Home

User Manual - Hitachi Solutions America

1. a 157 9 03 COPY Mare T ETT 158 9 6 4 Hide Specific DLE een 158 Chapt er LU OU To 9 iem 159 10 1 1 Print fron the Project IB O Wind 161 OA Print trom the Contis Ve Wer ea ses 161 Contents vii 10 1 3 Print the Trace View TOZI rol A es ee NR ee 165 10 2 2 C0py from the Conto Vie Wer naar arena ikea 166 10 23 Cops Tromi the LACS e dS LC ee Au Cs ol 167 e LOO Phred Phrap Option Installation and Default Settings Phred Phrap Option Installation and Default Settings Operating Platform DNASIS MAX Phred Phrap Option Ver2 0 operates in the following environment Hardware CPU Pentium or higher Pentium 4 1 0 GHz or higher recommended RAM 128 MB or more 1 GB or more recommended Hard Disk 150 MB or more additional capacity will be required for data CD ROM Drive Required for installation Video card amp Display 1024 x 768 dots 256 colors or more Operating Systems Windows 2000 Windows XP This program will not function on Windows 95 98 Me NT Note DNASIS MAX V2 5 must be installed on the computer before DNASIS MAX Contig Manager Ver2 0 can be installed and used The key codes specific to DNASIS MAX Contig Manager Ver2 0 are also required Installation This section explains how to install DNASIS MAX Phred Phrap Option Ver2 0 The user must logon to the system with administrator rights in order to install the DNASIS MAX Phred Phrap Option Ver2 0 DNASIS MAX needs DNASIS MAX V2 5
2. EEG BEE BO BER BON BER Corb dooce gtggisitrt tigetietigge eqtttteact ggrtgrrsgg ctegtagcct gtirrsggri CIC Cortar A nn nn nn M gsatrqpocoro sgoccosqsrq gqe qqogsetq qrqqoccgr TCTqqcogtis rqr qrorqas m L im IE pa ed a lo mm don o ee a o a o a dl do ee rirmararar sasrtigesrcgg reiggigras sacatcaegg getccregct rsgcagegeg nr i i iii LJ mrrrsgaiga eeerrelsege rtrtgatgrt grtggirsg trsginmasga irttrsgrctrc H Wale Ej E clggcrtggus sactccaase tfgecelgscc gucgelasgg nBcgregcar tcagtacc g ti ul mp 48 eal aH am nS FR RR RR ER EN ER BR SR GR BR AAN raagsgrigas egaccalgel ggegeagsaat gesagatigseg igssgasrrg igicyggrer E ru SABER AERE NER EEES iret EE HEKE i i i 1 LL i 1 ne 4 tacececqca ACTAS ACCC miqugaceceg 4995951009 eine _ hey l a L gd DNASIS Start Up window Chapter 1 Contig Manager Tutorial 29 3 Try an ORF search at this point by clicking ORF in the DNA Search group And click Execute in the Analysis dialog The analysis will be performed and results similar to those shown below will appear ORF search results 4 These results show that errors still exist in the contig sequence 5 As shown by the contig s quality value the sequence accuracy between values close to 1150bp to values close to 2050bp are relatively low The next step is to design a primer for increasing sequence accuracy by perfor
3. Leneth af Fragments IM Low Quality BPs Comment Cancel 4 Type the new name for the contig in the textbox to the right of the m icon 5 Press the Enter key or click OK The contig will be renamed Attach Comments to Contigs 1 Right click the contig to attach a comment 2 Select Property from the popup menu The Property dialog will appear Folder Length of Fragments Low Quality BPs Comment P Po Cancel 3 Type a comment in the Comment box Up to 255 characters can be used 4 Press the Enter key or click OK 3 14 3 Operations for Fragments Import Fragments It 1s possible to import fragment data from a window to a given folder in Contig Manager 91 l Selecta fragment file from the window to import More than one file can be imported simultaneously 2 Drag and drop the file s to the destination folder in Contig Manager Be sure to drop when the mouse pointer 1s over the destination folder 92 Chapter 3 Project Window 3 The Import Summary dialog will display a list of imported data skipped data and import error data 4 Check the contents of the dialog and click OK Move Fragments Select a fragment displayed in List View and drop it in the destination folder in Tree View This will move the dropped fragment to the corresponding folder This operation is typical of Windows based programs such as the Windows Explorer Na
4. Displays the number of data processed for import Displays a list of the imported data Also displays the names and sequence length The data can be sorted by clicking each column header Specifies files to skip when trying to import data with the same name as data already present The data can be sorted by clicking each column header Displays data failed to import The data can be sorted by clicking each column header Displays the number of imported data Displays the number of data overwritten on importing Closes the dialog 54 Chapter 2 Window Descriptions 2 2 11 Check Fragment dialog a Sell mesi do der bontig EN EN a Fe tl Fats ZEN Pattern 2 Patiam 7 a Pate s aaron ud Pate Pat Pattern 5 Patient em Ex Fraqremis Hara Larur H Tread L Trimrsad _ Loa Gua ite b ane Camna Item Select target folder contig Pattern Find Results Fragments Name Length Trimmed Length Trimmed Vector Low Quality bps Connected Comment Description Selects the search target folder or contig Input the fragment name for search Up to ten fragments can be searched and are available as wild cards any string any one character Lists the number of fragments found with the search string Displays a list of fragments found with the search string Displays the name of the fragment Displays the length of the fragment Displays the length of the region masked by t
5. Name ME Leneh Trimmed L 2 AIBS838 367 bp a alS2219 328 bp 2 AR30870 355 bp 2 AR30909 195 bp z ADO 422 bp 2 41416018 421 bp z aAps4822 448 bp 2 Absbeeo 418 bp 4 4635615 543 bp Fragment search result list 7 Double click on any of the fragments displayed on the Fragments list to display the sequence for that specific fragment 8 Trace data will be displayed together with the sequence if fragments that possess trace data are found m A1105838 SequenceYiewer B xj File Edit Help t anosese E tte TTGGGCA TTATTGTAAA gt BGAAAGTRTT BTCTCTCAGG ASTACCTCte agecttttta aaccasgarn Ready a SA Fragment sequence display File Edit View Help A o al dats ma a i amp d GAATGTTTTT GTTAGCTCTC GTATEGACTG TTTCCAGTGT natttttttt attzgncgzca TtatGAGGTA aTATAAACAG TACAGTATTT TTGGTTATTT tinengzc AAAA secasstaan TTTTCATCAC TAGCCRT AGA CAGATTTCAG TGCTGTTTGT C TTtenato ceggt ncattn IO x rn Tt zr GECACA G 20 0a ca 2 had ARM ah la Done E Fragment trace display CTGTTTCGAC TETGAGAGCH ACGCATATCA AGTATTGGTC ca TACCTOCA ccaaaalcca TAGTTGA TG TCAAGTAGGT TACTCTGCGA CTAATTCTA AGAGAATCAc egcagctenco zw zi 36 Chapter 1 Contig Manager Tutorial 1 4 Analysis Example 3 Analyses Using Phred Quality Values This section explains how to run homology searches using sequence selection and only high quality regions
6. Navigation Toolbar A group of tools for operating the Contig Manager 1 1 7 Close the Contig Manager Select File gt Exit from the menu to exit the Contig Manager 1 1 8 Data Used in the Tutorial The data used in the tutorial 1s installed together with the Contig Manager Select Programs gt DNASIS MAX gt Tutorial Data from the Start menu to open the folder that contains the DNASIS MAX tutorial data The tutorial use the data contained in the ContigManager folder To use this tutorial you need to install the DNASIS MAX Contig Manager Version 2 0 Chapter 1 Contig Manager Tutorial 11 1 2 Analysis Example 1 Assembling Trace Data This section explains how to use the Contig Manager to load trace data output from sequences to perform Phred basecalling vector trimming and Phrap assembly 1 2 1 Start up the Contig Manager Select Programs gt DNASIS MAX gt Contig Manager from the Start menu to display the Open Project dialog shown below rum Pramt ie Cramkm a rra promt Pio gent Finge Tuis ri Hra C Open a ot pramctz pr Hyaw La Select Pramctz Paget Morse EH jy TesiPropsi Em Inpari Len Ext Open Project dialog 1 2 2 Create a Project 1 Select the Create a new project radio button on the Open Project dialog 2 Enter Tutoriall in the Project Name text box and then click New 3 The main Contig Manager window appears 12 Chapter 1 Contig Manager Tutorial File Ed
7. fig 3 Unlock Product dialog If the DNASIS Key Code Manager does not start up select Programs gt DNASIS MAX gt Key Code Manager from the Start menu Phred Phrap Option Installation and Default Settings Key Code Issuance Procedures Fill in the required details on the Key Code Issuance amp User Forum Registration Form included in the package and either fax or mail it for email see below to your Regional Support Center see Appendix A The Key Code Issuance Notification and User Forum Registration Certificate will be sent back to you by fax and mail For e mail requests fill in the details for Key Code Issuance and send it to your Regional Support Center by e mail Be sure to include the Validation Code that came with your software The Machine ID of the computer on which DNASIS MAX Contig Manager Ver2 0 will be installed is also required for key code issuance The Machine ID is displayed in the Machine ID field of the Unlock Product dialog when Unlock on the Key Code Manager is clicked Be sure to include this machine ID number in your request 1 Product Key Phred Phrap Optionv20 y Machine ID ROCIO Kew Code E A Cancel fig 4 Unlock Product dialog Tutorial Data Select Programs gt DNASIS MAX gt Tutorial Data from the Windows Start menu to open the folder that contains the tutorial data The data used by the ContigManager tutorial is stored in the ContigManager folder Refer to Chapter 1 Contig
8. resides Mame tengeh Cantigt 4 815 bp d Contigdi Copy 1 4 815 bp 4 The copied contig is treated exactly the same as other fragments It can be used to assemble new contigs in the normal manner X Name rengh Kg 59 gt Contig 8 004 bp Cantigt 4 815 bp d Contigdi Copy 1 4 815 bp Be 30227332 941 bp h 30220463 262 bp h 30220457 084 bp h 30220454 935 bp Chapter 7 Phrap Assembly 135 7 6 2 Assemble a Contig Using Constituent Fragments It is possible to add more fragments to the fragments composing a contig before performing assembly This requires more time than assembling a contig as a fragment because it 1s necessary to first dissolve the contig and then realign it but the result reflects the data from each fragment more accurately l Create a new folder for storing all of the fragments composing the contig Right click the Root folder in Tree View 2 Select New Folder from the popup menu Mew Folder Delete Property 3 A new folder is created in Tree View 4 Select the contig to be assembled in Tree View A list of the fragments composing the contig is displayed in List View h 30220443 30220436 h 30214639 30214630 s 30207169 5 Select all of the fragments shown in List View and drag and drop them to the new folder To select all of the fragments click in the List View display area and then press Ctrl A or select Edit gt Select All f
9. 3 12 Three Display Modes The Main Window of Contig Manager has three display modes Standard All Contigs and All Fragments By clicking the tabs in the Main Window the modes can be changed Standard All Contigs All Fragments 84 Chapter 3 Project Window 3 12 1 Standard Display Mode Click the Standard Tab to display this mode It is the standard display The Map View Tree View and List View are shown and folders contigs and fragments are displayed 4 P pease gt Ma AUN L es MEUSE 3 12 2 All Contigs Display Mode Click the All Contigs Tab to display this mode In Map View and Tree View all the contigs included in a project are display In List View the fragments composing the contigs selected in Tree View are displayed vunbg Ma Hi Chapter 3 Project Window 85 3 12 3 All Fragments Display Mode Click the All Fragments Tab to display this mode This mode displays all the fragments included in a project OEA LL ee COPADA GEES AFERRA RRE Fr FF ur ud o um 3 13 Operations in Map View In the Map View the following operations can be performed Displaying Contigs 3 13 1 Display Contigs from Map View When double clicking the contig displayed in Map View the Contig Viewer will start and the linking status of fragments in the corresponding contig will graphically display The window is divided into Map View and Sequence View Map View
10. 3 3 Create a New Project At the start of the Contig Manager the Open Project dialog is displayed A new project can be created following the procedure below l Select Program gt DNASIS MAX gt Contig Manager from the Start menu The Contig Manager will start and the Open Project dialog will appear s Oral a THEM papel Project Flores 4 O pan axohng pramctz cram Hane T Ea uct Pramche rc Project Horas ed NS rem BETEN gri af Hap Ex 2 Check that the Create a new project radio button is selected and type any project name in the Project Name box 3 Click New to create a new project with the typed in name A new project can be created during the operation of the Contig Manager Select File gt New from the menu or click on the Toolbar to open the Open Project dialog 3 4 Open Existing Projects Follow the procedure below to open an existing project l Select Program gt DNASIS MAX gt Contig Manager from the Start menu The Contig Manger will start and the Open Project dialog will appear Chapter 3 Project Window 79 ie Cama a ra pro part Project Haras Open acohng pramciz crue Haee 7 l Salir Pramrcia r Projeri Fieres T Pra ect j Promet T Tiris W gi Tutar al FERE 2 Select a project in the Select Projects list 3 Click Open to open the selected project 3 5 Delete Projects l Select Program gt DNASIS MAX
11. Chapter 9 Trace Display Chapter 9 Trace Display 153 9 1 Open Trace File from the Project Window It is possible to display a trace graphically by double clicking on a trace data fragment in Contig Manager Alternately you can select a trace data fragment and click Open on the Navigation Toolbar The Open button is located in the lower part of the Navigation Toolbar see figure below Remove Fragments Reset To Original Sequence Performing one of the above operations causes the Contig Trace Viewer to open with the trace of the specified trace data fragment displayed For details refer to 8 5 2 How to Read the Trace Display all Joa Ban I aeasamacer e ross zi ETCACTECECTECETCACET amp amp x 1 ki rceguartii E MEMI Li ECT E ACT Lig k ttee iu a zY CE B GEGHTCEEETGT COTGCCCAG AC CTT CAGE AGC Er crrcrc LEE te eee RE Co B Lite Ec Kbv Adl m al E T mm a It is also possible to display multiple trace data fragments at the same time Select multiple trace data fragments in Contig Manager see figure below With the fragments still selected click Open on the Navigation Toolbar Performing the above operation displays the trace data fragments from the top downwards The display order matches the selection order of the trace data fragments in Contig Manager 154 Chapter 9 Trace Display Be B ER vem Wes 2 mn Jue
12. MSDE2000 for DNASIS and Contig Manager to be installed before you attempt to install the Phred Phrap Option Ver2 0 Please refer to the Installation Guide that came with your DNASIS MAX software to install DNASIS MAX V2 5 MSDE2000 for DNASIS and Contig Manager Phred Phrap Option Installation and Default Settings 3 To install Phred Phrap Option V2 0 insert the DNASIS MAX Phred Phrap Option Ver2 0 CD ROM in the computer and follow the instructions to proceed with installation If an installation dialog does not appear when you insert the CD ROM open the CD ROM with Explorer or another file manager and then double click the Setup exe file fig 2 Depending on the Explorer settings the exe extension may not be displayed Setup exe fig 1 Setup program icon Key Code Input The DNASIS Key Code Manager shown in fig 2 will start up once installation has completed IMSS Key Code Manager Copyright C 2003 Hitach Software Endesa w li Onks Hi Bh Fresi Piron Ooi fig 2 DNASIS Key Code Manager Select Phred Phrap Option V2 0 click Unlock to display the Unlock Product dialog shown in fig 4 and then enter the key code issued by your Regional Support Center see Appendix A User Support Contact Information in the Key Code field Refer to the section on Key Code Issuance Procedures for details on acquiring the key code UE TEENS Product Key pNasis Max v25 y Machine ID RSS Rep Code TT Cancel
13. Search a Consensus Sequence 144 Index Search a Sequence 156 Sequence Data 99 Sequence Editing 147 Sequence Files 104 Sequence View 142 Set up Vectors 123 Sort 92 100 Standard Display Mode 84 Start up the Contig Manager 4 9 11 24 T The formats that can be imported 104 Three Display Modes 83 Trace Data 100 Trace Files 103 Trace Display 144 151 171 Trace Display Methods 144 Trace Files 155 Trace View 73 Trace Viewer Parameter 73 Trace Window 71 Trace Window Menu 71 Trace Window Status Bar 73 Trace Window Toolbar 72 Tree View 82 Trimming Parameters 62 Trimming 124 Tutorial 7 10 Tutorial Data 4 V Vector Database Manager 63 Appendix A User Support Contact Information Please use the following information to contact your regional support center with questions on using or purchasing DNASIS MAX MiraiBio Inc The Americas Asia and Pacific Regions 1201 Harbor Bay Parkway Ste 150 Alameda CA 94502 U S A Web www miraibio com Tel 1 510 337 2000 Fax 1 510 337 2099 E mail dnasiskey miraibio com For obtaining key codes gene ag miraibio com For other information or inquiries Hitachi Software Engineering Europe AG Europe Middle East and Africa Regions Neues Kranzler Eck Kurf rstendamm 22 10719 Berlin Germany Web www hitachisoft bio com Tel 49 30 8877 2600 Fax 49 30 8877 2610 E mail dnasis hitachisoft de For obtai
14. Select a fragment displayed in List View and drop it in the destination folder in Tree View This will move the dropped fragment to the corresponding folder This operation 1s typical of Windows based programs such as the Windows Explorer Name EN Rant A Mew Folder Delete Fragments l Selecta fragment to delete in List View and press the Delete key on the keyboard A confirmation message will appear ContigMgr X Contigs will be dissolved Are vou sure to delete selected data 2 Click Yes to delete the corresponding fragment from the project Display Fragment Properties l Right click the fragment to display its properties in List View 2 Select Property from the popup menu 3 The Property dialog will appear Chapter 3 Project Window 97 Folder Root Leneth pe bp Low Quality BPs Ba Trimmed Vector EMI Trimmed Length bp Status Phred Assembledi Trace File Path D HSK DB Manual Data Trace S0201008 sct Comment EX Cancel Item Description Be e Displays the name of the fragment Can be renamed When the fragment is trace data the left icon is used and when it is sequence data the right icon Folder Shows the location of the fragment with the path from the root folder Length Displays the number of base pairs in the fragment Low Quality BPs Displays the number of base pairs in low quality regions in the fragment Trimmed Vector Disp
