Home

Sequence Alignment Algorithms

Contents

1. ATGATGCAGATTTTGTAGACGTCTTACACACAT TCACCAGAGGGTCCCCTG 20 30 40 50 i ATGAT ATTTTGTAGAG ACACACATTCACCAGAG G ATGA ATTTTGTAGA ACACACATTCACCAGA JG Figure 34 Sequences aligned with Clustal V the global multiple alignment algorithm ii Aligning Sequences in Sequencher E Contig 0004 aff Created ReferenelG AT GAT G CAGATTTTGTAGACGTCTTACACACATTCACCAGA GGGT CC Oa 4 Deleted Sequence GATGATAGATTTTGTAGAC TCTTACACACATTCACCAGACCTG gt bani base TT Tel 20 30 42 1 AM tt GATGATAGATTTTGTAGAC TCTTACACACATTCACCAGACCTG amie Coe E E EE E EE A Figure 35 Clean Data algorithm was used to align the two sequences iii Aligning Sequences with SeqScape PSIG cea Pro 4LRGC123P roject Known Variants Layer 1 ROIs All Variants Summary Variants Index Reference Reference AA T LPL Exon 5 Deletion 4 rt Lal gt Identification EE ESE Specimen Base Change ROI Position Length Type av Known E LPL Exon 5 Deletion 69 7Odelge Copied Reference 69 2 Del Ofavg no LPL Exon 5 Deletion 84delg Copied Reference 84 1 Del Ofavg no LPL Exon 5 Deletion 105 110delgagtee Copied Reference 105 6 Del Ofavg no Figure 36 The software identified the three major deletions at the correct positions 36 Analysis Both the softwares Lasergene and SeqScape were able to pick up all three major deletions in the sequences Clustal V w
2. 1767 Ginsburg Michelle PhD European Technical Manager Gene Codes Corporation 18 December 2006 Lesk Arthur M Introduction to Bioformatics New York Oxford University Press Inc 2002 Madden Tom 2003 The BLAST Sequence Analysis Tool In The NCBI Handbook Retrieved December 27 2006 from http www ncbi nlm nih gov books bv fcgi rid handbook chapter ch16 Pearson W R and T C Wood 2003 Statistical Significance in Biological Sequence Comparison In Balding D J M bishop and C Cannings Ed Handbook of Statistical Genetics 2 Edition pp 39 65 West Sussex John Wiley amp Sons Ltd QIAGEN 2002 2006 QIAquick Spin Handbook Skiena Steve 2002 Motifs and Multiple Sequence Alignment Retrieved December 27 2006 from http www cs sunysb edu skiena 549 lectures msa msa html Tippmann Helge Friedrich 2003 Comparing programs for sequence analysis Briefings in Bioinformatics software review DRAFT Denmark Plant Research Department Riso National Laboratory Wang Jian Research Assistant Blackburn Cardiovascular Genetics Laboratory Department of Vascular Biology Robarts Research Institute Interview December 2006 47 APPENDIX A HOW TO OBTAIN A REFERENCE SEQUENCE I Obtaining a Reference Sequence from NCBI i In an internet browser type in the web address http www ncbi nlm nih gov ii Under the Search field select Gene iii Type in the name of the gene that is to be used as re
3. Ee eee Figure 22 The samples are aligned with respect to the reference sequence a All the sequences are aligned against the reference sequence The reference sequence is distinguished by a row selector The different shades of blue represent the degree of ambiguity of the base at the particular position The consensus sequence is easily identified at the bottom of the panel The 28 symbol represents an ambiguity and the e symbol represents a base change at the corresponding position E Chromatograms from Contig 001 6 33 LPLOTWASA_A0S Ur base 163 Base 264 of 527 Figure 23 The double peak represents a heterozygous allele in the sample a The Show Electropherogram option allows traces of raw data to be displayed The electropherogram can be used for the visual inspection of the heterozygous allele if a base change is encountered One can also tell the orientation of the sequence by observing the arrow shown at the top left corner In this case the arrowhead points forward meaning that this particular sequence in the forward direction 6 View the Alignment Report E Contig 0017 E A a Ontons E SIF la IE Foe F ENES Y A A hg V SE IS hg 1G i GI 4 34 LPLOTV 139 CAGTTGGGCA TGTTGACATT TACCCGAATG GAGGTACTIT 3 31 LPLOTV 139 CAGTTGGGCA TGTTGACATT TACCCGAATG GAGGTACTIT 4 27 LPLOTV 139 CAGTTGGGCA TGTTGACATT TACCCGAATG GAGGTACTIT CAGTTGGGCA TGTTGACATT TACCCGAATG GAGGTACTIT CAGTTGGGCA TGTTGAC
4. Pairwise vs Multiple Alignment The procedure of aligning two sequences is termed pairwise alignment The method only looks at two sequences at a time On the other hand multiple alignment is the process of aligning more than two sequences simultaneously as the term implies Dale and von Schantz 2002 Older algorithms perform pairwise alignment using simple statistical methods to compute sequence similarity More sophisticated algorithms have been developed to perform multiple alignment For example the progressive pairwise method is a type of multiple alignment that first performs pairwise alignment and then progressively compare the sets of aligned pairs to carry out multiple alignment Altschul 1997 4 3 Optimal vs Heuristic Alignment Some famous alignment programs that utilize heuristic algorithms are BLAST and FASTA The theory behind heuristic methods is that the algorithm uses matching words to perform sequence alignments NCBI 2006 The pairwise method first identifies a short consensus common to the two sequences to be aligned Based on the locally identified consensus known as the word the algorithm will continue to search for matching pairs in both directions outwards from the word until a mismatch is encountered where the extension of the consensus will cease NCBI 2006 The longest consensus common to both sequences will be displayed This method of alignment is good at identifying specific regions of similarity quickly in
5. SNPs and insertion and deletion of bases in one or both alleles at the correct position Since the software is intended to process the trace data generated by the 37 automated DNA sequencer we use in the laboratory users can take advantage of the features that are compatible to the file type for quality alignment Lasergene s MegAlign is also integrated with the appropriate algorithms to carry out the detection The software is effective in identifying homozygous insertion or deletion in both alleles where the sequence is of good quality with confident base calls However the alignment is not effective with poor quality data Although users have the option to select either Clustal V or Clustal W to align their sequences depending on the condition of the sequences the software has a different base calling setting that neglects the presence of the heterozygous allele Sometimes basecalling could not be made as the software reports any ambiguity in the sequence as an N Lastly it was shown that Sequencher is not able to recognize any of the frameshift mutations The algorithms designed for the software are intended for contig assembly that can only accommodate minor gaps Furthermore the default base calling settings in the software do not consider the heterozygous allele The software is not suitable for frameshift mutation detection 6 2 Time Effectiveness All three softwares are capable of performing either multiple sequence ali
6. accurate alignment enhances the SNP and insertion and deletion detection process Furthermore the software is capable of aligning more than two sequences simultaneously The successive pairwise alignment method allows the software to perform multiple exon alignments all at once The method greatly improves time efficiency which is invaluable to the busy lab setting Lastly SeqScape s comprehensive user manual its fine layout and immediate response to queries from the company s technical support team generally accounts for the user friendliness of the software Customer services and technical support are freely available for novice users who want to get familiarized with the software 45 8 0 RECOMMENDATION It is the researchers goal to obtain reliable experimental results before drawing a valid conclusion to support their research hypotheses including scientists at RRI In order to further improve the reliability of the sequence alignment results with Dr Hegele s research the following approaches are recommended for effective alignment performance 1 Perform Alignment in All Three Sequence Alignment Softwares Although the SeqScape Software has demonstrated to align sequences most effectively sequences should be aligned in more than one alignment software to confirm the presence of any newly discovered mutations in the sample sequences The position as well as the identity of the mutation should be double checked to
7. algorithm refers to for score computation takes into account various evolutionary factors In the case of mutation detection some substitutions occur at a higher frequency than others For example in nucleotide sequence alignments the likelihood of a transition mutation is greater than that of a transversion mutation that is substitution mutation of a purine to purine or a pyridine to a pyridine are more commonly observed than replacing a purine with a pyridine or vice versa Lesk 2002 Therefore scores should be weighted accordingly to account for the frequency of certain mutations that is a transition mutation should get a higher score than a transversion mutation The following example illustrates the principle of scoring behind a simple sequence alignment Consider 2 short oligonucleotides Reference AATCTA Query AAGAT The 2 sequences can be aligned in several ways AATCTA AATCTA AATCTA AATCTA AATCTA AATCTA Il AAGAT A AGAT AA GAT AAG AT AAGA T A AGAT 0 15 8 8 8 15 Match 3 Gap 2 Mismatch 0 Transition 3 Transversion 4 Figure 1 The basic principle of sequence alignment is demonstrated in the above illustration For simplicity two short fragments are aligned with one superimposed on the other Some of the possible ways of aligning the reference and the query are shown The score of each pair of sequences is calculated based on the scoring scheme provided for this alignment It appe
