Home
5/FRT - bioss - Centre for Biological Signalling Studies
Contents
1. Technical Support Web Resources Visit the Invitrogen web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our web site www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech supportQinvitrogen com E mail E mail eurotechQinvitrogen com jpinfo invitrogen com MSDS Certificate of Analysis Limited Warranty 10 MSDSs Material Safety Data Sheets are available on our web site at www invitrogen com msds The Certificate of Analysis CofA provides detailed quality control information for each product The CofA is available on our website at www invitro
2. Appendix Map of pcDNA 5 FRT Vector Map of The figure below summarizes the features of the pcDNA 5 FRT vector Note that pcDNA 5 FRT the hygromycin resistance gene lacks a promoter and its native ATG start codon Transfection of the pe DNA 5 FRT plasmid alone into mammalian cells will not confer hygromycin resistance to the cells The complete nucleotide sequence for pcDNA 5 ERT is available for downloading from our web site at www invitrogen com or by contacting Technical Support page 10 o Es A Comments for pcDNA5 FRT 5070 nucleotides PUC ori CMV promoter bases 232 819 CMV forward priming site bases 769 789 T7 promoter priming site bases 863 882 Multiple cloning site bases 895 1010 BGH reverse priming site bases 1022 1039 BGH polyadenylation signal bases 1028 1252 FRT site bases 1536 1583 Hygromycin resistance gene no ATG bases 1591 2611 SV40 early polyadenylation signal bases 2743 2873 pUC origin bases 3256 3929 complementary strand bla promoter bases 4935 5033 complementary strand Ampicillin b a resistance gene bases 4074 4934 complementary strand Continued on next page Features of pcDNA 5 FRT Vector TM pcDNA 5 FRT is a 5070 bp vector that expresses your gene of interest under the control of the human CMV promoter The table below describes the relevant features of pcDNA 5 FRT All features have been functionally tested Features of pcDNA 5 FRT Feature Be
3. General information about transfection and selection is provided below Specific guidelines and protocols for generation of the Flp In expression cell line can be found in the Flp In System manual TM For detailed information about pOG44 and generation of the Flp In host cell line refer to the Flp In System manual TM TM Several Flp In host cell lines which stably express the lacZ Zeocin fusion gene from pFRT lacZeo or pFRT lacZeo2 and which contain a single integrated FRT site are available from Invitrogen see page vi for ordering information If you wish to express your gene of interest in 293 CV 1 CHO 3T3 BHK or Jurkat cells may want to use one of Invitrogen s Flp In cell lines as the host to establish your stable expression cell line For more information visit our web site www invitrogen com or contact Technical Support see page 10 We have observed down regulation of the viral CMV promoter and subsequent loss of gene expression when pcDNA 5 FRT based expression constructs are introduced into 3T3 or BHK cells This behavior is not observed with pEF5 FRT based expression constructs If you are generationg Flp In expression cell lines using a 3T3 or BHK host cell line we recommend that you clone your gene of interest into a pEF5 FRT based expression plasmid e g pEF5 FRT V5 D TOPO or pEF5 FRT V5 DEST For more information visit our web site www invitrogen com or contact Technical Suppo
4. FRT site originally isolated from Saccharomyces cerevisiae serves as a binding site for Flp recombinase and has been well characterized Gronostajski amp Sadowski 1985 Jayaram 1985 Sauer 1994 Senecoff et al 1985 The minimal FRT site consists of a 34 bp sequence containing two 13 bp imperfect inverted repeats separated by an 8 bp spacer that includes an Xba I restriction site see figure below An additional 13 bp repeat is found in most FRT sites but is not required for cleavage Andrews et al 1985 While Flp recombinase binds to all three of the 13 bp repeats strand cleavage actually occurs at the boundaries of the 8 bp spacer region see figure below Andrews et al 1985 Senecoff et al 1985 Minimal FRT site A CS e enn GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAAC TTC Xba CS CS cleavage site The following table outlines the steps required to clone and express your gene of interest in pcDNA 5 FRT Step Action 1 Consult the multiple cloning site diagrammed on page 4 to design your cloning strategy 2 Ligate your insert into peDNA 5 FRT and transform into E coli Select transformants on 50 100 pg ml ampicillin 3 Analyze your transformants for the presence of insert by restriction digestion 4 Select a transformant with the correct restriction pattern and sequence to confirm that your gene is cloned in the correct orientation 5 Cotransfect your pcDNA 5 FRT construct and pOG