15. The dialog shown below will display when the Contig Manager starts normally fe Crag s rue pramc Project Flores 4 C Opan axung prometi ore Haie ia brt Pramriz Pract Horses ry Open Project dialog 9 Before using the Contig Manager for analysis select whether to create a new project or open an existing project a list is displayed in the lower part of the dialog with this dialog For this tutorial a new project is created Select the Create a new project radio button and enter Sample in the Project Name text box and then click New 1 1 6 Part Names and Descriptions 10 Chapter 1 Contig Manager Tutorial The main Contig Manager window shown below will appear when a new project is created Eje Eik Wem Gori Heb O A E T Bi ni Conti ig Manager ss Brezal T Tnmnrag ope o Podes Mather Fhap T Fred Pr ire Pars Frimar Fred Tar rana Navigation s N Frag nda m NN D a j Ecm Al Comis All Fragrariz Peach Part Names of Main Contig Manager Window Item Description Map View Graphically displays a list of contigs that reside in the folder selected in Tree View Tree View Displays the folder hierarchy to manage the sequence data and a list of contigs List View Displays the contigs and fragments that reside in the folder selected in Tree View or a list of the fragments that make up the contig selected in Tree View
16. gt Contig Manager from the Start menu The Contig Manager will start and the Open Project dialog will appear 2 Select a project to delete in the Select Projects list 3 Click Delete to delete the selected project 3 6 Copy Projects l Select Program gt DNASIS MAX gt Contig Manager from the Start menu The Contig Manager will start and the Open Project dialog will appear 2 Select a project to copy in the Select Projects list 3 Click Duplicate to display a dialog for entering a new project name The selected project will be copied 3 Save Projects To save a project select Save Project from the File menu or click ei on the Menu Bar The whole project s current condition will be saved When any of the following operations are performed a project is automatically saved Therefore performing Revert will not restore the project e AutoAssemble Basecall Trim Assemble e When opening ContigViewer ContigTraceViewer or SequenceViewer e When importing data into the project e When opening another project e When terminating a project 80 Chapter 3 Project Window 3 8 Revert Projects To revert a project select File gt Revert from the menu The project will revert to the last saved status 3 9 Merge Projects The currently open project can be merged with another project l Select Import gt Import Project from the Contig Manager The Import Project dialog will appear Import Project Select a
17. y e 3 END Trim at least 10 Bg FF rm the first 10 Bg while the quality ig less than Jn y e Same as amp END 3 Select the Trim Vector check box select TutorialVectorA from the Vector Name list and then select PrimerA from the Cloning Site list rim Vector Vector Mame Cloning Site Cloning Site Position GPosition pBluescript KS Tutoria lector pBluescript SKCe DS yu m Tutorial vector poen 4 Trimming setup 4 Close the dialog with OK once the settings have been made 1 4 4 Blast Search Setup Double click Double click this to set database to open the parameter setup dialog Blast Parameters Program name blastn Detail Expectation value 10 Default e Filter query sequence Descriptions 100 r Y Include gap in alignment Alienments 100 Blast Parameters dialog It is not necessary to modify the parameters for use with this tutorial When performing actual analyses set the target search database and other details in this dialog 40 Chapter 1 Contig Manager Tutorial 1 4 5 Enter Trace Data l Select Programs gt DNASIS MAX gt Contig Manager Tutorial Data from the Start menu and then open the TutorialData folder 2 Open the ContigManager gt TutorialDatal gt TraceDatal 1 folder 3 Select all of the files contained in the TraceDatal 1 folder and drag and drop them into the Drop trace data here fo
18. 7 se 2227103 So CENT Cad s AT 104 paatai ii JE Sud EESTI da se IA 142 E KENT 282 se 303771 46 EHE se 30377169 aA se 2123 EE se 221447 CHER DB Tin De a ee Ti CA SO EN Tutora Datali org Merger Ti AR age Tui CA HEE DE Tutora Daah Cori Haragi Tol CE HEE DE Tan e a eT CA HEE DB Tutora Daa rte Fara uri Tut CE HEE DE Tuiri Die rag Tid CA HEE DB Tutora Daah rte Farag Tut CE HS DE Tao De Vener Tig CA HOB Tutora Daah r Plana nri Tunt CEI HSE DE Tutora De sra Ti CA HS DB Tutora Daah org Faraar Tut CE HEE DE Tutora ee Posuere Tid CA ASO Tutora Datali org Faraar Ti CE HEE DE Tan Die rre CA HE DB Tutora Dahl ort Fler eh Tol CHASE DE Tine Die rag Tiri Fathi bo a ram carecbars Chapter 2 Window Descriptions 65 Item Description Relink Trace Files Displays a list of fragments whose links have been disconnected Name Displays the data names The data can be sorted by clicking column headers Current Path Name Displays the path to the currently linked trace file Path to a new directory When setting where to link designates the path to the directory where trace files are stored Click this button to a path to a new directory Set When selecting data from the list to link to a new directory and then pushing this button 1f data with the same name as the selected data is already present a new link is created to the file 2 3 Contig Window 1 1 Lm Acer L 28 be ecce TEE TCET ET E B AACA CT TAA TT Ta
19. 9 Selection of Sequence Description Sets the colors of the Trace View Sets the background color of the Contig Trace View Sets the color for Base A and a trace of lane A Sets the color for Base C and a trace of lane C Sets the color for Base G and a trace of lane G Sets the color for Base T and a trace of lane T Sets the color for Base N and a trace of lane N Sets the color for the selection of sequence Double click the color box to display the color setting dialog 74 Chapter 2 Item Selection of Trace BasePair Font Name Size View Font Name Size Color of Quality Bar Quality score is between xx and yy Window Descriptions Description Sets the color for the selection of trace Double click the color box to display the color setting dialog Sets the display font for the number of bases bp Click Select to display the font dialog Displays the currently set font type Displays the currently set font size When changed the View Font will automatically be set to the same size Sets the display font for sequences Click Select to display the font dialog Displays the currently set font type Displays the currently set font size When changed the BasePair Font will automatically be set to the same size Sets the color of the Quality Bar When the quality value is within the set range 1t will display in the specified color To change the high quality range adjust the lower limi
20. AT ET Ac TOR A TT EAT TEC EC TT BA A TOT aj Eie id Ee TEETAR aid IER UST zx les 30701138 adr a 2x caeci zm cm Aures uma Deco dec AA gus SAC TA Cuki E hec pc es TOC TCET ET 8 BA CAT TACA T TTA AT ET AG Ta ES An TT EA EC TEE TT R5 Bs co AA TEE TGET CT AA GAAS DA CT TACA TT TACO DC AT ET AC TO AA AC TT CA DC TG LG AC TT EA AG B AAA Tol ETETA TO ACD TT CS TOR LC TT D 3 Sequence View Fee m 1 2 3 1 Menu File menu Description Export Stores sequences in the selected fragment range in Fasta format When multiple fragments are selected and stored they are stored in multi Fasta format Export Contig Stores a contig sequence in a file Export Contig to DNASIS MAX Outputs the currently displayed contig sequence into DNASIS MAX The data will be displayed in Sequence View of DNASIS MAX This is the same as D on the Toolbar Revert Refreshes the Viewer by rereading the stored data When the data has not been saved the data at the creation of the contig will be displayed Save Overwrites the sequence currently displayed in Sequence View to the original file The quality value in editing the sequence can be set with the Quality Tab in the dialog which is displayed when selecting View gt Preferences from the menu Print Prints the currently active view Only the displayed part of the page in each view will be printed Refer to 10 1 2 Print from the Contig Viewer for printing Print P
21. All Data 220 230 240 EBERGETTAARATLAADASAST AT aacagttaaaatcaaaaaaaalat stato m IM a Trace Display using the Trace Viewer Contig Manager Tutorial 3 Select View gt Show Single Data from the Trace Viewer menu or click on Single Data d located on the Toolbar to display the trace data in multiple stages so that it can be viewed over as wide a range as possible ee AA CRA na eu bola gcEBrETT TTCH EFT TACTIC GCE ETT EACEA Ls eT CLE ELE LE TEE Luces ri rx JACGT aT i ro DI ITAGGE G ATTI CT PG eb CA 8 LEY ab ri paris rial ce T rk et 1152251 d DM Ih A AURA Im ll a iy pal ihe si Prhati TN Ir tatti ili EELS trageeleacal autores Lo eecot tul iti bacca peeks Herr Repeuluzcilnes E HidabGe CET EA aat LSE ASE ee THUEEIET M l M VM Un N IM NNI ITE iy kN Wal Ad d T dh ATED Ga AMA EET ECAS HEHE ETICA AR E TR d uud m4 xl rra ACTOTEATARS THEE are cae Wi ie algal O Frrir T r iF Nw He N MW ilb htt wa nly ENTUM fuut aL taTOBAE WT ET Gat X ere beer EEE ee TEF I a IET Display Single Trace Data over Multiple Stages Chapter 1 Contig Manager Tutorial 15 4 Select multiple fragments from List View in Contig Manager and then click Open on the Navigation Toolbar to sort and display multiple trace data Fo Data Contig Trace Wiener File Edi View Heb e rn ise z lol B
22. Edit gt Copy from the menu All the data in the view is copied to the clipboard as tab delimited text It can then be copied into other applications such as Microsoft Excel and edited as needed che pe pur umm ba pur pee ENSIS i jojo AN are ee Ue ee ie EI 1 a le en r i E m p Dal p a gmu wi oe I n E uy 77 led Pr Im Te ze Ed E imi 7 maa T Fila dle imi Y ss MU LE LL E LE dp cu i a ar ma r i mi ma um uas m Tr LS ESL m ee a n as B PR T LI LI ry EA TI ed p EL ra Sar Eu ux li mua Fr MT m m ZI CIV x A ww L Pal ke patr al re iral C tegat 1 E Er Ti Mhai E Li Eo a Bi P us y 1 AN 1 1 aon p m PL 7 I n iFa m Tuc mes E i um a ini r a E E a a num ts J ut j al ie Ei ru m n ME dl in z E mA La ES a PB e m nn i 10 2 2 Copy from the Contig Viewer Click in the pane of the View you wish to copy from Then select Edit gt Copy from the menu In Map View and high quality Sequence View the range of data copied to the clipboard is what currently displays in the View The graphics are copied as vector data so they can be copied into other applications such as Microsoft Word and printed out in Chapter 10 Output 167 10 2 3 Copy from the Trace Viewer Select the part ofthe sequence you wish to copy Then select Edit gt Copy from the menu The selected part is copied to the clipboard as text
23. Hores E T Tarira Ij Tute mii E Et hpri Exi Open Project dialog 1 3 2 Create a Project l Select the Create a new project radio button on the Open Project dialog 2 Enter Tutorial2 in the Project Name text box and then click New to open the main Contig Manager window Chapter 1 Contig Manager Tutorial 25 Main Contig Manager Window 1 3 3 Enter Trace Data l Select Programs gt DNASIS MAX gt Tutorial Data from the Start menu to open the TutorialData folder 2 Open ContigManager gt TutorialData2 gt TraceData2 1 3 Select all of the files contained in the TraceData2 1 folder and then drag and drop them into the Root folder on the Tree View of the Contig Manager or into the List View Y Root D bp D Drag amp Drop Standard All 4 File reading will complete after a few moments The Import Summary dialog will show the total number of data the number and names of imported data the number and names of skipped data and the number and names of error data 26 Chapter 1 Contig Manager Tutorial Inert Serres Import Summary dialog 5 Click OK to close the dialog 1 3 4 Sequence Assembly 1 Select all fragments added to the List View on the main Contig Manager window O Select any data item in List View and then press Ctrl A or select Edit gt Select All from the menu to select all fragments 2 Click Assemble on the Navigation Toolba
24. It is possible to perform automated processing for basecalling trimming and assembly from settings in the Navigation Toolbar 1 To use a trace data basecall as the original basecall the sequence data described in the trace data file itself select Original on the Navigation Toolbar To use the Phred basecall select Phred This parameter has no effect 1f the input data 1s not trace Bazecall Phred 2 To perform trimming select the Trimming check box on the Navigation Toolbar If no trimming is to be performed clear the Trimming check box See 6 1 Vector Settings for detailed information on trimming settings Trimming Detail Trim 3 Specify the assembly parameters See 2 2 13 Phrap Parameter dialog for detailed information on parameter settings 4 In List View select the data to be assembled To select all items listed press Ctrl A or select Edit gt Select All from the menu 5 Click Auto Assemble on the Navigation Toolbar Auto Assemble 132 Chapter 7 Phrap Assembly 6 After a few moments the operation is complete and List View displays analysis results based on the settings 7 3 Display Assembly Results The items displayed for assembly results and generated contigs differ depending on the view 7 3 1 Map View In this view each contig 1s displayed as a single bar with the quality value equal to or greater than the threshold value and the quality va
25. List View da bg it ar ra 3 T eeu air 2 i ae wa t T ere min 1 LI wee ea ho TE A HEXTICE p PH ze muy z 1 1 Bi rules ml k cana iU im IE 1 i mere XE a T q PLI HN um pil LS TE 1 ral ETT Las ru E j ds y A i 1 CTC H View Switchover Tab Status Bar 48 Chapter 2 Window Descriptions 2 2 1 Menu File menu New Open Revert Save Project Print Setup Print Preview Print Import Import Project Import Sequence Export Sequence Export Original Sequence Export Sequence Exit Edit menu Copy Delete Select All Deselect All View menu Map View Check Fragments Composition Open Data Summary Navigation Tool bar Standard Toolbar Status Bar Preferences Description Opens a new project in a new window Displays Open Project dialog Opens a specified project file It is also possible to specify multiple files to open Returns the project to the pre edit status Ifthe project was not saved returns the project to the status when opened Stores a project by overwriting it Displays the Set Printing Information dialog and gives the setting of the paper size and printer information Displays a print image Carries out printing Obtains a specified project or sequence Imports a project Merges the data of other project with the currently opened project Reads the sequence from the specified file Stores a sequence by giving
26. based on Phred quality values The DNASIS MAX DNASpace option is required for this tutorial 1 4 1 Start up DNASpace and Opening Space l Select Programs gt DNASIS MAX gt DNASpace from the Start menu 2 The Open Space dialog shown below will appear TAT Ali 5 euch Local 172 Ali 5 euch HEHI 11 Se ge noanbe ol esi 101 Cte Loco Deine cl Speck Pra Dies 1 E71 5 pec Prisa Design E 214 Co Probe Dessin AN Ger E rea Beach HI Geen sek Pepo Esch Again TJ Coste He Are Folie 1413 mipan gt Cese Fi HJ Bn Fori Eich ni gt C 40 HCE B bet Seg reads Prods HIT Generelle Cheste Profile HE Deringer U ss Prode FAT Essrer s of HTTP Bei AL Erak od FTF sel EAT ese Corral Trace Dia EAT Bess enge Coden Lage bL Lonbeni FA Aura Acad order Heights E Open Space dialog 3 Select A 09 Blast Search with Phred QV from the list Click Open and the following space appears Euarrsradi recut be Fisi a Dubia cit the ka cat Hha yeda Tread myar ai Phrsri Calig ada Marking Dubia click the lo dan Bier march Fear TI Horacio basch Parir imr A 09 Blast Search with Phred QV Chapter 1 Contig Manager Tutorial 37 1 4 2 Set Sequence Masks and Selection Parameters of Quality Values l Double click on Phred Quality Value Masking on the Space dialog to open the Parameter Set Editor Phred GV Maskine Parameterset Editor Output Parameters Y If high Q v bp is less than ar equal to 99 bp
27. below low quality regions can be easily found Low quality region emphasis Chapter 5 Phred Basecall and Quality Evaluation 119 5 4 Export Phred Results 5 4 1 Export Phred Basecall Results as Strings l When File gt Export Phred is selected from the Contig Trace Viewer menu the Save As dialog will appear Saveas Save In My Documents a t Ej Ex Ep Pictures File name 30201033 Save as type FASTA Files na L ancel E 2 Check that File Type is FASTA Files na and click Save 5 4 2 Export Phred Basecall Results in SCF Format l When File gt Export Phred is selected from the Contig Trace Viewer menu the Save As dialog will appear c 2 xl Save In y My Documents lt My Pictures File name 30201 093 Save Save as type scr Files sch Lancel Jl 2 Check that File Type is SCF Files scf and click Save Chapter 6 Vector Trimming Chapter 6 Vector Trimming 123 6 1 Set up Vectors Click Detail under Trimming on the Navigation Toolbar to display the Trimming Parameters dialog All of the parameters required for vector trimming are located here Refer to 2 2 15 Vector Database Manager dialog for details lora Parar liz a mi x 6 2 Register Vectors 1 Click Vector Database Manager on the Trimming Parameters dialog to display the Vector Database Manager TE or A EIER pimp E51 ctas DH phagarad ma E
28. can be changed Chapter 2 Window Descriptions 71 2 4 Trace Window The Trace Window displays trace data in ABI and SCF formats as trace data Features include copying and searching bases ID x e Edt Wen Help Elida Jour Uan Laada Alacer at Toolbar Menu ALA rs dl rue E REXI tem ai 3110 sin 3120 3 G 4A TTT amp C G DC amp amp TE AEG CA EA ATITT amp ET TTC TGCACTTCARATACHO CACACA GGE AU G TTT 46406 AA Te a cea GAG kkiik a ET TTo sTG Ao TT Go amp amp AT narra amp b ch GG Trace View f f ral AAN N M N nf M Ara 3100 Done HU Status Bar 2 4 1 Menu File menu Description Export Stores the original basecall the upper sequence of the active data in a file The file can be saved in Fasta or SCF format When a range is selected only the sequence in the selected region will be stored in Fasta format Export Phred Stores the Phred basecall the lower sequence of the active data in a file The storing format can be chosen from either Fasta format or SCF format When a range is selected only the sequence in the selected region will be stored in Fasta format Print Setup Sets the printer Print Preview Displays the printing image To exit the print preview mode and return to the previous window click Close Print Performs printing Exit Closes the window Edit menu Description Copy Copies the selected sequence or the trace value of the selected part
