Home

Sample & Assay Technologies PyroMark® Q24 Software User Guide

1. Add or remove bisulfite treatment controls CpG assays Histogram GTCGACT EEUIPIS 8 3 GTA 5 l Add Potential Bisulfite Treatment Control Before Dispensation Add Potential Bisulfite Treatment Control After Dispensation CpG assays should contain at least one internal control to assess successful bisulfite treatment preferably at the beginning of the sequence C bases that are not followed by G in the sequence are usually not methylated and should therefore be fully converted to T after bisulfite treatment and PCR As a result of successful bisulfite treatment all templates should show only Ts and no Cs in these positions For reverse assays all templates should show only As and no Cs in these positions PyroMark Q24 Software User Guide 07 2009 21 The potential positions for bisulfite treatment controls are illustrated with a bold orange letter in the histogram T in a forward assay and A in a reverse assay A bisulfite treatment control can be added by left clicking the bold orange T or A and selecting the desired option from the context menu It can also be added manually by adding a C before or after a T in the dispensation order A bisulfite treatment control can be removed by left clicking the control C in a forward assay or G in a reverse assay and selecting Remove Bisulfite Control from the context menu Note In the sequence before bisulfite treatment check whether the suggested bisulfite treat
2. Fie Tods Repas Widow Select the desired assay type to create a new assay MUR file To set up the assay see page 17 AQ or CpG Qi newRun Ctrl R or page 28 SQA assay E Open SERO Select New Run or click the green button in the Impor toolbar to create a new run file To set up the run lel Save Ctrl S see page 31 Save As Ctrl Shift 5 EXE Select Open or click amp in the toolbar to open a saved assay or run file zu c d ME NewAQassay Crit Select Create New Run from Sample Layout File Ml few CpG Assay CHhe from the Import submenu to create a new run using Gal NewsQA Assay Ctri Q a plate layout for sample IDs and notes optional PyroMark Q24 Software User Guide 07 2009 defined in a tab or comma delimited text file tsv txt or csv see page 35 Select Create New AQ CpG Assay from Assay Design File from the Import submenu to create a new AQ or CpG assay based on an assay file xml created with PyroMark Assay Design Software The software will import the sequence to analyze and the names of the variable positions Select Save or click ll in the toolbar to save the changes in the current file If the file has never been saved select the location enter the filename in the dialog box that opens Select Save As to save a copy of the current file Select location and enter the filename in the dialog box that opens Select Exit to shut down the software Tools menu fo
3. Patterns that cannot exist after bisulfite treatment are not valid in a CpG assay For example GC TGAC G is not valid since C TG is a forward CpG site and C G cannot exist after bisulfite treatment The following CpG site and SNPs can be included in a forward assay E CpG site C TG M SNPs A T A G G T and A T G i e C cannot be included The following CpG site and SNPs can be included in a reverse assay M CpG site CG A M SNPs A T A C C T and A T C i e G cannot be included Note The software does not support analysis of CpG sites that include an additional variable position for example A C TG These kinds of SNPs can be analyzed by typing C TG in the Sequence to Analyze text box and ATCG in the Dispensation Order text box Proceed with the run as usual After analysis of the CpG sites switch to the AQ mode and change C TG to A C TG in the Sequence to Analyze text box and analyze the variable position In the same way C TG A can be analyzed by typing C TG in the Sequence to Analyze text box and TCGA in the Dispensation Order text box After analysis of the CpG sites switch to the AQ mode and change C TG to C TG A in the Sequence to Analyze text box and analyze the variable position PyroMark Q24 Software User Guide 07 2009 19 Generate the dispensation order A dispensation order for the entered sequence to analyze is generated by the software by cl
4. Analysis Log from the Tools menu Note If editing a base called sequence note that the quality assessments are still based on the original sequence the sequence called by the software To edit the quality assessments see page 46 Note It is not possible to edit the base called sequences for a locked assay 46 PyroMark Q24 Software User Guide 07 2009 View Print and Save Analysis Reports PyroMark Q24 Software offers the following analysis reports for processed runs Reports for CoG runs Analysis Statistics Report This includes analysis statistics for all or selected wells Reports Window Help CpG Analysis Statistics M Analysis Results Report This includes well CpG Analysis Results information and analysis results for all or selected CpG Pyrogram Report wel S CpG Full Report m uH x E Pyrogram Report This includes well information Reports for AQ runs and Pyrogram for all or selected wells Reports Window Help E Full Report This includes run parameters run log AQ Analysis Statistics well information and analysis results including AQ Analysis Results Pyrogram for all or selected wells AQ Pyrogram Report M SNP Overview Report This includes genotypes and quality assessments for all SNPs and InDels The information is presented in plate overviews with one plate per position number AQ Full Report SNP Analysis Results SNP Program Report SNP Full Report Note To view rep
5. s c3 BM T cuore Arun file that has been Refresh processed c9 New Assay amp amp Broken shortcut This may be New Run unite HET due to a network server that Properties is temporarily inaccessible or that the file or the folder has been moved renamed or aca cio deleted outside the software Add File Shortcut Adding and removing shortcuts updating the contents of a folder and viewing file and folder properties E Add a shortcut to a folder or drive by clicking Add Folder Shortcut or right click the Shortcuts folder and select Add Folder Shortcut from the context menu M Adda shortcut to a file by clicking Add File Shortcut or right click the Shortcuts folder and select Add File Shortcut from the context menu M Remove a shortcut by right clicking the shortcut and selecting Remove Shortcut from the context menu The files and subfolders in a shortcut folder cannot be removed separately M Update the contents of a folder by right clicking it and selecting Refresh from the context menu W View file or folder properties e g run parameters by right clicking the file or folder and selecting Properties from the context menu Note If the mouse pointer is positioned over a file in the shortcut browser a tooltip displays the assay note for assay files and the plate ID for run files if entered 8 PyroMark Q24 Software User Guide 07 2009 Creating opening and copying files and viewing the run
6. A 4 New CpG Assay Ctrl G bed Mew SQA Assay Ctrl Q 1 Click in the toolbar and select New SQA Assay A new assay file is created 2 Enter the Dispensation Order see page 29 3 Optional Enter information about the assay in the Assay Note text box 4 Before running your samples validate your assay using a reference DNA sample see Appendix B of the PyroMark Q24 User Manual 5 Optional If applicable during the assay validation edit the analysis parameters see page 29 6 Optional Lock the assay for editing by clicking the Lock Assay button at the bottom of the assay setup window A locked assay that has been run on the PyroMark Q24 Instrument cannot be unlocked i e it will not be possible to edit the analysis parameters or results after the assay has been processed Note In the shortcut browser you can create a new assay file by right clicking the folder you wish to place it in and selecting New Assay and the desired assay type from the context menu Enter the filename and press Enter To add a shortcut to a folder or drive click Add Folder Shortcut 28 PyroMark Q24 Software User Guide 07 2009 Note An assay note can be displayed in a tooltip in the shortcut browser by positioning the mouse pointer over the assay file Note To save the file click id in the toolbar If the file has never been saved select location and enter the filename in the dialog box th
7. High resolution quantification of di tri or tetra allelic mutations Genotyping and quantification of InDels AQ and CpG assays use sequence context as built in quality control Analysis of methylation in the presence of SNPs Built in quality control for bisulfite treatment in methylation assays Base calling with quality assessment Analysis modes TU NES PyroMark Q24 Software has three analysis gt New AQ Assay Ctrl 4 modes s New CpG Assay Ctrl G bed NewSQAAssay Ctrl Q E AQ A variety of quantification studies and genotype analysis of SNPs and InDels gt AQ y E CpG Methylation analysis of multiple AQ consecutive CpG sites Bess E SQA Base calling of unknown sequences P soa The three different types of analysis can be performed on the same PyroMark Q24 Plate To toggle between the analysis modes in the analysis view select AQ CpG or SQA in the toolbar PyroMark Q24 Software User Guide 07 2009 7 Shortcut browser The shortcut browser provides a quick and easy way to access folder contents and commonly used assay and run files PyroMark Q24 The following icons are used to display Q File Tools Reports Window Help information about the files x NT X SQA 2 02 djo Lps AQ assay file LJ Shortcuts J Example Files j CpG assay file 4 Lagerholm pee tal SQA assay file Plate23413 D A fil th t h t b a aid run file that has not been E Vra processed assay
8. Q24 Software User Guide 07 2009 23 M Adjust heights of histogram bars see page 27 E To enable or disable variable positions and or change expected methylation ranges only CpG assays see Set up the variable positions page 22 Ensure changes are validated see Appendix B of the PyroMark Q24 User Manual Note When using QIAGEN kits use the settings stated in the kit handbooks Note All saved changes are logged To view a change log for an assay open the assay file and click Show Change Log Edit analysis parameters in the Analysis Parameters tab The following analysis parameters can be edited in the Analysis Parameters tab Unsuccessful bisulfite These parameters state the highest acceptable treatment CpG percentages of unconverted sequence to achieve assays only Passed quality assessment and Check quality assessment for the CpG sites The entered values are compared to the single peak height value that the analysis algorithm determines Allowed percentage for The highest acceptable percentages of unconverted passed quality sequence to achieve Passed quality assessment for the CpG sites The default value is 5 Note The value cannot be higher than the allowed percentage for check quality value see below 24 PyroMark Q24 Software User Guide 07 2009 Allowed percentage for The highest acceptable percentages of unconverted check quality sequence to achieve Check q