5. Gene Molec Cell Biol 7 4125 4129 Neumann J R Morency C A and Russian K O 1987 A Novel Rapid Assay for Chloramphenicol Acetyltransferase Gene Expression BioTechniques 5 444 447 Palmer T D Hock R A Osborne W R A and Miller A D 1987 Efficient Retrovirus Mediated Transfer and Expression of a Human Adenosine Deaminase Gene in Diploid Skin Fibroblasts from an Adenosine Deficient Human Proc Natl Acad Sci U S A 84 1055 1059 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Ed Cold Spring Harbor Laboratory Press Plainview New York Sauer B 1994 Site Specific Recombination Developments and Applications Curr Opin Biotechnol 5 521 527 Senecoff J F Bruckner R C and Cox M M 1985 The FLP Recombinase of the Yeast 2 micron Plasmid Characterization of its Recombination Site Proc Natl Acad Sci USA 82 7270 7274 1999 2008 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 12 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
6. and a description of the features of pcDNA 5 FRT refer to the Appendix pages 7 8 CMV promoter CAAT 721 AAAATCAACG GGACTTTCCA AAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGCG CMV forward priming site TATA 3 end of CMV promoter putative transcriptional start sm 781 GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CTGGCTAACT AGAGAACCCA T7 promoter priming site Nhe I 1 I 841 CTGCTTACTG GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAGC Pmel Aflli Hind Il Asp718l Kpnl Bam H Bst X l l l l I 901 GTTTAAACTT AAGCTTGGTA CCGAGCTCGG ATCCACTAGT CCAGTGTGGT GGAATTCTGC EcoRV BS mee Ano Apal Pmel I 961 AGATATCCAG CACAGTGGCG GCCGCTCGAG TCTAGAGGGC CCGTTTAAAC CCGCTGATCA BGH reverse priming site 1 1021 GCCTCGACTG TGCCTTCTAG TTGCCAGCCA TCTGTTGTTT GCCCCTCCCC CGTGCCTTCC Note there are two Pme I sites and two BstX I sites in the polylinker E coli Transform your ligation mixtures into a competent recA endA E coli strain Transformation e g TOP10 DH5 and select on LB agar plates containing 50 to 100 pg ml ampicillin Select 10 20 clones and analyze for the presence and orientation of your insert BE We recommend that you sequence your construct to confirm that your gene is in the Ns correct orientation for expression and contains an ATG initiation codon and a stop codon TE oo To sequence your construct we suggest using the T7 Promoter and BGH
7. 41 521 530 Craig N L 1988 The Mechanism of Conservative Site Specific Recombination Ann Rev Genet 22 77 105 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Gritz L and Davies J 1983 Plasmid Encoded Hygromycin B Resistance The Sequence of Hygromycin B Phosphotransferase Gene and its Expression in E coli and S Cerevisiae Gene 25 179 188 Gronostajski R M and Sadowski P D 1985 Determination of DNA Sequences Essential for FLP mediated Recombination by a Novel Method J Biol Chem 260 12320 12327 Jayaram M 1985 Two micrometer Circle Site specific Recombination The Minimal Substrate and the Possible Role of Flanking Sequences Proc Natl Acad Sci USA 82 5875 5879 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 115 887 903 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early
8. 44 into the Flp In host cell line using your own method of choice and select for hygromycin TM resistant clones see the Flp In System manual for more information 6 Assay for expression of the gene of interest Methods Cloning into pcDNA 5 FRT Introduction General Molecular Biology Techniques E coli Strain Transformation Method Maintenance of Plasmids Cloning Considerations A diagram is provided on the next page to help you clone your gene of interest into pcCDNA 5 FRT General considerations for cloning and transformation are listed below For help with DNA ligations E coli transformations restriction enzyme analysis DNA sequencing and DNA biochemistry refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 Many E coli strains are suitable for the propagation and maintenance of this vector We recommend that you propagate vectors containing inserts in E coli strains that are recombination deficient recA and endonuclease A deficient endA For your convenience TOP10 is available as chemically competent or electrocompetent cells from Invitrogen page vi You may use any method of your choice for transformation Chemical transformation is the most convenient method for many researchers Electroporation is the most efficient and the method of choice for large plasmids To p