29. click on the trimmed sequence data d BIBB8B8448 644 bp 18 61333708 574bp 18bp amp BI706466 530 bp d BE201185 639bp 18bp gt Trimmed Sequence Data The Sequence Viewer will start up and display the trimmed sequence data The series of N s are the areas that have been tr mmed 61888448 SequenceViewer Bl x File Edit Help F ernossss E aggagtttac tttatagtte ctoteggate gaggalacca pottbggGta Claaagga cagccatete ttattettaa satzaatagg attattzgtc ttasgccatce tegagalccz tacatcaact cacalcaaa sagteleasa cclciccaga tecagtattt cccccalgag gegactatig ataggatgta ctteccttac talgggaaaa agacacalaa geettatett cagccttieg ttectetaaa ectettectt aagaaggaaE gt actacaactc czagclgatt glagaglgca agettgagee ctecaaccte aagaacaalg acgagcelga caagtttctt geccecetca ecttoceget ceteeteace gaalaaagca sttecteste cegacgolga aggggaactt etectacttt tectecctet tetctctgat gt ctecttttaa gccctcgagt glacgtcctg cleetoctca scaggaccta aaggacciga tttaactcte Cagacaggca teactgatte atttttetta ateaatocot ctcaccetet cllaacagga tetctettta etotecteto aagotcoctoc toctectgag cgltacccga Ee Ready Position 663 EI Es 6 5 Reset Test Data It 1s possible to restore the trimming to the original input sequence However note that this process does not only clear the results of trimming but also the Phred and Phrap results for the corresponding data Chapter 6 Vector Trimming 127 1 Select the trimming results to reset t
30. dau ET 14445 Hip F 4 The selected trace is imported and will display as trace data in List View Trace data is displayed using the B icon 104 Chapter 4 Import and Export Eo BE gm quema trim Dua ed j mam nu mmm un om UR oa rs AAA 4 2 Import Sequence Files It is possible to import sequence files that don t have trace data The formats that can be imported as sequence files are text file in which only sequences are written Fasta Format Multi Fasta Format Genbank Flat File Format Multi Genbank Flat File Format EMBL Format Multi EMBL Format and DNASIS for windows Format l Select File gt Import gt Import Sequence from the menu The Open Files dialog will display Files of type All Files L ancel y 2 Selecta file to import and click Open More than one file can be selected at the same time 3 The data is imported and the Import Summary dialog will display Check the contents and click OK Chapter 4 Import and Export 105 Imst Sarre Th raras ae I inert ia Skip uia Ena Luiz 230201110 Sel Bell BAT 1 32 Rz E xni S40 Su 31311147 BEZ EE PZA DES 21307145 EE v XO E db piam DE T1 H nd cia j m Fi J H id dala H oi verma daia 4 The sequence stored in the selected file is imported and will display as sequence data in List View Sequence data is
31. dialog The respective colors inside the ellipses in the figure above in the Color of Quality Bar group will display in the quality value graph for bases whose QV are within the specified range in the example above 0 to 19 and 20 to 99 By double clicking inside these ellipses the dialog will appear Select any color and click OK to change the graph color 118 Chapter 5 Phred Basecall and Quality Evaluation Basic colors EI NI Mir BI FAT MAA AE E E ETE f E NE NN NUI EERE Eee ee A a m POTRERO A Custom colors CU CU Define Custom Colors gt gt Conca Color palette 5 3 2 Set Quality Value Thresholds It is possible to change threshold colors of the quality value graph Select View gt Preference from the Contig Trace Viewer menu or click Preference S on the Toolbar to open the Contig Trace Viewer Parameters dialog Lontig Trace Viewer Parameters E B aseFair Font Mame Courier Size 12 Select View Font Mame Courier See 12 Select Color af Quality Bar Quality score is between 0 and 13 Quality score is between ral 39 Cancel Help Color Background Others EI Selection of Sequence Selection of Trace Contig Trace Viewer Parameter dialog The number in the ellipsis above is the lower threshold for coloring the quality value graph By changing this value along with colors for threshold values above and
32. gives an overall view of the fragments and contigs along with the quality value graph In Sequence View the contig alignments and each fragment alignment are displayed De Edt Wwe Heb Amo gps 9178 ow lec pc TECOS TCT CT ABA ACT TACA T Tac RAT CT AC TO ESEGTT ES DC TOC EC TT R8 AG TOT d zi rx Ih Ep arij tiu 30200047 arr ES 30700138 aint AER ee Fr mures HET Fema Beh gei CT gu cA CT Tibeti E Pame TTET ET A B ES CACT TADA TT TAUG ET ET AC TOCA AO TT DA CC TO EC TT Bh A Wes COMA TEDETEETET AA DA EA ACT TACA TT TAEGEGAT ET AC TAA AG TT CACC TG D AC TT EA 4G ua Becr E TOS TC C E a BA eS ACT TACA TT TA C DC AT ET AC TO E AN TT CA EC TO DIE EC TT Bh O AJ El jzj o ea s Refer to 2 3 Contig Window for the details of the Contig Window 86 Project Window 3 14 Operations in Tree View In Tree View the following operations can be performed Operations for folders Operations for contigs Operations for fragments Sorting data Operating trees 3 14 1 Operations for Folders Create Folders l In Tree View select the directory to create a new folder 2 Select Contig gt New Folder from the menu or right click the mouse on the folder and select New Folder from the popup menu see below 3 A new folder will be created under the selected or right clicked folder New Folder Delete Property Move Folders Select a folder and drag and drop it to the destination
33. it aname Stores a sequence by giving it aname before trimming or assembly Stores a specified sequence in the List View by giving it aname Terminates the Contig Manager Description The active view decides the target of copy When Map View is active The shapes drawn by Map View are copied to Clipboard When Tree View is active The data is copied as text data to Clipboard with all the data hierarchies of the Tree View open The depth of each hierarchy is expressed with the number of tabs at the line head so when pasted to applications such as Microsoft Excel browsing becomes easy When List View is active The information highlighted on List View is copied to Clipboard as tab delimited text Deletes a selected folder fragment or contig When Map View is active every contig displayed in Map View is highlighted When List View is active every fragment and contig displayed in List View is highlighted Every selection made in the active view is canceled Description Views hides the Map View Displays the Check Fragments dialog For details refer to 2 2 11 Check Fragments dialog Opens the highlighted data in the active view Displays the Import Summary dialog For details refer to 2 2 10 Import Summary dialog Views hides the Navigation Toolbar Views hides the Standard Toolbar Views hides the Status Bar Displays the Preferences dialog For details refer to 2 2 8 Preferences dialog Chapt
34. least stringent 0 maxgap Sets the maximum permitted size of an unmatched region in merging contigs during first most stringent merging pass 30 repeat_stringency Sets the stringency of match required for joins 0 95 revise_greedy Splits initial greedy assembly into pieces at weak joins and then tries to reattach them to give a higher overall score shatter greedy Breaks the assembly at weak joins as with revise greedy but does not try to reattach pieces C force high Causes edited high quality discrepancies to be ignored during final contig merge pass 0 60 Chapter 2 Window Descriptions Program Phrap Method ParameterSet Editor Scoring of pairwise alignments Othes Miscellaneous Program Filest4HitachiS of Ot Item Description Initial setting Program File Path Sets the drive path for storing phrap exe Automatically set at installation and usually it is not necessary to change Output File Name Sets the name of output files in MIME types files Set without using an extension Contig Chapter 2 Window Descriptions 61 Input data interpretation Output Phrap Method ParameterSet Editor Item Description Initial setting trim start Sets the number of bases to be removed at beginning of each read 0 qual show Sets the LLR score The LLR score is a measure of overlap length and quality High quality discrepancies that might indicate diffe
35. minscore Minimum SAT score 30 wector_bounc Number of bases at beginning of each read ED Consensus sequence construction node seg Minimum segment size E node space Spacing between nodes 4 Cancel Help Item Description Initial setting minmatch Sets the minimum length of matching word to nucleate SWAT If the value is set to 0 the matching process will terminate 14 bandwidth Sets the region value at half band width for banded SWAT search Full width is 2n 1 14 minscore Sets the minimum SWAT score 30 vector bound Sets the number of bases at the beginning of each read matches within which are assumed to be a vector 60 node_seg Sets the minimum segment size 8 node space Sets the spacing width between nodes 4 58 Chapter 2 Window Descriptions Miscellaneous Phrap Method ParameterSet Editor X Assembly Program Input data interpretation Output Scoring of pairwise alignments Others Miscellaneous trm penalty Identitving degenerate sequence at beginning end 3 trim score Identifying degenerate sequence at beginning end o confirm length Minimum size ef confirming segment P confirm tim Amount by which confirming segments mz confirm penalty Penalty used in aligning against 5 confirm score Minimum alignment score 30 Indexwordsize size of indexing hashing words in words c ho Cancel Help Item Description Initial setting trim penalty Sets the pe
36. open the Find dialog that string of bases is entered in the text box for you Itis only possible to search for base sequences within the original basecall base sequences output by the sequencer Chapter 9 Trace Display 157 9 6 Operations within Trace Viewer 9 6 1 Select Bases and Traces Drag the cursor along the portion of the base sequence or the trace you wish to select The selected portion of the base sequence or trace changes color To cancel the selection click outside of the selected area acarat TX AN JOVEN Daata ACGINY ua TIEFER E BPE Eri tet Tie that a LE LI ti m Ii uj N hl u INTL kd E dl RES IT F Fi f ku uu Mail iu I n ur ee tussis TM Iw N wil i m Jl ui ma ul mi c A SO mom m AX A nem fum Gn G Fo mm ERO ara nme m nn cae gt p TUS F Willy 9 6 2 Copy Bases Select a portion of a base sequence and select Edit gt Copy from the menu The selected base sequence is copied to the clipboard and can be copied into another application such as Microsoft Word for editing It is also possible to drag and drop sequences to paste them directly to a new location PUR Lans wes Guo cert dei deere ml ATCAELELTEREETTACAGATGG 158 Chapter 9 Trace Display 9 6 3 Copy Traces Select a portion of a trace and select Edit gt Copy from the menu The base traces for the selected portion of the trace are copied to the clipboard in tabular format and can be c
37. output to NG folder Masking Parameters Mask while moving average of GV is less than or equal to 19 Moving average window size 10 Y Mask as M Mask while moving average of GV is less than or equal to 19 Moving average window size 10 e Mask as M Mask while moving average of GV is less than or equal to 3 Moving average window size z Y Mask as M Help 1 Gancel Phred QV Masking Parameterset Editor Item Description Masking Parameters Sets the masking parameters based on the input sequence quality value 5 End Sets whether or not to perform masking with the QV set for the 5 end sequence Select this check box to perform masking Mask while moving average of Obtains the moving average of the QV from the 5 end and performs masking while the QV is less than or equal to XX average value is XX or less Masking ends when the average value exceeds the value specified here Moving average window size Specifies the window size for obtaining the moving average when masking with 5 end sequences Mask as N Select this check box if the base value is to be replaced with N for the relevant region when the moving average of the 5 end sequence s QV is the same or less than the threshold value 3 End Sets whether or not to perform masking with the QV set for the 3 end sequence Select this check box to perform masking Mask while moving average of Obtains the moving average of
38. project to import E Tutorial F Tutoriale Option f Add project name to head of data name Use original data name Cancel Item Description Select a project to import Displays a list of existing projects Option Sets options when merging projects Add project name to head of data When merging into an opened project the corresponding project name is added to the name heads of the contigs and fragments of the project to be merged Use original data name When merging into an opened project the names of the contigs and fragments of the project to be merged are added as they are If the currently opened project has contigs and fragments with the same name merging is not possible 2 Specify a project to merge from the projects displayed in the list and select the Option 3 Click OK to merge the selected project 3 10 Close Projects Select Exit from the File menu to close the Contig Manager The operation status will automatically be saved Chapter 3 Project Window 81 3 11 Structure of the Main Window The Main Window of the Contig Manager is explained below The Main Window consists of Map View Tree View and List View Map View 3f5 321 ESLER i roerief 2 ESPE F Tree View List View 3 11 1 Map View Map View colors the contigs in a project according to their quality values and displays them graphically The contig names are displayed at the left side of the view and the contigs ar
39. rgaqal Bu Ct oles cto arrrtaat qagcccccqu AAA EA CACA CACA grgraartgt Vector Database Manager Vector Name Length Definition Window size for vector trimming Minimum matching percentage Window Descriptions 63 Description Sets whether to make the trimming conditions from the 3 end the same as those from the 5 end Check to make them the same Sets whether to remove a vector sequence Check when trimming Up to six vectors can be checked simultaneously Select the vectors to be removed from a list Trimming can be done with up to six vectors simultaneously Sets a cloning site from a list for each vector to be trimmed Up to two cloning sites can be selected for each vector Check the cloning sites to use for trimming Sets the base length window size to extract from the vector cloning site sequence to use for determining the portion of vector sequence It is also used to correct the matching percentage Sets 15 or more integers Sets the minimum matching percentage between the alignment of a vector cloning site and the alignment to be trimmed When the matching percentage is larger than the set value it is considered to be a vector alignment Displays the Vector Database Manager Refer to 2 2 15 Vector Database Manager dialog for the details of the Vector Database Manager Closes the Dialog enabling what is set Closes the Dialog disabling all the changes Displays online help macia gall zz 1B
40. set to landscape before printing Printing with the orientation set to portrait can result in output that is partially cut off Use the Print Setup dialog to set the paper orientation To display this dialog select File gt Print Setup from the menu Print the Sequence View Click in the Sequence View pane Then select File gt Print from the menu or click amp on the Toolbar The data print range is what currently displays in Sequence View You can display a preview showing what the printout will look like by selecting File gt Print Preview from the menu Chapter 10 Output 163 Emir Meee I Pricey Birth Ll inm sE LI SF AB BEER TIGE LEE TEN EBENE ee ENTER AAAA TIERE EEE BET DEREN EEE TEE ET NTRA O BESTER ee re te BER TENE ET DEREN TEEN ET Peed ba ee sur baee imr inrimmini bil im tes bp eee ri bmsemumix iki imimnamir dd P imid imn inimmim s rhi ipg tg gingnumic FTE AS A 2 2 L ur mmeamr m iGmimmirG dH basse rin A AA E TANIA TA TS TE aaa EFTE ESTESE ee TEC TEE Eu tt EEE TEE NET TEE EEE TEE DGE 1 L TERET NA TON ANN CANON AAN rimmemm i ir Imimmirdi dl mririnmm ross invimmimi sdb tote ng imiaweee pomada SATA E A AAA TA E TAPA EA IE TIERE EEE ET DENE EEE TEE Tr SFP E A A TAS TAIANA T br besant is dilata inne E mr m m u BCTOCPAB NB Bom fs 9pm e ee 2 mo inimaimi ist imi ndmiuiueisn irsmmimi irs imit idee FFAA EEE EEE TEE Fasasi ibl im ioe a be ar dard EPIBESREU ID GPS ERR F
41. the focus to jump from the current cursor position to the next place to the right or to the left where there is a mismatch between the fragment and the contig sequence It is possible to continue jumping until you reach the marker closest to the end of the fragment sequence 8 7 Dissolve a Contig It is possible to dissolve a contig created previously This is performed from the project window l In Map View Tree View or List View select the contig you wish to dissolve Then click Dissolve on the Navigation Toolbar Alternately right click on the contig and select Dissolve Contig from the popup menu or select Contig gt Dissolve Contig from the menu 2 A confirmation dialog with the message Are you sure to dissolve contigs is displayed Click Yes to dissolve the contig ContigMgr X AN Are vou sure to dissolve contigs 8 8 Sequence Editing It 1s possible to edit the base sequence of a contig or the base sequences of the fragments that compose the contig The editor supports replace delete and backspace operations The editing unit is one base only It is not possible to define a range of bases and then apply the replace delete or backspace operations 30207153 30201135 30227276 30220436 30144604 30214639 30227258 30220443 Contig sequence 3130 3140 3150 3160 E 3150 3130 it AGAGACAGGAGCTTICAGGTTA CCOTGATGTTGAGCACCAAAATGOTGATCAAGAGGGATAGCE achGACAGGagdet cagzetatccc Gatent gAGCACcRaaa
