 10 mM dNTP mix 1 uL 500 uM each 3 First Strand Synthesis SuperScript II RT 1 uL per ug mRNA 200U to 1000U Add to the above tube and mix well variable 200 U L Incubate at 37 C for 1 hour Total Volume 20 pL Step 2 Second Strand cDNA Synthesis 1 Place First Strand reactions on ice Centrifuge briefly to bring down condensation on sides of tube 2 Add to the First Strand synthesis tube the reagents listed in the following Second Strand Final Reaction Composition Table Table 2 1 23 Table 2 123 Second Strand Final Reaction Composition Component Volume Final Concentration or Amount in Reaction DEPC treated water 91 uL 5X Second Strand Reaction Buffer 30 uL 1X 10 mM dNTP mix 3 uL 200 uM each 10 U uL E coli DNA Ligase luL 10 U 10 U uL E
137. ranscript 3 Apply 2 uL of the transcript mix with each 5 10 ug of total RNA prior to the cDNA synthesis procedure as described in Section 3 Chapter 1 Prokaryotic Target Preparation Final concentration applied on the array for the control transcripts would be 2 pM assuming 100 recovery during the cDNA synthesis and labeling process Different concentrations of transcript stock can be prepared to generate staggered concentrations for different transcripts to monitor the dynamic range of the assay Aliquot and freeze the IVT transcripts at 80 C Avoid repeated freeze thaw cycles 3 2 9 Prokaryotic 701032 Rev 3 Section 3 Chapter 3 g A Prokaryotic Target Hybridization Reagents and Materials Required 335 Reagent Preparations s se Ag ek weis IN ao OE o de 3 3 6 3 31 Prokaryotic Target Hybridization This Chapter Contains This chapter contains detailed steps for preparing the hybridization mix and instructions for hybridizing the target mix to the GeneChip P aeruginosa Genome Array and GeneChip E coli Antisense Genome Array The hybridized probe array is then ready for washing staining and scanning as detailed on page 3 4 3 Prokaryotic 701032 Rev 3 3 3 3 CHAPTER 3 Prokaryotic Target Hybridization Reagents and Materials Required AFFYMETRIX a The following reagents and materials are recommendations and
138. rk until ready for scanning If there are no more samples to hybridize shut down the fluidics station following the procedure outlined in the section Shutting Down the Fluidics Station on page 2 3 17 CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning v Note For proper cleaning and maintenance of the fluidics station including the bleach protocol refer to Section 4 Fluidics Station Maintenance Procedures Table 2 3 6 If Bubbles are Present Return the probe array to the probe array holder Engage the washblock by gently pushing up on the cartridge lever to the engaged or closed position The fluidics station will drain the probe array and then fill it with a fresh volume of the last wash buffer used When it is finished the LCD window will display EJECT CARTRIDGE Again remove the probe array and inspect it for bubbles If no bubbles are present it is ready to scan Proceed to Probe Array Scan on page 2 3 15 If several attempts to fill the probe array without bubbles are unsuccessful the array should be filled with Wash Buffer A non stringent buffer manually using a micropipette Excessive washing will result in a loss of signal intensity FS 400 If you are using the Fluidics Station 400 Washing and Staining the Probe Array 1 Inthe Fluidics Station dialog box on the workstation select the correct experiment name in the drop down Experiment list The probe array type will appear automatica
139. rm a cleanup using the QIAGEN RNeasy Mini Kit Much better yields of labeled cRNA are obtained from the in vitro transcription labeling reaction when this second cleanup is performed Poly A mRNA Good quality mRNA has been successfully isolated from mammalian cells such as cultured cells and lymphocytes using QIAGEN s Oligotex Direct mRNA kit and from total RNA using the Oligotex mRNA kit If mammalian tissue is used as the source of mRNA total RNA should be first purified using a commercial reagent such as TRIzol and then using a poly A mRNA isolation procedure or a commercial kit Precipitation of RNA Total RNA It is not necessary to precipitate total RNA following isolation or cleanup with the RNeasy Mini Kit Adjust elution volumes from the RNeasy column to prepare for cDNA synthesis based upon expected RNA yields from your experiment Ethanol precipitation is required following TRIzol isolation and hot phenol extraction methods see methods on page 2 1 11 for details Poly A mRNA Most poly A mRNA isolation procedures will result in dilution of RNA It is necessary to concentrate mRNA prior to the cDNA synthesis CHAPTER 1 Eukaryotic Target Preparation Precipitation Procedure 1 2 3 Add 1 10 volume 3M NaOAc pH 5 2 and 2 5 volumes ethanol Mix and incubate at 20 C for at least 1 hour Centrifuge at gt 12 000 x g in a microcentrifuge for 20 minutes at 4 C Wash pellet twice with 80 ethanol Air dr