8. are available to users who want to explore homology between sequences or say study genetic variations within the sequences Applied Biosystems 2002 Depending on the type of alignment that the algorithm is designed to measure the same set of sequences that is aligned in one will not necessarily give the same alignment result in another The key is to find out which type of alignment is to be performed Consider the following types of alignment local vs global heuristic vs optimal pairwise vs multiple alignment With an understanding of different alignment methods users can narrow down from a selection of softwares to the one that performs the desired alignment 4 1 Global vs Local Alignment In general terms algorithms that are designed to perform global alignment attempt to align every nucleotide in a set of aligned sequences Given a set of sequences that are different in length gaps will be inserted into the shorter sequences in effort to span the entire length of the longer sequence Pearson and Wood 2003 With global alignment it is most useful when the sequences to be aligned are approximately the same length AATTCGATGGCAT TTGCATGAGA Rise E Il CA TCGGTGGCAC GC T Figure 3 Aligning two sequences globally 11 The method is effective for identifying frameshift mutations such as insertion or deletion in one allele gaps will be inserted into the positions where the insertion or the deletion has occurred
9. assemblies It aligns overlapping regions of short sequence fragments which at the end will put together a complete nucleotide sequence Figure 17 Users can take advantage of the algorithms used for contig assembly to perform sequence alignment The algorithms Dirty Data Clean Data and Large Gap are modified versions of the Smith Waterman local sequence alignment algorithm Tippmann 2003 In particular the Dirty Data algorithm can align sequences that are untrimmed at the 5 or the 3 end Aligning sequences containing ambiguities N that are possibly caused by a substitution or a frameshift mutation with Dirty Data will not affect the alignment result Clean Data 25 algorithm is designed to align sequences that are trimmed as the name suggests The sequences that are to be aligned with this particular algorithm should not contain any ambiguities It is recommended to exclude the use of poor quality data with this algorithm Finally the Large Gap algorithm is designed to align large DNA such as genomic or cDNA It is able to accept gaps that are larger than two bases long in the overlapping regions between DNA fragments during contig assembly Ginsburg 2006 Af Bases Summary Sot A Options A Find i Getlnfo f Rediger myo S0_ F6_F12 110 WMYO F C04 g ee 83MYOCDS9_PWIF_608 T3MYOCDS9_PWSO 8F_A10 E ESES rv i a ak aw eT e sis ado owi aio aimn osi siis 6 84 7980 tt Litet i e iti ee i toe i Pete p
10. in the mutated allele Pearson and Wood 2003 One of the first algorithms that was used to measure global optimal alignments is called Dynamic Programming While this method is guaranteed to find the global optimum there are some disadvantages to the technique Lesk 2002 First and foremost the method inserts excessive gaps into the sequences due to the nature of the algorithm The region of interest to be aligned will be stretched over the entire length of the longer sequences resulting in some biologically insignificant alignments that are not suitable for comparison Lesk 2002 For the purpose of aligning sequences that only share a specific region of similarity local alignment would be the method of choice The algorithm uses a modified version of Dynamic Programming to search for the most similar region between two or more sequences that might be dissimilar in context or length Lesk 2002 AATTCGGTGGCATTTGCATGAGA PL domes GCGGTGGCACGC Figure 4 Aligning two sequences with the local alignment method Local alignment produces a more biologically meaningful comparison that is useful for investigating structural and functional aspects of the protein or the similarity between two or more nucleotide sequences Altschul 1997 Nevertheless with sufficient similarity displayed in the reference and the query either the local or global alignment method is able to accurately generate the most desirable alignment 12 4 2
11. primer will be sent for automated sequencing with Applied Biosystem s 3730 DNA Analyzer Applied Biosystems Foster City CA Once DNA sequencing is completed the raw data will be basecalled to decode the sequence Refer to Appendix B for the protocols on DNA extraction DNA amplification and DNA purification during sample preparation 3 3 Measuring Sequence Similarity Once the reference and the query sequences are acquired sequence alignment can be done with the use of an alignment software Given all possible ways of aligning the sequences how is the best alignment determined Most alignment softwares are integrated with an algorithm that searches for the optimal alignment Briefly the algorithm assigns to each possible way of arrangement a score which is defined as the standard measure of sequence similarity within a set of aligned sequences Lesk 2002 Depending on the algorithm that is used to perform the calculations the best alignment either reflects the maximum score or the minimum score from a set of aligned sequences Altschul 1997 In the case where the maximum score is sought a match in the aligned sequence is granted a point while a mismatch a gap initiation a gap extension or any deviation within the sequences will result in a penalty that contributes negatively to the final score Lesk 2002 The summation of score bits finalizes the overall score of the set of aligned sequences The scoring function that the
12. the QIAquick s Buffer PBI to the PCR product in the ratio of 5 1 Check to make sure that the colour of the mixture is yellow to ensure the correct pH range 3 Place a QIAquick spin column in the collection tube provided 4 Discard the waste that passed through the spin column Place the column back Add the PCR product to the spin column to bind DNA Centrifuge for 30 60s into the same tube Wash the DNA by adding a small amount of Buffer PE to the column and centrifuge for another 30 60s Discard the flow through and place the column back to the tube Elute the DNA by adding the correct amount of Buffer EB or water to the QIAquick membrane to ensure the right concentration Centrifuge for 1 minute The purified DNA can be collected after the DNA has passed through the membrane 51
13. triglyceride hydrolase and ligand bridging factor for receptor mediated lipoprotein uptake Severe mutations that cause LPL deficiency result in type I hyperlipoproteinemia while less extreme mutations in LPL are linked to many disorders of lipoprotein metabolism Genomic regions transcripts and products t2 Laseseso r tasemes A s meiseogazen WSseegetes precursor copsserzed B coding weston B untranal on 48 vi Select and copy the portion of the reference sequence that is to be compared against db_xref UniSTS 64183 gene 1 27992 gene LPL note Derived by automated computational analysis using gene prediction method BestRefseq Supporting evidence includes similarity to 1 mRNA db_xref GeneID 4023 db_xref HGNC 6677 mRNA join 262 p9is 9074 a250s 12607 SEEE 1 d 1 7 e 7 17 27992 ipoprotein lipase nelaeeifiad tranecrintian diecranance Exon 5 tettctcgac atattcagaa ktaatctaca aaaggaaatc cagccatcct gagtggaaac tgetgeataa ggctagttta agagactcaa attcatttta gaaggageca agectccttt tatgtctctc taagtaaaga t ccatgact gtagaatagg agctaataag aatctaaata getgecagtg cattcaaatg acatgcgaat tggaaattta caaatctg cttt TES t tgattg Peretti aatattattt agaagcgaat taaatgtgac tettatectt gacccaatgt cctactcagt agcttcaaag tatgtagttt teatatacac atttggccaa attatgtttc tgaagaattc tgcaatgtte agcatgacca ecttagagce aggcagacag ccattttatc ttttatttac tatactgtag gctacactga geagtgeact tacagtagc
14. 1 APOCIIOTV1B2_A06 B 33 4POCIIOTV1B1_A05 B 05 APOCIIOTV2241_E01 CCAGGAGTCCAGGCCCCCAGCC j i cTcectcagacccagcaal nwa ill Aaland J CCAGGAGTCCAGGCCCCCAGCCCICITETTCCTCCCTCAGACCCAGGA 1 1 1 1 161 171 Lel 191 Ki 3 bases are inserted between position 3029 and 3030 Specimen Base Change rol Positio Length Type QV Known Effect Descriptio nf CCCCCAGCCCCPETTCCTCCcT L NC_000019 2444 1 Sub 9 no missen 3029g gt C NC_000019 45 missen NC_000019 4Q avg no infam l l l l l CCCCCAGCCCC Speciment 3384A NC_000019 3384 1 Sub 3 no misen aehra 2414tG Figure 31 The software picked up both the SNP as well as the insertion mutation Analysis As shown in Figures 29 31 all the softwares were able to pick up the G C SNP However only SeqScape was able to identify the TCT insertion in the sample In both MegAlign and Sequencher the insertion was not detected because the program was not able to base call the heterozygous allele It was set by default that the higher peak is to be base called in the case of encountering an overlapping peak on the trace data Due to the nature of the reference and query sequences the pair of sequences gave a false impression to align with the reference sequence perfectly even with an existing insertion On the other hand SeqScape was able to base call the 34 heterozygous allele and identify the insertion of the three bas
15. A04 4 27 LPLOTW3A_C04 4E 32 LPLOTWSA_H04 4E 33 LPLOTW9A_A05 4 38 LPLOTWAI4A FOS 4 40 LPLOTWA16A_HO5 4 42 LPLOTWW18A_B06 4 43 LPLOTW19A_C06 4 46 LPLOTWW24A_F06 af LPL Exon Reference Seq Figure 19 Samples are imported for analysis 525 BPs 526 BPs 528 BPs 527 BPs 526 BPs 529 BPs 526 BPs 530 BPs 529 BPs 528 BPs 240 BPs DNA Fragment DNA Fragment DNA Fragment DNA Fragment DNA Fragment DNA Fragment DNA Fragment DNA Fragment DNA Fragment DNA Fragment Ref DNA Fra Mon Oct 02 2006 9 38 52 AM a Wed Sep 27 2006 11 43 02 AM Wed Sep 27 2006 11 43 02 AM Wed Sep 27 2006 11 43 02 AM Wed Sep 27 2006 11 43 02 AM Wed Sep 27 2006 11 43 02 AM Wed Sep 27 2006 11 43 04 AM Wed Sep 27 2006 11 43 04 AM Wed Sep 27 2006 11 43 04 AM Wed Sep 27 2006 11 43 04 AM Sat Now 18 2006 4 19 28 PM a All the samples to be aligned are listed in the panel along with the reference sequence 3 Choose Assembly Parameters Assembly Parameters r Assembly Algorithm Dirty Data Clean Data C Large Gap The dirty data algorithm is SLOWER and more rigorous than the clean data algorithm Ambiguous base calls are considered poor matches to exact base calls Figure 20 Three algorithms are available for alignment 27 a Since the samples imported into the software are traces of raw data that have not been processed the Dirty Data algorithm is chosen to perform the sequen