42. with a blue background indicates the target of menu and toolbar operations To change the target click a different area of the trace data In addition if Complementary appears after the sequence name the corresponding sequence is linked by complementary strands in the contig In this case the trace and original base sequence are displayed with left and right reversed Base Display The sequences displayed below show the original data read from the trace files The sequence displayed at the top shows original sequence stored in the trace file The sequences displayed below are the assembled sequences that were linked together That is the sequences that were basecalled using Phred They may have been edited by the user have had gaps inserted by the assembly process or have become linked by complementary strands Quality Graph Base quality in graphical format The display color differs depending on whether the quality value is higher or lower than the threshold value set by the user The user can set the display color and threshold value 146 Chapter 8 Contig Editing Trace Display The trace data is displayed based on the ABI and SCF formats 8 6 Markers It is possible to display marks on the contig sequence 8 6 1 Marker Settings 1 Select View gt Preferences from the menu or click 9 on the Toolbar 2 Select the Sequence tab from the dialog that is displayed 3 Under the Consensus Marker item select the check
43. 2 Gontige d Sequence 00001 New Folder 1 d Sequence 00002 Delete Contigs l Selecta contig to delete and press the Delete key on the keyboard A confirmation message will appear 94 Chapter 3 Project Window LontigMgr i X AN Are vou sure bo delete contigs and all Fragments included in selected contigs 2 Click Yes The corresponding contig and the fragments composing the contig from the project will be deleted Display Contigs from Tree View l Double click the contig to display Or select the contig and click Open on the Navigation Toolbar Remove Fragments Reset Io Original Sequence 2 The Contig Viewer will start and the corresponding contig will appear Display Contig Properties l Right click the contig to display its properties in Tree View 2 Select Property from the popup menu 3 The Property dialog will appear Folder Root Length 54 bp of Fragments mn Low Quality BPs Comment P Cancel Item Description Displays the name of the contig Can be renamed Folder Shows the location of the contig with the path from the root folder Length Displays the number of base pairs in the contig of Fragments Displays the number of fragments composing the contig Low Quality BPs Displays the number of base pairs in low quality regions in the contig Comment Displays comments They are editable by the user Chapter 3 Project Window 9
44. 2 GAGATTAdgccet aAAGGTGGAGRCCATGTICGTGGGCTtaageactht 30201034 GAGATTAAGCCATAAAGGTGGAGRCCATGTICGTGGGCTttadzacc 30207178 GAGATTAAGCCATAAAGGTGGAGECCATGTTCGTGGGCTT AGGACCT 30201104 GAGATTAAGCCATAAAGGTGGAGECCATGTICGTGGGCTT AGGACCT 30220454 GAGATTAAGCCATAAAGGTGGAGECCATGTTCGTGGGCTT AGGACCT 30220457 GAGATTAAGCCATAAAGGTGGAGRCCATGTTICGTGGGCTT AGGACCT 30227332 GAGATTAAGCCATAAAGGTGGAGECCATGTICGTGGGCTT A4GGACCT 2 Select View gt Chromatograms from the menu or click x on the Toolbar The contig sequence and the fragment sequences are displayed with the position of the selected base displayed in black and aligned vertically as shown in the figure below Chapter 9 Trace Display 155 9 3 Export Trace Files Trace fragment data can be stored as a FASTA file or as an SCF file You can select them as sequence to be saved as the sequence originally basecalled by the sequencer or the sequence basecalled by Phred 1 To store the sequence basecalled by the sequencer select File gt Export from the menu To store the sequence basecalled by Phred select File gt Export Phred from the menu In either case the Save As dialog opens 2 Specify the output destination the filename and the file type then click the Save button The available formats for saving files are FASTA na and SCF scf 9 4 Display Color Settings It 1s possible to change the display colors for the background traces bases quality values and also the f
45. 207163 3 Bl LAA Ready ELS A A Refer to 8 1 Contig Viewer Display for more information on the display items 7 5 Dissolve Contigs To dissolve contigs select the contigs to be removed in Map View Tree View or List View and click Dissolve on the Navigation Toolbar A confirmation dialog with the message Are you sure to dissolve contigs is displayed Click Yes to dissolve ContigMgr X AN Are you sure to dissolve contigs The selected contigs are removed from the view and each fragment directional marker composing the contig disappear 134 Chapter 7 Phrap Assembly 7 6 Reassemble Contig Sequences There are two methods for assembling contig sequences Each method may produce different results so it 1s important to select the method that is appropriate for the application 7 6 1 Assemble a Contig as a Single Fragment It is possible to assemble a contig as a single fragment This reduces the amount of computing time required 1f the number of fragments contained in the contig is large but it may produce results that differ from those that would have been produced if data were added to the individual fragments before assembly 1 Right click a contig in the Tree View or List View 2 Select Copy Contig As Fragment from the popup menu Dissolwe Contig Delete Copy Contig 4s Fragment Property 3 The contig sequence is copied as a fragment The fragment is copied to the folder in which the contig
46. 3 After a while performance of Phred ends and Phred completed icons will be displayed on the List View Naef ten t v to le 0194804 0201067 0201093 0201094 30201104 30201110 30201132 30201135 30201147 30207122 ES EE ES ES EEE ES DJ e ra a e Ea en 4 30207163 Phred basecalled data Chapter 5 Phred Basecall and Quality Evaluation 117 5 2 3 Display Basecall Results By double clicking the data with Phred completed icons in List View Phred basecall and QV bar are displayed in the Contig Trace Viewer along with trace data FIENT Data Contig Trace Viewer Ioj File Edit view Help A Bal data Jms c Sequence of Trace Data 60 70 at AGGCCA TRACACA GACAGGACCTAGCEGTEGT Let agecca teacaca gacaggsacctagcegg t The result of Phred Basecall N lhl Yl Basecall results in the Contig Trace Viewer 5 3 Search Low Quality Value Regions 5 3 1 Change Colors of Quality Value Bars Select View gt Preference from the Contig Trace Viewer menu or click Preference 4 on the Toolbar to open the Contig Trace Viewer Parameter dialog Contig Trace Yiewer Parameters y Color Background BasePar Font Mame Courier e Size iz Select L View Font G EN Mame Courier TES Size 12 Select nn Color af Quality Bar Sequence Ml Selection of Trace Contig Trace Viewer Parameter
47. 5 Rename Contigs l Right click the contig to rename 2 Select Property from the popup menu 3 The Property dialog will appear Folder Length Low Quality BPs of Fragments ni Comment 4 Type the new name for the contig in the textbox to the right of the m icon 5 Press the Enter key or click OK The contig will be renamed Attaching Comments to Contigs l Right click the contig to attach a comment 2 Select Property from the popup menu The Property dialog will appear Folder Length of Fragments la Low Quality BPs Comment 3 Type a comment in the Comment box Up to 255 characters can be used 4 Press the Enter key or click OK 96 Chapter 3 Project Window 3 15 2 Operations for Fragments Import Fragments It 1s possible to import fragment data from a window to a given folder in Contig Manager 1 Click the destination folder in Tree View of Contig Manager to display the contents of the corresponding folder in List View 2 Select a fragment file from the window to import More than one file can be imported simultaneously 3 Drag and drop the file s in List View of Contig Manager The fragment data will be imported to the folder selected in Tree View 4 The Import Summary dialog will display a list of imported data skipped data and import error data 5 Check the contents of the dialog and click OK Move Fragments
48. 8 ContigEalling u 139 9 1 CONTIG VIO Wena 141 8 2 CONTIG Map VIEW 141 8 3 SEQUENCEe VIEW een 142 8 4 Search a Consensus sequence ces iaa 144 9 race DISPla y anana 144 So LTrace DispidseMOLBOGS sn ae AAA EA A EOS 144 Bo HOW TO Read a II A Ben e e M Ms en E 145 0 0 MOI KGOES cod 146 8 6 l Marker SCE OS ardiendo il la ts 146 8 06 2 Tumpino to Markets on the Connie CUECA E 146 8 6 3 Jumping to Markers on Fragment Sequences seri ii 147 8 7 DISSOIVE a CORUG ns a 147 8 8 Sequence Edil an 147 58 1 On sequence Edi AAPP Me A en 147 g8 2 Fracment Sequence did 148 8 9 Reassembly after Removing Sequences uuu 2u0n n00nannonnnnnnnnunnnnnnnnnunnnnnnnnnnnnnnnnnnnnnnnenn 148 8 10 Display Color and Font Settings uu 220 2000 n000 n00nnnnnnnnunnnnnnnnnnn nun nun nnnnnnnnn nnn 149 8 11 Export Contig Sequens aaa 149 8 12 Use DNASIS MAX to Analyze a Consensus Sequence eere eene 150 Chapter 9 Trace DISPla Votadas d cil 151 9 1 Open Trace File from the Project Window 22u20220002n0000n0nnnnnnannun anno erre nene nnne nnn 153 9 2 Open Trace Files from the Contig Trace Viewer uu uuus02u0000n0nnnnnnannnnannnnnnnnnnnnnnnnnn anne 154 9 39 EXPO Trace Files as 155 9 4 Display Color Settings diia 155 9 5 Search a Sequence cias 156 9 6 Operations Within Trace Viewer aaa 157 0 6 Select Bases and Trac ei e d een 157 CEU COP MS P
49. A E DEXNTukar ial Dura apar Tue Bei EET DIST GH E DET id Di vr Magos E Tui Ki Air Docs CHE E DE Tutor w url plam par Tue de SCT LESE DES Tiri id Dog hye vr u Magno Tui i 0011171 04 HES E CB Tutorial Dort grad Tue pe SCNT ID CH E DENT Ms id ii vn asa Tit fee 0011150 CX HS E Ci Tutorial Daria i arri gp larga Tue pe apenas CH E DES Tutor id Di von Moss Tol hi petri e CAHE E DEU Tuty ial ut par Tut s E arm Era LH E DET ed Dorbnik vri Mgr Tol hi Ue i CAHE E DES Tutor w Dura arri pham par Tur as EL es LESE DENT ed Dit vnnd uc Msc Tol hi oer en CHE E LE Tutor ad Dura gg Tur pe DTT TE GEHE E DENT id iii vr Moped Tui bei E ded CHE E Ci Tutor ad Dura arri gang Tut af e GEHE E DET ed Dog tye vr red Tol Ki ESE CHE E Ci Tutor w Dura arri plam par Tur Item List Name Current Path Name Path to a new directory Set OK Import and Export Description Displays the trace data information of broken links Displays the trace data names of broken links The data can be sorted in ascending or descending order by clicking the column headers Displays the current path name of the trace data with broken link The data can be sorted in ascending or descending order by clicking the column headers Designate the directory to relink Displays the Browse dialog to designate a directory to relink When pushed the trace data selected in the list and the files in the directory designated for relinking are compared and ifthe data
50. AM lo zu la TIREE TE BPS D OREL ZTA UT TIE TERA AO NTE T E E L E P E E A B f re e di A A Ya Y sl TM n M H m NOACOTAO E RITO TTFFTEEE TT urakbus im ik iim ot sarro TEE wr mao AA ari L i l i MM WIN DIN il Whey AN hun M Ni wih AN IR Na abe ETS aT Ta ITTTTTA EER E Ea T ACE ATi ra Tia TTC TCA CTA a The page orientation setting should be set to landscape before printing Printing with the orientation set to portrait can result in output that is partially cut off Use the Print Setup dialog to set the paper orientation To display this dialog select File gt Print Setup from the menu Chapter 10 Output 165 10 2 Copying Images 10 2 1 Copy from the Project Window Map View Click in the Map View pane Then select Edit gt Copy from the menu or click on the Toolbar The Map View data is copied to the clipboard The graphics are copied as vector data so they can be copied into other applications such as Microsoft Word and printed out in high quality BEE u an FEM Tree View Click in the Tree View pane Then select Edit gt Copy from the menu All the data in the view is copied to the clipboard as tab delimited text It can then be copied into other applications such as Microsoft Excel and edited as needed EI TRITT cer an um Ea SY Mi DEEP BEE oae ln mis A A HE E HE AL A FT Em 166 List View Output Click in the List View pane Then select
51. CCOTCTCOOCATTCOTCTG CTAAAACTTACTTALC 44442 233334022222334444044444444443332333244043333244444444 ACTGTAACTGGT AGGTCTGAATGHOCCOCTCTCOOCATTCOTCTG CTAAAACTTACTTAC 2223332355555 55555555555 0444445555444445555550555555555555544 ADTRTAALTRRTSAGGTCTGAATUSRCCCCTCTCCCCATTEETCTRSCTAAAACTTACTTALC 0001222222220333111100000003331000000000000000000000111111101 144 Chapter 8 Contig Editing 8 4 Search a Consensus Sequence It 1s possible to search for data within a consensus sequence l In Sequence View click a consensus sequence The base clicked on is selected and highlighted 2 The search menu Toolbar becomes active Next select Edit gt Find from the menu or click ch on the Toolbar 3 lt A dialog like the one shown below is displayed Input the sequence of bases to be searched for in the text box then click Find Next Find LM 3 xi Find what Eind Mest Cancel Match case 4 The search begins from the selected base and proceeds toward the 3 end Matching portions of the sequence are displayed in pink and highlighted Clicking Find Next again causes the program to search for the next match The matches found thus far remain displayed in yellow 5 Clicking Cancel clears all highlighted items and closes the search dialog 8 5 Trace Display It is possible line up the actual trace data in order to evaluate the assembly results 8 5 1 Trace Display Methods l Click the base in the contig sequence you want to display
52. Debs 2 2 15 Vector Database Manager dialog The Vector Database Manager dialog displays a list of vectors registered in the database It also creates modifies HEH TI bate Phap H13 prera WE ee i 4361 Dor vector pAA 322 complaba parara 001744 ROS LEE H 102 Enid Garg vector pil 3 Premeiar Fee lucia 1 4725 Sue pham E51 eta D H phagangd aa PLA Fuar Ea End Feature gtaagegtta asccastasgq ttgagtgttg Bnhqugqcqgas agttttttag tttagagott ir bair Lair ir br bas gocgogotta tuggaagugc atattttgtt cogasatogg ttrragtttg asscogtota ugtcgagutg gacggggasaa rtagggrgrt atgogoogot gateygigeg aaasattrgrty caanatcoct gaaraagagt tceaqquoqst rrgtaaagra gcecqgogaac ggraagtgta acegggcqcq ggeetetteg Description ttamattttt intanatcan rrartattaa qqcccactac rtaaatrcgga giggogagas gcggtrargr tcocattogo rtattargrr Displays a list of registered vectors Displays vector names Displays vector lengths Displays vector definitions gttaaatrag anqganinqac aguarqtgqa qigqasccatco arrrtaaagg aggaagggaa tgegegtaae caticaggot agclggrgaa El E Wa Dese me ewi OE6 Reference Het 64 Chapter 2 Item Accession Cloning Site Cloning Site Name Position CPosition Edit Add Delete Features Features Start End Features Edit Add Delete Edit New Delete Import Export Close Reference Help Window Descriptions Description Displays acces
53. ERRE ERE T P A AA MT SE AAN TN mi imsmmmin ivi imimmia din EST AAA AA A AFP E ee inrmminmi ji Pim ordmiammir FA A E Pb pegqpride liBbibhbrilid Pi iid PEG LEE TEE EEE DEREN BEN TE DEE LTP RENTEN Ce EEE GGG ERR GRE inimmimi idl in s m seminm ri imsumis diia irradia da irinmim iosi ns sspinmm n tmeenis iia Pe ee iri irrnmimib iitmte 1 5msgem e or Toe Pe ee ee TEE Papani iniimimmir tind mins EEP TEEREIT IET IB L i 1 i L L LI Vrimsimi ri ini s in iuemis vidimseumit ir imimmiriiril im iri i L LI 1 1 1 L Poe Toe AAA AE A Poe ANA UT AAA IMAN T lurmmimliisesmi r im eee ee imeem mie mi minnis iig jr db gr jg inammim ii ieee Pm bee milmhumit ir ima Pa mad d rimimyrmirimminrminermemi Fumumin ibi imiumin 5g dd dms da d The page orientation setting should be set to landscape before printing Printing with the orientation set to portrait can result in output that is partially cut off Use the Print Setup dialog to set the paper orientation To display this dialog select File gt Print Setup from the menu 164 Output 10 1 3 Print the Trace View From the Trace View window select File gt Print from the menu or click on the Toolbar The printed output appears as shown below All of the data is printed You can display a preview showing what the printout will look like by selecting File gt Print Preview from the menu DLTQ4EZSS Trace 110 Fridmy March 12 2004 02 37 34
54. LA piha SEI acta D phaganad aa 2329 ESPA Eit Hea ese ome Bert _Feteserce Hee 124 Chapter 6 Vector Trimming 2 Click Import The dialog below appears Ax Look in C3 VectorData amp t E Ex A tumefaciens T DNA vector rontaining nctopine T DNA borders and mark Artificial DMA sequence paD56 of pBR322 derived cloning vector prm Artificial DN amp sequence __ pods rived cloning veckor prm B subtilis cloning_vector DNA Bacteriophage_434 cI gene ins Bacteriophage lambda beta lactamase Ap galactokinase galK aminagl Files of type Vector Parameter Files prm Cancel y 3 Select the vector data that is to be imported and then click Open The Vector Database Manager dialog appears again and the new vector will be added to the vector list The vectors are registered in the VectorData folder This folder 1s located inside the Database directory created when installing DNASIS MAX The default path is C HSK_DB VectorData More than 900 vector databases reside in the VectorData folder The contents of these vectors can be viewed with the VectorTable txt file located in the VectorData folder The most convenient way of viewing this data is to use MS Excel or a similar spreadsheet application 4 Once the required vector data has been registered click Close to exit the Vector Database Manager 6 3 Trimming l This procedure sets up the t
55. Mab LAA RAMA CG TIA 1 z x YT TW CT DE Cs TTD YT Tea C WUT COE E TOATA ATEA TOL rH 25 TAGPCATETCCRET ET Um S TBEAGE MEILE 1 Tw CT EA Ce TGOGTED S E TE TANGA IG A oC ON Tii lA TCR TAG AGA Ts TEAM ME ACOSTA TEA TA ET CTAE aC TTA ECA ES DSTOG THTG CA GC TT ACTA EN ATE pgs sE eo a E E 3 TNT m ll n a li MT In TUA ul I ul td 7 lini di Lou ii hi n i ji a fh ws TER zi m Bn a 1m 110 Te TTELLTH ETET ms ANGE Toke TE eR METH CRM de US EB EMITE ou ELLIT g amp TEC sort roi ba i Ts a ERSTES Tr Cos GB TT Tain iT E FEBSAG CTE STEDSAMTA 5 1 ERETT GER Tere hi i WT f Sea M ose AN MM M f 1 i I TON er NAH ME LN aei N ei Asn Hut Nee REES DEER ATO a Bu n TIEFEFLECIELAETETTECE IC ICE 4 TIIFECCHECAETETFTECT IC ICE E LN md Mtt MM Wha n si v aud i Ww I i VULT 9 2 Open Trace Files from the Contig Trace Viewer It is possible to display the traces of trace data fragments linked to a contig displayed in the Contig Trace Viewer window Select a contig in Contig Manager Then double click it or click Open on the Navigation Toolbar to open the Contig Viewer Continue with the procedure below l Click the base in the contig sequence you wish to display This will select it The base in the selected contig sequence and the bases in the corresponding positions in the fragments composing the contig sequence are highlighted Hi GAGATTAAGCCATAAAGGTGGAGRECCATGTICGTGGGCTT AGGACCT 3021463