9. a specific well displayed in the upper area with a Pyrogram of one or several wells displayed in the lower area 1 In the Overview tab select the well or wells see Select wells page 16 you wish to open in the lower area 2 Right click the selection and select Open in Lower Area from the context menu 3 Select the well you wish to open in the upper area PyroMark Q24 Software User Guide 07 2009 43 A1 I33 Qo Analyze Selected Lil K in Lower Area ad Lal Copy as Image c Print If the Pyrograms of several wells are displayed in the lower area use the scroll bar to change the Pyrogram within the selection A Pyrogram with the same sequence to analyze can be zoomed simultaneously i e linked zooming by clicking amp in the top right corner of the upper area To close the Pyrogram list in the lower area click x in the upper right corner of the lower area Zoom Pyrogram and view description of icons and colors For information on icons and colors used in the Pyrogram area and how to zoom see Pyrogram page 14 Edit analysis parameters The default analysis settings have been set to give optimal analysis results for most assays If changing these settings ensure the changes are validated see Appendix B of the PyroMark Q24 User Manual Note When using QIAGEN kits use the settings stated in the kit handbooks Note It is not possible to edit the analysis parameters for a locked
10. cell 2 To increment by row Position the mouse pointer over the lower right square of the selection Press and hold down the Ctrl key the left mouse button while moving the mouse to change the selection 34 PyroMark Q24 Software User Guide 07 2009 First release the left mouse button then the Ctrl key When the left mouse button is released the sample ID of the first selected cell is incremented and pasted into the selected cells 3 To increment by column Position the mouse pointer over the lower right square of the selection Press and hold down the Shift and Ctrl keys the left mouse button while moving the mouse to change the selection First release the left mouse button then the Shift and Ctrl keys When the left mouse button is released the sample ID of the first selected cell is incremented and pasted into the selected cells AQ Assay 1 Sample 3 AQ Assay 1 Sample 4 The sample ID Sample 1 is copied and incremented by column Print or export plate setup as image The Plate Setup can be printed or copied as an image to the clipboard by right clicking the plate and selecting Print or Copy as Image from the context menu The image can be pasted into applications that support Enhanced Metafile EMF images Define sample ID and note externally By using the Import Insert Sample Layout File or Paste Sample Layout feature you can easily use the same layou
11. delete contents from cells 34 Print or export plate setup as image 35 PyroMark Q24 Software User Guide 07 2009 3 Define sample ID and note externally 35 Review the plate setup 37 Process the Run on the PyroMark Q24 Instrument 38 Workflow 38 Analyze the Run 39 Workflow 39 Analyze all or the selected wells 39 View the analysis results 40 Edit analysis parameters 44 Edit quality assessments 46 Edit base called sequences 46 View Print and Save Analysis Reports 47 Analysis statistics report 48 Analysis results report 49 Pyrogram report 50 Full report 52 SNP overview report 53 Manage Instrument Methods 54 Method parameters 54 General Hints and Tips 55 Validation of assays 55 Analysis log 55 Protection of files 55 Protection of analysis results 55 Troubleshooting Guide 56 References 57 4 PyroMark Q24 Software User Guide 07 2009 Product Use Limitations Use PyroMark Q24 Software only with the PyroMark Q24 System Product Warranty and Satisfaction Guarantee QIAGEN guarantees the performance of all products in the manner described in our product literature The purchaser must determine the suitability of the product for its particular use Should any product fail to perform satisfactorily due to any reason other than misuse QIAGEN will replace it free of charge or refund the purchase price We reserve the right to change alter or modify any product to enhance its performance and design If a QIAGEN product does not meet your exp
12. from the context menu the zoom is set to the previous level or by double clicking the histogram area the zoom is set to 100 Export the histogram as an image The histogram can be copied as an image to the clipboard by right clicking the histogram and selecting Copy as Image from the context menu The image can be pasted into applications that support Enhanced Metafile EMF images PyroMark Q24 Software User Guide 07 2009 13 Pyrogram The Pyrogram is the graph resulting from a sequencing reaction performed using Pyrosequencing technology Incorporated nucleotides are shown as peaks in the Pyrogram AQ and CpG assays A5 YGGATAGYGA AAYGYGTAAGYGTATA 2 1 4 1 3 Zoom Out Copy as Image CJ Show Histogram 100L MER thet tmh oti m s Show Reference Peaks 0 EA k t td A E 4 PF S GTCGACTATGTCGATTGATCAGTCGTATGTCGTA 5 10 15 20 25 30 The following information icons and colors are displayed and used in the Pyrogram area for an AQ or CpG assay E The well name and the sequence to analyze are shown in the upper left corner M The analysis result the allele frequencies or the methylation percentage is displayed above each variable position for example RP InDel and 959 The background color shows the quality assessment of the analysis result see color legend on page 42 If a quality assessment has been edited by the user this is displayed by a bor
13. 2009 15 Export Pyrogram as image The Pyrogram can be copied as an image to the clipboard by right clicking the Pyrogram area and selecting Copy as Image from the context menu The image can be pasted into applications that support Enhanced Metafile EMF images Select wells To select a single well simply click on it aqaaaaca To select a rectangular group of wells for example A2 A3 B2 B3 and C2 C3 E Press and hold down the left mouse button while dragging the mouse pointer from well A2 to C3 or M Select well A2 and press and hold down the Shift key while selecting well C3 or E Select well A2 and press and hold down the Shift key while pressing the Right Arrow key once and the Down Arrow key twice EXENEEENEEAEN go m XX X CO BO T XXX XX 00000000 To add wells to the selection above for example wells B7 and C7 press and hold down the Ctrl key while selecting the wells ERENEN ER EN EXIEER ER FI To deselect a well press and hold down the Ctrl key while selecting the well Note If several wells are selected in the plate information for the well with the orange selection frame in the analysis view is shown in the Well Information area etc 16 PyroMark Q24 Software User Guide 07 2009 Start the Software In the Windows Start menu select All Programs PyroMark PyroMark Q24 The PyroMark Q24 Software User Guide this publication can be ac
14. AQ Analysis Results AQ Pyrogram Report AQ Pyrogram Report AQ Full Report AQ Full Report Reports Window Help SNP Analysis Results SNP Analysis Results CpG Analysis Statistics Reports Window Help SNP Pyrogram Report SNP Pyrogram Report CpG Analysis Results SQA Analysis Results SNP Full Report SNP Full Report CpG Pyrogram Report SQA Pyrogram Report SNP Overview Report SNP Overview Report CpG Full Report SQA Full Report The Pyrogram report includes well information well name assay name sample ID and well note and Pyrogram for all or selected wells see Select wells page 16 If analysis parameters quality assessments or analysis results SQA report only have been edited by the user this is stated in the report 50 PyroMark Q24 Software User Guide 07 2009 The following information icons and colors are displayed and used in the AQ SNP and CpG reports E The well name and the sequence to analyze E The analysis result allele frequencies AQ report genotypes SNP report or methylation percentages CpG report is displayed above each variable position for example s InDel and 26 The background color shows the quality assessment of the analysis result see color legend on page 42 Note in white Deselected by the user 4 in white 2 The software does not support analysis for example analysis of SNP in the CpG mode 8 89 in red Not possible to anal
15. F OF Or OF ar ararararararar ef Of Of 5 101520 2530 354045 5055 6065 70 75 80 85 90 95100103 10 182 When a base is selected in the base called sequence the corresponding peak is highlighted in both Pyrogram areas and vice versa The following information and colors are displayed and used in the Pyrogram area for an SQA assay M The well name is shown in the upper left corner M To view the height of a peak position the mouse pointer over the top of the peak A tooltip displays the height M When showing the histogram a compensated Pyrogram is displayed in gray over the peaks in the Pyrogram It is best viewed when zoomed in E When showing known bases peaks with known bases are marked with blue diamonds in Pyrogram E When showing peak levels calculated peak levels are displayed in the Pyrogram M Inthe compensated Pyrogram in the lower area the peaks are colored according to their quality assessments see color legend page 42 Note By right clicking the Pyrogram area it is possible to toggle between viewing and hiding the histogram known bases and peak levels Zoom Pyrogram It is possible to zoom in on the Pyrogram by selecting a stretch with the left mouse button Zoom out either by right clicking the Pyrogram area and selecting Zoom Out from the context menu the zoom is set to the previous level or by double clicking the Pyrogram area the zoom is set to 100 PyroMark Q24 Software User Guide 07
16. July 2009 PyroMark Q24 Software User Guide For use with the PyroMark Q24 QIAGEN Sample amp Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies enabling the isolation and detection of contents of any biological sample Our advanced high quality products and services ensure success from sample to result QIAGEN sets standards in Purification of DNA RNA and proteins Nucleic acid and protein assays microRNA research and RNAi Automation of sample and assay technologies Our mission is to enable you to achieve outstanding success and breakthroughs For more information visit www giagen com Contents Product Use Limitations 5 Product Warranty and Satisfaction Guarantee 5 Technical Assistance 5 Introduction 6 About this user guide 6 PyroMark Q24 Software 7 Analysis modes 7 Shortcut browser 8 Main menu and toolbars 9 Histogram 13 Pyrogram 14 Select wells 16 Start the Software 17 Set Up an AQ or CpG Assay 17 Workflow 17 Enter the sequence to analyze 18 Generate the dispensation order 20 Add or remove bisulfite treatment controls CpG assays 21 Set up the variable positions 22 Edit analysis parameters 23 Set Up an SQA Assay 28 Workflow 28 Enter the dispensation order 29 Edit analysis parameters 29 Set Up a Run 31 Workflow 31 Enter the run parameters 32 Add assay files to the plate 33 Enter sample IDs and notes 33 Copy or