16. ACATICACCAGAGGGTCOOCTGGTOGARSC TIGGAATCCAGARACCAGTIGGGCATGTIGACATITACCOGAATGGAGGTACTITICAG CAGGRIGTAACATIGGAGAAGCTATCCGCGTGATIGCAGAGAGAGGACTIGGAG 19 856 145 19 857 631 1 487 gtaaatattatttagaagcgaatta atcttggtgtctcttttttaccce ENSE00001206552 8 1 19 857 632 19 857 874 1 1 243 ATGIGGACCAGCTAGIGAAGTGCTCCCACGAGCGCTCCATICATCICIICATOGACTC TGTIGAATGAAGAAAATCCARGTAAGGCCTACAGGTGCAGTICCARGGAAGCCTITGAG AAGGGCTCTGCTIGAGTIGTAGAAAGAACCGCT GCAACAATCIGGGCTATGAGATCAAT ANGTCAGAGCCAAAAGAAGCAGCAARATGTACCTGAAGACTCGTICTCAGATGCOCTAC o 49 APPENDIX B SAMPLE PREPARATION I DNA Extraction In Dr Hegele s lab scientists use the PUREGENE Kit to carry out DNA extraction Below is a brief overview of the extraction process Refer to PUREGENE DNA Purification Kit DNA Purification Protocol For 10 ml Fresh Whole Blood at the website http www isisco ie isis Main Lifesciences 20Gentra htm for the complete protocol 1 Obtain blood samples 2 Add the appropriate amount of RBC Red Blood Cell Lysis Solution to the whole blood sample to remove red blood cells 3 Mix the solution Incubate the solution at room temperature for 5 minutes 4 Centrifuge the solution for 5 minutes Remove the supernatant and keep the white cell pellet and 200 400 ul residual liquid 5 Mix the solution well Resuspend the pellet in the residual liquid with Cell Lysis Solution to lyse the white blood cells in the sample Incubate the cell lysate at 37 Add the appropr
17. ACCTAACTTT GCAGAGAGAGGACTT GGA Figure 11 LPL Exon 5 is imported in MegAlign a The reference is sent to MegAlign as shown in the working panel above The sequence is displayed in two separate panels Users can scroll along the scroll bar to view a particular section of the sequence that they want to examine The coloured bar at the top of the window is the consensus meter which shows the consensus strength The colour scheme shown at the left of the consensus meter is indicative of the relative strength of the consensus Red indicates the strongest consensus black indicates the weakest consensus Two rows below the consensus meter is the position ruler It helps identify the position of the bases in the sequence 22 3 Import Sequence Samples into the Project LPL Exon5 Reference Sequence meg Sequence Name lt Pos 1 lt Pos 515 E S XXXXXXXXXXXXCTGGCX TTXTXTTTTXXXXXXXXX 10 520 530 AAGGCCT CGATCCAGCTG NNNNNNNNNNNNCTGCCN NNNATCTTTTA NNNNNNNNNNNNNCTGNN TTNTATCTTTTN NNNNNNNNNNNNCTGCNN TTTATCTNNNNN NNNNNNNNNNNNGCTGCN NTNNNTCTNNNNNNNN NNNNNNNNNNNGCTGCNN TTTTATCTTNNNNNN NNNNNNNNNNNNGCTGCC JATTTTATCTNNN NNNCATGNNNNNNGAATA NCNNNNNNNNNNNG CNNNNNNNNNNNNNNTGC TCTANNNNCATGGTANNN CNNNNNNNNNNNNNNGCT NNNNNCATGGTAN Figure 12 Imported sequences are listed below the reference sequence a Imported sequences are listed below the reference sequence Note that the consensus meter is now disp
18. ATT TACCNGAATG GAGGTACTTT 3 33 LPLOTV CAGTTGGGCA TGTTGACATT TACCCGAATG GAGGTACTIT 3 25 LPLOTV CAGTTGGGCA TGTTGACATT TACCCGAATG GAGGTACTTT 4 37 LPLOTY CAGTTGGGCA TGTTGACATT TACCCGAATG GAGGTACTIT 4 33 LPLOTV CAGTTGGGCA TGTTGACATT TACCCGAATG GAGGTACTTT 3 21 LPLOTV CAGTTGGGCA TGTTGACATT TACCCGAATG GAGGTACTIT LPL Exon 5 139 CAGTTGGGCA TGTTGACATT TACCCGAATG GAGGTACTIT Figure 24 A variant is noted in sample 18 in the report a The alignment report summarizes the finding of all variants in the samples 29 6 0 ASSESSMENT OF THE THREE ALIGNMENT SOFTWARES Aligning DNA sequences with a software that produces quick and accurate alignment results will improve work and time efficiency in the laboratory In order to decide which software is able to carry out sequence alignments most effectively the same set of sequences will be aligned respectively in all three softwares SeqScape Sequencher and Lasergene The alignment results generated by the softwares will be used for comparison The parameters of the assessment include the software s accuracy in determining the location of existing mutations the amount of sequences that the software can handle vs time efficiency the ease of use and cost 6 1 Accuracy of Sequence Alignment 6 1 1 SNP Detection In this experiment 10 LPL exon 5 sequences are chosen to align with the corresponding reference sequence to test the software s ability to detect the presenc
19. B 31 LPLOTV 7A_G j B 18 LPLoTv 4a 27 LPLOT5 14748 15276 E 25 LPLotv taea_ 4 E 27 LPLOTV 34_0 E 33 LPLoTv taa_A B 34 LPLOTV H 0A B 21 LPLOTV 44A_ B41 LPLoTV t 7A E 37 LPLoTv te14_ B45 LPLoTv t224_ 18 LPLO 5 Position 15013 GAATGGAGGTACTTTTCAGCCAGGATGTA 1 271 281 291 GAATGGAGGTACTTTTCAGCCAGGATGTA i 251 261 GGCATGTTGACATTTACCIC 1 1 251 GGCATGTTGACATTTACCC 1 1 GAATGGAGGTACTTTTCAGCCAGGATGTA 1 251 GGCATGTTGACATTTACCC i 1 GAATGGAGGTACTTTTCAGCCAGGATGTA 1 i 281 291 271 251 261 GGCATGTTGACATTTACCICIGAATGGAGGTACTTTTCAGCCAGCATGTA Specimen Base Change ROI Positi Leng Type OV Know Effec Description on th n t Speciment 1 14746 deloooct Nc_oooo0s ad 147 Del S avg no no Speciment Nc_ooooos Speciment 15276trA Nc_oooo0s 15276 1 Sub 3 no nant Speciment 15277 27992del Nc_ooooo0s 15277 1271 Del S avg no no c Figure 27 The mutation report in SeqScape identifies that the mutation found in sample18 is a substitution mutation of a C to a T 31 Analysis All three softwares were able to correctly identify the position of the SNP in sample 18 The variation was either highlighted in a different colour Lasergene and Sequencher or marked with a dot SeqScape for easy recognition The ruler feature in the software conveniently allows users to identify the position of
20. CQIGAAT GGA Variants are indicated with another colour Gaps are indicated with a dash Figure 15 The sequences are aligned with Clustal V b In this example Clustal V is chosen to perform the alignment It is a global multiple alignment method where sequences are spanned in attempt to align nucleotides starting from the first nucleotide in the longest sequence until the end is reached 24 6 Examine the Alignment Report Alignment Report of LPL Exon5 Reference Sequence meg Clustal Weighted BEE LPLOTV 10A_B05 seq ia Q 4 gt O jority LPL Exon5 Reference Sequence 18 LPLOTV 41A_B03 seq 20 LPLOTV 43A_D03 seq 25 LPLOTV IA_A04 seq 29 LPLOTV 5A_E04 seq 30 LPLOTV 6A_F04 seq 34 LPLOTV 10A_B05 seq brhi A A A A A A A A A AAAAAAA AAAAAAA AAAAAAA bEPPEES 0 0000000 0 0000000 bd D00000 Majority ooog o LPL Exon5 Reference Sequence 18 LPLOTV 41A_B03 seq 20 LPLOTV 43A_D03 seq Figure 16 A SNP is identified in sample 18 a The alignment report summarizes any mutations detected within the aligned set of sequences In this case a SNP is identified in sample 8 LPLOTV 41A_BO0 seq Users can also choose another algorithm for alignment depending on the nature and characteristic of their nucleotide sequences 5 3 Sequencher Version 4 7 Sequencher 4 7 is a sequence analysis software that specializes in contig
21. IOTV22A2 is known to carry a TCT insertion between position 3029 and 3030 just after the G C SNP Wang 2006 dik ser i 7 CCAGGAGTCCAGGCCCCCAGCCCCTCCTCCCTCagaACCcagGAGtcCAGGCCCCCagctcec 1 1 1 1 1 1 Reference AGCCCG TCCTCCCTCAGA Query AGCCCCTCTTCCTCCCT Figure 28 Three nucleotides TCT were inserted in sample 93 Result i Aligning the Sequences in Lasergene MegAlign APOCII Meg Project meg i File Edit Align View Options Net Search Window Help afl 2 Sequences 0 APOC Refere E al 93 APOCIIOTY Figure 29 Sample sequences are aligned with Clustal W The G C SNP was identified however the insertion was not detected because the mutated heterozygous allele was not base called The program only base calls for the higher peak ii Aligning the Sequences in Sequencher amp Contig 0001 AE APOCII Reference GCCCCCAGCCCGTCCTCCCTCAGACCCAGG 4 G a 5 fee arora sl Fong bases selected E Chromatograms from Contig 0001 Figure 30 The G C SNP was identified with Sequencher The heterozygous allele was not base called however 33 iii Aligning Sequences in SeqScape WRAP OCIProject ect Navigator APOCIIProject Specimen NC_000019 E APOCIProject Layout Assembly 8 T Speciment Tart jovey eer 5 Unassembled i j 2424 3384 5 5 NC_000019 x ALD 2426 3386 B 93 APOCIOTV2242_E12 B 81 APOCIIOTV1A1_A11 B 73 APOCIIOTV1A2_A10 H 60 APOCIIOTV22B2_D08 H 52 APOCIOTV22B1_D07 B 4
22. Reference Sequence EER pana Bso arociotv22e 4 E 52 APOCIIOTV22E B 41 APocIOTvI B B33 APocioTv1B1 2381 2481 2581 2681 2781 2881 2981 3078 3178 3 Bos arociorvaze T S0 APOCIOTV2282_D08 52 AP OCIOTV2261_D07 33 APPCIIOTV1B1_A0S 4 APDCIIOTV1B2_A06 Query Sequences 81 APOCIIOTVIAT_AI1 0 APOCIOTV22A1_E01 93 APOCIOTV22A2_E12 73 APOCIIOTVIA2_A1D Figure 9 The Layout view a The software is able to display the sequences relative positioning along the reference using the Smith Waterman local alignment algorithm The sequences represented as arrows are positioned at their alignment sites against the reference Furthermore the direction of the arrowheads is 19 indicative of the orientation of the sequences b One of the components of the alignment report is the Mutation Report In the report any variations observed that is different from the reference are listed in the table It identifies the mutation ie Base change Insertion or Deletion its position in the sequence the type of mutation and its effect on the sequence ie Missense Nonsense or Silent 5 2 Lasergene Version 7 0 Lasergene is a sequence analysis software with five applications SeqBuilder GeneQuest PrimerSelect Protean and MegAlign The software features synchronous updating which allows users to wor