56. Manager Tutorial for details on how to use the tutorial data Start up the Contig Manager Select Programs gt DNASIS MAX gt Contig Manager from the Start menu The window shown in fig 5 will appear Tu d E iT Daie arra neues I nario Be I E A a Doc J pal BE III fig 5 Initial window Chapter 1 Contig Manager Tutorial 8 Chapter 1 Contig Manager Tutorial This chapter explains the basic operations of the Contig Manager which enables the sample data to be used through a series of simple operations Chapter 1 Contig Manager Tutorial 1 1 Foreword 1 1 1 Contig Manager The Contig Manager is a user interface that enables sequencing to be carried out with DNASIS MAX Contig Manager both simply and graphically 1 1 2 Contigs and Fragments A contig is a consensus sequence constructed by assembling sequences A fragment is sequence segment used for constructing contigs 1 1 3 Data Management by Project The Contig Manager enables the entered fragment types sequences trimming results assembled sequence results quality values and other data to be managed under single analysis units known as projects Multiple projects can be created to allow data management to be performed independently for each user or for each sequence analysis 1 1 4 Start up the Contig Manager Select Programs gt DNASIS MAX gt Contig Manager from the Start menu to start up the Contig Manager 1 1 5 Create Projects
57. MiraiBio DNASIS MAX Contig Manager User s Manual For Research Use Only Part no C 51125 10202 Preface Preface Thank you for purchasing DNASIS MAX from MiraiBio DNASIS MAX incorporates an excellent user friendly graphical user interface GUI and Contig Manager database for taking full control of fragments and contigs And by installing the Contig Manager Version 2 0 users can take advantage of sequence assembly at even higher precision and higher speed Read this manual thoroughly to ensure correct usage Note e Thecopyrights for this software and user manual belong to Hitachi Software Engineering Co Ltd e Itis prohibited to copy or reproduce the contents of this manual in part or in whole e This manual is subject to change without prior notice e Hitachi Software Engineering Co Ltd is not responsible for any erroneous or incorrect descriptions in this manual e The use of this software and user manual is based upon agreement to the stipulations laid out in the Product License Agreement First Edition July 2002 invalid Second Edition February 2003 invalid Third Edition April 2004 O 2002 2004 Hitachi Software Engineering Co Ltd All rights reserved DNASIS is a registered trademark of Hitachi Software Engineering Co Ltd DNASpace is a registered trademark of Hitachi Software Engineering Co Ltd Windows is a registered trademark of Microsoft Corporation All other company and product names mentio
58. Project dialog will display Import Project select the project to import ig 10 El Copy M ODOLT ig Gopy P 00001 ig 4 00001 ig M O0002 E M O0003 ig F 00001 ig P 00004 E P O0005 Option f Add project name to head of data name Use original data name Gancel 2 The existing project will display in the window Select a project to import 3 Check the Option box and click OK Add project name to head of data name Project names are added to the front of the names of each fragment and contig included in the imported projects Use original data name Adds data to the currently opened project leaving the names of each fragment and contig included in the imported projects as they are If importing would create duplicate fragment or contig names the data cannot be imported 4 5 Relink of Trace data The trace data imported into a project don t actually contain trace information they contain path information to the trace files Therefore if the trace data are moved or deleted after the import process the path information of the trace files will not be correct and a 7 icon will display in the Contig Manager Relocating the trace data files in Contig Manager is called relinking Select Contig gt Relink Trace Files from the menu to display the Relink Trace File dialog 108 Chapter 4 Eora dt bar org link to org read iraca ida Plage ge up thi path to the irane File 54 stri 0460 GAH
59. TGC TGATca eadeeal AGCC AGAGACAGGAGCTTCAGGTTAXCERTBATGT TGAGCACCAKAATGCTGATCAAGAGGGATAGCE AGAGACAGGAGCTTCAGGTTA CCL INSTOTTGAGCACCAAAATOECTGATCASGAGGGATAGCL AGAGACAGGAGGTTCAGGTTA CCOTGANGT TGAGCACCAAAATOCTGATCASGAGGGATAGCE cecectat Cursor Fragment sequence 8 8 1 Contig Sequence Editing 1 Click a contig base sequence 2 The cursor moves to the base sequence you clicked The base sequences of the contig on which the cursor is positioned and the fragments composing it are highlighted 3 Move the cursor to the place in the base sequence you wish to edit 148 Chapter 8 Contig Editing 4 To move the cursor either use the and keys or click the base sequence you wish to edit directly with the mouse Replace Move the cursor to the replace position in the base sequence Input the replacement using the A G C or T key When the replacement is made in the contig base sequence the corresponding location in the consensus sequence will also be replaced with the input base value 8 8 2 Fragment Sequence Editing l Click a fragment base sequence 2 The cursor moves to the base sequence you clicked The base sequence on which the cursor is positioned is highlighted 3 Move the cursor to the place in the base sequence you wish to edit 4 To move the cursor either use the f f and keys or click the base sequence you wish to edit directly with the mouse Move the cursor to the place in the base sequence wher
60. TT TALC ET ETA TO E T TT CA CI TUEC AC TT RAO TOT E anui ix BigrisatcclEged CT AA pee SALT Tact ib Ih 14896 hec OCs TOR TCET ET E ph i8 GACT Ta CA TT TA PEZ AT ET 5 TO E AG TT CA DC TOC AC TT eae Sx d i0 ls cO TCCCTCET CTA GAA GACT TA CA TT TA CG CC AT ET AG TG SA AG TT CA DC TG CE AZ TT E AG JEPIT Bho Ges TE Tol EL A A ACT Taba TT Ta CAT ET AC TO CARO TT Cabo TOCA TT Bag A LES 307011354 AER ET T nz cm ST 30720445 AJ l Elx Fux Bmw g Graphical Display of the Composition The Contig Viewer is divided into top and bottom panes The top pane graphically displays the entire subject Map View and the bottom Sequence View displays the contig sequence top stage and each fragment sequence Chapter 1 Contig Manager Tutorial 21 1 2 10 Sort and Display Trace Data Actual trace data can be sorted and displayed to evaluate assembly results l Click the base value for the trace that is to be sorted and displayed on the contig sequence and then either select View gt Chromatograms from the menu or click Show Chromatograms Fal with the base value highlighted 1320 1330 13 AACCTGACAAAMTGTTCTTGBCTG LARCCTGACAAABTGTTCTTGGCTG AACCTGACAAABTGTTCTTGGETG LARCCTGACAAABTGTTCTTGGCTG Highlighted base values 2 The trace data will be aligned and displayed based on the selected base value Trace data sorted and displayed 3 The status of the trace data display is linked into the selected position of the se
61. The parameter for trimming the end of fragments Trim at least The base value for unconditional 5 and 3 ends trimming Trim the first XX bp while the The base value for average movement trim the first XX bp with the unstable base N quality is less than XX 9o percentage for the fragment s end quality is less than XX Trim Vector The parameter for removing vector sequences included in fragments Select Vector The check boxes for selecting vectors to be trimmed Select 1 or 2 cloning sites The check boxes for the cloning sites to be trimmed Window size for vector trimming The parameter for setting the base length window size to be extracted from the vector cloning site sequence that is used for determining the vector sequence area Set with integers of 15 or higher Minimum matching percentage The parameter for setting the minimum percentage for matching the vector cloning site considered as contamination sequence with the sequence targeted for trimming Vector sequences that are larger than the percentage set here will be ignored Trimming is performed on 5 ends and 3 ends with the conditions set for Trim the first 10bp while the quality 1s less than 90 for explanatory purposes in this tutorial Note that trimming will not be carried out for registered vector sequences with the sample fragments provided by the tutorial Proceed onto the next section on Add Vector Data 1 2 6 Add Vector Data l Click Vector Data
62. This operation is typical of Windows based programs such as the Windows Explorer Delete Folders 1 Select a folder to delete in Tree View and press the Delete key on the keyboard or right click the folder and select Delete A delete confirmation message will appear ContigMgr X All data in the Folder will be deleted Are vou sure ka continue this operation 2 Click Yes The folder and all the folders contigs and fragments within will be deleted Chapter 3 Project Window 87 Display Folder Properties l Right click the folder to display the property in List View 2 Select Property from the popup menu 3 The Property dialog will appear Folder YRoot 301 94014 Length jo bp of Fragments po Low Quality BPs Comment Item Description Displays the folder name Can be renamed Refer to Rename Folders for the details Folder Shows the location of the corresponding folder with the path from the root folder Length Displays the total number of base pairs in the fragments of a folder of Fragments Displays the number of fragments in a folder Low Quality BPs Displays the number of base pairs in low quality regions in the fragments of the corresponding folder Comment Displays folder comments They are editable by the user Rename Folders 1 Right click the folder to rename 2 Select Property from the popup menu 3 The Property dialog will app
63. Trace data 3 The Phred basecall data is saved in the Basecall result by Phred folder Double click this data to display the trace data The original basecall the Phred basecall the Phred QV and the trace data Original Basecall Phred Basecall Phred QV can be viewed Results of Phred 42 Chapter 1 Contig Manager Tutorial 4 The vector sequences deleted with trimming are output to the Trimmed sequence folder Of the 30 items of data input with this tutorial 17 have been vector trimmed This shows the vectors regions replaced with N NNNNI caaae Trimming Results 5 The vector sequences that could not be deleted are output to the No trimmed sequence folder Of the 30 items of data input with this tutorial 13 have been separated as data that could not be vector trimmed 6 The results of Phred QV masking and the data for which the high quality region bp count is longer than the threshold value 500bp with the tutorial are output to the High quality region is short folder Of the 17 items of trimmed data input with this tutorial 12 1tems of data are judged to have long high quality regions Double click on the data to display the results and show the low quality regions masked by N Masking results with Phred QV 7 The data for which the high quality region bp count is shorter than the threshold value is output to the ok High quality region is short f
64. TutorialData2 folder and then drag and drop it into the TutorialFolderl folder on the Contig Manager s Tree View 4 File reading will complete after a few moments The Import Summary dialog will show the total number of data the number and names of imported data the number and names of skipped data and the number and names of error data Dropping this file into TutorialFolderl enables the fragments contained in the folder to be read directly 1 3 13 Sequence Assembly With Only the Sequence Data Contained in the Folder l Click TutorialFolderl in Tree View to display a list of the contigs and fragments contained in the folder in List View 2 Select all of the fragments in List View and click Assemble on the Navigation Toolbar 3 A message stating Some of the selected fragments are connected Are you sure to dissolve the connection and continue operation will appear Click Yes to continue with the process ContigMgr x N Some of Ehe selected Fragments are connected Are you sure to dissolve the connection and continue operation 4 The assembly process will be performed and Contig37 will be created immediately beneath TutorialFolderl 32 Chapter 1 Contig Manager Tutorial i 1 000 2000 200 re bh dh Ach TR Se A A A aug zi gj Root 193682 bp 352 B TutorialFolder 256945 bp 54 one 2807 bp 8 Conte 731 bp 1 H 8 Conte 703 bp 2 215 Contig37 5 Clearly adding fragments and re assembling the da
65. Xbp or less to XX bp output to NG folder when this check box is selected 2 In this tutorial the threshold of the QVs for both ends are set to 29 the threshold of the QVs for the entire sequence are set to 19 and the bp count of the high quality regions to be output to the NG folder is set at 500bp and lower Masking Parameters v D End allum Mask while moving average of GV ig less than or equal q o Moving average window size 10 e Mask as M Mask while moving average of QW is less than or equal A 03 Moving average window size 10 Mask as M Mask while moving average of QW is less than or equal 19 Moving average window size Mask as M Output Parameters Output Parameters p TE M If high CU bp is less than or equal Qa bp output to NG folder 1 4 3 Trimming Setup This tutorial uses the vector registered in section 1 2 If the relevant vector has not been registered refer to 1 2 6 Add Vector Data to register the vector before continuing with this tutorial 1 Double click Double click this to set the vector to open the trimming settings dialog 2 Select the Trim End check box at the top and then set 5 End to Trim the first 10bp while the quality is less than 90 and 3 End to Same as 5 End Chapter 1 Contig Manager Tutorial 39 a End X4 5b END Trim at least e Trim the first 10 bp while the quality is less than go
66. a neasaamaccT E So GDAAATT CT CAGALAAACEGAE i swetl che pagwonaecl gaota A Vil wi p UM IM iud wl WAT Wi AA Im 14u SW 125 TU ATT betel caatt tit canta HATT ree AG RAT CANCHT T TACO AMMEPORAGIALUTITATAC TTE Agni d d angit AAA TL EA dusstissiids EF Le eee ena giall ittak E EET 120 1 180 Tu 150 12 pla Be les des Bl ed TT ERI AGAT BAG OTAT Jib ii bbs FEDERE ANM ae el geosal Lt gi IGCTTTAAAAT cht laaaal ING ulli N inl N a Il IN n Mi F il LL ETE amp Display Multiple Trace Data with the Trace Viewer 1 2 5 Trimming Parameter Setup 1 This procedure sets the parameters for erasing vector sequences sequencing primer sequences and other to be assembled with even higher levels of precision elements before the fragments are assembled Removing these sequences prior to assembly enables the sequences Click Detail under Trimming group on the Navigation Toolbar to display the Trimming Parameters dialog F rn End _ F EEHD Trim ar kaat T be Fl Trim the dirt 10 bp mile the quality is less than x Rm FEHI Ll Trim si regi m bn Iron de ies 10 Dr mme bor ed rm x Inn a X Fe Sara arb EHD a A A am coma manam a amp Wurter Dwtabars Manager ce He Trimming Parameters dialog 16 Chapter 1 Contig Manager Tutorial This dialog is used to set up the parameters for trimming Below are parameter descriptions Item Description Trim End
67. a 1 gt TutorialVector from the tutorial data default C HSK_DB TutorialData select the Tutorial VectorA prm file and then click Open 5 The window will return to the Vector Database Manager and TutorialVectorA will be added to the vector list 6 Perform the same procedure for TutorialVectorB prm and TutotialVectorC prm to add a total of three vectors When registering the vectors to be trimmed with actual analysis data add any of the vectors from the VectorData folder default CAHSK DBWectorData that is specified beneath the Database directory when DNASIS MAX is installed If the location cannot be found select Programs gt DNASIS MAX gt Tutorial Data from the Start menu The required folder is in the first hierarchy of folders in the database This folder contains more than 900 different types of vector data Refer to the VectorTable txt file located in the VectorData folder for details This file can be easily viewed with Microsoft Excel or another spreadsheet application 7 Register the vector and then click Close to end the Vector Database Manager 1 2 7 Trimming Parameter Setup 2 This procedure sets the parameters required trimming using the vectors added in the previous section on Add Vector Data l Selectthe Trim Vector check box on the Trimming Parameters dialog 2 Select the TutorialVectorA check box on the Select Vector list 3 Select the PrimerA check box on the Cloning Sites list Trim Vecto
68. ality value The same as clicking IG on the Toolbar Displays the sequence and quality value The same as clicking IN on the Toolbar Displays the trace data of the sequence selected in Sequence View The same as clicking Fy on the Toolbar Quality Lists Auto Scroll Preferences Help menu Contents About Contig Viewer Displays the list of the consensus and the high quality region of a fragment in a dialog The same as clicking on the Toolbar The criteria for determining the high quality region can be set with the Quality Tab in the dialog which is displayed when selecting View gt Preferences from the menu Additionally selecting a high quality region from the list in the dialog and clicking OK will underline the corresponding sequence and region in Sequence View Sets whether to automatically compensate the display position of the Sequence View Displays the parameter setting window The same as clicking on the Toolbar Description Displays the Help for Contig Manager Contig View Displays the contig version information Chapter 2 Window Descriptions 67 2 3 2 Toolbar Button Description Prints the contents of the currently active view What is displayed will be printed The function is the same as selecting File gt Print from the menu ch Searches sequences The function is the same as selecting Edit gt Find from the menu a Outputs the currently open contig to DNASIS MAX The data is
