SVARAP and aSVARAP - IHU Méditerranée Infection
Contents
1. SVARAP analysis of variability per site and per sliding window of 25 nucleotides 80 0 z Dm 60 E 60 50 s 82 40 Q 8 w 5n E 10 10 3 o 0 35 Number of sequences harbouring a nucleotide at a given position Y 400 z 3 zo L7 0 288 E 25 Mean variability per sliding window of 25 nucleotides RRE TT Fi 5 2 E 20 9 o 5 2 S 15 4 22s S 4 Hi 3 5 Es L1 pre 2 2751 2781 2791 Corynebacterium species variability in rpoB Forward primer ee Defined positions 2736 2737 2738 2739 2740 2741 2742 2743 2744 2745 2746 2747 2748 2749 2750 2751 2752 2753 2754 2155 2756 2757 2758 27 Number of sequences 58 58 58 5 5 5 5i 5 58 56 58 58 58 5B 58 58 Consensus 5 0 0 pwopoTo To o o o w 2 0 0 0 0 0 Co 0 5 o6 9 9 o o 9 0 00 0 0 0 0 0 0 0 0 0 Aie dedinc varices f 0 2 0 0 0 0 0 o 0 0 1 0 0 2 0 0 f 0 0 2 1 0 Variabil ity 14 0 0 5 0 D 0 0 0 0 0 0 26 0 0 26 0 0 2 0 0 62 2 0 Corynebacterium species variability in rpoB WA 4 sn ORE AM m MEAM MR OAM AT Se m ClustalX v1 8 3151 3161 3171 3181 3191 3201 3211 3221 3231 3241 SVARAP analysis of variability per site and per sliding window of 25 nucleotides Reverse primer so2uenbos jo 1equinN Variability 96 es8ssssss aps uaAi6 P ye apyoajanu e Buynoqiey Variability seo2uenbos jo uoruodojd 10 i 40 0 3211 3221 32. attataatacagaacaaatattagaca s teegagetcttggatactcttcagalc tecgagctcttggatactcttcagac ttegagcattgqggtattcgacaga c g tatgagtactgaagaaattataaaa DE gataccctgatgcctca gaatggttacaacttcgaagactccat gatactctgatgccaca gaacggttacaacttcgaagactccat gatgegatcacgecaca gaacgget Loco bb noe ecm oe cet gat geagtgacaccaca gaat que Link te MAIN PAGE gacatgettatgectca gaatggatataactttgaagattcaat ctcagatacgttgactecagg gtatggatacaactttgaggatgegat ctcagat acgttgactccagg gtatggatacaactttgaggatgcqat ttccgatacgttaactcctgg gtatggqtacaacttegaagatgegat gataccgtaatgectca gaacggttataattttgaagattccat g tatgagtactgaagaaattataaaa gatacegtaatgectca gaacggttataattttgaagattcaat ggtataaaaaacaagatattattaagt tcttgataaagtaatgcct ta gaatggttataactatgaggatgctat ggtttgatacgagagaaaaaataatag aggaagtttttaatctaaagcctca gaatggatttaattatgaggatgctat actacgaaacgegtgagcagatcateg aggaaacggaaacgatcaagccgca gaacggttacaactacgaggatgccat gtttctcaggtgatgatgaaatctttg ggacaatgaagtcttgacaccaca ggaaggttacaacttcgaggatgccegt gtttctcaggtgatgat gaaattgttg agacaacgatgtgttaacaccaca ggaaggttataactttgaggatgccgt gctttggttccgatcaagaaattattg agatatgactacaattacaccgca ggatggttataactacgaggatgegat gtttctcaagtgaccaagaaattgttg agatactgagtctatcacacctca ggacggttacaactatgaggatgcegt Sgttttac tgaagaaagcatgtaca agaaatctctagaatcactccaaa aaatggatataactatgaagatgctat E Analysis of variability Go back to the main page in the Microsoft Excel File Sheet Paste t
3. 385 Marseille Cedex 05 Phone number 33 0 4 91 38 55 17 Downloads SVARAP and aSVARAP http ifr48 timone univ mrs fr portail2 index php option com_content amp task view amp id 50 telechargements An example of use for SVARAP http ifr48 timone univ mrs fr files S V ARAP ExampleUseSVARAP pdf