9. Life Technologies You may not assign sub license rent lease or otherwise transfer any of the rights or obligations set forth herein except as expressly permitted by Life Tech nologies This product is licensed under U S Patent Nos 5 654 182 and 5 677 177 and is for research purposes only Inquiries about licensing for commercial or other uses should be directed to The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Department of Intellectual Property and Technology Transfer Phone 858 453 4100 ext 1703 Fax 858 450 0509 Email mwhite salk edu 11 References Andersson 5 Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Andrews B J Proteau G A Beatty L G and Sadowski P D 1985 The FLP Recombinase of the 2 Micron Circle DNA of Yeast Interaction with its Target Sequences Cell 40 795 803 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell
10. Reverse primer 7 sequences See page 4 for sequences and location of primer binding sites For your convenience Invitrogen offers the T7 Promoter Primer page vi as well as custom primer services For more information on custom primer services vist our web site at www invitrogen com or contact Technical Support see page 10 Preparing a Once you have identified the correct clone purify the colony and make a glycerol stock Glycerol Stock for long term storage You should keep a DNA stock of your plasmid at 20 C e Streak the original colony out on an LB plate containing 50 ug ml ampicillin Incubate the plate at 37 C overnight e Isolate a single colony and inoculate into 1 2 ml of LB containing 50 pg ml ampicillin e Grow the culture to mid log phase ODs 0 5 0 7 e Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial e Store at 80 C Transfection Introduction NN io 7 D RE NS gt I Important Plasmid Preparation Positive Control Once you have cloned your gene of interest into p DNA 5 FRT and have TM prepared clean plasmid preparations of your pcDNA 5 FRT construct and pOG44 you are ready to cotransfect the plasmids into your mammalian Flp In host cell line to generate your stable Flp In expression cell line We recommend that you include the peDNA 5 FRT CAT positive control vector and a mock transfection negative control to evaluate your results
11. ation e Hygromycin resistance gene for selection of stable cell lines Gritz amp Davies 1983 The control plasmid peDNA 5 FRT CAT is included for use as a positive control for transfection and expression in the Flp In host cell line of choice TM For more information about the Flp In System the pOG44 plasmid and generation of the Flp In host cell line refer to the Flp In System manual The Flp In System manual is supplied with the Flp In Complete or Core Systems but is also available for downloading from our Web site www invitrogen com or by contacting Technical Support see page 10 TM The pcDNA 5 FRT vector contains a single FRT site immediately upstream of the hygromycin resistance gene for Flp recombinase mediated integration and selection of the pcDNA 5 FRT plasmid following cotransfection of the vector with pOG44 into Flp In mammalian host cells The FRT site serves as both the recognition and cleavage site for the Flp recombinase and allows recombination to occur immediately adjacent to the hygromycin resistance gene The Flp recombinase is expressed from the pOG44 plasmid For more information about the FRT site and recombination see the next page For more information about pOG44 refer to the Flp In System manual The hygromycin resistance gene in pcCDNA 5 FRT lacks a promoter and an ATG initiation codon therefore transfection of the pcDNA 5 FRT plasmid alone into mam
12. gen com cofa and is searchable by product lot number which is printed on each box Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Invitrogen assumes no respons
13. ibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Limited Label License No 64 Flp In System Use of the Flp In System and its components System is covered under a number of different licenses including those detailed below Life Technologies Corporation Life Technologies has a license to sell the Flp In System and its components System to scientists for research purposes only under the terms described below Use of the System for any Commercial Purpose as defined below requires the user to obtain commercial licenses as detailed below Before using the System please read the terms and conditions set forth below Your use of the System shall constitute acknowledgment and acceptance of these terms and conditions If you do not wish to use the System pursuant to these terms and conditions please contact Life Technologies Technical Services within 10 days to return the unused and unopened System for a full refund Otherwise please complete the User Registration Card and return it to Life Technologies Life Technologies grants you a non exclusive license to use the enclosed System for research purposes only The System is being