140. rotates in a clockwise direction orient the caps in a counterclockwise direction This avoids damage of the caps Label the collection tubes with the sample name During centrifugation some column caps may break resulting in loss of sample information Centrifugation with open caps allows complete drying of the membrane 8 Transfer spin column into a new 1 5 mL Collection Tube supplied and pipet 11 uL of RNase free Water directly onto the spin column membrane Ensure that the water is dispensed directly onto the membrane Centrifuge 1 minute at maximum speed lt 25 000 x g to elute 9 Pipet 10 uL of RNase free Water directly onto the spin column membrane Ensure that the water is dispensed directly onto the membrane Centrifuge 1 minute at maximum speed lt 25 000 x g to elute For subsequent photometric quantification of the purified cRNA we recommend dilution of the eluate between 1 100 fold and 1 200 fold Step 2 Quantification of the cRNA AFFYMETRIX Use spectrophotometric analysis to determine the cRNA yield Apply the convention that 1 absorbance unit at 260 nm equals 40 ug mL RNA m Check the absorbance at 260 nm and 280 nm to determine sample concentration and purity z Maintain the A gt 6 A2g9 ratio close to 2 0 for pure RNA ratios between 19 and 2 1 are acceptable For quantification of CRNA when using total RNA as starting material an adjusted cRNA yield must be calculated to reflect carryover of u
141. s 3 Stop the reaction by adding 2 uL of 0 5M EDTA v Note When the amount of fragmentation product exceeds 3 ug extend the reaction time to up to 60 minutes a The target is ready to be hybridized onto probe arrays as described in Section 3 Chapter 3 Prokaryotic Target Hybridization Alternatively it may be stored at 20 C for later use To estimate the labeling efficiency a gel shift assay can be performed see below In general greater than 90 of the fragments should be labeled and therefore shifted Gel Shift Assay After purification of the target the efficiency of the labeling procedure can be assessed using the following procedure This quality control protocol prevents hybridizing poorly labeled target onto the probe array The addition of biotin residues is monitored in a gel shift assay where the fragments are incubated with avidin prior to electrophoresis The nucleic acids are then detected by staining as shown in the gel photograph Figure 3 12 The procedure takes approximately 90 minutes to complete Y Note The absence of a shift pattern indicates poor biotin labeling The problem should be addressed before proceeding to the hybridization step AFFYMETRIX KG 3 1 11 Prokaryotic 3 1 12 SECTION 3 Prokaryotic Sample and Array Processing Lane 1 10 bp DNA Ladder Lane 2 Fragmented and labeled enriched F coli RNA Lane 3 Fragmented and labeled enriched F coli RNA with avidin Lane 4
142. s operated using Microarray Suite Setting Up the Fluidics Station Turn on the Fluidics Station using the switch on the lower left side of the machine Select Run Fluidics from the menu bar The Fluidics Station dialog box appears with a drop down list for selecting the experiment name for each of the fluidics station modules A second list is accessed for choosing the Protocol for each of the four fluidics station modules Refer to the appropriate GeneChip Fluidics Station User s Guide for instructions on connecting and addressing multiple fluidics stations Priming the Fluidics Station Priming ensures that the lines of the fluidics station are filled with the appropriate buffers and the fluidics station is ready for running fluidics station protocols Priming should be done z When the fluidics station is first started m When wash solutions are changed a Before washing if a shutdown has been performed z If the LCD window instructs the user to prime Select Protocol in the Fluidics Station dialog box Choose Prime or Prime_450 for the respective modules in the Protocol drop down list Change the intake buffer reservoir A to Non stringent Wash Buffer and intake buffer reservoir B to Stringent Wash Buffer Click Run for each module to begin priming CHAPTER 4 Prokaryotic Arrays Washing Staining and Scanning Probe Array Wash and Stain AFFYMETRIX a Following hybridization the wash and stain proc