23. SUMMARY Nucleotide sequence alignment is a useful comparison technique that detects existing mutations in the DNA sequences While some mutations are silent mutations that pose no harm to an individual others that occur in the coding regions of the DNA could very well predispose humans to diseases In Dr Robert Hegele s Blackburn Cardiovascular Genetics Laboratory at Robarts Research Institute RRI nucleotide sequence alignment is carried out to detect single nucleotide polymorphisms SNPs and insertion or deletion mutations in the coding regions of patients DNA in hope to discover the genetic basis of the diseases The purpose of this report is to compare and analyze three different sequence alignment softwares SeqScape Lasergene and Sequencher that are available to the laboratory for mutation detection Scientists working in the laboratory are currently looking for a sequence alignment program that facilitates the mutation detection process The software that is most suitable for the purposes of RRI is determined based on parameters such as the algorithm used for mutation detection the amount of sequences that the software can handle time efficiency cost and ease of use In particular the same set of sequences with known mutations is imported to all three softwares to test for their efficacy to accurately pinpoint the location of the mutation Based on the alignment results generated from the three softwares SeqScape sof
24. Select and copy the exon that is to be compared against ie Exon 5 E Exon Information No Exon intron Chr Strand Start End Start End Length Sequence Phase Phase S upstream sasessases teatcagteggteegegecttgcagetectecagagggacgegeccega sequence 1 ENSE00001206572 8 1 19 841 232 19841319 0 1 88 ATGGAGAGCAAAGOCCIGCTCGTGCTGACTCIGGCCGTGTGGCTOCAGAGTCTGACCGC TCOCGOGGAGGGGIGGCCGCCGCCGACC Intron 1 2 8 4 19 841 320 19 849 970 8 651 gtaagttttgegegcaaactcccct 6 ctcatatccaatttttcctttcce ENSE00001206564 8 1 19 849 971 19 850 131 1 O 161 AAAGANGAGATTTTATCGACATCGAAAGTAAATTTGCCCTAAGGACCCCTGANGACACR CTGAGGACACTIGCCACCICATTCCCGGAGTAGCAGAGTCCGIGGCTACCIGICAITIC RICACAGCAGCARAACCTICAIGGIGATCCATGGCTGGACG Inton2 3 8 4 19 850 132 19 853 559 3 428 graagggaggctctttgggyaagag sagaaagettgtgtcatcatcttce ENSE0000121 8 1 19 853 560 19853739 0 0 180 GTAACAGGAATGTATGAGAGTIGGGTGCCAAAACTIGTGGCCGCCCTGTACAAGAGAGH CCAGRCTOCAATGICATIGIGGTGGRCTGGCTGICACGGGCTCRGGRGCATTACCCRGT TCOGCGGGCTACACCAAACTGGTGGGACAGGATGIGGCCCGGITIATCAACTGGAIGGS Inton3 4 8 4 19 853 740 19 855 100 1 361 gtaagactgggagaaggagacttat cotteattttetttttettecaaa 4 ENSE00001206558 8 1 19 855 101 19 855 212 0 1 112 GAGGAGTTTAACTACCCTCTGGACAATGICCAICICTIGGGATACAGCCTIGGAGCOCA Intron 19 855 213 19 855 910 698 graagasagcaatttcgttggtctt tgttectgertttttcecttttas ENSE00001206556 19 855 911 19 856 144 234 GOCTOGATCCAGCTGGACCTAACTITGAGTATGCAGAAGCCCCGASTOGICTITCTO T RIGATGCAGATITIGIAGACGTCITACAC
25. a agagaaaaag gtgggatttt agacaggaag actccactga ectcaataat ggcatcataa aatgctatct ggccacatgt tgtcatacct tgaatgtage II Obtaining a Reference Sequence from Ensembl i In an internet browser type in the web address http www ensembl org ii Enter the name of the gene that is to be the reference ie LPL iii Select Exon Info Search e Human Anything x Ef Ensembl Human GeneView 9 NSG0000019616 Rp y y E Ensembl Gene Report for ENSG00000175445 Gene LPL HGNC Symbol To view ali Ensem genes lires name gid here This gene is a member of the human CCDS set CCDS6012 12 Ensembl GeneID NSG00000175445 Genomic Location This gene can be found on Chromosome 8 at location 19 841 232 19 367 912 The start of this gene is located in Contig AC107964 4 1 138594 Description Lipoprotein lipase precursor EC 3 1 1 34 LPL Sarot Unig SwisSeROT o Prediction Method Genes were annotated by the Ensembi automatic analysis pipeline using either a GeneWise Exonerate model trom database protein or a set of aligned cDNAS followed by an ORF prediction GeneWise Exonerate models are further Combined with avaliable aligned cDNAs to annotate UTRs For more information see V Curwen et al Genome Res 2004 14 942 50 Features v cnr 8 oe we Woes Mb oem oea Length Forward srand 4008 Ki eee a Ensembl trans LUPL_HUMAN gt Ensembl Known Protein Casing DNA contigs Langh rers EEEN oas iv
26. alent scores Lasergene is not the ideal software to detect the identity of the SNP as well as mutation in one allele Sequencher is not the ideal tool to identify frameshift mutations in general Table 7 The ease of use of the softwares Seq Scape Lasergene Seq uencher Appearance 3 4 5 Setup Procedures 4 3 4 Alignment features gt 2 3 Select Reverse Complement Work with Poor Quality Data Trimming Options Overall 12 9 12 The above evaluation looks at the ease of use of the softwares in a scale of 5 with 5 representing the highest score Both SeqScape and Sequencher scored the highest overall score for its well designed layout as well as the ease of use 44 7 0 CONCLUSION The SeqScape sequence analysis software from Applied Biosystems is thought to be the most effective sequence comparison tool that best suits the purposes of Dr Hegele s research As shown in Tables 5 7 the software obtained the highest overall score regarding the assessment of its alignment features accuracy in mutation detection and ease of use SeqScape is shown to produce the most accurate alignment results The Smith Waterman local alignment algorithm that the software uses can accurately position the exon sequences of interest to the corresponding region of the reference allowing biologically meaningful comparison between sequences SeqScape software s design for processing high quality sequences as well as its ability to produce
27. ars that the first alignment achieved the highest final score of 0 with 3 matches 2 mismatches 1 gap and 2 transversion mutations Lesk 2002 Most nucleotide sequence alignment algorithms refer to a scoring matrix to score a particular alignment of sequences Lesk 2002 The matrix is filled based on the scoring parameters that were set for the algorithm The algorithm will then proceed with the search for the best alignment by tracking a path along the matrix that produces the highest score Figure 2 below shows a scoring matrix that outlines a random scoring scheme for simple substitution mutations Here the diagonal path exhibits the highest score meaning that aligning ATCG on top of ATCG will be the best alignment A T C G A 20 10 5 5 T 10 20 5 5 C 5 5 20 10 G 5 5 10 20 Figure 2 A substitution scoring matrix Lesk 2002 The scoring scheme of different algorithms may be modified depending on the type of alignment that the algorithm is designed to compute Users are recommended to get familiarized with the algorithms so they can select the most appropriate algorithm to carry out the type of alignment that they want generating the most ideal results suitable for their purposes 10 4 0 DIFFERENT TYPES OF SEQEUENCE ALIGNMENT Different methods of alignments are available for different types of sequence alignment Many custom designed algorithms have been developed to suit different demands For example different softwares
28. as chosen to perform the alignment because the reference and query sequences have similar length Since the algorithm applies the global alignment method it made the detection of the three deletions possible Similarly the Smith Waterman local alignment algorithm in SeqScape matches the test sequence to the region of the reference where highest similarity is observed Gaps were inserted accordingly to the corresponding positions where the deletion was created Furthermore the software s mutation report indicated exactly where the deletion occurred identifying the deleted bases accurately Sequencher however was only able to identify the one base deletion A possible explanation of the occurrence might have to do with the nature of the algorithm that was used to align the sequences Since the custom designed algorithm Clean Data employs a different scoring parameter intended for assembling contigs it was not expecting gaps bigger than two bases as expected in result shown in Figure 33 6 1 4 Summary The assessment shows that all softwares Lasergene Sequencher and SeqScape were able to pinpoint the position of the SNP accurately The show electropherogram feature in both Sequencher and SeqScape allows one to unravel the identity of the SNP SeqScape is also integrated with special base calling features with improved abilities to interpret traces The software demonstrated its ability to recognize and identify the presence of
29. ce alignment 4 Align Sequences to Reference E Contig 0003 DEA EA A n a en m 81 APOCIIOTV1A1_A11 05 APOCIIOTV22A1_E01 APOCII Reference 73 APOCIIOTV1A2_A10 93 APOCIIOTV22A2_E12 52 APOCIIOTV2281 207 mere ORON E Single fragment Diagram Key Bumps on _ E Multiple fragments same direction fragments Bi Both strand show motifs i E Eth strands plus s hanar i Start codon frame rectangles E Stop codon frame 2 show features Figure 21 Sample sequences are aligned along the reference sequence a In the overview all sequences are shown at their aligned position relative to the reference sequence Each sequence is labelled with the corresponding sample name Green arrows indicate the sequence is being read in the forward direction while red arrows indicate that the sequences are in the reverse direction 5 Analyze the Aligned Sequences amp Contig 0003 DER g Ea Piore 3 60 APOCIIOTW22B2_Do8 C T G CCCG Ceim BMOAGAAACTCAGGTAGC Mics 3 41 APOCHOTvIB2_A06 C T ee See C A GG IA c cik 3 33 APOCIIOTW1B1_A05 3 81 APOCIIOTVIAI_AI1 05 APOCIIOTV22A1_ED1 F APOCII Reference CTGCCCGCTGTAGATGAGAAACTCAGGTAGCAq J 73 APOCIIOTIA2_AI0 S GT ACCA C 3 93 APOCHOTV22A2_E12 3 2 APOCIIOTV22B1_D07 Rog Js highlight base call disagreements 380 390 40 CECGCTOT AGATGAGAAACTCAGGTAGCAC Gs highlight ambiguities 7 gt ee eee ee ee ee Ee