14. invitrogen pcDNA 5 FRT Expression vector designed for use with the Fip In System Catalog no V6010 20 Version F 10 November 2010 25 0307 Table of Contents Kit Contents aiid Stora AAA edit tett ale an HERE Pan v Accessory Products seser ra atado es oE derne dee de Ada vi O een 1 DU dd 1 A A 3 Cloning into pein Ay RS 3 Transfection ironia atodos 5 Appendix eia eea ae aa EEE ETEA EE E E A EA E E E E E 7 Map ot PNAS RIV Re 7 Features of PNAS ERT Vehus NARA 8 PCNA S FRT CAT Nedover ii 9 iS O 10 Purchaser Notificationwe ii iia 11 Referencesi NN 12 111 iv Kit Contents and Storage Shipping Storage The pcDNA 5 FRT Vectors are shipped on wet ice Upon receipt store at 20 C Kit Contents The following vectors are provided with pcDNA 5 FRT Vector Quantity Contents pcDNA 5 FRT 20 ug 40 ul of 0 5 ug ul pcDNA 5 FRT in 10 mM Tris HCI 1 mM EDTA pH 8 0 pcDNA 5 FRT CAT 20 ug 40 ul of 0 5 ug pl pcDNA 5 FRT CAT in 10 mM Tris HCI 1 mM EDTA pH 8 0 Accessory Products Accessory Additional products available from Invitrogen are listed below For more information Products visit our website at www invitrogen com or contact Technical Support page 10 Product Amount Catalog no T7 Promoter Primer 2 ug lyophilized N560 02 Zeocin 1g R250 01 58 R250 05 Hygromycin 1g R220 05 pFRT lacZeo 20 ug suspe
15. malian host cells will not confer hygromycin resistance to the cells The SV40 promoter and ATG initiation codon required for expression of the hygromycin resistance gene are integrated into the genome in the Flp In host cell line and are only brought into the correct proximity and frame with the hygromycin resistance gene through Flp recombinase mediated integration of pcDNA 5 FRT at the FRT site For more information about the generation of the Flp In host cell line and details of the Flp In System refer to the Flp In System manual Continued on next page Overview Continued Flp Recombinase Mediated DNA Recombination FRT Site Experimental Outline TM In the Flp In System integration of your pcDNA 5 FRT expression construct into the genome occurs via Flp recombinase mediated intermolecular DNA recombination The hallmarks of Flp mediated recombination are listed below e Recombination occurs between specific FRT sites see below on the interacting DNA molecules e Recombination is conservative and requires no DNA synthesis the FRT sites are preserved following recombination and there is minimal opportunity for introduction of mutations at the recombination site e Strand exchange requires only the small 34 bp minimal FRT site see below For more information about the Flp recombinase and conservative site specific recombination refer to published reviews Craig 1988 Sauer 1994 The
16. nalysis fluorometric assay or radioactive assay Ausubel et al 1994 Neumann et al 1987 For Western blot analysis you may use CAT Antiserum available from Invitrogen for detection Other commercial kits to assay for CAT protein are available TM The pcDNA 5 FRT vector contains the hygromycin resistance gene Gritz amp Davies 1983 for selection of transfectants with the antibiotic hygromycin B Palmer et al 1987 When added to cultured mammalian cells hygromycin B acts as an aminocyclitol to inhibit protein synthesis Hygromycin B liquid is supplied with the Flp In Complete System and is also available separately from Invitrogen For instructions to handle and store hygromycin B refer to the Flp In System manual TM Before generating a stable cell line expressing your protein of interest Flp In expression cell line we recommend that you generate a kill curve to determine the minimum concentration of hygromycin required to kill your untransfected Flp In host cell line Generally concentrations between 10 and 400 pg ml hygromycin are required for selection of most mammalian cell lines General TM guidelines for performing a kill curve are provided in the Flp In System manual TM Refer to the Flp In System manual for detailed guidelines and instructions to cotransfect your pcDNA 5 FRT construct and pOG44 into the Flp In host cell line to generate stable Flp In expression cell lines