17. Pyrogram Report CpG Full Report Reports Window Help SQA Analysis Results SQA Pyrogram Report SQA Full Report The Analysis Results report includes the following information for all or selected wells see Select wells page 16 Optional The analysis version well notes and analysis warnings In the AQ and CpG reports it is also possible to include the names and the original Well information well name assay name and sample ID The allele frequencies AQ report genotypes SNP report methylation percentages CpG report or base called sequences SQA report and the quality assessments The mean methylation percentage and the standard deviation of all passed CpG sites in a well CpG report only The highest and lowest methylation percentage in a well CpG report only Information on whether the analysis parameters quality assessments and analysis results SQA report only have been edited by the user or not and or the current quality assessments for the variable positions The report can be saved as a text file tsv or csv or an HTML file html The report can be imported into Microsoft Excel or other applications that can handle text files tsv or csv with data that is separated by semicolons or tabs This is useful when doing further calculations on the data The first line in the report states the name of the run The following two or three lines contain the column headin
18. accessed from the Reports menu in the AQ mode Note Since the CoG mode does not support automatic analysis of SNPs methylation percentages and quality assessments are only determined for the CpG sites SNPs in a CpG assay can be analyzed in the AQ mode using the sequence to analyze used in the CpG setup To exclude the CpG sites in the SNP reports select the Analysis Setup tab and uncheck the Analyze option for these positions in the Variable Positions tab View the analysis results By selecting an analyzed light blue well in the Overview tab the corresponding Pyrogram is displayed in the Pyrogram area and the well information including analysis warnings is listed in the Well Information area If several wells are selected in the plate overview information for the well with the orange selection frame is shown _ 40 PyroMark Q24 Software User Guide 07 2009 Get an overview of the results The following well information can be viewed in the plate overview in the Overview tab AQ assays Select to show the assay name f Select to show the sample ID ki Select to show the well note Sample ID Note Quality A Select to show the quality bar The quality bar shows the quality assessment of all variable positions in the well or of all the bases in the base called sequence See color legend on page 42 2j Assay Adi None 23 Assay Select to show the
19. all variable positions or a single position If several warnings of the same kind were triggered only the most serious ones are displayed in the Well Information area E SQA assays Affects the quality assessment for either the whole sequence or from a specific dispensation and forward All warnings triggered within the quality control window are displayed in the Well Information area For some of the warnings the criteria for occurrence and the effect on the quality assessment can be modified by the user in the Analysis Parameters tab see Edit analysis parameters page 44 Note If a dispensation error occurs it is recommended that the reagent cartridge is replaced Quality assessments The quality assessments of the analysis results are displayed by Quality bars in the plate overview see page 41 M The background color of the analysis results the allele frequencies or the methylation percentages in the Pyrogram for example 28 or the base called sequence see page 41 E Quality control windows 9 in the plate overview see page 41 SQA assays only E The peaks in the compensated Pyrogram are colored according to their quality assessments SQA assays only Quality colors E Blue Passed m Yellow Check E Red Failed Bi White Not analyzed Either analysis is not supported by the software e g SNP in the CpG mode or the variable position has been deselected by the user AQ and CpG ass
20. alysis Parameters tab see below Ensure changes are validated see Appendix B of the PyroMark Q24 User Manual Note When using QIAGEN kits use the settings stated in the kit handbook PyroMark Q24 Software User Guide 07 2009 29 Note All saved changes are logged To view a change log for an assay open the assay file and click Show Change Log at the bottom of the assay setup window Edit analysis parameters in the Analysis Parameters tab The following analysis parameters can be edited in the Analysis Parameters tab Peak height These parameters define the lower intensity limit for threshold the single peak height level at the beginning of the Pyrogram Required peak height The minimum signal value for a peak to achieve for passed quality Passed quality assessment in the base called sequence The default value is 10 Note The value cannot be lower than the Required peak height for check quality value see below Required peak height The minimum signal value for a peak to achieve for check quality Check quality assessment in the base called sequence The warning Uncertain due to low peak height is triggered during the analysis Note This rule is only used if the rule for Passed quality is not met The default value is 5 A signal value for a peak that is lower than the set value will result in a Failed quality assessment The warning Failed due to low peak height is triggered du
21. are User Guide 07 2009 33 Copy or delete contents from cells M To cut the contents of a cell to the clipboard right click the cell and select Cut from the context menu M To copy the contents of a cell to the clipboard either right click the cell and select Copy Cell from the context menu or select the cell and press Ctrl C E To paste the clipboard to a cell or a selection of cells see Select wells page 16 either right click the cell or the selection and select Paste from the context menu or select the cell s and press Ctrl V M To delete one or more assays sample IDs or notes either right click the cell or the selection and select Delete from the context menu or select the cell s and press Delete Drag copy the contents of a cell to other wells To drag copy the contents of a cell to other wells 1 Select the cell that you wish to copy 2 Position the mouse pointer over the lower right square of the selection and press and hold down the left mouse button while you move the mouse to change the selection 3 When the left mouse button is released the contents of the first selected cell are pasted into the selected cells CpG Assay 1 CpG Assay 2 25 yl PCR prod Drag copy of the note 25 ul PCR prod Drag copy and increment sample ID If the last part of an entered sample ID is a number the number can be incremented when drag copying the sample ID 1 Select the sample ID
22. assay A 1 Select the well or wells see Select wells page 16 for which you wish to edit the analysis parameters Note The changes will only be applied to wells that share the same assay and dispensation order as the displayed well To edit the analysis parameters for all wells with the same assay and dispensation order you only have to select one of the wells 2 Edit analysis parameters in the Analysis Setup tab To enable or disable variable positions and or change expected methylation ranges only CpG assays see Set up the variable positions page 22 To edit other analysis parameters for an AQ or CpG assay see page 23 To edit the analysis parameters for an SQA assay see page 29 Note It is not possible to change the assay name dispensation order or assay note 44 PyroMark Q24 Software User Guide 07 2009 3 When finished click Apply Note It is also possible to enable or disable reference peaks and or bisulfite treatment controls CpG assays only in Pyrogram in the Overview tab see instructions on page 27 To apply changes made in Pyrogram click the green button This button is enabled when a change has been made 4 Inthe Apply Analysis Setup dialog box apply the changes to all or the selected wells To apply the changes to all wells that share the same assay and dispensation order as the displayed well i e all the white wells in the Apply Analysis Setup dialog box clic
23. at opens Enter the dispensation order Type or paste Ctrl V the dispensation order into the Dispensation Order text box The following rules apply when entering the dispensation order in the software W The allowed characters for input are A C G and T M To repeat a group of bases use numbers in combination with parenthesis e g 3 CTGA corresponds to CTGACTGACTOA If the dispensation order contains an error this is displayed by a red exclamation mark at the end of the text box Position the mouse pointer over the exclamation mark and a tooltip will display an explanation of the error The character or characters that caused the error will be marked red in the dispensation order The entered dispensation order is not complete Dispensation Order 3 CTGAJCTT4 GCTC Qs Expanded Dispensation Order CTGACTGACTGACTTGCTC The error The entered dispensation order is not complete is caused by a missing or incorrect positioned parenthesis In this example a closing parenthesis is missing Edit analysis parameters The default analysis settings have been set to give optimal analysis results for most assays If applicable during the assay validation the results may be improved by edit the analysis parameters M The Quality Control Window setting in the Settings tab is by default set to 20 If more or less bases are required change accordingly M Edit analysis parameters in the An
24. ay file by right clicking the folder you wish to place it in and selecting New Assay followed by AQ Assay or CpG Assay from the context menu Enter the filename and press Enter To add a shortcut to a folder or drive click Add Folder Shortcut PyroMark Q24 Software User Guide 07 2009 17 Note An assay note can be displayed in a tooltip in the shortcut browser by positioning the mouse pointer over the assay file Note To save the file click id in the toolbar If the file has never been saved select location and enter the filename in the dialog box that opens Enter the sequence to analyze Type or paste Ctrl V the sequence to analyze into the Sequence to Analyze text box If creating a CpG assay enter the sequence after the bisulfite treatment The following rules apply when entering the DNA sequence in the software E The allowed characters for sequence input are A C G and T as well as IUPAC codes E Variable positions can be entered using either IUPAC codes or a forward slash as a separator between the two potential bases e g C T M InDels should be entered using square bracket notation e g AT M The sequence should not include more than 400 characters or 100 variable positions E Variable positions involving a combination of SNPs and InDels should be entered using a combination of or IUPAC codes and For example T A or W represents a tri allelic p
25. ays only 42 PyroMark Q24 Software User Guide 07 2009 Methylation levels In the CoG mode a methylation bar in the Overview tab shows the methylation level for each CpG site in the well see page 41 Methylation colors W Light green Below the expected range E Green Within the expected range E Dark green Above the expected range View and compare Pyrogram By selecting an analyzed well in the Overview tab the corresponding Pyrogram and theoretical histogram if an AQ or CpG assay or compensated Pyrogram if an SQA assay are displayed verview mE AQ CT ICT BCT ATG ACTH Nel AC DINNI ES pner Sanner Uc igi peg ES DUIS peg Bz AFTR ANSCTS ACTA Boele OCT ANTA 30 cT6 Ans CT ABAE Dogg rong lands ffawna Fin uig KHT LARS _ Lm 30 CTG 30 CTG 30xCTS PRETE L3Q CTG 30XCTG 30CT G 3OXCTG LAESA LAGAS aria MDC S gers Benussi Faktor Y Eulog 1 S um um _ CAGTCTGTGA HSEAGGAGCCAGGCTCAGTCTGTGCAGG 5 1015 20 25 30 354045 5055 6065 70 75 80 85 90 9510003 1018020 When a base is selected in the base called sequence the corresponding peak is highlighted in both Pyrogram areas and vice versa Compare Pyrogram of different wells To compare a Pyrogram of