30. discontinued in the market because more updated versions of the software have been developed for enhanced usage Applied Biosystems Technical Support It would be beneficial to the laboratory to gain assess to a sequence alignment software that can perform multiple alignments to save time More importantly having a software that performs the desired type of alignment ensures accuracy of mutation detection The convenience and quality alignments that such a software offers are invaluable to the busy research intensive laboratory 15 5 0 THE THREE ALIGNMENT SOFTWARES AVAILABLE IN RRI Fortunately we have licenses to three additional alignment softwares integrated with new and improved alignment functions and features suitable for complicated sequence alignments The three softwares that are available for use are Applied Biosystems s SeqScape Version 2 0 DNAStar s Lasergene Version 7 0 and Gene Code s Sequencher Version 4 7 This section of the report will briefly describe the softwares features related to nucleotide sequence alignment 5 1 ABI SeqScape Version 2 0 Applied Biosystems SeqScape software is a sequence analysis program that processes electropherogram traces or the raw data generated by an automated sequencing system Although the software is mainly used for sequence editing users have the option to align their sequences once they have been base called The software uses the famous Smith Waterman loca
31. e designed for multiple sequence alignments The Jotun Hein algorithm is designed for multiple protein sequence alignments while Clustal V and two Clustal W are suitable for multiple nucleotide sequence analyses Gindullis et al 1999 The Clustal algorithms are the most commonly used statistical measures that exploit the progressive pairwise method to carry out multiple alignments Clustal V is a global multiple alignment method while Clustal W is a local multiple alignment method 5 3 3 Aligning Sequences with Lasergene Aligning nucleotide sequences in Lasergene is rather simple For reference and query sequence comparisons users can either import their reference from NCBI s Entrez database or use a pre existing reference file in MegAlign Users can also take advantage of the synchronous updating feature in Lasergene to transfer their reference sequence designed in SeqBuilder The following example shows the procedure of aligning a few LPL exon 5 sequences with the appropriate reference obtained in NCBI database additional features relating to the alignment are also described LPL is the gene that encodes the protein Lipoprotein Lipase The deficiency of the protein leads to the accumulation of triglyceride which leads to high blood pressure and potentially the development of atherosclerosis The gene sequence is extracted in patients DNA for mutation detection analysis NCBI 2006 21 1 Edit the Reference Sequence in SeqBu
32. e of SNPs at the accurate position One of the sample sequences 18 LPLOTV 41A is known to carry a C T SNP at position 15013 relative to the LPL gene reference or at position 163 relative to the LPL exon 5 reference Wang 2006 Results i Aligning the Sequences in Lasergene 10 LPL E5 Genes meg TTT C TG G TT C a fat rat amp are TrTacchcaataaagd ACATTTACCEIGAAT TTTACCcasrEGa Ga Tee Te Ter ep i TT C G CTTTTCAG TT C G GTACT T CAG Figure 25 A SNP represented as an N is detected in sample 18 at position 163 30 ii Aligning the Sequences in Sequencher E Contig 0016 BE 4E 27 LPLoTAsA c04 T GT TGACATTTACC AATGGA E a tprommi7a op IT GTTGACATTTACES AATGGA i aE 18 LPLOTW41A B09 GACATTT MEEA T GGA i 4E 25 LPLOT 48A A04 FOACATI TAGE 4E 37 LPLOT W6 1A_E05 GAGAT TT AGE 4E 33 LPLOTWWS7A_ A085 T G A CAT TF A GE 11 frag bases selected at consensus position 163 E T Rev aepeneeantguinw costs nt eee er es 18 LPLOTV 41A_BO03 ea base 163 Base 264 of 524 4 A C AT T TA C C Ba OT TOON 33 POTMA FO5 tan 163 Base 267 of 527 Figure 26 The double peak shown in the electropherogram confirms that the SNP detected in sample 18 is a C T SNP i Aligning Sequences in SeqScape fe LPLTemplate LPLTemplate Specimen NC_000008 Layout psremel Project Navigator 2 LPLTemplate B UJ Speciment oo Unassembled E NC_o00008 B
33. ensure the reproducibility of alignment the results 2 Avoid Analyzing Large Quantity of Sequences Simultaneously To improve the time efficiency of sequence alignment it is recommended to align and analyze no more than 20 nucleotide sequences at a time Although SeqScape is capable of analyzing and comparing as many sequences as the user desires the time it requires to complete the alignment increases with the number of sequences With less than 20 sequences to align per analysis the alignment results are generated almost immediately 46 9 0 REFERENCES Altschul Stephen F 1997 Sequence comparison and alignment In Bishop M J and C J Rawlings Ed DNA and Protein Sequence Analysis A Practical Approach pp 137 168 New York Oxford University Press Inc Applied Biosystems 2002 ABI Prism SeqScape Software Version 2 0 User Guide Applied Biosystems Technical Support 15 December 2006 Dale Jeremy W and Malcolm von Schantz From Genes to Genomes Concepts and Applications of DNA Technology West Sussex John Wiley amp Sons Ltd 2002 DNASTAR Inc 2006 GETTING STARTED with DNASTAR Lasergene 7 Software Suite for Sequence Analysis Engelking Jeff DNASTAR Inc Technical Sales Consultant 18 December 2006 Gindullis Frank Nancy J Peffer and Iris Meier 1999 MAF1 a Novel Plant Protein Interacting with Matrix Attachment Region Binding Protein MFP1 Is Located at the Nuclear Envelope The Plant Cell 11 1755
34. ere amplified in the opposite orientation In terms of the software s design the layout of the software can be customized according to personal preference Some users might find the colours distracting as the reference sequence is not distinguished from the sample sequences With the addition of coloured electropherograms users might experience difficulties distinguishing one sample from the next To improve the view users can choose to display one electropherogram at a time 6 3 2 Lasergene Lasergene s simple software design allows for easy and quick identification of mutations The procedure of aligning sequences with the software is simple and straight forward The software works best with good quality sequences The untrimmed 5 and 3 ends as well as the ambiguities within the sequences will affect the alignment result since the software does not recognize a particular sequence as the reference Raw data have to be 41 trimmed individually to obtain clean sequences Furthermore the software cannot automatically translate the sequences to the correct orientation if the samples were sequenced in the opposite orientation as the reference It is very time consuming to convert the sequences back to the right orientation because users have to repetitively select the Select complementary option one by one for all sequences that exhibit the opposite orientation 6 3 3 Sequencher Sequencher is a user friendly well designed seque
35. es In the mutation report it explicitly stated that an insertion of TCT occurred in position 2029 2030 causing an in frame mutation 6 1 3 Homozygous Insertion Deletion Detection Homozygous insertion or deletion occurs when the same bases are inserted or deleted from both the alleles of the DNA at the same location The mutation is not noticeable on the electropherogram unless the sequence is aligned with its corresponding reference sequence Wang 2006 The test sequence that will be used for the assessment for homozygous mutation is a self created sequence with three deletions based on the LPL Exon 5 reference sequence as shown in Figure 32 Test Sequence LPL Exon 5 Sequence Reference Sequence 53bp GATGATGCAGATTTTGTAGACGTCTTACACACAT TCACCAGAGGGT CCCCTGG Deletion GATGATAGATTTTGTAGACTCTTACACACAT TCACCAGACCT GG Query Sequence 44bp Figure 32 Three regions in the reference are deleted to create the new query sequence This sequence will be imported into the softwares to examine the efficacy of the software to detect the three major deletions The expected result should contain 3 gapped regions at the position where the deletion was made to occur as shown in Figure 33 GATGATGCAGATTTTGTAGACGTCTTACACACAT TCACCAGAGGGTCCCCTGG Le ee ee ee IILI GATGAT AGATTTTGTAGAC TOTTACACACATTCACCA CTGG Figure 33 The expected alignment result 35 Result i Aligning Sequences in Lasergene Untitled lt Pos 2
36. ference View Column Selector F Ret a V Reference Figure 7 Options in Display Settings Users can customize the appearance of the screen layout by choosing the colours and text styles according to their preference The software also allows users to choose which icons or features are to be shown and which ones to be removed Figure 7 For example it can show or hide electropherogram s the reference sequence the corresponding amino acid sequence the consensus and variants etc 18 4 Create Reference Data Group ROI Name Segment Seg Start Seg End ROI Start ROlLength Translation Color on Layer1 1 NC_oo0019 NC_o00019 1 3576 1 3576 M E E 2 APOC2_gene NC_000019 1 3576 1 3576 M oi 3 sTSs_1 NC_000019 134 284 1 151 m E J 4 sTs_2 NC_000019 139 434 1 296 E E 5 NC_000019 186 286 1 101 r iE 5 Ene Figure 8 Reference Data Group settings a Users can either import a reference sequence from NCBI s Entrez database or copy and paste a sequence from another source b Users can define as many regions of interest ROIs as they desire in separate layers so that the sequences when imported will only align with that particular segment of the reference 5 Create Project Template 6 Import Sequence Samples 7 Perform Sequence Analysis ecirne n1 NC_ 000019 Start Ref End_ CR Leng CR Start_ CR End j 2921 541 541 1 960 360 1 13337 lasa lasa 1
37. ference in the alignment ie LPL Lipoprotein Lipase s m Entrez Gene S PubMest tide Prote Struct IT Go Clear Save Search Limits Previewindex History Clipboard Details Display Summary Show 20 Sendto v Entrez Gene i All 66 Current Only 63 Genes Genomes 60 SNP GeneView 34 X Items 1 20 of 66 D1 ipl Lpl Halobacterium sp NRC 1 Other Aliases VNGO181G Other Designations lipoate protein ligase GeneID 1447104 Mailing Lists O EL 3 ae Official Symbol LPL and Name lipoprotein lipake Homo sapiens gt Other Aliases LIPD Chromosome 8 Location 8p22 MIM 238600 Feedback GeneID 4023 iv Select the corresponding species that the reference is extracted from ie Homo Sapiens v Click on Go to reference sequence details to view the sequence D1 LPL lipoprotein lipase Homo sapiens GenelD 4023 updated 01 Nov 2006 Summary 2 Official Symbol LPL HGNC Official Full Name lipoprotein lipase HGNC Primary source HGNC 6677 See related HPRD 01999 MIM 238600 Gene type protein coding RefSeq status Reviewed Organism Homo sapiens Lineage Eukaryota Metazoa Chordata Craniata Vertebrata Euteleostomi Mammalia Eutheria Euarchontoglires Primates Haplorrhini Catarrhini Hominidae Homo Also known as LIPO Summary LPL encodes lipoprotein lipase which is expressed in heart musde and adipose tissue LPL functions as a homodimer and has the dual functions of