4. Excel sheet arrows by clicking on the sheet name index You can check that the GDE alignment has been well formatted in the Microsoft Excel amp Sheet Sep1000 Check that In column Identification only sequence names are present check that the number of studied sequences is right Incolumns Nucleotides only sequences are present If not OK check the GDE alignment then paste again Identification Nucleotides 1 1000 gcatggacggcgaagaaattctgtcca geatggatggcgqaagaaatectgtcga gceatgacgeecgaatcgatectegege getacaccaacgaagagatectgtecg gctacagcacggaagagatectcaacq getacaacaatgagcaaatcttggata ggtattctcecgcacaaattctegegg gttatgataccgagcaaatcctegata Nucleotides 1000 2000 geatgqgacgqgcqaagqaaattctgtcca gectgacgecggaacagatcctggegc Nucleotides 2000 3000 Nucleotides 3000 4000 gatacggtcatgeegca gaacggctacaactacgaagattcgat f nn gatacggtcatgecgca gaacgyctacaactacgaagattcgat gacaccgtgatgcegca gaatggetacaactacgaagactegat nm gaaaacctgatgecgca gaacggyctacaacttcgaagactcgat m gaaaacctgatgeegca gaacggetacaacttcgaggattcegat gacaacctgatgccgca gaacggetacaactacgaagactegat DE gaaggectgatgeegca gaacggcttcaacttcqaagactccat gaaaacttgatgccgca gaacggttacaactatgaagactegat mm gaaaatcttatgccaca gaacggacttaatttcgaggattctat Gaaaacctcatgectca gaacggatataacttegaagattecat sjactacaccacagagcagatcctcgacc atttcaccactgcacagatcttggatc getacaccactgaagaaatcttaaact attacaccaccgaacaaattttagata
5. resisting bacteria recently reported to colonize hospital water supplies Appl Environ Microbiol 2003 69 11 6740 9 SVARAP Sequence VARiability Analysis Program An example of application rpoB gene sequencing for identification of Corynebacterium species Khamis A Raoult D amp La Scola B 2004 J Clin Microbiol 42 3925 31 Clustal X alignment Y E azur ru HE LM AMEN UEM LANE UM HED Ei Multiple Alignment Mode Font Size 10 wal 15260065 gt amp 3 amp n239 gn gil 46360995 ob ruler 700 730 740 750 760 VA AY AAA NAR SN VAM WR ANA I Dn gt File Ci Seqrpr Bl eryneb ein forded EL OT 2 ghost adn eer eur soo mas s Corynebacterium species variability in rpoB One shot vizualisation of nucleotide variability nonsliding window of 50 nucleotides SE Microsoft Excel SVARAP 4000 v 1 1 10 old TE the caro aficho poeton romat Quis Dom es rentie 2 Acct nla x IYTt 200 Q res ma IRI eon end tmi lH nnm ri ARA me STD E Glick here before prinling allthe following figures a w i 430 nucleotides 3 single run sequencing 2 2 F Highest variability 3 Ee _ a A 3 e 1 2 zz 7 mJ E n V i 3 Y S 3 Lowest variability 2 PRR FEERESEER EER ER EEEL RR EE ER EL EER REE ER ER Positions windows of 80 nucleotides H 4 gt if Fig par ske 2 Z Fig 1 2000 wind
6. the ClustalX alignment for the studied set of sequences The number of distinct variations corresponds to the number of different nucleotides observed at a given site Both absolute numbers and proportions of nucleotides harbored at a given site are given VIWIXJY Z AA AB 105 Positions D EN ER 1 2 106 Defined positions 1 2 13 14 15 16 17 18 19 20 21 22 23 24 1 109 Number of sequences 35 35 35 35 35 35 35 35 35 35 35 35 110 Consensus 111 Absolute values 6 17 18 19 20 21 22 23 24 5 36 35 35 35 36 35 o o2 Al 2 1 113 e0 1 0 90 a Link to MAIN PAGE oto G alwle 3 N sain h a N J Rj OC oa N C fan N mn mn N n N w N R n Sols 3 0 0 6 9 1 5 13B At oF aistisct variations 4 438 Variability D o r T oO 3 T e m eq eo N oO T 139 Positions 140 Defined positions o NIN no w wl N Id 4 M Data window 50 Data 50 NOT IN USE ig 1 4000 window 50 Consensus Consensus 2 Ax A x 2 All figures or tables are printable an eo q i eo cA oo 2 Var 1 200 War 201 400 4 gt An example of the use of SVARAP Investigation of the usefulness of rpoB sequencing for differentiation and identification of bacteria belonging to the genera Afipia and Bosea which are amoeba