17. nded as 40 ul of 0 5 ug ul pFRT lacZeo V6015 20 in 10 mM Tris HCI 1 mM EDTA pH 8 0 pFRT lacZeo2 20 ug suspended as 40 ul of 0 5 ug ul pFRT V6022 20 lacZeo2 in 10 mM Tris HCI 1 mM EDTA pH 8 0 pOG44 20 ug suspended as 40 ul of 0 5 ug ul pOG44 in V6005 20 10 mM Tris HC1 1 mM EDTA pH 8 0 One Shot Kit 10 reactions C4040 10 TOP10 Chemically Competent Cells 20 reactions C4040 03 40 reactions C4040 06 One Shot Kit 10 reactions C4040 50 TOP10 Electrocompetent Cells 20 reactions C4040 52 Flp In Additional Flp In expression vectors are available from Invitrogen For more Expression information about the features of each vector visit our web site at Vectors www invitrogen com or contact Technical Support page 10 Product Amount Catalog no pcDNA 5 FRT V5 His TOPO TA Expression 1 kit K6020 01 Kit pSecTag FRT V5 His TOPO TA Expression Kit 1 kit K6025 01 pEF5 FRT V5 Directional TOPO Expression Kit 1 kit K6035 01 pEF5 FRT V5 DEST Gateway Vector Pack 6 ug supplied as 40 ul of 150ng ul vector V6020 20 in 10 mM Tris HCl 1 mM EDTA pH 8 0 Flp In Host Cell For your convenience Invitrogen has available several mammalian Flp In host Lines cell lines that stably express the lacZ Zeocin fusion gene from pFRT lacZeo or pFRT lacZeo2 Each cell line contains a single integrated FRT site as confirmed by Southern blot analysis The cell lines should be maintained in medium containing Zeocin For m
18. ne Ampicillin bla resistance gene B lactamase Allows selection of transformants in E coli pcDNA 5 FRT CAT Vector Description pcDNA 5 FRT CAT is a 5858 bp control vector containing the gene for chloramphenicol acetyl transferase CAT This vector was constructed by ligating a 0 7 kb Xho I Apa I fragment containing the CAT gene into the Xho I Apa I site of pcDNA 5 FRT The CAT protein expressed from pcDNA 5 FRT CAT is approximately 32 kDa in size Map of The figure below summarizes the features of the pcDNA 5 FRT CAT vector pcDNA S5 FRT The complete nucleotide sequence for peDNA 5 FRT CAT is available for CAT downloading from our web site at www invitrogen com or from Technical Support next page co Z gt S BREERSK ZO EE SERHSHSCHIHSE Q 3122840025 ML lt lt Comments for pcDNAS FRT CAT 5858 nucleotides CMV promoter bases 232 819 CMV forward priming site bases 769 789 T7 promoter priming site bases 863 882 Chloramphenicol acetyl transferase CAT gene bases 1026 1685 BGH reverse priming site bases 1810 1827 BGH polyadenylation signal bases 1816 2040 FRT site bases 2324 2371 Hygromycin resistance gene no ATG bases 2379 3399 SV40 early polyadenylation signal bases 3531 3661 pUC origin bases 4044 4717 complementary strand bla promoter bases 5723 5821 complementary strand Ampicillin b a resistance gene bases 4862 5722 complementary strand PUC ori
19. nefit Human cytomegalovirus CMV immediate early promoter Allows high level expression of your gene of interest Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 CMV Forward priming site Allows sequencing in the sense orientation T7 promoter priming site Allows in vitro transcription in the sense orientation and sequencing through the insert Multiple cloning site Allows insertion of your gene of interest pBGH Reverse priming site Allows sequencing of the non coding strand Bovine growth hormone BGH polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Goodwin amp Rottman 1992 Flp Recombination Target FRT site Encodes a 34 bp 14 bp of non essential sequence that serves as the binding and cleavage site for Flp recombinase Gronostajski amp Sadowski 1985 Jayaram 1985 Senecoff et al 1985 Hygromycin resistance gene no ATG Allows selection of stable transfectants in mammalian cells Gritz amp Davies 1983 when brought in frame with a promoter and an ATG initiation codon through Flp recombinase mediated recombination via the FRT site SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin Allows high copy number replication and growth in E coli bla promoter Allows expression of the ampicillin bla resistance ge
20. ore information visit our web site at www invitrogen com or contact Technical Support page 10 Cell Line Amount Catalog no Flp In 293 3 x 10 cells frozen R750 07 Flp In CV 1 3 x 10 cells frozen R752 07 Flp In CHO 3 x 10 cells frozen R758 07 Flp In BHK 3 x 10 cells frozen R760 07 Flp In 3T3 3 x 10 cells frozen R761 07 Flp In Jurkat 3 x 10 cells frozen R762 07 vi Overview Introduction A Note About pcDNA 5 FRT Important Introduction TM TM pcDNA 5 FRT is a 5 1 kb expression vector designed for use with the Flp In System Catalog nos K6010 01 and K6010 02 available from Invitrogen When cotransfected with the pOG44 Flp recombinase expression plasmid into a Flp In mammalian host cell line the peDNA 5 FRT vector containing the gene of interest is integrated in a Flp recombinase dependent manner into the genome The vector contains the following elements TM e The human cytomegalovirus CMV immediate early enhancer promoter for high level constitutive expression of the gene of interest in a wide range of mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 e Multiple cloning site with 10 unique restriction sites to facilitate cloning the gene of interest e FLP Recombination Target FRT site for Flp recombinase mediated integration of the vector into the Flp In host cell line see next page for more inform