69. an asterisk The display colors can be changed from the Preferences dialog Refer to 2 3 6 Contig Viewer Parameter Sequence Tab for details about this dialog Scrolling The alignment sequence can be scrolled to the left or right using the horizontal scroll bar at the bottom of the Sequence View pane or by moving the cursor in Map View It is possible to have the display automatically scroll vertically so that the bases are always displayed at the top ofthe Sequence View To select this option clear the View gt Auto Scroll check Quality Value Display It is possible to display quality values below the base values of contig and fragment sequences To select this option select View gt Display Type gt Quality Map from the menu or click iG on the Toolbar The quality values of the bases are indicated by bar graphs Alternately select View gt Display Type gt Quality Numeric from the menu or click IN on the Toolbar to De READ EE UD WE ee a A aa ken AOS ARE A A A cR display the second digit of the quality values in numeric form 30214632 20201094 30207178 30201104 H E ACTGTAACTGGT AGGTCTGAATGROCCOCTOTCOOCATTCOTCTG OTAAAACTTACTTAC BB5733338058530333237766770338580 777777776777 7 T07 772 7 7 8888 7 778 ACtestacTGGtaagetCTGddtesecectctctecalTOCTCtegctaaactttalTTac 0110000110000001111110000001111110000000000110011001111111111 ACTGTAACTGGT AGGTCTGAATG C
70. arameter SEUD ZE IA A A ASS Rt ASE Alice Dat dd 17 1 28 PERO EH Auto ASS MD eiei ea A A 18 220 Display one Re lit 20 1 2 10 S0rH and Display Trace Data a usar ee 21 D ES SEDD Ve a ee UM a N 22 122 7 E at the Contre Nana p E ve ee se ER DR 23 1 3 Analysis Example 2 Sequence Clustering and DNASIS MAX Links 24 LU Statt upalhe Contro Inde cores uec RA PRR ctt Abate ee A dn eM M AER cM AA ee Lia Al eL 24 IE A ETICA A TE 24 L3 Enter LACS QU Ah etat cette edat tou edat eaaet IN ed uut Eo tui 25 IN AAA no ER A 26 bs AU USAN Ihreshold nenne ee ee ee 2 136 Examine Assembly Results uoce t PO tO nene I M MM MM LM PN E E 27 Lo P Display Assembly Status Dt teen eee tiec dudes dtt 27 S rod Eink DNS ES EA ee M 28 Lio Mace sequence Data Dy Folder ce ido 29 L3 TOC reate a NW older ee ERU MM E ME 30 L5 KIE NIS Rd GEH ee ese tota ee ee RN 30 1 Add Seguen e D3Eq ne ee EAE O A A PR 31 1 3 13 Sequence Assembly With Only the Sequence Data Contained in the Folder ccccnnnnncooooononcnocccononananononnnnnnnonocnnnnnanananonos 31 1 23 14 Dissolve AssembledoSequernces uds d D ee esse me Pe E M I KD M E 32 Peale or n Ro AMA ENERO RUMP RA 33 1 4 Analysis Example 3 Analyses Using Phred Quality Values 36 1 41 Startup DNAS Pace and Openms Spade cus aeos cete a ox Pd Oa ses 36 1 4 2 Set Sequence Masks and Selection Parameters of Quality Values ooonnnnonouuoococccccononanon
71. as trace data to select it Clicking as base in the contig sequence causes the corresponding bases in the fragment sequences to be selected as well Clicking a base in a fragment sequence will only select that base azal 324i 32d a260 CGGTATTRTATGAAGGCMAGGASACAGACAGGACDCTAG ceggat TOTATGAAGE Bib ceaateatactecaactag COGTATTGOTATGAAGGC RAGGASACAGACAGGACCTAG COGTATTGTATGAAGGCRAGGAAACAGACAGGACCTAG COGTATTGTATGAAGGCRAGGASACAGACAGGACCTAG COGTATIGTATGOAAGGO Rt gacacAGACAGGACCTAn 2 Select View gt Chromatograms from the menu or click N on the Toolbar The relevant trace data is displayed with the selected base in the center This step can be omitted if trace data is already being displayed Chapter 8 Contig Editing 145 8 5 2 How to Read the Trace Display ae Jos gan 06a c8 aco T Wi PERT RRR REPEC CeCe ee ee Ree u k N 7 Brad d LAT A A lg J AA y AI NA A LAA A Au AN as ALL Le el A ERS li zi i d zz I1 LN TIL E EE fi E L i La gi j rE E ETEEL E E E EE i IIEJLJI TEZ AI AA Ll The display consists of four sections They show starting from the top the sequence name the bases a graph indicating quality and the traces Since data for multiple sequences 1s displayed arranged from top to bottom the data displayed on one line does not wrap to the next line To see more of a particular sequence use the horizontal scroll bar to scroll the display RM ly Sequence Name A sequence name
72. asecall Results in SCF Format 119 Export Phred Results 119 Export Sequences 109 Export Sequences of Fragments 109 Export the Original Fragment Sequences 109 Export Trace Files 155 Export Trace Files 111 F Folder Properties 87 Folders 77 86 170 Fragment Properties 96 Fragment Sequence 148 Fragment Sequence Editing 148 Fragments 77 91 96 Import ACE Files 106 Import Fragments 91 96 Import Projects 107 Import Sequence Files 104 Import Summary 53 Import Trace Files 103 Installation 2 K Key Code Input 3 Key Code Issuance 4 L List View 83 Low Quality Value Regions 117 M Main Window 81 Map View 81 85 Markers 146 Merge Projects 80 Mismatch Display 143 Move Contigs 89 93 Move Folders 86 Move Fragments 30 92 96 N Navigation Toolbar 50 O Online Help 47 Index Open Project 52 P Phrap 129 Phrap Parameter 56 Phred 115 Phred Basecall 115 Preferences 52 Printing 161 Project 77 Project Window 47 Project Window Map View 51 Project Window Menu 48 Project Window Status Bar 51 Project Window Toolbar 49 Q Quality Value 115 143 Quality Value Thresholds 118 R Reassembly 148 Register Vectors 123 Relink 107 Relink of Trace data 107 Relink Trace Files 64 Rename Contigs 95 Rename Folders 87 Reset 126 Reset Test Data 126 Revert Projects 80 Ruler 142 S Save Projects 79 Scrolling 143
73. at are read clearly and not clearly are treated as equivalent information On the other hand Phred calculates the accuracy of called bases attaching a numerical Quality Value QV to the results QV is defined in the equation below O 10 X logioP Q Quality Value representing the accuracy of a called base P Estimated error probability of a called base The relationship between basecall QV and accuracy is shown in below 5 2 Display Basecall Results and Quality Values Basecalls and quality values can be displayed following the procedure below 5 2 1 Prepare Trace Data Start the Contig Manager and create a new project Refer to 3 3 Create a New Project for creating new projects Import trace data into the project Phred basecalling can only calculate the quality values QV for trace files QV cannot be calculated from a basecalled sequence that doesn t have trace data Refer to 4 1 Import trace files for importing trace data 5 2 2 Phred Basecalling 1 Select data to Phred basecall on the List View 116 Chapter 5 Name tenth mh al 951 bp 20194504 30201110 30201132 20201135 30201147 30207122 30207146 30207165 966 bp 919 bp 943 bp 960 bp 4406 p 965 bp Selecting Data to Phred Basecall Phred Basecall and Quality Evaluation 2 Ensure that Use Phred is checked in Basecall group on the Navigation Toolbar click Basecall Bazecall use Phred Bazecall
74. ath D HSK_DE Manual Data Trace 301 94804 ect Comment ain Y Cancel 3 Type a comment in the Comment box Up to 255 characters can be used 4 Enter the new name and click OK The fragment will be renamed Chapter 3 Project Window 99 3 15 3 Display Data Display Contig Data Double click a contig on the List View The Contig Viewer will start and the corresponding contig will display enl oe Det 2 z FAA ATA SIT HIN mud pur Aa AREA pe re i p IE P Ma Lu TEC oH d real ot Prada Fi TT T Lia Maa al TUS Lia ETILE i oe u ES HU EARL TEE MEDIE ZU LH FE EEE E Li i col pa ITI a a a ee En ET IT 3 Display Sequence Data Double click sequence data in List View The Sequence Viewer will start and the corresponding sequence data will display 2 WETTER DDACANDATC M OCTAN iti TOCACACTTA CETACTGTT CTCTTACT 151 AATOTOCTTT TIT FTE TA ACTA TT za ACTAGCACTG TOCTITACTG GAAL METETE All AGTATTAAOD agreman 100 Chapter 3 Project Window Display Trace Data The specified file can be displayed in trace from Tree View Double click the file to display More than one file can be selected simultaneously Bia FACET TE Y iL A TTG amp ET TG ACTG ACTA GT kic E lto motlgec opie El a E GATE CTA CT ECCTATCACA E at Lack L MEC mc a i 1 hl of 3 15 4 Other Operati
75. avigation Toolbar Ifthe Use Phred check box was selected under the Basecall group Phred basecalling will be performed with assembly taking into account the quality values QVs If the check box is not selected assembly will be performed based on the trace s internal basecall data without regard to the QVs 3 The contig sequence information is added to Tree View once analysis is completed Comme 28 389 bp 30 CTTTTETTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTITITTITITITITITTITITITITITITTITITIITIIITITITIU s Contig 15 Ema Contig 3 104 bp 15 102 New contigs 4 Trimming results and direction information are added to each fragment in List View Mame Lengh Trimmedien vector tow vs f lt comment bei 30194504 az bp 24bp TutorialWector 379 P gt h 30201067 936 bp 30 bp TutorialvectorB a4 OB S r bei 30201093 941 bp 25bp Tutarialveckarc 390 3 gt be 30201094 919 bp ag S The List View with the new information added Contig Manager Tutorial 19 In the example above the length of fragment 30194804 1s 927bp after trimming the trimmed bp count is 24bp the name of the vector used for trimming is Tutorial VectorA the number of base pairs within the range set as Low QV with the QV as 379bp the basecall procedure was performed with Phred trimming has been complet
76. base Manager on the Trimming Parameters dialog 2 The Vector Database Manager for managing registered vector data will start up 57 Vector Databases Manager Chreng vache MEER compie yens UIER C ple SE ZH Dikeni SEL verte DAS ger ies A SEU SS Ex pels Ponte Vector Son Lloreng ith Pal 3 Prosohie Ines kacders uaria 9 peluescipe Kie Eg pBluecrp Ete recto DA phagemid exi 52 x Phage M12 genome Gin Fhage M13 genome voire 102461 Kado C psluscrpt SET 2350 piker SE rectos OMA p agersd ar SES r Ghning Sre cFamhrms Stat Ena Font agcgcccaat Acgpcasabog potctonoccg pgcgttgqcc qattoathbas tgcagctgqgr scgecosggtt toccqgsctqg smesgcgsgca gtgqegpgcss cgqcamttast gigegttagd Ecectcatts gucaccccaq gotibecect ttatgctice sgchostatg itgtsiggen Ebgtgagecag absacasith cecac csas scagctetge Geatgattec gasbicqagc Leggtacseg ggsatecter acagtcgacc Lgcaggcatg eaagettgge ackescegte gttttacamc gqtcgtgsctg ppasascoct ggcgttaccc aacttaatcg ccttgcagca catocccutt togocagotg gcgtantegc gasqgaggccc goscogsteg cccttcccam cagtigcoza goctqsstggq czaatgscQqc ctgstgoggt attttoctcct acgcatctg Egoggtett cecaccgcak acskcassgr seocetagta cocgcochot sgegescgcst Gier Fafimenca Help Vector Database Manager 3 Click Import to open the dialog for importing vectors Chapter 1 Contig Manager Tutorial 17 a acts Ion Fame Dialog to Import Vector Data 4 Select ContigManager gt TutorialDat
77. boxes for the items you wish to display as marks Refer to 2 3 6 Contig Viewer Parameter for a description of the Preferences dialog Contig Yiewer Parameters I x Consensus Map Sequence Quality Display Font Font Mame Courier El Font Size 2 Marker Color Consensus sequence EN Fragment sequence Find sequence of consensus i Selecting sequence NN Emphasis sequence Consensus Marker v Low Quality Ambiguous Code Mismatch Base Cancel Help 4 Click OK The markers are displayed above the contig sequence E 3 2 BRTTCCTTTCCAGCTTETCTCTCTCCTSCACTCA 20227255 GGTTCCTTTCCAGCTTRTICTCTCOTCCT CACTCA 390201147 GGTTCCTTTCCAGCTTRTCTOTOTCOCT CACTCA 30201033 GGTTECTTTCCazgatiBMtetotttcttececic 8 6 2 Jumping to Markers on the Contig Sequence After specifying marker types to display it is possible to jump to marked bases in the contig sequence Click the contig series in Sequence View Now clicking zi or E causes the focus to jump from the current cursor position to the next marker to the right or to the left It is possible to continue jumping until you reach the marker closest to the end of the contig sequence Chapter 8 Contig Editing 147 8 6 3 Jumping to Markers on Fragment Sequences It is possible to jump to positions where the fragments and contig sequence do not match Click on a fragment sequence in Sequence View Now clicking zi or Ley causes
78. ce region to export in Sequence View of Contig Viewer 2 Select File gt Export from the menu 3 When the Save As dialog opens designate the location and the file name to save and click Save 4 When exporting the whole fragment length by clicking the arrow of the corresponding fragment in Map View the entire fragment can be selected 5 When performed with more than one fragment selected the sequence will be exported in multi Fasta Format Method to Export from Trace Viewer It 1s possible to export from Trace Viewer only with trace data l Click the fragments to export in Sequence View of Contig Viewer to make them active 2 Select View gt Chromatograms from the menu of Contig Viewer 3 The trace data of the corresponding fragment will display in the Contig Trace Viewer 4 Select File gt Export Phred from the menu of the Contig Trace Viewer 5 When the Save As dialog opens ensure that the file type is FASTA assign an appropriate name and click Save 6 Ifapart of Phred Basecall the lower row of the sequence data is selected and exported only that selected region will be exported 4 6 2 Export the Original Fragment Sequences To export fragment sequences use the methods below Exporting by these methods sequences will be exported as they were at the time of input no matter what condition the sequences are in 110 Chapter 4 Import and Export Method to Export from Contig Manager l Sele
79. column header is clicked the names are sorted in ascending and descending orders Chapter 3 3 11 3 List View Project Window 83 The List View displays the contents of the folder selected in Tree View he BDEDTIZZ i SGOT Ae he SEDI h SICOTIED he SDEDTITE ha arides he SET i atatum mata Column header item Name Length Trimmed Len Vector Low QVs it az Comment Satake 3828 P Rn A s p E pn DF pa Foo a A Mn pr E a a a a a a a a a fF a a a a a E Description Displays the names of the contig and fragment Each time the column header is clicked the names are sorted in ascending and descending orders Displays the bp length of contigs and fragments Each time the column header is clicked the names are sorted in ascending and descending orders Displays the number of base pairs trimmed by performing Trimming Displays the corresponding vector name when a fragment is trimmed by a vector Displays the number of low quality base pair regions in the corresponding fragment The threshold of quality can be set in 2 2 8 Preferences dialog Indicates fragments for which Phred was performed Indicates trimmed fragments Indicates the link direction for fragments that are linked If comments are attached to folders or fragments they are displayed here Each time the column header is clicked the names are sorted in ascending and descending orders
80. crine hh ted eda A MEE D Ld 89 3 14 3 Operations for Framed dd dd 91 Sud O OR AN 92 23 15 Operations M EISE VMieW ra A ON 93 SA Operations for CONES iniciei idad ierdie t 93 30152 Op tations tor Fragments N A O 96 do 99 5192 20 e A D DL DL DU E EUN DII DHT ATTI 100 Chapter 4 Import and EXPO unas iaa Rina b RU Oa e Ri d 101 4 1 Import Trace FUES toas 103 4 2 Import Sequence FIICS usns nee 104 AS ueplgd isu Auirlvsee DET EN 106 4 4 IMBOFt Projecls 5 107 49 RelINnK Of Trace rep 107 4O EXPO SEQUENCES cora o 109 4 6 Export Sequences of Fragen ee a 109 4 02 Export ihe Orismal Erasment sequen 2 SS euge EE 109 4 63 Export Contig SequUeflCeS aaa E E EETA E e pne oru bu EE A d a ape ETE Du Gau brad 110 46 Export Conte sequence 10 DNASIS MAR anne een 111 4 Export Trace FOS acia 111 4 RLE pot Oreina Bassel as Trace Dale aset ve t qu e gan nata 111 4 12 Export Phred Baseeallas Trace Datsun n rp tee HU NO er MAU COMMI ee ge 111 Contents V Chapter 5 Phred Basecall and Quality Evaluation 113 5 1 Phred Basecall and Quality a a 115 Sohal PAra Baseta anne E EE E E ENEE NE E E 115 STL CU VVE E dtt Ad ee ee ee 115 5 2 Display Basecall Results and Quality Values ooncccnnnccnnniccnncncnconcnnonannnnnronanronannnnannnnas 115 920 Prepare Trace Data ran erbauen 115 9 2 Pr ed Basecall ne een ee ehe 115 22 5 Display Basecall ReStlts Sense nenne euere 117 5 3 Search Low Quality Value Re
81. ct the fragment sequence to export in List View of Contig Manager 2 Select File gt Export Sequence gt Export Original Sequence from the menu 3 When the Save As dialog opens designate the location and the file name to save and click Save 4 When performed in List View with more than one data item selected the sequence will be exported in multi Fasta Format Method to Export from Trace Viewer l Double click the trace data fragment to export in List View of Contig Manager 2 The trace data of the corresponding fragment will display in the Contig Trace Viewer 3 Select File gt Export from the menu of the Contig Trace Viewer 4 When the Save As dialog opens ensure that the file type is FASTA assign an appropriate name and click Save 5 Ifselecting a part of the original basecall the upper row of the sequence data to export only the selected sequence region will be exported Method to Export from Sequence Viewer 1 Double click the sequence data fragment to export in List View of the Contig Manager 2 The sequence data of the corresponding fragment will display in the Sequence Viewer 3 Select File gt Export from the menu of the Sequence Viewer 4 When the Save As dialog opens assign an appropriate name and click Save 4 6 3 Export Contig Sequences To export contig sequences use the following methods Method to Export from Contig Manager l Select the contig data to exp
82. d ending points for searches will be perfectly identical points more than the number of bases set here The setting can range from 1 to 6 4 Sets the number of bases bp to compare in the maximum matching of fragments When the part to compare is greater than the number of bases set here the ends of the part to compare will be repeatedly compared by half the value set here The setting can range from 200 to 500 200 To embed MIME information sets the header name for contig information the actual name of a contig will be the value set here the order of creation Value up to 64 letter characters both capitals and lower cases and the underbar 56 Chapter 2 2 2 13 Phrap Parameter dialog Scoring of pairwise alignments Phrap Method ParameterSet Editor Item penalty gap init gap ext Taw Description Initial setting Sets the mismatch penalty for SWAT comparisons 2 Sets the gap initiating penalty for SWAT comparisons 2 Sets the gap extension penalty for SWAT comparisons 1 Uses raw rather than the existing Smith Waterman scores Window Descriptions Chapter 2 Window Descriptions 57 Others Phrap Method ParameterSet Editor E X Assembly Program Input data interpretation Output Scoring af pairwise alignments Others Miscellaneous Banded search minmatch Minimum length of matching word to nucleate E bandwidth Halt band width 1 4 Filtering of matches