7. 231 3241 3151 3161 3171 3181 3191 3201 Corynebacterium species variability in rpoB Reverse primer Defined positions 3167 3168 3169 3170 3171 3172 3173 3174 3175 3476 3177 3178 3179 3180 3181 3182 3183 3184 3185 3186 3187 3188 3189 31908 Number of sequences 58 53 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 Consensus 0 6 D 58 0 0 D 0 0 56 43 57 0 0 58 D 51 0 015 r2 s ojojo ojo jz se se 2 oc o sjojssjo ss o o o 0 EEE ice hones sas io no AD OF BEM variar o 0 Poet eof ey ope ee pete ete 9 400 EA 0 0 0 Variability 3 850258 9 9 4 1249 3 768 aE SVARAP download Philippe Colson Unit des Rickettsies CNRS UMR 6020 IFR 48 Facult de M decine Universit de la M diterran e Marseille France e http ifr free fr recherche jeu_cadre jeu_rickettsie html Hypertext link T l chargement aSVARAP user manual The study of variability can also concern amino acid sequences amino acids 1 to 1000 The principle and use are the same as for SVARAP References for published studies using SVARAP or aSVARAP 1 Ad kambi T Colson P Drancourt M RpoB based identification of nonpigmented and late pigmenting rapidly growing mycobacteria J Clin Microbiol 2003 41 12 5699 5708 2 Colson P M Henry C Tourres D Lozachmeur H Gallais J A Gastaut J Moreau and C Tamalet 2004 Polymorphism and drug selected mu
8. 4 Pr0046919 15 Pr0046920 CLUSTALW sequence numbers OFF v Pr0046921 fF SS L Pr0046922 18 Pr0046923 Output order ALIGNED Pr0046924 ES Parameter output OFF koi 4 4 gt File CASeqProt txt appended Sa Formatting the GDE alignment using Microsoft Word Like for most of sequences analysis it is necessary to format sequences Open the GDE file using a software that is able to read text format for instance note pad Copy then paste the GDE alignment in a Microsoft Word file then 1 Delete all paragraph jumps For instance replace 57337355 SS sSS5 gt tctgcggcagtgaaagagttcttcggttccagccagctgt ctcagttcatggaccagaacaacccgctgtctgagatcacgcacaaacgt cgtatctccgcactcggcccaggcggtctgacccgtgaacgcgcaggctt 157331357 SSeS SSeS SSeS ee eee aaacgt cgtatctccgcactcggcccaggcggtctgacccgtgaacgcgcaggctt 57337355 tctgcggcagtgaaagagttcttcggttccagccagctgtctcagttcatggaccagaacaacccgctg tctgagatcacgcacaaacgtcgtatctccgcactcggcccaggcggtctgacccgtgaacgcgcaggc tt 57337357 aaacgtcgtatctccgcactcggcccaggcggtctgacccgtgaacgcgcaggctt 2 Replace the by another kind that does not lead to paragraph jump For instance replace 157337355 tctgcggcagtgaaagagttcttcggttccagccagctgtctcagttcatggaccagaacaacccgctg tctgagatcacgcacaaacgtcgtatctccgcactcggcccaggcggtctgacccgtgaacgcgcaggc CEPIT 3939 ans Ss Sse Sa SSeS Ss SaaS Sa SS eS Se Sas Sasa S aaacgtcgtatctccgcactcggcccaggcggtct