143. s in the labeling process the addition of 2 uL of 130 pM controls results in a 2 pM final concentration in the hybridization cocktail Detection limit of the assay is estimated to be 7 pM or better To monitor the assay sensitivity it is recommended to use concentration of the individual spikes in a range of 0 1 to 2 pM The random primers supplied by Invitrogen Life Technologies are oligodeoxynucleotides composed mainly of hexamers Random primers of different length or GC content have been successfully applied to the procedure 1 Incubate the RNA Primer mix at the following temperatures a 70 C for 10 minutes a 25 C for 10 minutes a Chill to 4 C CHAPTER 1 Prokaryotic Target Preparation 2 Prepare the reaction mix for cDNA synthesis Briefly centrifuge the reaction tube to collect sample at the bottom and add the cDNA synthesis mix from Table 3 1 2 to the RNA primer hybridization mix Table 3 L2 cDNA Synthesis Components Components Volume Final Concentration RNA Primer hybridization mix 30 uL from previous step 5X 15t Strand Buffer 12 uL 1X 100 mM DTT 6 uL 10 mM 10 mM dNTPs 3 uL 0 5 mM SUPERasesln 20 U uL 15 uL 0 5 U uL SuperScript II 200 U uL 75 uL 25 U uL Total Volume 60 pL 3 Incubate the reaction at the following temperatures m 25 C for 10 minutes a 37 C for 60 minutes m 42 C for 60 minutes z Inactivate SuperScript II at 70 C for 10 minutes a Chill to 4 C Step 2 Remova
144. sample holder of the fluidics station module s being used If prompted to Load Vials 1 2 3 place the three experiment sample vials the microcentrifuge vials into the sample holders 1 2 and 3 on the fluidics station m Place one vial containing 600 uL of streptavidin phycoerythrin SAPE solution in sample holder 1 Place one vial containing 600 uL of anti streptavidin biotinylated antibody solution in sample holder 2 m Place one vial containing 600 uL of streptavidin phycoerythrin SAPE solution in sample holder 3 m Press down on the needle lever to snap needles into position and to start the run The run begins The Fluidics Station dialog box at the workstation terminal and the LCD window display the status of the washing and staining as they progress Atthe end ofthe run or at the appropriate prompt remove the microcentrifuge vials and replace with three empty microcentrifuge vials Remove the probe arrays from the fluidics station modules by first pressing down the cartridge lever to the eject position Check the probe array window for large bubbles or air pockets z f bubbles are present proceed to Table 2 3 6 m f the probe array has no large bubbles it is ready to scan on the GeneArray Scanner or the GeneChip Scanner 3000 Pull up on the cartridge lever to engage washblock and proceed to Probe Array Scan on page 2 3 15 If you do not scan the arrays right away keep the probe arrays at 4 C and in the da
145. sate for potential pipetting inaccuracy or solution lost during the process The following recipe in Table 2 1 15 is for a single reaction 2 1 30 CHAPTER 1 Eukaryotic Target Preparation AFFYMETRIX Table 2 115 Preparation of Second Cycle Second Strand Master Mix Component Volume RNase free Water 88 uL 5X 214 Strand Reaction Mix 30 uL dNTP 10 mM 3 uL E coli DNA Polymerase I 4 uL Total Volume 125 pL b Mix well by gently flicking the tube a few times Centrifuge briefly 5 seconds to collect the master mix at the bottom of the tube 3 Add 125 uL of the Second Cycle Second Strand Master Mix to each sample from Step 7 Second Cycle Second Strand cDNA Synthesis substep 1 for a total volume of 150 uL Gently flick the tube a few times to mix then centrifuge briefly 5 seconds to collect the reaction at the bottom of tube 4 Incubate for 2 hours at 16 C 5 Add 2 uL of T4 DNA Polymerase to the samples for a final volume of 152 uL Gently flick the tube a few times to mix and then centrifuge briefly 5 seconds to collect the reaction at the bottom of the tube 6 Incubate for 10 minutes at 16 C then cool the sample at 4 C for at least 2 minutes Centrifuge briefly 5 seconds to collect sample at the bottom of the tube After the incubation at 4 C centrifuge the tube briefly 5 seconds to collect the reaction at the bottom of the tube Proceed to Cleanup of Double Stranded cDNA for Both t