26. cessed at any time by pressing the F1 key when in the software Set Up an AQ or CpG Assay Workflow 2 New AQ Assay Ctrl 4 New CpG Assay Ctrl G bed Mew SQA Assay Ctrl Q 1 Click in the toolbar and select New AQ Assay or New CpG Assay A new assay file is created 2 Enter the sequence to analyze see page 18 3 Click the Generate Dispensation Order button see page 20 4 Optional If creating a CpG assay enter the Sequence Before Bisulfite Treatment This information is useful when adding bisulfite treatment controls 5 Recommended If creating a CpG assay add bisulfite treatment controls preferable at the beginning of the sequence see page 21 6 Optional Enter information about the assay in the Assay Note text box 7 Optional Set up the variable positions see page 22 8 Before running your samples validate your assay using a reference DNA sample see Appendix B of the PyroMark Q24 User Manual 9 Optional If applicable during the assay validation edit the analysis parameters see page 23 10 Optional Lock the assay for editing by clicking the Lock Assay button at the bottom of the assay setup window A locked assay i that has been run on the PyroMark Q24 Instrument cannot be unlocked i e it will not be possible to edit the analysis parameters or results after the assay has been processed Note In the shortcut browser you can create a new ass
27. d Note To save the file click id in the toolbar If the file has never been saved select location and enter the filename in the dialog box that opens Enter the run parameters The following run parameters are available Run name The name of the run is given when the file is saved Renaming the file also changes the name of the run Instrument method Select instrument method according to the reagents and cartridge that will be used for the run see the handbooks supplied with the products Note It is recommended that only methods supplied by QIAGEN are used Plate ID Optional Enter ID of the PyroMark Q24 Plate Note If you position the mouse pointer over a run file in the shortcut browser a tooltip displays the entered plate ID Barcode Optional Enter a barcode number for the plate or if you have a barcode reader connected to your computer place the mouse cursor in the Barcode text box and scan the barcode Reagent ID Optional Enter the lot number for the PyroMark Gold Q24 Reagents to be used The lot number can be found on the product label Note It is recommended that the reagent ID is entered so that any unexpected problems with the reagents can be traced Estimated run time The estimated run time eee 32 PyroMark Q24 Software User Guide 07 2009 Run note Optional Enter a note about the contents or purpose of the run Add assay files to the plate To add an assay to a well you can either E Se
28. der around the analysis result for example E42 If the mouse pointer is positioned over the analysis result a tooltip displays the position number and analysis warnings Note in white Deselected by the user in white The software does not support analysis for example analysis of SNP in the CpG mode WAI in red Not possible to analyze due to lack of data E Variable positions are highlighted with a blue gray background color M When showing reference peaks blue diamonds are displayed above the reference peaks E Bisulfite treatment controls are highlighted with a light yellow background color When showing reference peaks orange diamonds are displayed above the bisulfite treatment controls CpG assays only M To view the height of a peak position the mouse pointer over the top of the peak A tooltip displays the height E When showing the histogram the histogram is displayed in gray over the peaks It is best viewed when zoomed in 14 PyroMark Q24 Software User Guide 07 2009 Note By right clicking the Pyrogram area it is possible to toggle between viewing and hiding the histogram and reference peaks SQA assays CAGTCT GTGA Q A GGA GCCAGGCT CAGT CT GTGACCAC if ER LAE Zoom Out LE baa bali baba X Copy as Image FITUS C EJTATATSTIATA KIAIA Show Histogram bo 85 90 951000210132 RE EET Show Known Bases Serres L tow Peak Love Se ere er ererarararararararar Of OF OF OF O
29. ders 800 18859 Fax 800 18817 Technical 800 18712 Singapore Orders 65 67775366 Fax 65 67785177 Technical 65 67775366 Spain Orders 91 630 7050 Fax 91 630 5145 Technical 91 630 7050 Sweden Orders 020 790282 Fax 020 790582 Technical 020 798328 Switzerland Orders 055 254 22 11 Fax 055 254 22 13 Technical 055 254 22 12 UK Orders 01293 422 911 Fax 01293 422 922 Technical 01293 422 999 LIL USA Orders 800 426 8157 Fax 800 718 2056 Technical 800 DNA PREP 800 362 7737 QIAGEN N Sample amp Assay Technologies
30. e AQ CpG or SNP from specified is being imported PyroMark Assay Design Software file For analysis related problem see the Troubleshooting section of the PyroMark Q24 User Manual For more information see the Frequently Asked Questions page at the Technical Support Center www giagen com FAQ FAQList aspx The scientists in QIAGEN Technical Services are always happy to answer any questions you may have about either the information in this user guide or sample and assay technologies for contact information see back cover or visit www qiagen com ER 56 PyroMark Q24 Software User Guide 07 2009 References QIAGEN maintains a large up to date online database of scientific publications utilizing QIAGEN products Comprehensive search options allow you to find the articles you need either by a simple keyword search or by specifying the application research area title etc For a complete list of references visit the QIAGEN Reference Database online at www qiagen com RefDB search asp or contact QIAGEN Technical Services or your local distributor eee H s PyroMark Q24 Software User Guide 07 2009 57 Notes 58 PyroMark Q24 Software User Guide 07 2009 Trademarks QIAGEN Pyrogram PyroMark Pyrosequencing QIAGEN Group Adobe Reader Adobe Systems Incorporated Excel Microsoft Windows Microsoft Corporation Limited License Agreement Use of thi
31. e Io 19 ao Selected Wells see Select wells page 16 for the Analyze All Wells current run file Meyrin e Click u2 to view the run parameters and a run log for the current run file To print the report click amp US Select AQ CpG or SQA in the toolbar to i toggle between the analysis modes Pp Bi SQA 12 PyroMark Q24 Software User Guide 07 2009 Histogram Histogram ee EN 2 E Copy as Image ooo eeeeeeeeeeeeeugeee6 n 00060006 t i SORORE E ES Peaks Lil 1 M i Tt Il o Ivi hei Dei ei TCTGTCGTAGTCGCT TCGTAGTCGA 5 10 15 20 25 Histogram showing a theoretical CpG assay result When setting up an AQ or CpG assay the theoretical representation of the expected Pyrosequencing peak pattern is presented in the Histogram area The following icons and colors are used in the histogram E Variable positions are highlighted with a blue gray background color E When showing reference peaks blue diamonds are displayed above the reference peaks E Bisulfite treatment controls are highlighted with a yellow background color When showing reference peaks orange diamonds are displayed above the bisulfite treatment controls CpG assays only Zoom histogram It is possible to zoom in on the histogram by selecting a stretch of it with the left mouse button Zoom out either by right clicking the histogram area and selecting Zoom Out
32. e context menu To edit the quality assessment of a base called sequence position the mouse pointer over the left or the right end of the Passed Check or Failed area so that the pointer changes from a white arrow to and move the mouse to the left or the right while holding down the left mouse button ITACATGTTGGTATTTGGG If a quality assessment has been edited by the user this is displayed by a warning icon in the plate overview in the Overview tab a warning in the Well Information area and if it is an AQ or CpG assay a border around the analysis result in Pyrogram e g El Note All changes are logged To view the analysis log for a selected well select Analysis Log from the Tools menu Note The quality assessments generated by the software are based on advanced analysis algorithms It is not recommended to edit the quality assessments Note It is not possible to edit the quality assessments for a locked assay Note Changes in the AQ mode will not affect the quality assessments in the SNP reports Edit base called sequences To edit a base called sequence right click it and select the desired option CA BT CTGTGA CCAGGAGCCAGGCTCAGTCTGTGCAGG B5 Increase Selected Insert Before h gt Insert T Insert After gt Insert C 150 Delete Selected Note All changes are logged To view the analysis log for a selected well select
33. e plate i e add an assay and if desired enter a sample ID and note for each used well see page 33 When the run is set up and ready to run on the PyroMark Q24 Instrument To print the plate setup and a list of required volumes of enzyme mix substrate mix and nucleotides select Pre Run Information from the Tools menu and when the report opens click amp Close the run file and copy it to one of the USB sticks supplied with the system using Windows Explorer To open Windows Explorer right click the folder containing the run file in the shortcut browser and select Explore from the context menu For more information press the F1 key to open Windows online help To run the plate on the PyroMark Q24 Instrument see page 38 PyroMark Q24 Software User Guide 07 2009 31 Note To print the Pre Run Information report in color turn on the Print background colors and images option in the Internet Explorer Tools Internet Options Advanced Printing Note In the shortcut browser you can create a new run file by right clicking the desired folder and selecting New Run from the context menu Enter the filename and press Enter To add a shortcut to a folder or drive click Add Folder Shortcut Note To base your run on a previous run right click the processed run file in the shortcut browser and select Copy and Rerun from the context menu Only the run setup not the run and analysis data will be copie
34. ectations simply call your local Technical Service Department or distributor We will credit your account or exchange the product as you wish Separate conditions apply to QIAGEN scientific instruments service products and to products shipped on dry ice Please inquire for more information A copy of QIAGEN terms and conditions can be obtained on request and is also provided on the back of our invoices If you have questions about product specifications or performance please call QIAGEN Technical Services or your local distributor see back cover or visit www giagen com Technical Assistance At QIAGEN we pride ourselves on the quality and availability of our technical support Our Technical Service Departments are staffed by experienced scientists with extensive practical and theoretical expertise in sample and assay technologies and the use of QIAGEN products If you have any questions or experience any difficulties regarding the PyroMark Q24 System or QIAGEN products in general please do not hesitate to contact us QIAGEN customers are a major source of information regarding advanced or specialized uses of our products This information is helpful to other scientists as well as to the researchers at QIAGEN We therefore encourage you to contact us if you have any suggestions about product performance or new applications and techniques For technical assistance and more information please see our Technical Support Center at www gia