83. data In parallel display mode the sequence to copy from should first be made active Index Index A ACE Files 106 Alignment 142 All Contigs Display Mode 84 All Fragments Display Mode 85 Assembled sequence results 9 Assembly 131 Attach Comments to Contigs 91 Attach Comments to Folders 88 Attach Comments to Fragments 98 B Basecall Results 117 C Check Fragment 54 Consensus Sequence 144 Contig Data 99 Contig Detail View 133 Contig Editing 139 Contig Map View 141 Contig Properties 90 94 Contig Sequence 147 Contig Sequence Editing 147 Contig Viewer 141 Contig Viewer Parameters 68 Contig Window 65 Contig Window Sequence View 68 Contig Window Status Bar 67 Contig Window Toolbar 67 Contigs 77 93 Copy Bases 157 Copy Projects 79 Copy Traces 158 Create a New Folder 30 169 Create a Project 11 24 Create Contigs 93 D Delete Contigs 89 93 Delete Folders 86 Delete Fragments 96 Delete Projects 79 Display Basecall Results 117 Display Color Settings 155 Display Contig Data 99 Display Contig Properties 94 Display Contigs 85 Display Fragment Properties 96 Display Sequence Data 99 Display Trace Data 100 Display Trimming Results 125 Dissolve a Contig 147 DNASIS Assemble 55 DNASIS Assemble Parameter dialog 55 E Export Contig Sequence to DNASIS MAX 111 Export Contig Sequences 110 149 Export Phred Basecall 111 119 Export Phred B
84. displayed in the Sequence View of DNASIS MAX The function is the same as selecting File gt Export Contig to DNASIS from the menu Expands the Map View e Shrinks the Map View fe Displays the Map View at 100 size Jumps to the mark to the right of the cursor in the Sequence View Jumps to the mark to the left of the cursor in the Sequence View Displays the Sequence View in sequence The function is the same as selecting View gt Display Type gt Sequence from the menu E Displays a sequence diagram and quality value in Sequence View The function is the same as selecting View gt Display Type gt Quality Map from the menu H Displays a sequence and quality value in Sequence View The function is the same as selecting View gt Display Type gt Quality Numeric from the menu Fa Displays sequence chromatograms selected in Sequence View If the selected sequence does not have trace information Chromatograms will not display Same as selecting View gt Chromatograms from the menu Displays the list ofthe selected consensus and the quality information of the sequence used to link the consensus Same as selecting View gt Quality Lists from the menu Displays the Parameter Editor Same as selecting View gt Preferences from the menu 7 Displays online help Same as selecting Help gt Contents from the menu 2 3 3 Status Bar l Zu ua Display sequence data Seq 800 2 The Status Bar d
85. displayed using the icon When a file is imported and has the same data name as the one already existing in the project the following dialog will display Contig Manager Data name A919 is already in Folder What do vou want to do vernir ite Cvrerwrite All Skip skip All 1 Button Description Overwrite Overwrites the data Overwrites all the data that have the duplicate names Used when multiple data files are Overwrite All specified Skip Skips data The skipped data will not be imported Skin All Skips all the data that have the same names Only data that has a different name will be Ip imported Cancel Cancels file import process No data will be imported 106 Chapter 4 Import and Export 4 3 Import ACE Files ACE files can be imported when no data exist in a project 1 Select File gt Import gt Import Sequence from the menu The Open Files dialog will display Fag 2 Select ACE files to import and click Open The files are imported and the Import Summary dialog will display Import Summary 3 Check the contents and click OK When importing is completed the fragments and contigs imported to the Contig Manager will display s x Mm x x Chapter 4 Import and Export 107 4 4 Import Projects Loading data of another project into the currently opened project is called import l Select File gt Import gt Import Project from the menu The Import
86. e Map View Tree View and List View Print the Map View Click in the Map View pane Then select File gt Print from the menu or click on the Toolbar The data print range is what currently displays in Map View You can display a preview showing what the printout will look like by selecting File gt Print Preview from the menu AE Frisia March 12 2004 Lm gem 1 NIE Pago Lal The page orientation setting should be set to landscape before printing Printing with the orientation set to portrait can result in output that is partially cut off Use the Print Setup dialog to set the paper orientation To display this dialog select File gt Print Setup from the menu Print the Tree View Click in the Tree View pane Then select File gt Print from the menu or click on the Toolbar Print the List View Click in the List View pane Then select File gt Print from the menu or click on the Toolbar 10 1 2 Print from the Contig Viewer From the Contig Viewer you can print the Map View and Sequence View 162 Output Print the Map View Click in the Map View pane Then select File gt Print from the menu or click on the Toolbar The data print range is what currently displays in Map View You can display a preview showing what the printout will look like by selecting File gt Print Preview from the menu Ei Ines Ari LiL Fri Huch Li nm dp eT 8T AB The page orientation setting should be
87. e displayed under the ruler colored according to their quality values Contig name murer Length 3130bp Quality 128 82 Chapter 3 3 11 2 Tree View Project Window The Tree View displays folders and contigs in a project in a hierarchical structure The hierarchical structure can be changed by using the mouse Refer to 3 14 Operations in Tree View for details El Root J E 3019404 ag 30201135 Gantigl Contig Column header item Name Length Fragments Low QVs Comment 24 909 bp al 0 bp 0 bp 0 4 701 bp 15 3 1 30 bp 15 Description Displays the names of folders and contigs Each time the column header is clicked the names are sorted in ascending and descending orders Displays the total bp length of fragments in a folder and the bp length of each contig Each time the column header is clicked the names are sorted in ascending and descending orders Displays the number of fragments in a folder and the number of fragments composing a contig Each time the column header 1s clicked the names are sorted in ascending and descending orders Displays the number of base pairs in a contig whose quality 1s less than the threshold quality The threshold of quality can be set in 2 2 8 Preferences dialog Each time the column header is clicked the names are sorted in ascending and descending orders If comments are attached to folders or fragments they are displayed here Each time the
88. e the replacement is to take place Input the replacement using the A G C or T key When the replacement is made in the Replace Tn fragment base sequence the corresponding location in the contig sequence is replaced with an ambiguous code Move the cursor to the place in the base sequence where the backspace is to take place and press the Backspace key The base at the cursor position is moved backwards one space replacing the base that was to its left If there 1s a consensus at the same position as the Backspace o cursor position the base in the consensus base sequence is replaced with an ambiguous code In addition the portion of the consensus extending to the right from the cursor position to the data end is all replaced with an ambiguous code Move the cursor to the place in the base sequence where the deletion is to take place and press the Delete key The base at the cursor position is deleted If there is a consensus at Delete the same position as the cursor position the base in the consensus base sequence is replaced with an ambiguous code In addition the portion of the consensus extending to the left from the cursor position to the data end is all replaced with ambiguous codes Note The backspace or delete function can only be performed once 8 9 Reassembly after Removing Sequences It is possible to select some of the fragments composing a contig for removal and then reassemble the contig In the project window sel
89. ear Mew Folder Folder Root Length jo bp of Fragments jo Low Quality BPs jo Comment P Cancel 88 Chapter 3 4 Type the new name for the folder in the textbox of the J icon 5 Press the Enter key or click OK The folder will be renamed Attach Comments to Folders l Right click the folder to attach a comment 2 Select Property from the popup menu displayed The Property dialog will appear Folder Root Length jo bp of Fragments jo Low Quality BPs jo Comment P Cancel 3 Type a comment in the Comment box Up to 255 characters can be used 4 Press the Enter key or click OK Project Window Chapter 3 Project Window 89 3 14 2 Operations for Contigs Move Contigs Select a contig to move in Tree View and drag and drop it to the destination This operation is typical of Windows based programs such as the Windows Explorer Contig amp Sequence 00007 amp Sequence 0000 Dissolve Contigs l Right click on the contig to dissolve 2 Select Dissolve Contig from the popup menu 1 Root 20 009 bp atl 3 23 30194014 0 bp 4 30201135 0 bp Dissolve Contig Delete Copy Gontie As Fragment Property 3 A confirmation message will appear Click Yes to dissolve the link with the corresponding contig xj AN Are you sure bo dissolve contigs Delete Contigs l Selecta contig to delete and press the Delete key on t
90. ect the fragments you wish to remove It is possible to select multiple fragments at once Click Remove on the Navigation Toolbar Alternately select Contig gt Remove Selected Sequences from the menu bar or right click on one of the selected fragments and select Remove selected sequences from the popup menu A confirmation dialog with the message This may dissolve the contig Do you wish to continue is displayed Click Yes to proceed with reassembly of the contig Chapter 8 Contig Editing 149 8 10 Display Color and Font Settings It is possible to change the colors used to display traces and bases l Select View gt Preference from the menu or click 9 on the Toolbar The Preferences dialog is displayed Tasby Varwwer Faransa Camera Map sequence Dual Col ol Sequence Ear P Camaro igaren B MAA A comiera Fragrant Sequence B AE B Gratin cain coke sdh coles m cte fte 2 Enter the desired settings and click OK Refer to 2 3 6 Contig Viewer Parameters for a description of the Preferences dialog 8 11 Export Contig Sequences It is possible to export contig sequences The output files use the Fasta format If multiple contigs are selected for export they are saved in the Multi Fasta format 1 In the project window select the data you wish to export 2 In Contig Viewer the displayed contig sequence is exported 3 Select File gt Export Sequence gt Export Sequence from the proj
91. ect window menu The Save As dialog is displayed 4 In Contig Viewer select File gt Export Contig from the menu xl Emea irc Oy Ma Diocunenk amp ce ET Fe Phunez Here MESI Seve setae Pacha Fier lal E _ Cancel 150 Chapter 8 8 12 Use DNASIS MAX to Analyze a Consensus Sequence 5 Specify the file name and the location then click Save It is possible to use DNASIS MAX to analyze the contigs you create Contig Editing 1 In the project window Map View click the contig you wish to analyze to display it in Contig View 2 Select File gt Export Contig to DNASIS MAX or click ra on the Toolbar DNASIS MAX starts and the sequence is displayed Tik GE Dem hee num ae LAR AA ET EEE LAA POESIA Qm em jam des a OOO TABAT ap E LO MA Idus sp gt delata a is A id m a hos mn mm omia malomesmon on mn Om mn ee m m mm mm gt NEC RIO nn m E00 DE LER LESE En RS Ce N ia a En mi E irren ET TT Tg ITI 3g e peaga a gia Ea VERE ul CANON LITO AL m pa m m cgi Ma cara a lar m m yu PEE EEEEEEE in resisti banens LIEES Is E SERIE LTE ren a N ca m m y Lu ap apr red rau telam Ra AICA Al ED E B sk taki tetris E siete Wath be UT gran veram E pu na eamus TIDETUR tra takt IT EU lage am Sr iB ki Refer to the DNASIS MAX user s manual for details on DNASIS MAX analysis procedures
92. ed and assembly was carried out with the normal strand The details for each column are listed below Item Icons by data type 5 EE Li Name Length Trimmed Len Vector Low QVs Phred icon P Trimming icon 5 Assembly Direction Icon sE Comment Description Indicates the data type The icon attached to fragments that possess trace data The icon attached to fragments that possess only sequence data The icon attached to fragments that have been entered as trace data but for which the trace data has been moved or deleted The icon attached to contigs Displays the name of the corresponding data Displays the sequence length of the corresponding data Displays the total bp count of the trimmed area when trimming has been performed This column remains blank if trimming is not performed or no fragments were trimmed Displays the name of the vector for which trimming was performed When using Phred basecalling displays the number of bases in bp units that are within the range of Low QVs set in View gt Preferences from the menu Displays if Phred basecalling is performed on the fragment Displays if the fragment has been trimmed It will also display even if trimming was not performed Indicates the direction in which the fragment was assembled Data that does not display this icon has not been assembled This icon is displayed when assembly has been performed with the same st
93. er 2 Contig menu New Folder Assemble Basecall Trimming Phrap Assemble DNASIS Assemble Auto Assemble Dissolve Contig Remove Selected Sequence Copy Contig As Fragment Relink Trace Files Parameters Trimming Vector DB Manager Phrap DNASIS Assemble Property Help menu Contents User Forum Web Page About Contig Manager 2 2 2 Toolbar Window Descriptions 49 Description Creates a new folder This feature is enabled when Tree View is active and a folder is selected The new folder is created under the selected folder Assembles what is selected in List View such as fragments Performs basecall assembly of the trace data selected in List View from the Basecall setting on the Navigation Toolbar Removes terminal regions with numerous N s and vector sequences from fragments selected in List View Refer to 2 2 15 Trimming Parameter dialog for setting details Assembles fragments selected in List View utilizing Phrap Refer to 2 2 13 Phrap Parameter dialog for setting details To use Phrap you need to install the Contig Manager Automatically searches and assembles the fragments selected in List View Refer to 2 2 12 DNASIS Assemble Parameter dialog for setting details Based on the Navigation Toolbar settings performs basecalling trimming and assembly of fragments selected in List View Removes the contig alignment selected in the currently active view Removes co
94. ets the color of the markers Sets the color of the contig sequence markers When set to display Low Quality Ambiguous Code and Mismatch Base the respective marker will be the color specified here Sets the marker color of the fragment sequences The color will be the background color of the fragments bases which do not match the contig Sets the background color of the region where searching strings are found in the alignment search Sets the background color of the last searched region Sets the previously searched region when performing consecutive searches Displays a marker on a consensus sequence When a check box is selected that item will display with a marker Attaches an asterisk to low quality sequences The quality threshold can be changed with the parameters in the Quality page Attaches a question mark to a contig sequence when the code is ambiguous Attaches an exclamation mark to mismatched bases in fragments 70 Chapter 2 Window Descriptions Quality Contig Yiewer Parameters Item Description The quality value to be set when When sequences are edited the quality value of the corresponding bases will be the value sequence are edited xx set here The valid range is 0 to 99 Color of Quality Bar Sets the color of the Quality Bar Quality value is between xx and yy When the quality value is within the set range it will display in the specified color Only the lower limit of the high quality value
95. f a trace Decreases the horizontal width of a view je i E PU RD ER E Increases the horizontal width of a view Decreases the vertical width of a view Increases the vertical width of a view Turns ON OFF the hand tool for scrolling through individual items of data in the parallel data mode Displays hides a trace of lane A Displays hides a trace of lane C Displays hides a trace of lane G Displays hides a trace of lane T Displays the dialog to set view parameters Displays online help lal ee Chapter 2 2 4 3 Status Bar Window Descriptions 13 The Status Bar displays the names of each menu and Toolbar button at the mouse cursor and each application on the application palette 2 4 4 Trace View iut Ad The Trace View displays four big rows which are the Sequence Name Base Display Quality Bar and Trace Data from top to bottom Refer to 8 5 2 How to Read the Trace Display for details 2 4 5 Trace Viewer Parameter Lontig Trace Viewer Parameters Color Background EE NE amp om E Others a Selection of Sequence EA Selection of Trace BasePar Font Mame Courier Size 12 Select View Font Mame Courier Size 12 Select Color of Quality Bar po Quality score is between 0 and 13 Quality score is between zu and 39 Cancel Help Item Color Background 219 X 3x
96. f fragments linked with complementary strands of the input data Sets the display color of the lower quality parts than the set value Sets the color of the graphical cursor Sets the color of the frame Chapter 2 Sequence Contig Yiewer Parameters X Consensus Map Sequence Quality Display Font Font Mame Courier EX Font Size 12 Consensus Marker ve Low Quality Ambiguous Code 1 Mismatch Base Item Display Font Font Name Font Size Sequence Color A G C T Gap Marker Color Consensus Sequence Fragment Sequence Find sequence of consensus Selecting sequence Emphasis sequence Consensus Marker Low Quality Ambiguous Code Mismatch Base Marker Color e Consensus sequence i Fragment sequence Find sequence of consensus Selecting sequence mi Emphasis sequence Lancel Help Window Descriptions 69 Description Sets the display font of sequences Sets the font type Click and set the display font in the font setting dialog Sets the size of font Click and set the display font size in the font setting dialog Sets the sequence color Double clicking each color with mouse will display the color setting dialog Sets the color of Base A Sets the color of Base G Sets the color of Base C Sets the color of Base T Sets the color of elements other than Bases O G C T S