146. stant perpendicular angle during filling and draining of the array AFFYMETRIX a 5 B 11 Appendices 5 B 12 SECTION 5 Appendices Problem Likely Cause Solution Software Problems In Microarray Suite M AS The default path for the library files in MAS is Set the correct path for the library files received the error message incorrect Could not find the cif file The library files for those specific arrays are not installed on the computer Install the library files for that array making sure to check the box appropriate for that array during the installation process The probe array type is missing The default path for the library files in MAS is from the pull down menu when incorrect Set the correct path for the library files creating an exp file The library files for those specific arrays are not installed on the computer Install the library files for that array making sure to check the box appropriate for that array during the installation process The fluidics protocols are missing from the pull down incorrect menu in the Fluidics control window The default path for the protocol files in MAS is Check that the location of the fluidics files on the hard drive corresponds to the default protocol path in MAS The library files are not installed on the computer Install the library files making sure the protocols are in the same directory as the def
147. t been validated by Affymetrix 701030 Rev 3 3 1 3 3 1 4 SECTION 3 Prokaryotic Sample and Array Processing Target Labeling for Prokaryotic GeneChip Antisense Arrays _ RNA Extraction M Random priming CDNA synthesis io RNA degradation with NaOH gt CDNA column purification 0 CDNA fragmentation Terminal labeling with ddUTP Legend RNA 5 RNA 3 Piri 5 3 IIIIII1I11111 111010 1110 1110 5 3 5 3 nine 3 00 DNA Biotin CHAPTER 1 Prokaryotic Target Preparation Reagents and Materials Required The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier phone numbers in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual Labeling z dATP dCTP dGTP dTTP 100 mM Amersham Pharmacia Biotech P N 27 2035 01 v Note Prepare a mix of all 4 dNTPs at a final concentration of 10 mM each following the instructions below z Random Primers 3 ug UL Invitrogen Life Technologies P N 48190 011 z SuperScript Il Reverse Transcriptase Invitrogen Life Technologies P N 18064 071 z SUPERaseeln Ambion
148. tation Maintenance Procedures Figure 4 14 Tamp down on the tubes to ensure that the ends remain immersed in the solution v Note For ease of handling band the tubes together using a rubber band 9 Remove any probe array cartridges and engage the washblock as shown in Figure 4 1 5 The fluidics station will begin the protocol begin to empty the lines and perform three cleaning cycles of 10 rinses each using bleach solution CHAPTER 1 Fluidics Station Maintenance Procedures AFFYMETRIX Figure 4 1 5 Remove probe array cartridges and pull up on the cartridge lever to engage the washblock and begin the protocol 10 When the fluidics station LCD window displays Remove Tube from Needles carefully remove tubing from each module needle by pushing the tubing down with your fingers while holding the needle with the other Do not pull the tube out as this may damage the needle in the process 11 Load empty microcentrifuge vials onto each module The fluidics station will empty the lines and run three cycles with three rinses each In addition the fluidics station will rinse the needle 20 times twice using distilled water then bring the temperature back to 25 C and drain the lines with air 12 The LCD display will read CLEANING DONE ES Maintenance 4 1 10 SECTION 4 Fluidics Station Maintenance Procedures Monthly Fluidics Station Decontamination Protocol To maintain your Fluidics Station in th
149. tation is helpful in estimating quantity and size distribution Spectrophotometric measurements are also important after CRNA synthesis Low Appendices 5 B 3 5 B 4 SECTION 5 Appendices cRNA yield can be a sensitive indicator of problematic labeling procedures and or starting material You may also want to experiment with using real time PCR analysis on house keeping genes after each of these reactions to monitor the efficiency of each step 3 GeneChip array image and basic data analysis Routine QC parameters to monitor include visual array inspection background scaling factor noise 3 5 GAPDH and Actin ratios and Present calls Can I hybridize samples to an array from a species other than the organism for which the array was designed Affymetrix has not validated the use of GeneChip expression arrays with alternate species Although there may be high homology between different species the sequence differences may be sufficient to interfere with hybridization and more importantly data interpretation However some customers have explored this approach The following publication is an example of this type of study Please note that this reference is listed for the convenience of our customers and is not endorsed or supported by Affymetrix Kayo T Allison D B Weindruch R Prolla T A Influences of aging and caloric restriction on the transcriptional profile of skeletal muscles from rhesus monkeys Proceedings o