35. en importing the sample and note layout file above Using the paste sample layout feature You can for example generate and copy layouts from your LIMS Sample layouts can be copied from Microsoft Excel Word Notepad and similar applications In the source file each column of sample IDs must be delimited by a tab and each row of sample IDs must be delimited by a line break To paste a sample layout into an existing run file 1 Copy all the information in the source file 2 Right click a well in the Plate Setup and select Paste Sample Layout from the context menu The software will paste the sample IDs into the plate starting at well AT If well notes have been entered into the wells these are kept P Paste Sample Layout Example txt Notepad DER File Edit Format View Help 323 324 325 326 327 An example of a sample layout created in Microsoft Notepad 36 PyroMark Q24 Software User Guide 07 2009 Plate Setup The result when copying and pasting the sample layout created in Microsoft Notepad Review the plate setup The Well Information area shows the following information about a well that is selected in the Plate Setup E Well name Type of assay AQ CpG or SQA Assay name Sample ID if entered Sequence to analyze AQ and CpG assays Dispensation order M Well note if entered If several wells are selected in the Plate Setup the information for the fi
36. er or tabloid To view the report before saving or printing it click Preview Note In order to view the report a PDF reader must be installed on the computer Adobe Reader can be downloaded at www adobe com Full report Reports Window Help AQ Analysis Statistics AQ Analysis Results AQ Pyrogram Report AQ Full Report SNP Analysis Results SNP Pyrogram Report SNP Full Report SNP Overview Report Reports Window Help AQ Analysis Statistics AQ Analysis Results AQ Pyrogram Report AQ Full Report SNP Analysis Results SNP Pyrogram Report sweFul Report SNP Overview Report Reports Window Help CpG Analysis Statistics Reports Window Help CpG Analysis Results SQA Analysis Results CpG Pyrogram Report SQAPyrogram Report CpG Full Report SQA Full Report The full report includes the following information for all or selected wells see Select wells page 16 E Run parameters run name run date and time instrument method instrument name serial number operator plate ID barcode reagent ID and run note and a run log E Well information well name assay name sample ID and well note analysis version AQ or CpG assay sequence to analyze M Pyrogram For information on icons and colors used in the Pyrogram area see Pyrogram report page 50 E Allele frequencies AQ report genotypes SNP report methylation percentages CpG report or base called se
37. gen com Support or call one of the QIAGEN Technical Service Departments or local distributors see back cover or visit www qiagen com eee PyroMark Q24 Software User Guide 07 2009 5 Introduction About this user guide This user guide provides information about the functions and features of PyroMark Q24 Software Please refer to the PyroMark Q24 User Manual for complete information about the proper care maintenance and use of the PyroMark Q24 Instrument and PyroMark Q24 Vacuum Workstation This user guide describes the features of the software and associated tools and enables the user to manage and modify files and analyses This user guide provides information about PyroMark Q24 Software in the following sections E Introduction PyroMark Q24 Software Start the software Set up an AQ or CpG assay Set up an SQA assay Set up a run Process the run on the PyroMark Q24 Instrument Analyze the run View print and save analysis reports Manage instrument methods General hints and tips Troubleshooting guide m J e 6 PyroMark Q24 Software User Guide 07 2009 PyroMark Q24 Software The PyroMark Q24 System is a complete solution comprising instrument vacuum workstation chemistry and software The main advantages of the system are
38. gs Each of the lines following the column headings contains detailed well information and statistics of a specified well PyroMark Q24 Software User Guide 07 2009 49 Report options In the Analysis Results Report dialog box there are the following options All wells Selected wells The wells to be included in the report Sort by row column The sorting order of the wells All Passed Passed The bases in the base called sequences to be Check Only Quality included in the report Window This option is only available for the SQA report Note column If this option is checked a column with well notes is included Warnings column If this option is checked a column with analysis warnings is included Analysis version If this option is checked a column with the analysis column version is included Position name column _ If this option is checked a column with the names of the variable positions is included This option is not available for the SQA report Quality column If this option is checked a column with the current quality assessments is included Original quality If this option is checked a column with the original columns quality assessments is included This option is not available for the SQA report To view the report before saving or printing it click Preview Pyrogram report Reports Window Help Reports Window Help AQ Analysis Statistics AQ Analysis Statistics AQ Analysis Results
39. hecked The expected range area can be moved to the left or to the right by holding down the left mouse button while moving the area with the mouse The arrows can be used to increase or decrease the expected range You can also increase or decrease the expected range by 1 Positioning the mouse pointer over the left or the right end of the green area so that the pointer changes from a white arrow to 2 Moving the mouse to the left or the right while holding down the left mouse button To edit all methylation ranges simultaneously hold down the Shift key while changing one of the ranges Examples of methylation ranges gt a 100 LO IIIi gt 4s de gt 43 4 Expected methylation 100 Expected methylation 0 100906 3 Expected methylation 30 7096 default 4 Expected methylation 0 0 v 3 v 0 v 1 2 To reset the parameters in the Variable Positions tab and the Analysis Parameters tab to their default values click Revert to Default Edit analysis parameters The default analysis settings have been set to give optimal analysis results for most assays If applicable during the assay validation the results may be improved by editing the analysis parameters E Edit analysis parameters in the Analysis Parameters tab see below M Enable or disable reference peaks and bisulfite treatment controls only CpG assays see page 27 PyroMark
40. icking the Generate Dispensation Order button The generated dispensation order includes blank dispensations to ensure that the correct sequence has been obtained When creating CpG assays the dispensation order should also include bisulfite treatment controls These controls have to be added manually by the user after the dispensation order has been generated see page 21 If desired the dispensation order can be entered or adjusted manually Note When clicking Generate Dispensation Order any existing dispensation order will be overwritten Note When a base position is selected in the sequence to analyze the corresponding dispensation is highlighted with a gray background color and vice versa Sequence to Analyze TGTTNBAMATGATNCAG Dispensation Order GTCGTAGCTGACATGCATAGCGA Histogram GTCGTAGCTGACATGCATAGCOGIA 5 10 15 20 The arrow in the sequence to analyze the dispensation order and the histogram show the position of the cursor Note If the last variable position in the sequence to analyze is a long InDel dispensation will only be performed until three variable peaks are found and providing the requirement of five reference peaks is fulfilled To dispense the whole InDel add a variable position after the InDel or adjust the dispensation order manually Note If it is not possible for the sequence to come in phase before 32 alleles are dispensed the dispensation order will n
41. includes well information and AQ runs Pyrogram for all or selected wells Reports Window Help AQ Analysis Statistics The Full Report includes run parameters run log well information and analysis results including AQ Analysis Results Pyrogram for all or selected wells AQ Pyrogram Report The SNP Overview Report includes genotypes and AQ Full Report quality assessments for all SNPs and InDels The information is presented in plate overviews with one plate per position number SNP Analysis Results SNP Pyrogram Report SNP Full Report F The report options are only available for processed SNP Overview Report x runs For more information on the reports see page Reports menu for 47 SQA runs Note To view reports generated in PDF format a Help PDF reader must be installed on the computer pda ur Adobe Reader can be downloaded at sob os e www adobe com SQA Full Report Window menu Toggle between open files in the software using the Window menu 1 AQ Assay CM ILagerholm AQ assay 2 CpG Assay CM Lagerholm CpG assay 3 5QA Assay C Lagerhalm SQA assay 4 SQA Run Analysis C Lagerholm Plate23413 5 Run Setup Untitled Help menu Select PyroMark Q24 Software Help or press the F1 key to open this user guide il PyroMark Q24 Software Help Fi About PyroMark Q24 Analysis toolbar Click Q and select Analyze All Wells or Analyz
42. ition 1 2 1 3 4 5 7 8 EE GCSE SWR cr epee Iram r jor itgrp p Qe pe cI Oe I nee Position 2 Extract from a report The Analyze option has been turned off for position 1 and 2 in well A5 Well A3 A4 B3 B4 and C3 C4 have no SNPs or InDels in position 2 Note Variable positions can be excluded from the report by turning off the Analyze option in the Analysis Setup tab see Set up the variable positions page 22 Note The SNP Overview report is only available in the AQ mode In order to view the report a PDF reader must be installed on the computer Adobe Reader can be downloaded at www adobe com PyroMark Q24 Software User Guide 07 2009 53 Manage Instrument Methods Window Instrument Methods Pre Run Information The instrument method should be selected according to the reagents and reagent cartridge that will be used for the run see the handbooks supplied with the products Note It is recommended that only methods supplied by QIAGEN are used To import a new method 1 In the Instrument Methods dialog box click Import The Find Instrument Method dialog box opens 2 Locate and select the method that you wish to import and click Open To create a new method 1 In the Instrument Method dialog box select an existing method and click Save As 2 Enter a name for the method and press Enter 3 Change the settings and click Save Method parameters In