38. gnment or progressive pairwise alignment where numerous pairwise alignments are simultaneously carried out Altschul 1997 In the following assessment sequences in multiples of ten up to 60 sequences will be entered into the softwares to examine time efficiency of each alignment software 38 Result i Lasergene Table 1 Aligning sequences in MegAlign Number of Sequences Time s 10 10 20 22 30 38 40 68 50 100 60 147 ii Sequencher Table 2 Aligning sequences in Sequencher Number of Sequences Time s 10 lt l 20 lt 1 30 lt l 40 lt 1 50 1 60 1 iii SeqScape Table 3 Aligning sequences in SeqScape Number of Sequences Time s 10 21 20 41 30 60 40 80 50 99 60 121 Tables 1 2 and 3 show the time the softwares take to process the alignment as the number of sequences increase With the exception of Sequencher it is observed that the processing time is proportional to the number of sequences being analyzed with the other two softwares 39 Figure 37 The amount of sequences the softwares can handle with time Number of Sequences vs Time 160 140 120 n 100 60 ae 0 T 7 T T 7 10 20 30 40 50 60 Number of Sequences Time s 0 e SeqScape Sequencher MegAlign Analysis In general with the exception of aligning sequences in Sequencher the ti
39. iate amount of Protein Precipitate Solution to the cell lysate 7 Mix the Protein Precipitate Solution uniformly with the cell lysate to obtain a homogeneous solution Centrifuge the solution for 5 minutes 9 To the supernatant containing the DNA add the appropriate amount of isopropanol to precipitate the DNA 10 Centrifuge the mixture for 3 minutes DNA will be in form of a white pellet 11 Remove the supernatant Add 70 ethanol to wash the pellet containing the DNA 12 Dry the DNA pellet 13 DNA Hydration Solution is added to preserve and hydrate the pellet Store the DNA at 4 D va II Isolate the Gene of Interest In order to obtain the desired region in the DNA for sequence comparison a pair of primers has to be designed to flank the gene of interest During primer design one has to ensure the same annealing temperature and GC content for both primers Primers are usually designed so that they anneal to the template 50 base pairs away from the gene to be amplified The gene of interest can then be amplified with the appropriate primers using the PCR Polymerase Chain Reaction machine Wang 2006 50 HI DNA Purification The laboratory currently uses Qiagen s QIAquick PCR Purification Kit to purify the amplified gene of interest produced from the previous PCR reaction The procedures are described as follows Refer to the O Aquick Spin Handbook for the complete protocol on DNA purification l 2 Add
40. ilder SeqBuilder File Edit Features Enzymes Sequence Cloning Format View NetSearch Window Help td LPL Exon5 Reference Sequence sbd DER a Position 241 240 bp Sequence 10 20 30 40 50 Feature List aaggeetegatecagetggacctaactttgagtatgcagaagececgagt Comment Linear May j cgtetttetectgatgatgcagattttgtagacgtettacacacattcac Circular Map Minimag nen cagagggteecetggtcgaagcattggaatccagaaaccagttgggcatg Residues 1 Bottom Strand Enzymes Displayed AO Features Displayed Gad ons gaagetatcegegtgattgcagagagaggacttggaggtd peeeteenes ONUN seeee seeereaeee sees EUREN Views a pa A ttgacatttacccgaatggaggtacttttcagecaggatgtaacattgga c Full Translations a 2 D A m Figure 10 Editing the sequence in SeqBuilder a The reference sequence can be edited in SeqBuilder so that only the region of interest or the segment that is relevant for alignment is displayed At the top right corner the sequence s length is displayed The ruler beneath the sequence is included to indicate the base position 2 Import the Reference Sequence to MegAlign Megalign DER Fie Edit Align View Options NetSearch Window Help LPL Exon5 Reference Sequence meg HieR Sequence Nam Pos 1 lt Pos 219 m f E a PU i lt consensus AAGGCCT CGAT CCAGCT GGACCTAACTTT GCAGAGAGAGGACTT GGA Sequences 10 20 1220 230 E LPL Exond R JAAGGCCT CGAT CCAGCT GG
41. k on the same file in any or all of the applications at the same time DNASTAR 2006 The applications that concern sequence alignment are SeqBuilder and MegAlign which will be introduced as follows Refer to the user guide GETTING STARTED with DNASTAR Lasergene 7 Software Suite for Sequence Analysis for more information 5 2 1 SeqBuilder SeqBuilder is a powerful program that allows users to design their own DNA sequence by entering individual nucleotides A T C or G into the program or by just simply pasting any sequences that they have copied from another source Users can also edit the copied sequence with the program to make modifications as they need The program is also capable of identifying any open reading frames and enzyme restriction sites for cloning purposes Other useful features include translating back translating and selecting the reverse complement of the newly designed DNA 20 5 3 2 MegAlign MegAlign performs sequence comparison with either nucleotide or protein sequences and is able to do both pairwise and multiple alignments Based on the aligned sequences the program can generate phylogenic trees alignment reports and tables to summarize the match results and variants identified within sequences Four algorithms are available to perform pairwise sequence alignments The users can choose to display a dot plot from each for a visual representation of the alignment Furthermore four additional algorithms ar
42. l alignment algorithm to align the base called sequences with a user defined reference Applied Biosystems 2002 Although the algorithm is technically a pairwise method the software is designed in such a way that it is capable of displaying more than two sequences simultaneously in the same window all of which have been analyzed and aligned with the reference sequence This technique is known as the progressive pairwise alignment method Applied Biosystems Technical Support 2006 The software is ideal for investigators who are conducting in depth studies of various gene segments along the same reference sequence 16 5 1 1 Aligning Sequences with SeqScape Users are recommended to follow the software s set up procedures before performing sequence analysis Applied Biosystems 2002 Briefly the protocol is outlined as follows 1 Create Analysis Defaults a b c d Analysis Protocol Editor General Basecalling Mixed Bases Clear Range Filter Mixed Bases Settings Use Mixed Base Identification Call IUB if 2nd highest peak is gt 25 of the highest peak Figure 5 The analysis protocol editor In the Basecalling tab users select from the drop down menus the automated sequencer as well as the Dye set they use for sequencing Users can also tell the software when to stop the basecalling whether it is at a PCR stop or at a position where a specific number of ambiguities N has been disp
43. layed In the Mixed Bases Tab the Mixed Base Identification option can be used in case of encountering a heterozygous allele The option takes into effect if the second peak height is of a certain percentage user defined of the main peak height Figure 5 The parameters listed in the Clear Range tab enable users to define the quality of their sequences For example the software can be instructed to display the sequence in between a certain range where all other ambiguous bases outside of the range are trimmed In the Filter tab users can reject sequences that are of poor quality by defining the parameters of a good quality sequence 17 2 Define Analysis Settings Edit Analysis Settings General Project Sample Settings Gap Penalty Extension Penalty 8 5 Library Matches 20 V Basecall Samples e Figure 6 Analysis settings a The software s alignment algorithm uses the numeric values entered in the Gap and Extension Penalties fields in the Project and Specimen tabs respectively to score an alignment with gaps Figure 6 3 Define Display Settings General Bases Electropherogram A jiyi View Settings Characters Dots E Project View Settings a m Display Mode o 4 S Electropherograms LA FA EP Window bp 10 Confidence Bars Vall Bul Expanded NT NT Tab Jump Multiple Summary V Variants A Tab Jump Multiple F Ind v V Show Overview 3 i zs v Re
44. laying different colours due to the variations shown in the sequences Because the software does not recognize a particular sequence as the reference sequence the consensus sequence is reflective of all sequences listed in the panel 4 Trim Sequence Samples LPL Exon5 Reference Sequence meg DER Z Sequence Na lt Pos 1 lt Pos 508 o ME m es E E K Consensus TAAGGGCCCGGT CGCGCTT GACCTAACTT IXXXXXXXXXXXXXXXXXX 10 Sequence 10 20 30 510 520 a LPL Exon5 AAGGCCT CGAT CCAGCT GGACCTAACTTTG Ramee NN NNNNNNNNNNCTGCCONGTGCATTCAATG CNNNNNNNNNATCTTTTA s 25 LPLOT a Set Ends Bloo ae 29 LPLOTV ETT AAGGG 18 LPLOTVH414_B03 seq 100 gt 340 f 30 LPLOT IT B4 LPLOT T sfo A m j a 49 LPLOT x a 46 LPLOT GAGAAAG me a _aserafssras 4T LPLOT AAAGACG Select complement Length 525 bp Range 241 bp oj Ce Figure 13 Setting the 5 and the 3 ends of the sequences a The N represents an ambiguity in the sequence They are usually present at the beginning of the sequences as they are the priming regions Clean sequences can be obtained by specifying the start and end positions for trimming There is also the option to select the complementary strand of the sequence if it appears in the opposite orientation The coloured bases represent variants that are different from the consensus 23 5 Select an Alignment Method MegAlign Opti