150. ted target probe array controls BSA and herring sperm DNA It is then hybridized to the probe array during a 16 hour incubation The hybridization process is described in the respective sections for the different probe array types AFFYMETRIX A 1 1 5 Overview SECTION 1 GeneChip Expression Analysis Overview Step 3 Experiment and Fluidics Station Setup Specific experimental information is defined using Affymetrix Microarray Suite on a PC compatible workstation with a Windows 2000 operating system The probe array type sample description and comments are entered in Microarray Suite and saved with a unique experiment name The fluidics station is then prepared for use by priming with the appropriate buffers For more information on the fluidics station refer to the Fluidics Station User s Guide Step 4 Probe Array Washing and Staining Immediately following hybridization the probe array undergoes an automated washing and staining protocol on the fluidics station Step 5 Probe Array Scan Once the probe array has been hybridized washed and stained it is scanned Each workstation running Affymetrix Microarray Suite can control one scanner The software defines the probe cells and computes an intensity for each cell Each complete probe array image is stored in a separate data file identified by the experiment name and is saved with a data image file dat extension Review the scanner user s manual for safet
151. tion Reagents and Materials Required AFFYMETRIX The following reagents and materials are recommendations and have been tested and evaluated by Affymetrix scientists For supplier information in the U S and Europe please refer to the Supplier and Reagent Reference List Appendix A of this manual Information and part numbers listed are based on U S catalog information Additional reagents needed for the complete analysis are listed in the appropriate chapters Appendix A contains a master list of all reagents used in this manual Water Molecular Biology Grade BioWhittaker Molecular Applications Cambrex P N 51200 Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 Herring Sperm DNA Promega Corporation P N D1811 GeneChip Eukaryotic Hybridization Control Kit Affymetrix P N 900454 30 reactions or P N 900457 150 reactions contains Control cRNA and Control Oligo B2 Control Oligo B2 3 nM Affymetrix P N 900301 can be ordered separately 5M NaCl RNase free DNase free Ambion P N 9760G MES hydrate SigmaUltra Sigma Aldrich P N M5287 MES Sodium Salt Sigma Aldrich P N M5057 EDTA Disodium Salt 0 5M solution 100 mL Sigma Aldrich P N E7889 DMSO Sigma Aldrich P N D5879 Surfact Amps 20 Tween 20 10 Pierce Chemical P N 28320 Miscellaneous Supplies Hybridization Oven 640 Affymetrix P N 800138 110V or 800139 220V Sterile RNase free microcentrifuge vi
152. tion AFFX Spike in transcript name X probe sets on the GeneChip arrays listed above 1 Users who do not purchase this Kit may be required to obtain a license under U S Patent Nos 5 716 785 5 891 636 6 291 170 and 5 545 522 or to purchase another licensed kit AFFYMETRIX 2 1 13 Eukaryotic 2 1 14 SECTION 2 Eukaryotic Sample and Array Processing IMPORI Recommend 1200 Z 800 2 s 5 400 gt 7 0 T T T T T T 1 50 000 1 16 667 1 10 000 1 7 142 1 25 000 1 12 500 1 8 333 Relative Ratio Figure 2 13 Poly A RNA spikes amplified using a complex human J urkat total RNA sample Evaluation was performed using Affymetrix M icroarray Suite MAS 5 0 software The Poly A RNA Control Stock and Poly A Control Dil Buffer are provided with the kit to prepare the appropriate serial dilutions based on Table 2 1 2 This is a guideline when 1 5 or 10 ug of total RNA or 0 2 ug of mRNA is used as starting material For starting sample amounts other than those listed here calculations are needed in order to perform the appropriate dilutions to arrive at the same proportionate final concentration of the spike in controls in the samples Use non stick RNase free microfuge tubes to prepare all of the dilutions Table 2 12 Serial Dilutions of Poly A RNA Control Stock Starting Amount Serial Dilutions Spike in Volume Total RNA mRNA First Second Third 1 Lg 1 20 1 50 1 50 2 uL 5