43. k To All To apply the changes to the selected wells i e the white wells that are selected in the Apply Analysis Setup dialog box click To Selected During the analysis a progress dialog box is shown The dialog box contains a progress bar a stop button and the name of the well that is being analyzed The analysis can be stopped by clicking Stop 5 To save the changes click i Note If analysis parameters quality assessments or analysis results SQA assays only have been edited by the user the well is marked with a warning icon in the Overview tab Note All changes are logged To view the analysis log for a selected well select Analysis Log from the Tools menu Use modified assay in other runs Changes made in the Analysis Setup tab will not be saved in the original assay file To use the modified assay in other runs I 1 Select a well that is using the modified assay and click Save Assay The Save Assay As dialog box opens 2 Save the changes to the original file or save the modified assay as a new file Select destination folder from the Save in drop down list Enter filename in the File name text box and click Save PyroMark Q24 Software User Guide 07 2009 45 Edit quality assessments To edit the quality assessment of an allele frequency or a methylation percentage left click the analysis result in Pyrogram and select Passed Check or Failed from th
44. l rights reserved www qiagen com Australia Orders 03 9840 9800 Fax 03 9840 9888 Technical 1 800 243 066 Austria Orders 0800 28 10 10 Fax 0800 28 10 19 Technical 0800 28 10 11 Belgium Orders 0800 79612 Fax 0800 79611 Technical 0800 79556 Brazil Orders 0800 557779 Fax 55 11 5079 4001 Technical 0800 557779 Canada Orders 800 572 9613 Fax 800 713 5951 Technical 800 DNA PREP 800 362 7737 China Orders 0086 21 3865 3865 Fax 0086 21 3865 3965 Technical 800 988 0325 800 988 0327 Denmark Orders 80 885945 Fax 80 885944 Technical 80 885942 Finland Orders 0800 914416 Fax 0800 914415 Technical 0800 914413 France Orders 01 60 920 926 Fax 01 60 920 925 Technical 01 60 920 930 Offers 01 60 920 928 Germany Orders 02103 29 12000 Fax 02103 29 22000 Technical 02103 29 12400 Hong Kong Orders 800 933 965 Fax 800 930 439 Technical 800 930 425 Ireland Orders 1800 555 049 Fax 1800 555 048 Technical 1800 555 061 Italy Orders 02 33430 420 Fax 02 33430 426 Technical 800 787980 Japan Telephone 03 6890 7300 Fax 03 5547 0818 Technical 03 6890 7300 Korea South Orders 1544 7145 Fax 1544 7146 Technical 1544 7145 Luxembourg Orders 8002 2076 Fax 8002 2073 Technical 8002 2067 Mexico Orders 01 800 7742 639 Fax 01 800 1122 330 Technical 01 800 7742 639 The Netherlands Orders 0800 0229592 Fax 0800 0229593 Technical 0800 0229602 Norway Or
45. lect the assay in the shortcut browser and press and hold down the left mouse button while you drag the assay to the well M Right click the well and select Load Assay from the context menu Note To add an assay to several wells select the wells see Select wells page 16 and drag the assay to the selection Note It is not possible to add an assay with no dispensation order or add two or more assays with the same assay name but have different dispensation orders Plate Setup ECCE EE PERS a FERE FOE EET TS A assay1 AQ assay 2 CpG assay 1 CpG assay 2 SOA assay 1 SOA assay 2 A well is colored according to the assay loaded to the well Enter sample IDs and notes M To enter a sample ID or note select the cell see image below and enter the text E To edit a sample ID or note either select the cell the current contents will be selected or double click the cell E To import a sample and note layout defined in a text file tsv or csv right click a well and select Insert Sample Layout File from the context menu For more information see Define sample ID and note externally page 35 M To paste a sample layout from the clipboard right click a well and select Paste Sample Layout from the context menu For more information see Define sample ID and note externally page 35 Note Commas and semicolon are not supported A selected cell is highlighted with a blue background color PyroMark Q24 Softw
46. led orange diamond Enabled both as a bisulfite treatment control and a reference peak E Filled blue diamond Enabled as a reference peak but disabled as a bisulfite treatment control M Hollow orange diamond Disabled both as a bisulfite treatment control and a reference peak Position the mouse pointer over the diamond and a tooltip will describe the consequence of a click Note To toggle between viewing and hiding reference peaks in the histogram right click the histogram and select Show Reference Peaks from the context menu Adjust heights of histogram bars This feature can be used when previous experiences have shown a reproducible deviation in the measured pattern from the theoretical pattern Use this feature with care 1 Press and hold down the Ctrl key while left clicking the top of the histogram bar left click when the pointer changes from a white arrow to 2 Either enter the height in the text box that opens or increase or decrease the height by using the arrows next to the text box 3 To apply the new height press Enter eee LLLI PyroMark Q24 Software User Guide 07 2009 27 Note Instead of removing nonstandard methylation patterns from the sequence to analyze for example methylations of Cs that are not followed by Gs set the expected heights of the Gs to zero 0 Light orange decreased height Dark orange increased height Set Up an SQA Assay Workflow gt New AQ Assay Ckrl
47. log for a processed run Create a new assay file by right clicking the desired folder and selecting New Assay and the desired assay type from the context menu Enter the filename and press Enter To set up the assay see page 17 AQ or CpG or page 28 SQA Create a new run file by right clicking the desired folder and selecting New Run from the context menu Enter the filename and press Enter To set up the run see page 31 Copy a processed run file and rerun it by right clicking the run file and selecting Copy and Rerun from the context menu Note Only the run setup not the run and analysis data will be copied Copy a file by right clicking the folder containing the file and selecting Explore from the context menu Windows Explorer opens For more information press the F1 key to open the online help for Windows Explorer Note To avoid losing data do not copy a file that is open in PyroMark Q24 Software Open a file by double clicking it or right click the file and select Open from the context menu To open a processed run file select Open with followed by the analysis mode AQ CpG or SQA View the run parameters and a run log for a processed run file by right clicking the file and selecting Run Information from the context menu Main menu and toolbars File menu and toolbars Select New Assay or click in the toolbar and
48. mean methylation percentage of all CpG sites in the well 3 Sample ID Note Quality Mean m Ranges Select to show the methylation bar The methylation bar shows the methylation level for each CpG site in the well See color legend on page 43 None o Select to show the quality assessment at the end of the gt ee quality control window The default number of bases Note included is 20 Quality Q Window Note Wells with a high substrate peak will be marked with an information icon in the plate overview This will not affect the quality assessments Note If analysis parameters quality assessments or analysis results SQA assays only have been edited by the user the well is marked with a warning icon Note If an assay is locked the well is marked with the amp icon Print or export plate overview as image The plate overview can be printed or copied as an image to the clipboard by right clicking the plate overview and selecting Print or Copy as Image from the context menu The image can be pasted into applications that support Enhanced Metafile EMF images PyroMark Q24 Software User Guide 07 2009 41 Analysis warnings By selecting an analyzed light blue well the analysis warnings if any are listed in the Well Information area An analysis warning affects the quality assessment in the following way E AQ and CpG assays Affects the quality assessment for either
49. ment controls are Cs converted to Ts read as Gs and As in a reverse assay and suitable as controls or not Set up the variable positions The variable positions can be setup in the Variable Positions tab The available parameters are listed below Note If the sequence to analyze is changed and a new dispensation order is generated the variable position parameters are reset to their default values Position Name Type Analyze Methylation ranges CpG assays only 22 The location of the variable position in the sequence to analyze counting from left to right The name of the variable position To change the name either select the text box the current contents will be selected or double click the text box The type of variable position SNP InDel or CoG site If this option is checked the variable position will be analyzed Note This option is not available for variable positions that cannot be analyzed for the current assay type The expected CpG methylation Setting this parameter for all the CpG sites allows easy identification of sites in the analysis results that are outside the expected methylation range M The light green area is below the expected range E The green area is within the expected range E The dark green area is above the expected range PyroMark Q24 Software User Guide 07 2009 Note The expected methylation cannot be set for CpG sites with the Analyze option unc
50. ntact your system administrator for more information To protect a file from being accidentally overwritten by you or another user set the Read only attribute for the file using Windows Explorer 1 Close the file in the PyroMark Q24 Software 2 Open Windows Explorer and locate the file This can be done by right clicking the folder containing the file in the shortcut browser and selecting Explore from the context menu 3 In Windows Explorer right click the file and select Properties from the context menu 4 When the Properties dialog box opens turn on z the Read only attribute and click OK A backup should be performed frequently Protection of analysis results It is not possible to edit the analysis parameters or results for a locked assay amp To lock an assay open the assay file and click the Lock Assay button at the bottom of the assay setup window Lock the assay before adding it to the plate PyroMark Q24 Software User Guide 07 2009 55 Troubleshooting Guide Errors Comments and suggestions a Red cross over wells in Contact QIAGEN Technical Services the Overview tab during analysis 2 Exception dialog box Save the error report and send to QIAGEN appears Technical Services for information Click Continue to proceed with analysis If the dialog box remains click Quit and restart the software c Could not create assay Ensure a valid assay file typ
51. olymorphism where the possible alleles are a T an A or neither deletion E It is not possible to have a combination of a SNP and constant bases within an InDel e g A TC E Nested InDels are not supported e g ATT C G If the sequence to analyze contains an error this is displayed by a red exclamation mark at the end of the text box Position the mouse pointer over the exclamation mark and a tooltip will display an explanation of the error The character or characters that caused the error will be marked in red in the sequence to analyze Sequence to Analyze TYGT T As T T is not a valid variable position it causes an Invalid sequence error Note If analyzing nonstandard methylation patterns for example methylations of Cs that are not followed by Gs these patterns can be analyzed in the AQ mode To analyze in the CoG mode enter extra Gs in the Sequence to Analyze text box and set the expected heights of the extra Gs to zero 0 see Adjust heights of histogram bars page 27 18 PyroMark Q24 Software User Guide 07 2009 IUPAC codes Code Description Code Description A Adenine W TorA G Cytosine S Cor G G Guanine B C T or G not A T Thymine D A T or G not C R Purine A or C H A T or C not C Y Pyrimidine C or T V A C or G not T M Cor A N Any base A C G or T K TorG Note S B V and N are not valid after bisulfite treatment Valid patterns in a CpG assay