45. me it requires to complete the alignment process is proportional to the number of sequences imported into the software In SeqScape a linear relationship is observed as the number of sequences increase with time while in Lasergene a power curve is observed between the number of sequences and time Figure 37 The more sophisticated algorithms such as Clustal V and Clustal W require much longer time to complete the alignment process Altschul 1997 Aligning sequences in Sequencher is most time efficient as the alignment process only takes an average of one second to complete Table 2 Although the matching process slows down with the increasing number of sequences all three softwares were able to generate the alignment result under 30 seconds when aligning 10 sequences at a time 40 6 3 Ease of Use 6 3 1 SeqScape The set up procedures of the software are quite complicated for first time users Once the user specified settings are instructed to the software later procedures are relatively simple Although the trimming option is available the software is still able to work with poor quality sequences and make corresponding matches to the reference Ambiguities in the sequence will not affect the alignment result In addition the software can automatically convert the sequences to the correct orientation relative to the reference Users do not have to worry about translating the sequences into their reverse complement if the sequences w
46. n facilitate the SNP identification process as well as minimize possible human errors The purpose of this report is to assess and discuss the advantages and disadvantages of three sequence alignment softwares over the currently in use software Sequence Navigator available in RRI The three softwares are ABI Prism SeqScape Software Version 2 0 Lasergene Version 7 0 and Sequencher Version 4 7 This report will thoroughly describe the features and functions of each sequence alignment software The softwares will be assessed individually for their accuracy and efficiency in performing sequence alignments In particular the alignment algorithm and the speed of performance will be looked at in detail Other assessment parameters such as the ease of use as well as the cost of the softwares will also be considered in the evaluation At the end of the report a recommendation will be made as to the software that is most supportive to the ongoing SNP detection project in RRI 2 0 INTRODUCTON TO SEQUENCE ALIGNMENT Sequence alignment is the most direct method to measure sequence similarity between two or more nucleotide or amino acid sequences It is the process of comparing individual nucleotides or residues at the position corresponding to how the sequences are superimposed Lesk 2002 Given a set of sequences with different lengths and context there are numerous ways that the sequences can be aligned the goal is to seek the one that exhibi
47. nce analysis tool Users simply import their reference and working sequences into the program The sequences will be aligned automatically by clicking the Assemble To Reference button There is the option to set the nucleotides to specific colours according to users preference Located at the bottom of the working panel the consensus sequence is easily distinguishable Symbols are used to mark any variation that is different than the consensus The reference to which all the sample sequences are aligned against is also marked so it can be easily identified All aligned sequences are displayed in a contig map where users can observe the relative positioning of all sample sequences that are aligned to the reference Each sequence fragment is labelled with its sample name for identification purposes In addition the orientation of each fragment is represented by the direction of the arrow The software automatically converts the sequences into the correct orientation relative to the reference However in order to produce ideal results individual sequences have to be trimmed which requires a lot of base deleting work With many sequences to align at once the editing becomes repetitive 42 6 4 Cost Analysis Table 4 Quotes for the alignment softwares SeqScape Lasergene Sequencher Initial License Cost 8820 CND 4496 USD 3450 USD Service Plan Renewal 780 USD 325 USD Table 4 outlines the initial license cost of the
48. ngle nucleotide polymorphisms SNPs SNPs are single base mutations that occur when a single nucleotide in the DNA sequence is substituted with one of the three other nucleotides Karp 2005 While some SNPs are silent mutations that will not cause any harm to an individual others could induce detrimental effects and be associated with pathology Karp 2005 The study of SNPs is a promising field of research as it helps identify genes that are potentially linked to certain diseases For a variation to be considered as a SNP that predispose humans to disease the mutation must occur in at least 1 of the population Dale and von Schantz 2002 In Dr Hegle s lab population studies and related experiments are conducted to discover SNPs First blood samples are collected from patients who are affected by cardiovascular disease The DNA from the samples will be extracted purified and amplified After isolating the gene of interest from the processed samples with the design of specific primers the genes will be sequenced for further analysis The set of sequences obtained will be compared and examined for the presence of SNPs or other changes such as insertions or deletions With many sequences to compare and analyze it would be more efficient if the sequences could be examined simultaneously with the help of an alignment program An alignment program which performs sequence alignments quickly and accurately to pick out sequence variations ca
49. ons_Net Search Window Help y Jotun Hein Method Shift Ctrl J By Clustal V Method Ctrl K By Clustal W Method Ctrl L __ lt Pos 336 a SS eee SAG AGGATGTAACATTGGAGAAGCTATI Unalign All Ctrl 2 340 350 TR AG AGGATGTAACATTGGAGAAGCTATI IAG AGGATGTAACATTGGAGAAGCTAT iskelia IAG JAGGATGTAACATTGGAGAAGCTATI IAG AGGATGTAACATTGGAGAAGCTAT IAG AGGATGTAACATTGGAGAAGCTAT T Figure 14 Three multiple alignment algorithms are available for selection a Sequences can be aligned by selecting the appropriate algorithm under the Align command Clustal V and Clustal W algorithms are the methods suitable for aligning multiple sequences simultaneously Example Consensus Strength Meter MegAlign Ox Fe Et An vw Opts seach windon HD LPL Exon5 Reference Sequence meg DER x Sequence Name lt Pos 109 y lt Pos 166 me m ee M I Consensus ATT CACCAGAGGGTCCCCTGG TTGACATTTACCCGAAT GGA l 7 Sequences 110 120 131 170 180 23 LPL Exon Reference ATT CACCAGAGGGT CCCCTGG TTGACATTTACCRIGAAT GGA ge 8 LPLOTV 4TA_BOS ATT CACCAGAGGGT CCCCTGG TTGACATTTACCIIGAAT GGA gal 20 LPLOTV 43A_D03 s ATT CACCAGAGGGT CCCCTGG TTGACATTTACCRGAAT GGA wee 26 LPLOTV 1A_A04 se ATT CACCAGAGGGT CCCCTGG TTGACATTTACCIIGAAT GGA HLPLOTV 5A_E04 se ATT CACCAGAGGGT CCCCTGG TTGACATTTACCRGAAT GGA 1 30 LPLOTV 6A_F04 se ATT CACCAGAGGGT CCCCTGG TTGACATTTACCIIGAAT GGA 34 LPLOTV 10A_B05 ATT CACCAGANNGTCCCCTGG TTGACATTTAC
50. p pp pm epee ee Figure 17 A map of overlapping contigs 5 2 1 Aligning Sequences in Sequencher Sequencher software is compatible with sample files that are in abl format Just like SeqScape the software is able to accept and analyze traces of raw data for alignment purposes The following provides an overview of aligning nucleotide sequences in Sequencher More information can be found the Gene Codes Sequencher 4 7 website at www genecodes com 26 1 Import the Reference Sequence E LPL Exon5 Reference Sequence CS mA E e a Residue 201 Sequenced Strand lS SIE IGN Fore PBE as IS E is 1 AAGGCCTCGA TCCAGCTGGA CCTAACTITG AGTATGCAGA al AGCCCCGAGT CGTCTTTCTC CTGATGATGC AGATTTTGTA l GACGTCTTAC ACACATTCAC CAGAGGGTCC CCTGGTCGAA 121 GCATTGGAAT CCAGAAACCA GTTGGGCATG TTGACATTTA 161 CCCGAATGGA GGTACTTTTC AGCCAGGATG TAACATTGGA 201 GAAGCTATCC GCGTGATTGC AGAGAGAGGA CTTGGAGGTA Figure 18 A reference sequence is pasted to the sequence editing panel a A reference sequence can be copied and pasted to Create New DNA window This sequence should be set as the reference sequence under the Sequence command Sequences in this panel can be trimmed by simply deleting all the bases that are not desirable 2 Import Sequence Samples LPL Exon 5 alignment SPF Assembly Parameters Assemble Automatically f Assemble Interactively Assemble to Reference Modified 4 18 LPLOTW 414 _ B03 4 25 LPLOTWW1A_
51. public as reference For example reference sequences can be retrieved online from NCBI s GenBank at http www ncbi nlm nih gov or from Ensembl at http www ensembl org Many of these sequences are submitted by reliable sources such as scientific publications and genome projects which accounts for the validity of the entries Lesk 2002 Useful annotations such as restriction enzyme cleavage sites and the coding and non coding regions of the nucleotide sequence are also provided for investigators own interest Details regarding the retrieval of the desired reference sequence are outlined in Appendix A 3 2 Obtaining the Query Sequence In Dr Hegele s lab 99 of the DNA sequences to be analyzed are obtained from patient s blood samples Specific genes that are thought to be related to a particular cardiovascular disease are isolated from the DNA The exons or the coding regions of the genes are studied one by one to check for the presence of SNPs or other existing mutations Briefly the DNA that is extracted from the carefully treated blood samples is subjected to PCR amplification Two custom designed primers have been added prior to the PCR reaction so that only the gene of interest is multiplied The end products of the PCR reaction will go through a thorough purification process to rid excess nucleotides or enzymes that remained in solution Wang 2006 The clean DNA templates containing the gene of interest along with the appropriate