9. SVARAP and aSVARAP simple tools for quantitative analysis of nucleotide SVARAP user manual SVARAP and aSVARAP are free and downloadable at URL http ifr48 timone univ mrs ft portail2 index php option com_content amp task view amp id 50 telechargements To get an alignment in GDE format using clustal X v1 83 Clustal X v1 83 is free and downloadable at URL ftp igbmc u strasbg fr pub Clustal X Open ClustalX 1 8 and append sequences in FASTA format Select tab Alignment then output Format Options Select GDE format Start alignment Do complete alignment Z ClustalX 1 8 BAX File Edit Alignment Trees Colors Quality Help Do Complete Alignment Multipl Produce Guide Tree Only x Do Alignment from Guide Tree l Realign Selected Sequences Realign Selected Residue Range Alignment Parameters Save Log File Output Format Options Pr0046919 Pr0046920 Pr0046921 Pr0046922 Pr0046923 Pr0046924 ruler BREE RRR IH H MH D 00 0 O1 C HOw File CASeqProt txt appended Multiple Alignment Mode gt Font Size 10 Output Format Options 1 Pr0046458 Pr0046459 Pr0046460 CLOSE Pr0046461 Pr0046462 Output Files RUE EE Iv CLUSTAL format NBRF PIR format r Pr0046469 GCG MSF format PHYLIP format Pr0046588 mg 10 Pr0046890 v GDE format 11 Pr0046891 1 Pr0046892 GDE output case Lower v 1 Pr0046893 P 1
10. gacccgtgaacgcgcaggctt dF533J4355c45 x tctgcggcagtgaaagagttcttcggttccagccagctgtctcagttcat ggaccagaacaacccgctgtctgagatcacgcacaaacgtcgtatctccgcactcggcccaggcggtct gacccgtgaacgegcaggcttqt5 13372957 vwd led ERE SERA EE EMEGH YS ES cgcactcggcccaggcggtctgacccgtgaacgcgcaggctt 3 Add a paragraph jump before and after each sequence name For instance replace 5739 4355 E ERA tctgcggcagtgaaagagttcttcggttccagccagctgtctcagttcat ggaccagaacaacccgctgtctgagatcacgcacaaacgtcgtatctccgcactcggcccaggcggtct gaccegtgdacgegcaggcttts7394295 7 9 1 abe ed Nbre E Re pcena se tuere cgcactcggcccaggcggtctgacccgtgaacgcgcaggctt 157337355 P DEAE tctgcggcagtgaaagagttcttcggttccagccagctgtctcagttcatggaccagaa caacccgctgtctgagatcacgcacaaacgtcgtatctccgcactcggcccaggcggtctgacccgtga acgcgcaggctt 157337357 acgcgcaggctt The Microsoft word file is now formatted and can be copied then pasted into SVARAP Pasting the GDE alignment in SVARAP in the Microsoft Excel File Sheet Paste the alignment Step 1 When using this program click on column B then key lt Suppr gt to delete prior work Step 2 Paste in a same cell white space cell B2 the GDE alignment formatted using Microsoft Word emblAE014424JAE0 14424 Study of nucleotidic positions 1 to 4000 o Paste here cell B2 your alignement in GDE format Hypertext Links to final analysis Navigate T Advance sheet by sheet by using the t Go directly to a Microsoft
11. he alignment by using any of the boxes called Link to main page hypertext link Then select one of the four hypertext links to analysis of variability 1 Link to analysis of variability by nonsliding windows of 50 nucleotides Click here before printing all the following figures Mean variability per nonsliding windows of 50 nucleotides Fig 1 4000 window 50 2 Link to site by site analysis of variability Nucievvides 2001 iv 4000 The green line represents the absolute number of sequences analysed in the studied set of sequences The blue rods represent variability at