153. tire eukaryotic target labeling process a set of poly A RNA controls is supplied in the GeneChip Eukaryotic Poly A RNA Control Kit Each eukaryotic GeneChip probe array contains probe sets for several B subtilis genes that are absent in eukaryotic samples lys phe thr and dap These poly A RNA controls are in vitro synthesized and the polyadenylated transcripts for the B subtilis genes are pre mixed at staggered concentrations The concentrated Poly A Control Stock can be diluted with the Poly A Control Dil Buffer and spiked directly into RNA samples to achieve the final concentrations referred to as a ratio of copy number summarized below in Table 2 1 1 Table 2 L1 Final Concentrations of Poly A RNA Controls in Samples Final Concentration Poly A RNA Spike ratio of copy number lys 1 100 000 phe 1 50 000 thr 1 25 000 dap 1 7500 The controls are then amplified and labeled together with the samples Examining the hybridization intensities of these controls on GeneChip arrays helps to monitor the labeling process independently from the quality of the starting RNA samples Typical GeneChip array results from these poly A spike in controls are shown in Figure 2 1 3 For Drosophila Genome Arrays P N 900335 and 900336 and Yeast Genome S98 Arrays P N 900256 and 900285 the 3 AFFX r2 Bs probe sets are not available Note that the data shown here may not be representative of those obtained using the previous genera
154. tment before proceeding to cDNA synthesis Lane 1 1 ug Sample 1 Lane 2 1 ug Sample 2 Lane 3 1 ug Sample 3 Lane 4 RNA Size Markers 23S rRNA gt 16S rRNA gt Figure 3 11 Typical RNA preparation from E coli AFFYMETRIX Prokaryotic SECTION 3 Prokaryotic Sample and Array Processing cDNA Synthesis cDNA Synthesis The following protocol starts with 10 ug of total RNA Incubations are performed in a thermocycler The integrity of total RNA is essential for the success of the assay Exercise precautions and follow standard laboratory procedures when handling RNA samples Step1 cDNA Synthesis 1 Prepare the following mixture for primer annealing Table 3 11 Primer Hybridization Mix Components Volume Final Concentration Total RNA 10 ug 0 33 ug uL 75 ng uL Random Primers 10 uL 25 ng uL 130 pM Spike in Control Transcripts 2 uL 8 pM optional Nucleasefree DI H O Up to 30 0 uL Total Volume Added 30 pL We strongly recommend using control transcripts to monitor the assay sensitivity and performance Probe sets for control genes from yeast Arabidopsis and B subtilis have been tiled on the GeneChip P aeruginosa Genome Array and E coli Antisense Genome Array To prepare spike controls containing RNA transcripts from B subtilis genes please refer to Preparation of Control Spike In Transcripts Section 3 Chapter 2 Assuming complete recovery of control transcript
155. uded in the GeneChip Sample Cleanup M odule AFFYMETRIX ICH 5 A 7 Appendices SECTION 5 Appendices Volume per Reagent Vendor P N hn Volume in Kit Rxns per Kit Hybridization Cocktail Following quantities are for 49 Format Standard Arrays see Table 2 3 1 for details on other array formats GeneChip Eukaryotic Hybridization Affymetrix 900299 or 30 Control Kit 900362 150 Herring Sperm DNA Promega D1811 3 uL 1mL 333 Acetylated BSA Invitrogen 15561 020 3 UL 3 mL 3 X 1 1 000 2x MES Hybridization Buffer 150 uL 50 mL 333 Mol Bio or DEPC Water Stain Reagents Following quantities are for the Antibody Amplification Staining Protocol 2x MES Stain Buffer 900 uL 250 mL 277 DI water 806 4 uL Acetylated BSA Invitrogen 15561 020 72 uL 3 mL 3 X 1 41 Streptavidin Phycoerythrin SAPE Molecular S 866 12 uL 1 mL 83 Probes Normal Goat IgG Sigma 15256 6 uL 1 mL 166 Biotinylated Antibody Vector BA 0500 3 6 uL 1 mL 277 Labs 4 The GeneChip Eukaryotic Hybridization Control Kit contains 20x Eukaryotic Hybridization Controls and Oligo B2 gt Total Acetylated BSA used for hybridization and stain reagents is 75 uL Each order of BSA contains 3 mL so each order is sufficient for 40 samples 6 See page 2 3 6 for 50 mL preparation 7 See page 2 3 6 for 250 mL preparation 5 A 8 APPENDIX A Supplier an