52. orts generated in PDF format a PDF reader must be installed on the computer Reports for SQA runs Adobe Reader can be downloaded at www adobe com SNP Overview Report Reports Window Help SQA Analysis Results SQA Pyrogram Report SQA Full Report PyroMark Q24 Software User Guide 07 2009 47 Analysis statistics report Window Help AQ Analysis Statistics AQ Analysis Results AQ Pyrogram Report AQ Full Report SNP Pyrogram Report CpG Analysis Results SNP Full Report CpG Pyrogram Report SNP Overview Report CpG Full Report The Analysis Statistics report includes the following information for variable positions in all or selected wells see Select wells page 16 E The mean allele frequencies AQ report or mean methylation percentage CpG report E The highest and the lowest allele frequencies AQ report or methylation percentage CpG report B The standard deviation B The number of values and the wells used in each calculation W f analysis parameters or quality assessments have been edited by the user the affected wells are listed at the top of the report The report can be saved as a text file tsv or csv or an HTML file html The report can be imported into Microsoft Excel or other applications that can handle text files tsv or csv with data that is separated by semicolons or tabs This is useful when doing further calculations on the data Report options In the Analysis Statis
53. ositions The warning Failed due to low peak height is triggered during the analysis Note The value cannot be higher than the Required peak height for passed quality value see above PyroMark Q24 Software User Guide 07 2009 25 Stringency levels The stringency of the warnings for Pattern deviation in variable positions and Sum deviation in variable positions can be set to Low Normal default or High A high stringency level narrows the allowed deviation Pattern deviation in The deviation between the measured peak pattern in variable positions the variable position and the theoretical peak patiern If the deviation is higher than the set stringency level allows the warning Uncertain Failed due to high pattern deviation in variable position is triggered during the analysis Whether the warning will yield a Check or Failed quality assessment for the analysis result depends on the magnitude of the deviation Sum deviation in The deviation between the measured sum of all the variable positions peaks in the variable position and the theoretical sum based on the single peak height If the deviation is higher than the stringency level allows the warning Uncertain Failed due to high sum deviation in variable position is triggered during the analysis Whether the warning will yield a Check or Failed quality assessment for the analysis result depends on the magnit
54. ossible to open the run file by double clicking it in Windows Explorer 3 Analyze the run see below View the analysis results see page 40 gt 5 Optional If applicable modify how the analysis is performed see page 44 6 Optional Enter an analysis note in the Note text box in the Overview tab Note To expand or collapse the Note field click or 7 To save the analysis results click H in the toolbar Note It is not possible to edit the analysis parameters or enter an analysis note for a locked assay Analyze all or the selected wells In the Overview tab there are two ways to perform the analysis RHH Analyze all wells with a valid analysis setup for the current analysis mode Om Analyze the selected wells Select wells page 16 Note It is also possible to right click the selection and select Analyze Selected from the context menu PyroMark Q24 Software User Guide 07 2009 39 During the analysis a progress dialog box is shown This dialog box contains a progress bar a stop button and the name of the well that is being analyzed The analysis can be stopped by clicking Stop Note When a well has been analyzed the well color changes to light blue Analysis modes PyroMark Q24 Software has three analysis modes AQ CpG and SQA To toggle between the modes select AQ CpG or SQA in the toolbar Genotyping of SNPs and InDels can be
55. ot be completed For example the sequence ACTCDDDDG will have the dispensation order ACTC since the four D polymorphisms will generate an out of phase stretch over too many alleles 20 PyroMark Q24 Software User Guide 07 2009 Dispensation warnings If the dispensation order contains a warning this is displayed by a red exclamation mark at the end of the Dispensation Order text box It is possible to run an assay with a dispensation warning but the warning must be considered when evaluating the analysis result If you position the mouse pointer over the exclamation mark a tooltip will display an explanation of the warning Warning Suggested action Sequence uncertain due The problem may be resolved by either entering to lack of terminal more sequence information or reducing the sequence information number of dispensations Sequence not in phase The problem may be resolved by adjusting the at the end of the dispensation order manually or by clicking dispensations Generate Dispensation Order or entering more sequence information Note If the problem is not resolved the out of phase stretch will not be analyzed The generated If possible enter more sequence information and dispensation order increase the number of dispensations For the best contains less reference possible quality assessment of the results five or peaks than required more reference peaks with the height 1 2 or 3 are recommended
56. quences SQA report and the quality assessments S Analysis warnings E f analysis parameters or quality assessments have been edited by the user the affected wells are listed Report options In the Full Report dialog box there are the following options All wells Selected wells Raw Pyrogram The wells to be included in the report The type of Pyrogram to be included in the report Compensated This option is only available for the SQA report Pyrogram 52 PyroMark Q24 Software User Guide 07 2009 To view the report before saving or printing it click Preview Note In order to view the report a PDF reader must be installed on the computer Adobe Reader can be downloaded at www adobe com SNP overview report Reports Window AQ Analysis Statistics AQ Analysis Results Help AQ Pyrogram Report AQ Full Report SNP Analysis Results SNP Pyrogram Report SNP Full Report SNP Overview Report The SNP Overview report includes genotypes and quality assessments for all SNPs and InDels The information is presented in plate overviews with one plate per position number The background color of the wells shows the quality assessment of the SNP see color legend on page 42 If analysis parameters have been edited by the user the affected wells are listed at the top of the report To view the report before saving or printing it click Preview in the SNP Overview Report dialog box Pos
57. quences in FASTA format SQA assays only In the 10 PyroMark Q24 Software User Guide 07 2009 dialog that opens select the wells to be included all or selected the sorting order of the wells row or column and the bases in the sequences to be included all passed passed check or only quality control window Select Analysis Log to view or save the log with all analyses performed on the selected well as an HTML file Each analysis is logged with the used analysis settings analysis mode AQ CpG or SQA analysis version results including warnings date and time and the Windows user account used to perform the analysis see the General Hints and Tips page 55 Text files tsv or csv can be imported into Microsoft Excel or other applications that can handle data that is separated by semicolons or tabs This is useful when doing further calculations on the data Reports menu for The Analysis Statistics report includes analysis CpG runs statistics for all or selected wells Reports Window Help The Analysis Results report includes well Gps iets Statistics information and analysis results for all or selected CpG Analysis Results wel S CpG Pyrogram Report CpG Full Report o 2 H A sm PyroMark Q24 Software User Guide 07 2009 11 Reports menu for The Pyrogram Report
58. r Select Instrument Methods to view the settings for unprocessed run files the instrument methods and if necessary import or set up new methods according to settings supplied by QIAGEN see Manage Instrument Methods page 54 Select Pre Run Information to view the plate setup and a list of required volumes of enzyme mix substrate mix and nucleotides for the current run file To print the report click 3 Window Instrument Methods Pre Run Information Note To print the Pre Run Information report in color turn on the Print background colors and images option in the Internet Explorer Tools Internet Options Advanced Printing Tools menu for Select Run Information to view the run parameters processed run files and a run log for the current run file To print the x Tools Reports Window Help report click Instrument Methods Run Information Select Export Peak Heights to save the peak heights of all used wells as a text file Export Peak Heights A Ji A Select Export Environment Data to save the mixer speed block temperature and pressure readings as a text file The temperatures of the environment the process chamber lid and the cooler are also listed Export Environment Data Export Raw Data Export 4s FASTA Analysis Log Select Export Raw Data to save the intensities and dispensation data as a text file Select Export As FASTA to save base called se
59. ring the analysis Note The value cannot be higher than the Required peak height for passed quality value see above Parameters A peak reduction The factor by which the A peak intensities are factor multiplied to account for the fact that A peaks are higher than other peaks The default value is 0 90 Plus shift compensation If this option is checked the peaks are compensated for plus shift 30 PyroMark Q24 Software User Guide 07 2009 Minus shift If this option is checked the peaks are compensated compensation for minus shift Stringent homopolymer If this option is checked stricter rules are used for the scoring quality assessment of homopolymers The warning Peak height deviates from the expected peak level at dispensation number s is triggered during the analysis Known bases If there are any known bases in the dispensation order it is recommended that these are entered as this can improve the analysis 1 Left click in the dispensation order and either enter the height in the text box that opens or increase or decrease the height by using the arrows next to the text box 2 To apply the height press Enter To reset the parameters in the Settings tab and the Analysis Parameters tab to their default values click Revert to Default Set Up a Run Workflow 1 2 3 Click in the toolbar A new run file is created Enter the run parameters see page 32 Set up th