each site in the alignment of sequences Nucleotide positions are noted in abcissa 3 Link to analysis of variability by sliding window of 25 nucleotides 4 Link to detailed analysis of variability per 200 nucleotides click on the Microsoft Excel amp sheet name index These tables contain the main part of analysis of variability the level of variability correspond to the proportion of sequences for which at a given nucleotidic site the nucleotide differ compared with the nucleotide the most frequently found in the studied set of sequences Positions that are defined correspond to those defined in
12. ow 50 2 Data window 50 Data window 50 2 Fig 1 4000 window 50 4 Consens br Jawa IV dme Na ox FAFRORAE ESRI or VATAD INR in fos Excol D 4000 v 1 1 E ader cen i heat remsen remet Ome Condes Fenda 7 Arshat e 9 A rre mie PA Ci Comments and settore leues Test KARAR mH OO C Nucleotides 1 to 2000 244 244 2461 um 248 2491 Ti i hl bail LRO Jon dial Lu nume 341 3151 3481 71 3184 3191 3201 3231 le Pig Nac 2001 3000 n fiuc 3001 4000 s Table siding wnd 25 Graphe aiding wmd 35 Tues E pr me R beses nn ss8sssa 58288 Bower Edbon Affichage neerton Formst Que Donn es Fen tre 2 Acrogst le lor SQ reme Mur PA Conme and setrgrenieuremirest Seige mbar ll i uL 3 iudi D TI ignes iel alo MZ hue 2001 3000 Z Nur 3001 4000 Tabl sking wnd 25 Graphe ating wnd 25 2 Tig per ste No per wta 2 ris MARRIDA Corynebacterium species variability in rpoB Vizualisation of nucleotide site by site variability primers hibridization regions Variability per site Number of zi harbouring a nucleotide at a given position 2754 ERR L primer 3151 3161 3171 3181 3191 3201 3211 3221 Ll Reverse primer S Corynebacterium species variability in rpoB ClustalX v1 8 2701 2711 2721 2731 2741 2751 2761 2771 2781 2791
13. tations in the protease gene of human immunodeficiency virus type 2 from patients living in Southern France J Clin Microbiol 2004 42 2 570 577 3 Colson P Henry M Tivoli N Gallais H Gastaut JA Moreau J Tamalet C Polymorphism and drug selected mutations in the reverse transcriptase gene of HIV 2 from patients living in southeastern France J Med Virol 2005 75 381 390 4 Khamis A Colson P Raoult D La Scola B Usefulness of rpoB gene sequencing for identification of Afipia and Bosea species including a strategy for the choice of discriminative partial sequences Appl Environ Microbiol 2003 69 11 6740 9 5 Khamis A Raoult D La Scola B rpoB gene sequencing for identification of Corynebacterium species J Clin Microbiol 2005 Apr 43 4 1934 6 Other references Thompson J D T J Gibson F Plewniak F Jeanmougin and D G Higgins 1997 The CLUSTAL X windows interface flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25 4876 4882 Contact Philippe Colson F d ration Hospitali re de Microbiologie Clinique et d Hygi ne CHRU Timone Laboratoire de Virologie 264 rue Saint Pierre 13385 Marseille Cedex 05 Phone number 33 0 4 91 38 55 19 Fax number 33 0 4 91 38 55 18 E mail address Philippe Colson ap hm fr Unit des Rickettsies CNRS UMR 6020 IFR48 Facult de M decine Universit de la M diterran e 27 boulevard Jean Moulin 13
Download Pdf Manuals
Related Search