156. ug 1 20 1 50 1 10 2 uL 10 ug 0 2 ug 1 20 1 50 1 5 2 uL Avoid pipetting solutions less than 2 uL in volume to maintain precision and consistency when preparing the dilutions For example to prepare the poly A RNA dilutions for 5 ug of total RNA 1 Add 2 uL of the Poly A Control Stock to 38 uL of Poly A Control Dil Buffer for the First Dilution 1 20 2 Mix thoroughly and spin down to collect the liquid at the bottom of the tube 3 Add 2 uL of the First Dilution to 98 uL of Poly A Control Dil Buffer to prepare the Second Dilution 1 50 4 Mix thoroughly and spin down to collect the liquid at the bottom of the tube 5 Add 2 uL of the Second Dilution to 18 uL of Poly A Control Dil Buffer to prepare the Third Dilution 1 10 CHAPTER 1 Eukaryotic Target Preparation AFFYMETRIX 6 7 Mix thoroughly and spin down to collect the liquid at the bottom of the tube Add 2 uL of this Third Dilution to 5 ug of sample total RNA The First Dilution of the poly A RNA controls can be stored up to six weeks in a non frost free freezer at 20 C and frozen thawed up to eight times 2 1 15 Eukaryotic SECTION 2 Eukaryotic Sample and Array Processing Step 2 First Strand cDNA Synthesis One Cycle cDNA Synthesis Kit is used for this step v Not a 1 Briefly spin down all tubes in the Kit before using the reagents 2 Perform all of the incubations in thermal cyclers The following program can be used as a referenc
157. v4 EukGE WS2v5 Micro_1 Midi_euk2 Mini_euk2 Post Hyb 10 cycles of 2 mixes cycle with Wash 10 cycles of 2 mixes cycle with 10 cycles of 2 mixes cycle with Wash Buffer A at 25 C Wash Buffer A at 30 C Buffer A at 25 C Wash 1 Post Hyb 4 cycles of 15 mixes cycle with Wash 6 cycles of 15 mixes cycle with 8 cycles of 15 mixes cycle with Wash Buffer B at 50 C Wash Buffer B at 50 C Buffer B at 50 C Wash 2 Stain Stain the probe array for 10 minutes in Stain the probe array for 5 minutes Stain the probe array for 10 minutes in SAPE solution at 25 C in SAPE solution at 35 C SAPE solution at 25 C Post Stain 10 cycles of 4 mixes cycle with Wash 10 cycles of 4 mixes cycle with 10 cycles of 4 mixes cycle with Wash Buffer A at 25 C Wash Buffer A at 30 C Buffer A at 30 C Wash 2nd Stain Stain the probe array for 10 minutes in Stain the probe array for 5 minutes Stain the probe array for 10 minutes in antibody solution at 25 C in antibody solution at 35 C antibody solution at 25 C 3rd Stain Stain the probe array for 10 minutes in Stain the probe array for 5 minutes Stain the probe array for 10 minutes in SAPE solution at 25 C in SAPE solution at 35 C SAPE solution at 25 C Final 15 cycles of 4 mixes cycle with Wash 15 cycles of 4 mixes cycle with 15 cycles of 4 mixes cycle with Wash Wash Buffer A at 30 C The holding Wash Buffer A at 35 C The holding Buffer A at 35 C The holding temperature is 25 C t
158. ween 20 For 1 000 mL 83 3 mL of 12X MES Stock Buffer see Section 2 Chapter 2 for reagent preparation 5 2 mL of 5M NaCl 1 0 mL of 10 Tween 20 910 5 mL of water Filter through a 0 2 um filter Store at 2 C to 8 C and shield from light 2X Stain Buffer Final 1X concentration 100 mM MES 1M Nat 0 05 Tween 20 For 250 mL 41 7 mL of 12X MES Stock Buffer see Section 2 Chapter 2 for reagent preparation 92 5 mL of 5M NaCl 2 5 mL of 10 Tween 20 113 3 mL of water Filter through a 0 2 um filter Store at 2 C to 8 C and shield from light 10 mg mL Goat IgG Stock Resuspend 50 mg in 5 mL of 150 mM NaCI Store at 4 C If a larger volume of the 10 mg mL IgG stock is prepared aliguot and store at 20 C until use After the solution has been thawed it should be stored at 4 C Avoid additional freezing and thawing CHAPTER 3 Eukaryotic Arrays Washing Staining and Scanning Experiment and Fluidics Station Setup Step 1 Defining File Locations Before working with Affymetrix Microarray Suite it is important to define where the program stores and looks for files For GeneChip Operating Software GCOS this step is not necessary Proceed directly to Step 2 Entering Experiment Information 1 Launch Microarray Suite from the workstation and select Tools gt Defaults File Locations from the menu bar 2 The File Locations window displays the locations of the following files m Probe Information libr
159. y pellet Check for dryness before proceeding Resuspend pellet in DEPC treated H 0 The appropriate volume for resuspension depends on the expected yield and the amount of RNA required for the cDNA synthesis Please read ahead to the cDNA synthesis protocol in order to determine the appropriate resuspension volume at this step Addition of Carrier to Ethanol Precipitations Adding carrier material has been shown to improve the RNA vield of precipitation reactions Pellet Paint Addition of 0 5 uL of Pellet Paint per tube to nucleic acid precipitations makes the nucleic acid pellet easier to visualize and helps reduce the chance of losing the pellet during washing steps The pellet paint does not appear to affect the outcome of subseguent steps in this protocol however it can contribute to the absorbance at 260 nm when quantifying the mRNA Glycogen Addition of 0 5 to 1 uL of glycogen 5 mg mL to nucleic acid precipitations aids in visualization of the pellet and may increase recovery The glycogen does not appear to affect the outcome of subsequent steps in this protocol Quantification of RNA Quantify RNA yield by spectrophotometric analysis using the convention that 1 absorbance unit at 260 nm equals 40 ug mL RNA AFFYMETRIX The absorbance should be checked at 260 and 280 nm for determination of sample concentration and purity The A gt 60 A280 ratio should be close to 2 0 for pure RNA ratios between 19 and 2 1 are acceptab