60. rst selected well is shown PyroMark Q24 Software User Guide 07 2009 37 Process the Run on the PyroMark Q24 Instrument Workflow When a run is set up and ready to run on the PyroMark Q24 Instrument perform the following steps 1 Prepare your samples 2 Fill the PyroMark Q24 Cartridge with the required volumes of reagents 3 Load the reagent cartridge and PyroMark Q24 Plate into the instrument 4 Insert the USB stick containing the run file into the USB port at the front of the instrument 5 Select the run file and start the run 6 When the run has been completed and data transferred to the USB stick remove the USB stick 7 Unload the plate and the reagent cartridge For more information see Section 5 5 of the PyroMark Q24 User Manual 38 PyroMark Q24 Software User Guide 07 2009 Analyze the Run Workflow 1 Move the processed run file from the USB stick to a computer running PyroMark Q24 Software insert the USB stick into the computer s USB port and move the run file to the desired location using Windows Explorer 2 Open the run file in PyroMark Q24 Software either by selecting Open in the File menu or double clicking the file in the shortcut browser If several assay types are included select the analysis mode in the dialog box that opens Note To update the contents of a folder in the shortcut browser right click it and select Refresh from the context menu Note It is also p
61. s product signifies the agreement of any purchaser or user of the PyroMark Q24 System to the following terms 1 QV expo uo NS PyroMark Q24 Software may be used solely in accordance with the PyroMark Q24 Software User Guide and for use with components contained with the Software only QIAGEN grants no license under any of its intellectual property to use or incorporate the enclosed components of this software with any components not included within this software except as described in the PyroMark Q24 User Manual and additional protocols available at www giagen com Other than expressly stated licenses QIAGEN makes no warranty that this Software and or its use s do not infringe the rights of third parties This software and its components are licensed for one time use and may not be reused refurbished or resold QIAGEN specifically disclaims any other licenses expressed or implied other than those expressly stated The purchaser and user of the software agree not to take or permit anyone else to take any steps that could lead to or facilitate any acts prohibited above QIAGEN may enforce the prohibitions of this Limited License Agreement in any Court and shall recover all its investigative and Court costs including attorney fees in any action to enforce this Limited License Agreement or any of its intellectual property rights relating to the software and or its components For updated license terms see www giagen com 2009 QIAGEN al
62. t in several runs and reuse information available in existing documentation Using the import insert sample layout file feature You can for example generate layout files from your Laboratory Information Management Systems LIMS Sample and note layout files can also be created in Microsoft Excel Notepad and similar applications The layout file must have two or three columns Well Sample ID and Note optional Each column must be separated by a tab comma or semicolon and each line must be delimited by a line break Save the file as a tab or comma delimited text file tsv txt or csv PyroMark Q24 Software User Guide 07 2009 35 The sample and note layout file can be imported into E An existing run file by right clicking a well in the Plate Setup and selecting Insert Sample Layout File from the context menu E A new run file by selecting Import followed by Create New Run from Sample Layout File from the File menu amp Microsoft Excel Sample Layout Example csv File Edit view Insert Format Tools Data Window Help X Dele amp amp x 4 dgio 7 m f Notes for well A3 B C Sample ID Note DNA 342 Notes for well Al DNA 360 Notes for well A3 1 M 4 gt nNSample Layout Example 4l Ready An example of a sample and note layout file created in Microsoft Excel Plate Setup E DNA 342 DNA 360 Notes for well amp 1 Notes for well amp 3 E Y Y The result wh
63. the Instrument Methods dialog box the following parameters are available Reagent pressure Pressure millibar for dispensation of the enzyme mix and substrate mix Enzyme pulse time Dispensation time milliseconds for the enzyme mix Substrate pulse time Dispensation time milliseconds for the substrate mix Nucleotide pressure Pressure millibar for the dispensation of nucleotides Nucleotide pulse time Dispensation time milliseconds for nucleotides Note Note on the instrument method optional 54 PyroMark Q24 Software User Guide 07 2009 General Hints and Tips Validation of assays Validate your assays using reference DNA samples see Appendix B of the PyroMark Q24 User Manual Analysis log All analyses performed are logged with analysis settings used analysis mode AQ CpG or SQA analysis version results including analysis warnings date and time of the analysis and who performed the analysis For information on who performed an analysis and who created an assay or run file to be correct all users must log on to Windows using their own user accounts For more information about user accounts and logging on and off see Windows online help or contact your system administrator To view the analysis log for a selected well select Analysis Log from the Tools menu Protection of files To protect a file from being edited by another user save the file in a folder that can only be accessed by you Co
64. tics Report dialog box there are the following options All wells Selected wells The wells to be included in the report Assay Assay and The analysis results statistics can be grouped sample ID according to B Assay Wells with the same assay will be grouped E Assay and sample ID Wells with the same assay and sample ID will be grouped Can be useful when experiments with replicates are performed 48 PyroMark Q24 Software User Guide 07 2009 Passed Check The analysis results to be included The calculations can be performed on results with passed and or check quality assessment Note If all passed and check results are to be included in the report you can exclude results within this group by turning off the Analyze option for these positions in the Analysis Setup tab see Set up the variable positions page 22 To view the report before saving or printing it click Preview Analysis results report Reports Window Help Reports Window Help AQ Analysis Statistics AQ Analysis Statistics AQ Analysis Results AQ Analysis Results AQ Pyrogram Report AQ Full Report SNP Analysis Results SNP Pyrogram Report SNP Full Report SNP Overview Report AQ Pyrogram Report AQ Full Report SNP Analysis Results Reports Window Help CpG Analysis Statistics SNP Pyrogram Report SNP Full Report SNP Overview Report CpG Analysis Results CpG
65. uality assessment for the CpG sites The warning Uncertain bisulfite conversion at dispensation number s is triggered during the analysis Note This rule is only used if the rule for Passed quality is not met A higher percentage of unconverted sequence than the set value will result in a Failed quality assessment for all CpG sites The warning Failed bisulfite conversion at dispensation number s is triggered during the analysis The default value is 7 Note The value cannot be lower than the Allowed percentage for passed quality value see above Peak height These parameters define the lower intensity limit for threshold the single peak height level at the beginning of the Pyrogram Required peak height The minimum signal value for a peak to achieve for passed quality Passed quality assessment for the variable positions The default value is 20 Note The value cannot be lower than the Required peak height for check quality value see below Required peak height The minimum signal value for a peak to achieve for check quality Check quality assessment for the variable positions The warning Uncertain due to low peak height is triggered during the analysis Note This rule is only used if the rule for Passed quality is not met The default value is 10 A signal value for a peak that is lower than the set value will result in a Failed quality assessment for the variable p
66. ude of the deviation Parameters A peak reduction The factor by which the A peak intensities are factor multiplied to account for the fact that A peaks are higher than other peaks The default value is 0 90 To reset the parameters in the Variable Positions tab and the Analysis Parameters tab to their default values click Revert to Default 26 PyroMark Q24 Software User Guide 07 2009 Enable or disable reference peaks and bisulfite treatment controls Nonvariable peaks i e peaks that are not a part of a variable position including blank dispensations are referred to as reference peaks Reference peaks are used in the analysis both as references when calculating the single peak height level and as internal controls when assessing the quality For the best possible quality assessment of the results it is recommended that the reference peaks that are generated by the software are kept enabled By left clicking a reference peak diamond in the histogram the peak is either enabled or disabled as a reference peak depending on the previous status The diamond displays the status M Filled blue diamond Enabled as a reference peak amp Hollow blue diamond Disabled as a reference peak By left clicking a bisulfite treatment control diamond CpG assays only the control is either enabled or disabled as a control and or a reference peak depending on the previous status The diamond displays the status E Fil
67. yze due to lack of data E If desired the variable positions are highlighted with a blue gray background color E Bisulfite treatment controls are highlighted with a light yellow background color CpG report only The following information and colors are displayed and used in the SQA report B The well name M The base called sequence The background color of a base in the sequence is according to its quality assessment see color legend on page 42 E fa compensated Pyrogram is included the peaks are colored according to their quality assessments Report options In the Pyrogram Report dialog box there are the following options All wells Selected wells The wells to be included in the report Number of The number of columns and rows of a Pyrogram on rows columns each sheet Sort by row column The sorting order of the wells Portrait Landscape The paper orientation Highlight variable If this option is checked the variable regions are regions highlighted with a blue gray background color This option is not available for the SQA report Show peak levels If this option is checked the calculated peak levels are shown in the Pyrogram This option is only available for the SQA report PyroMark Q24 Software User Guide 07 2009 51 Raw Pyrogram Compensated Pyrogram Paper size The type of Pyrogram to be included in the report This option is only available for the SQA report The paper size A4 A3 lett

Sample & Assay Technologies PyroMark® Q24 Software User Guide

Contents

Download Pdf Manuals

Related Search

Related Contents

Sample &amp; Assay Technologies PyroMark&reg; Q24 Software User Guide

Contents

Download Pdf Manuals

Related Search

Related Contents

Sample & Assay Technologies PyroMark® Q24 Software User Guide