21. ropagate and maintain the pcDNA 5 FRT and pcDNA 5 FRT CAT vectors we recommend using 10 ng of the vector to transform a recA endA E coli strain like TOP10 DH5a JM109 or equivalent Select transformants on LB agar plates containing 50 100 pg ml ampicillin Be sure to prepare a glycerol stock of each plasmid for long term storage see page 4 Your insert should contain a Kozak consensus sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1990 Kozak 1991 An example of a Kozak consensus sequence is provided below Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring sequence with strong consensus Replacing one of the two bases at these positions provides moderate consensus while having neither results in weak consensus The ATG initiation codon is shown underlined G A NNATGG Your insert must also contain a stop codon for proper termination of your gene Continued on next page Cloning into pcDNA 5 FRT Continued Multiple Cloning Below is the multiple cloning site for pcDNA 5 FRT Restriction sites are labeled to Site of indicate the cleavage site The multiple cloning site has been confirmed by sequencing pcDNA 5 FRT and functional testing The complete sequence of pcDNA 5 FRT is available for downloading from our web site at www invitrogen com or from Technical Support page 10 For a map
22. rt see page 10 Plasmid DNA for transfection into eukaryotic cells must be very clean and free from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the S N A P MiniPrep Kit 10 15 ug DNA Catalog no K1900 01 the S N A P MidiPrep Kit 10 200 ug DNA Catalog no K1910 01 or CsCl gradient centrifugation TM pcDNA 5 FRT CAT is provided as a positive control vector for mammalian cell transfection and expression see page 9 and may be used to assay for recombinant protein expression levels in your Flp In expression cell line Cotransfection of the positive control vector and pOG44 into your Flp In host cell line allows you to generate a stable cell line expressing chloramphenicol acetyl transferase CAT at the same genomic locus as your gene of interest If you have several different Flp In host cell lines you may use the pcDNA 5 FRT CAT control vector to compare protein expression levels between the various cell lines Continued on next page Transfection Assay for CAT Protein Hygromycin B Determination of Hygromycin Sensitivity Generation of Flp In Expression Cell Lines Continued The CAT protein expressed from the peDNA 5 FRT CAT control plasmid is approximately 32 kDa in size You may assay for CAT expression by ELISA assay Western blot a
23. transferred to you in furtherance of and reliance on such license You may not use the System or the materials contained therein for any Commercial Purpose without licenses for such purpose Commercial Purpose includes any use of the System or Expression Products in a Commercial Product any use of the System or Expression Products in the manufacture of a Commercial Product any sale of the System or Expression Products any use of the System or Expression Products to facilitate or advance research or development of a Commercial Product and any use of the System or Expression Products to facilitate or advance any research or development program the results of which will be applied to the development of a Commercial Product Expression Products means products expressed with the System or with the use of any vectors or host strains in the System Commercial Product means any product intended for sale or commercial use Access to the System must be limited solely to those officers employees and students of your entity who need access to perform the aforementioned research Each such officer employee and student must be informed of these terms and conditions and agree in writing to be bound by same You may not distribute the System or the vectors or host strains contained in it to others You may not transfer modified altered or original material from the System to a third party without written notification to and written approval from
Download Pdf Manuals
Related Search
Related Contents
VPCZ13CGX/S AT-UWC-APL ユーザーマニュアル Copyright © All rights reserved.
Failed to retrieve file