52. query sequences it is most preferred to align the sequences globally However with an alignment software that is not able to truncate the reference to show a similar length as the query sequences local alignment would be the method of choice The method will match the query sequences to the most similar region in the reference without inserting unnecessary gaps into the sequences Furthermore it would be more time efficient if the software we use is able to perform multiple alignment Considering the large number of sample sequences to be analyzed the most convenient method is to compare more than two sequences simultaneously 14 With multiple alignment SNPs that are present in the samples can be picked out all at once The convenience that multiple sequence alignment provides is invaluable to the busy laboratory setting Lastly since the sequences that we analyze show sufficient similarity with one another the best approach is to use optimal alignment that is most effective when comparing related sequences The heuristic approach should not be used since the method cannot identify major insertion or deletion mutations 4 5 The Currently In use Software in RRI In the laboratory the alignment software that is currently in use for sequence alignment analysis is the Sequence Navigator software v1 1 from Applied Biosystems The software has limited alignment features and is only capable of doing pairwise analysis The software is
53. the variation along the reference or the consensus sequence In both SeqScape and Sequencher the electropherograms that complemented the sequences provide a visual representation of the SNP Both the electropherogram showed a blue red double peak at the SNP position confirming C and T base substitution In addition the mutation report included in SeqScape verifies that the SNP is a substitution of the C allele Other details about the mutation such as the type of mutation were also addressed in the report Although MegAlign was also able to identify the presence of the SNP at the correct location it cannot distinguish the substitution Users will not be able to tell what the base change was because the SNP was base called as N which represents an ambiguity in the sequence 6 1 2 Heterozygous Insertion Deletion Detection Frameshift mutations occur when a mutation in gene sequence acquires an insertion or a deletion of nucleotides that interferes with the normal reading frame of the sequence The mutation is heterozygous if the variation occurs only in one of the two alleles of the DNA Wang 2006 The mutation is characterized by overlapping peaks that usually start off in the mid section of the electropherogram In the second part of the assessment eight APOCII genes are chosen to test the software s ability to identify the bases that have been inserted or deleted within the set of 32 sequences One of the sequences 93 APOCI
54. three sequence alignment softwares The initial license cost of SeqScape Software is 8820 CND which is about double the cost of Lasergene and Sequencher Lasergene from DNASTAR costs 4579 USD with a 780 dollar annual service plan renewal while Sequencher from Gene Codes cost 3450 USD with an annual cost of 325 USD SeqScape is the most expensive alignment software however considering the multiple tasks that it can perform the software is a worthwhile purchase 6 5 Summary The following tables summarize the features and functions of the three alignment softwares Table 5 The alignment algorithms of the three softwares SeqScape Lasergene Sequencher Local Alignment V vi v Global Alignment y Multiple Alignment V v V Optimal Alignment v y v Table 5 outlines the types of alignment that each of the softwares can perform Lasergene can carry out all four types of alignment local global multiple and optimal SeqScape and Sequencher can only perform three types of the four 43 Table 6 The mutation detection efficacy of the softwares SeqScape Lasergene Sequencher SNP 5 3 5 Homozygous Mutation 5 4 3 Heterozygous Mutation 5 3 2 Overall 15 10 10 The above evaluation ranks the software s ability to detect mutations in a scale of 5 with 5 representing the highest score SeqScape scored the highest as it is capable of recognizing all three types of mutation Lasergene and Sequencher both achieved equiv
55. ts the best alignment While gaps can be inserted within the sequences to achieve more matching pairs in the alignment the order of the nucleotides or residues must be conserved as the original sequence Lesk 2002 How is it determined that a particular arrangement of the sequences be the best alignment The topic will be addressed in Section 3 3 of the report 2 1 Purpose of Performing Sequence Alignment Sequence alignment is a useful comparison technique with many applications in evolutionary and molecular studies In both protein and nucleotide sequence alignments the goal is to identify regions of similarity between aligned sequences known as the consensus sequence Pearson and Wood 2002 With protein alignments the degree of resemblance noted from a set of amino acid sequences demonstrates the homology or the relative closeness of the aligned species Applied Biosystems 2002 A phylogenetic tree deduced from the aligned sequences can also track down the common ancestor of the species Furthermore the identification of conserved or unchanged regions of the protein sequence in one species leads to the prediction of the structure and the function of the particular protein in another Applied Biosystems 2002 Alternatively aligning nucleotide or DNA sequences identifies any variant or mutation that might be present in the sequences Altschul 1997 Some well known mutations within the nucleotide sequence are substitution mutations s
56. tware has demonstrated to be the most effective alignment program to detect mutations that exist in the nucleotide sequences SeqScape software is integrated with the Smith Waterman local alignment algorithm that is able to match the sample gene sequences at the correct position along the reference sequence during the alignment The algorithm is also a successive pairwise method where multiple sequences can be aligned simultaneously to improve time efficiency in the laboratory New and improved alignment features are also integrated in the software at the convenience of first time uSers Although results showed that the SeqScape software is best suited for the purposes of the laboratory it is recommended that sample sequences be aligned in all three softwares to ensure the reproducibility of the alignment result Furthermore users should avoid aligning too many sequences simultaneously to improve time efficiency of the process 1 0 INTRODUCTION Dr Robert Hegele is the Director of the Blackburn Cardiovascular Genetics Laboratory at Robarts Research Institute RRI His research interest is focused on the genetic basis of cardiovascular diseases such as diabetes atherosclerosis and dyslipidemia He and his team of dedicated scientists work together in the lab to study gene mutations in the human genome that could very well predispose humans to such diseases As a part of the research tremendous effort is put forth to the finding of si
57. two unrelated sequences it will not miss the strong regions of similarity that might appear at different positions in the aligned sequences Pearson and Wood 2003 However heuristic alignment is an approximation method which does not guarantee the search of the optimal alignment 13 because the nature of the algorithm does not allow the introduction of gaps Altschul 1997 A better approach to generate biologically meaningful alignments is to align the sequences optimally Optimal alignment is a method to align sequences systemically with the use of scoring matrices and gaps Skiena 2002 Both local and global alignment algorithms use the optimal approach that allows the introduction of gaps to align sequences Skiena 2002 Comparatively the optimal approach is able to generate a more desirable alignment between related sequences with a higher confidence than the heuristic approach 4 4 Choosing the Methods of Alignment As mentioned previously one of the tasks carried out in Dr Hegele s laboratory is to identify SNPs and other genetic mutations such as insertions or deletions in patients DNA Related exons of the gene of interest in the DNA sequences are examined individually Since the exons of interest are isolated and amplified in PCR using the same pair of primers the lengths of the query sequences are more or less the same in size Dale and von Schantz 2002 With a reference sequence that displays similar length as the
58. uch as single base changes or frameshift mutations such as an insertion deletion or duplication of several nucleotides For the purposes in Dr Hegele s laboratory DNA sequence alignment is mostly performed to detect the presence of SNPs or any major frameshift mutations in patients DNA The comparative study is conducted to verify the hypothesis about the genetic basis of certain cardiovascular diseases Hence topics covered in the remaining parts of the report will mainly focus on methods and applications of nucleotide sequence alignment 3 0 HOW ARE NUCLEOTIDE SEQUENCES ALIGNED In general two components are involved in a nucleotide sequence alignment the reference and the query The reference sequence is a known sequence with the order of nucleotides predetermined from a valid source that is suitable to be compared against Query sequences on the other hand could be DNA fragments or bacterial genomes with an unknown sequence yet to be decoded Dale and von Schantz 2002 The nucleotide sequence of the query can be verified with the reference for any existing mutations Once the components for alignment have been gathered similarity searches within the sequences can proceed with a program containing the appropriate alignment algorithm that performs the desired method of alignment 3 1 Obtaining the Reference Sequence Several electronic databases containing a collection of known nucleotide sequences are available to the general

Download Pdf Manuals

Related Search

Related Contents

Massive Ceiling light 32080/17/10  here  

Copyright © All rights reserved. Failed to retrieve file