160. y precautions and for more information on using the scanner Step 6 Data Analysis Precautions Data is analyzed using the Microarray Suite Expression Analysis window The dat image is analyzed for probe intensities results are reported in tabular and graphical formats Information on data analysis is provided in the enclosed GeneChip Expression Analysis Data Analysis Fundamentals booklet P N 701190 1 FOR RESEARCH USE ONLY NOT FOR USE IN DIAGNOSTIC PROCEDURES 2 Avoid microbial contamination which may cause erroneous results All biological specimens and materials with which they come into contact should be handled as if capable of transmitting infection and disposed of with proper precautions in accordance with federal state and local regulations This includes adherence to the OSHA Bloodborne Pathogens Standard 29 CFR 1910 1030 for blood derived and other samples governed by this act Never pipet by mouth Avoid specimen contact with skin and mucous membranes 3 Exercise standard precautions when obtaining handling and disposing of potentially carcinogenic reagents 4 Exercise care to avoid cross contamination of samples during all steps of this procedure as this may lead to erroneous results 5 Use powder free gloves whenever possible to minimize introduction of powder particles into sample or probe array cartridges CHAPTER 1 GeneChip Expression Analysis Overview Terminology Probes The oligonucl
161. ys 900301 Section 2 Chapter 2 and Chapter 3 E coli bioB Antisense biotinylated CRNA are used as GeneChip Eukaryotic bioC hybridization controls Hybridization Control bioD Kit i P N 900299 P1 Bacteriophage cre Section 2 Chapter 3 B subtilis dap Poly A tailed sense RNA can be produced by IVT N A thr and spiked into isolated RNA samples as controls trp for the labeling and hybridization process The Section 2 Chapter 2 phe spikes can also be used to estimate assay lys sensitivity Prokaryotic synthetic B2 Oligo Grid alignment Control Oligo B2 P N Arrays 900301 Section 3 Chapter 3 B subtilis dap Sense RNA can be produced by IVT and spiked N A thr into purified sample RNA as control for the trp labeling and hybridization process The spikes can Section 3 Chapter 2 phe also be used to estimate assay sensitivity and Chapter 3 lys Appendices 701045 Rev 3 5 C 3 Registration To automatically receive updates to the Expression Analysis Technical Manual please register on our web site at www affymetrix com support technical expression_registration affx
162. z Distilled water Invitrogen Life Technologies P N 15230 147 m Bovine Serum Albumin BSA solution 50 mg mL Invitrogen Life Technologies P N 15561 020 m R Phycoerythrin Streptavidin Molecular Probes P N S 866 m 5M NaCl RNase free DNase free Ambion P N 9760G z PBS pH 72 Invitrogen Life Technologies P N 20012 027 m 20X SSPE 3M NaCl 0 2M NaH PO 0 02M EDTA BioWhittaker Molecular Applications Cambrex P N 51214 m Goat IgG Reagent Grade Sigma Aldrich P N 5256 a Anti streptavidin antibody goat biotinylated Vector Laboratories P N BA 0500 Surfact Amps 20 Tween 20 10 Pierce Chemical P N 28320 m Bleach 5 25 Sodium Hypochlorite VWR Scientific P N 37001 060 or equivalent Miscellaneous Supplies m Sterile RNase free microcentrifuge vials 1 5 mL USA Scientific P N 1415 2600 or equivalent m Micropipettors P 2 P 20 P 200 P 1000 Rainin Pipetman or equivalent Sterile barrier pipette tips and non barrier pipette tips z Tygon Tubing 0 04 inner diameter Cole Parmer P N H 06418 04 z Tough Spots Label Dots USA Scientific P N 9185 0000 Eukaryotic 2 3 6 SECTION 2 Eukaryotic Sample and Array Processing Reagent Preparation Wash Buffer A Non Stringent Wash Buffer 6X SSPE 0 01 Tween 20 For 1 000 mL 300 mL of 20X SSPE 1 0 mL of 10 Tween 20 699 mL of water Filter through a 0 2 um filter Wash Buffer B Stringent Wash Buffer 100 mM MES 0 1M Na 0 01 T

Affy Technical Manual

Contents

Download Pdf Manuals

Related Search

Related Contents