97. f the dialog 1s for the folder name which can be changed 5 For this Tutorial use TutorialFolderl En Tutoria Folder Folder B RactiNew Foldet Length m bp of Fragments D Low Quality BP m Sommer Property dialog 1 3 11 Move Fragments Fragments and contigs are moved to other folders by dragging and dropping For example the following explains how to move all the fragments that make up Contig34 to TutorialFolderl l Select Contig34 from the Tree View to display a list of fragments that make up Contig34 on the List View 2 Select all the fragments in ListView Drag and drop all fragments into the TutorialFolderl 3 The selected fragments move to TutorialFolderl Chapter 1 Contig Manager Tutorial 31 d AA4945127 d AA549782 e AA606170 Contig pu d AI105838 Contig E m Contig 5 AI322219 m Contig5 x Contigs 31330870 Contig4 2 Contig4 g 51330909 PE Contig36 _ RE Contig36 d 51396573 i T Contig35 i er iContig35 d AI416018 x Conkig34 m Contig34 d AI584822 Contig33 I Contig33 d 1585220 1 3 12 Add Sequence Data This section explains how to add sequence data from sequencing using a combination of DNASIS MAX features like primer design and others l Select Programs gt DNASIS MAX gt Tutorial Data from the Start menu to open the TutorialData folder 2 Then open ContigManager gt TutorialData2 3 Select TutorialData2 2 txt from the
98. gions uus02u020 n000nn0nannunannonnnnnnnnnnnnnnnannnnnnnnn nun nnnnnnnn 117 So Chance Colors or Quality Value Bas en Iva I ISI EC epa I bv edd o eaa rase t ce E Tue E Me 117 3 222 ser Quality Valuesrhtesholdssseuendvetatet true ut utut Oa E Reese 118 DA EXPO Phr d ROS UNS mn did 119 54 Export Phred Basecalb Results ds SINES a een VACUA t DU a VA CUR SUIS 119 Sv R2 Expo Phred Bdsecall Results SCP FONA ana ee Ru ee li uet E tice dui pet rhet udi 119 Chapter 6 Vector Trimimillg ae 121 6 1 56 UD VECOS io pube A cubes eu edu CDU Mo eI c MEC aves teenie ee CEN I QUEUE 123 6 2 Register VectOES an een 123 6 9 TAMMING carla E Anido 124 6 4 Display Trimming RESUS ud u an een 125 OA Wrace Timmins AA ee II II LM 125 6 42 Trimmins Resulisof Sequence Dir een 126 6 9 Reset Test Dalai 126 Chapter 7 Phrap Assembly sii 129 PR CI 131 1 2 Fully Automatic Assembly de aaa 131 7 3 Display Assembly Resulls u a ee anne 132 l l WIAD Viewer euere 132 IL TE MI We AO 132 Td List VI ra en ee re ee e 132 7 4 Contig Detail VIEW aa 133 715 Dissolve Cont Sii aii cnc 133 7 6 Reassemble Contig Sequences u 2u00 20002n00nnnnnnnnunnnnnnnnnnnnnnunnnnnnnnnnnnnnnunnnnnnnnn nenn nennen 134 A a Conlis as a Snelle Fragment uns esse 134 7 6 2 Assemble a Conlig Using Constituent Frasments unsre 135 fL Parameters no 137 7 8 Advanced Parameters ning naked 137 Contents Chapter
99. hat is the quality value QV bar graph quality value with color coded threshold values The threshold value and the colors can be changed by the user Below the contig bar are fragment bars that compose the contig A blue right facing arrow indicates a fragment linked in the normal direction and an orange left facing arrow one that is linked by a complementary strand The bar lengths and positions indicate the fragment positions and lengths within the contig sequence In addition the dark colored parts of fragment bars are of lower quality than the threshold value Refer to 2 3 6 Contig Viewer Parameters for details 142 Chapter 8 Contig Editing Quality graph Ruler 2H on un al L E Contig G i raphical Cursor Move the mouse pointer over a contig or fragment bar to display the name size and number of sequences for the corresponding contig or fragment Mame 90214630 Size 964 Map View can be resized horizontally Click the G icon on the Toolbar to expand the view one step and the e icon to reduce the view one step Click the icon to restore the 100 display The red rectangular box is the cursor The portion inside the box is displayed in expanded form in the Sequence View When the red box is dragged with the mouse to a different location the content shown in the Sequence View changes to match 8 3 Sequence View This view displays the alignment of contig and fragment sequences Rule
100. he 5 end 2 When the quality is lower than the threshold move the window toward the 3 end for one base and repeat 1 3 When the above produces a quality higher than the threshold trimming will be done from the 5 end to N closest to the 3 end in the current window 3 End When checked trims the 3 end When both Trim at least and Trim the first are checked first run Trim at least followed by Trim the first Trim at least Unconditionally trims the length of sequence specified from the 3 end Trims when checked For sequence lengths must be integers greater than 0 Trim the first When checked trims where quality is low from the 3 end When determining the quality set integers greater than 0 for window lengths and quality thresholds Below is the trimming procedure 1 Calculate the quality of the sequence length called a window set from the 3 end 2 When the quality is lower than the threshold move the window toward the 5 end for one base and repeat 1 3 When the above produces a quality higher than the threshold trimming will be done from the 3 end to N closest to the 5 end in the current window Chapter 2 je Phega Hii parara le Ri le pilie actos le pha Ei Item Same as 5 End Trim Vector Vector Name Cloning Site OK Cancel Help THE Item considered as contamination Vector Database Manager and deletes vectors rarrtaaatt ctcettittt
101. he Tree View to display a list of all fragments contained in that folder the fragments that make up Contig36 The absence of the icons that indicate the assembled status confirms that assembled sequence has been dissolved Chapter 1 Contig Manager Tutorial 33 1 3 15 Search for Fragments Fragment names can be specified to run searches on which folder or contig they belong to Wildcards can be used as search strings to enable fragment names that share specific patterns to be retrieved as efficiently as possible 1 Click Fragments on the Navigation Toolbar Open Dissolve Remove Reset Io Oneinal sequence 2 Check Fragment dialog appears Check Fragment dialog Navigation Toolbar Description 1 Select target folder contig Select the folder or contig for the search target 2 Pattern Pattern10 Enter the name of the fragments for which the search is to be run Searches can be run with a maximum of ten fragments The following two methods are available for specifying the wildcard Random character strings Single random character Names that represent perfect matches and names that include the wildcard can be entered 3 Find Results Displays a list of the fragments found that match the search strings 4 Fragments Displays a list of the fragments found during the search 3 Enter AA494612 in Pattern 1 AI in Pattern 2 12 in Pattern 3 and AA49 in Pattern 4 34 Cha
102. he keyboard A confirmation message will appear ContigMgr f X AN Are vou sure ko delete contigs and all Fragments included in selected contigs 2 Click Yes and delete the corresponding contig and the fragments that composed the contig in the project 90 Chapter 3 Project Window Display Contigs from Tree View l Double click the contig to display Or select the contig and click Open on the Navigation Toolbar Remove Fragments Reset Io Original Sequence 2 The Contig Viewer will start and the corresponding contig will appear Display Contig Properties l Right click the contig to display the property in Tree View 2 Select Property from the popup menu displayed 3 The Property dialog will appear Folder Root Length 54 bp of Fragments Oo Low Quality BPs Comment Item Description Displays the name of a contig Can be renamed Folder Shows the location of the contig with the path from the root folder Length Displays the number of base pairs in the contigs of Fragments Displays the number of fragments composing the contigs Low Quality BPs Displays the number of base pairs in low quality region in the contigs Comment Displays comments They are editable by the user Renaming Contigs l Right click the contig to rename 2 Select Property from the popup menu displayed 3 The Property dialog will appear Chapter 3 Project Window Folder
103. in List View of Contig Manager The corresponding data will display in the Contig Trace Viewer Select File gt Export from the menu of the Contig Trace Viewer When the Save As dialog opens change the file type to SCF scf Assign an appropriate name and click Save 4 7 2 Export Phred Basecall as Trace Data i 2 B Double click the Phred Basecalled trace data in List View of Contig Manager The corresponding data will display in the Contig Trace Viewer Select File gt Export Phred from the menu of the Contig Trace Viewer When the Save As dialog opens change the file type to SCF scf Assign an appropriate name and click Save Chapter 5 Phred Basecall and Quality Evaluation 114 Chapter 5 Phred Basecall and Quality Evaluation Contents in this section assume that the Phred Phrap Option is installed Chapter 5 Phred Basecall and Quality Evaluation 115 5 1 Phred Basecall and Quality This section explains the basics of Phred 5 1 1 Phred Basecall Basecalling converts trace data output from a sequencer into ACGT strings Usually the sequencer that outputs the trace data file has its own algorithm for basecalling Phred is a program that independently analyzes trace data and basecalls them without using the algorithm that the sequencer has 5 1 2 Quality Value As the basecall information written in trace data files output from the sequencer contains only ACGT characters regions th
104. isplays a description of each button on the menu and Toolbar at the mouse cursor l Display sequence data Displays the location of the mouse cursor on the contig in Sequence View 1 4 Se BO y 2 3 4 Map View The Map View graphically displays contigs and the fragments composing the contigs Refer to 8 2 Contig Map View for the details 68 Chapter 2 2 3 5 Sequence View Window Descriptions Sequence View displays contigs and fragment sequences Displays the sequences using the color parameters set for Base A Base G Base C Base T and others Refer to 8 3 Sequence View for the details 2 3 6 Contig Viewer Parameters Consensus Map Contig Yiewer Parameters X Consensus Map Sequence Quality Color of Sequence Bar Consensus Sequence Low Quality Part Graphical cursor color Selected frame color Normal Fragment Sequence Complementary Fragment Sequence Cancel Help Item Color of Sequence Bar Consensus Sequence Normal Fragment Sequence Complementary Fragment Sequence Low Quality Part Graphical cursor color Selected frame color Description Sets the display color of the contigs and fragments in Map View When double clicking on the displayed colors with the mouse cursor a color setting dialog will display Sets the display color of contigs Sets the display color of fragments linked with the strand as the input data Sets the display color o
105. it Wera ori Heb Oe mela FP n Main Contig Manager window 1 2 3 Enter Trace Data l Select Programs gt DNASIS MAX gt Contig Manager Tutorial Data from the Start menu to open the TutorialData folder 2 Then open ContigManager gt TutorialDatal gt TraceDatal 1 3 Select all of the files contained in the TraceDatal 1 folder and then drag and drop them into the Root folder in Tree View of the Contig Manager or into the List View 4 When dropping the files into Tree View be sure that the data overlaps the destination folder the Root folder in this case Chapter 1 Contig Manager Tutorial 13 Root O bp 0 Drag amp Drop Standard Ald _ ta Ready 35 1130714635 730214649 30H 05 SSO dez Enter Sequence Data by Drag amp Drop 5 File reading will complete after a few moments The Import Summary dialog will show the total number of data the number and names of imported data the number and names of skipped data and the number and names of error data Import Summary dialog 6 Click OK to close the dialog after first checking the imported fragment contents 1 2 4 Display Trace Data l Alistofthe fragments imported in the previous step will appear in List View on the main Contig Manager window 14 Chapter 1 Fragments in List View 2 Double click on any item in the list to display the fragment trace data All Data Contig Trace Viewer File Edit Wem Help sp A
106. lays a list of existing projects Chapter 2 Item Delete Duplicate Rename Export Import Open Exit Window Descriptions 53 Description Deletes the project selected in the Select Projects list Copies the project selected in the Select Projects list After pushing the button you will be prompted to enter anew name which is required Renames the project selected in the Select Projects list Exports the project selected in the Select Projects list The whole project can be stored in a file Imports the project exported in Export Project names can be specified for import Opens the project selected in the Select Projects list Closes the Open Project dialog 2 2 10 Import Summary dialog When the imported data is not an ACE file the dialog displays the contents of the imported data Import Summary i E E The number of processed data 30 r Skip Data Mame Length Import Data Y Mame Length be 30194804 351 30201067 966 bel 30201093 966 be 30201094 313 be 30201104 343 be 30201110 960 amp amp 30201132 321 be 30201135 940 be 30201147 962 30207122 965 h 30207146 956 be 30207163 946 mE 21301071 ru oc of data 30 of overnarite data t Item The number of processed data Import Data Skip Data Error Data of data of overwrite data OK L Mame Lenath of data 0 H of data O Description
107. lays the vector name when a fragment is trimmed with by a vector Trimmed Length Displays the number of trimmed base pairs Status Displays the status listed below of the corresponding fragment Trimmed trimmed fragments Phred Phred basecalled fragments Assembled N fragments linked with normal strand Assembled C fragments linked with complementary strand Trace File Path For trace data displays the path to the linked trace file Comment Displays comments They are editable by the user Rename Fragments 1 The Property dialog will appear 2 Right click the fragment to rename 3 Select Property from the popup menu 4 The Property dialog will appear Chapter 3 Project Window Folder Root Length O66 bp Low Quality BPs 390 ERO Trimmed Vector KA o7 Trimmed Length I bp status Phreed Assembled 53535 Trace File Fath D HSK_DE Manual Data Trace S0201093 scf Comment a E Cancel 5 Type the new name for the fragment in the textbox to the right of the bei icon in case of sequence data the f icon 6 Press the Enter key or click OK The fragment will be renamed Attach Comments to Fragments l Right click the fragment to attach a comment 2 Select Property from the popup menu The Property dialog will appear Falder E Root Length ee bp Low Quality BPe 378 Trimmed Vector Trimmed Length bp Status Phred Trimmed Assembled N Trace File P
108. lcor lutea Lote lutto lU E 67 2 9 9 SEQUENCEN IC WE neam cocti te A d Ln tA c MM t UU M rA Uu uM dcm eU 68 230 onis Viewer parameter ana deter Ata pet Ar Amet AE NS m rt Au uUa ELA LA ute ee 68 2 4 Trace VV INC OW sia E 71 DPN Men ee es ON 71 TOD O o ee ea ee ee EE 72 ENS o rid O 73 DP ACC VLC Wy Neue N E ON E E A IA 73 2 0 9 Trace NIEWE EPI aE E e td ee orante 73 Chapler3 Pro ject WINGOW un et 75 S T What Is a Proje tt u nenne sten 77 3 2 Components or a PFoJeck la aio taaan tas danza 77 TAKEO A te Nee see Nee se N nt este 77 a COMMU ee ae eae i alt ne ial cian Nat atl RR RR RN 77 is PSN o Beso E eaa RRR O eRe OORT ERT A A AA 71 3 93 Create a NeW Projet l un enable 78 2 4 Open Exisung Project 78 3 5 Delete Projects Biennale 79 JO GODY PrTOjeels uma did 79 Contents Sil Save Project RER Kae IE 79 310 Reven Projecte cia EVA EORR E CO AV CU DEVAIT DEO Du D RUE 80 3 9 Merge Project caida 80 2 10 CIOS POCOS ui til 80 3 11 Structure of the Main Window a 81 Sa LE Eee VIEW ee ee ee NE REN 81 A td M 82 Sl I Ie A A O is N le 83 o2 nree Display MOE S cut 83 3 12 1 Standard Display Mole mess dta etti ite rm ae MM LL MU EM IE dA II M M EET Mu Et IET 84 242 2 ATI ECOS Display NIOGE ioa a o ds 84 3 12 3 Al Fragsments Display dida 85 3 13 Operations in Map VIEW sia 85 Sa Display Contes From Map Vd de dd nc cd o OS 85 2 14 ODerations m Iree VIEW ee 86 3 JA TcCODerattons tor Folder coto seems esse lau 86 3 14 2 Operans Tor Cana A
109. lder in the Space dialog BA 4 09 Blast Search with Phred QV Space Edit Mode Data Drop trace data here Ellos Phred EE Base t by Pred 30 24504 30207146 ix 30220406 30201 06 30 07163 s02 20436 Drag 4 Drop 30207169 30220443 30207175 30220454 30201104 530214650 3001110 a0 146524 JE eee 30214635 3227255 0201135 30214639 04 Aog 30201147 30214649 n 1 Ir ine G I nun Cd u or o e on Cod Lan Ln I m Fo DU mug m 1 A A lz a E MAA a hn E l T La Ba NILUM ms A Vu here node Go to background Progress dialog Chapter 1 Contig Manager Tutorial 41 1 4 6 Results l Data will accumulate in the folders located in the Space window when the processing has completed Double click Drop trace data here and confirm that the entered trace data has been saved Earcail rum bo Fiese Cia chick the da sa bar eect 77 Trina rargmrcu 8 Phad Qualia siaua Marking 2 High qualig wagon E erg Data confirmation in the Space window 2 Double click on any item listed in the selected folder to display data details i E E 5 F Jordan 098568 al HN Y r E u it d i LA i N rat D d YR P sea a M ine ve n yl ODA l Vas PA A L AE AT dp Jl UN nd af dat vll an s JEUHT R EL EL ET kx med rrRurbi y e E EEE BR mo ms e i FAM Hl LU ein Er LTER NAT
110. lity value 7 Select the corresponding fragment and click Trim on the Navigation Toolbar to perform the vector trimming 8 Select all of the fragments in the List View and press Assemble A message stating Some ofthe selected fragments are connected Are you sure to dissolve the connection and continue operation will appear Click Yes to continue with the process Chapter 1 Contig Manager Tutorial 23 ContigMgr x AN Some of the selected fragments are connected Are you sure to dissolve the connection and continue operation 9 The assembly process will be performed including the added fragments and a new contig sequence will be created 10 These will be assembled into a single contig if the tutorial data is used 1 2 12 Exit the Contig Manager Select File gt Exit from the Contig Manager s menu if analysis has completed 24 Chapter 1 Contig Manager Tutorial 1 3 Analysis Example 2 Sequence Clustering and DNASIS MAX Links This section explains how to perform clustering on the EST sequences registered in Genbank using the Contig Manager It also explains how to perform simple analysis of new contig sequences with the use of DNASIS MAX 1 3 1 Start up the Contig Manager Select Programs gt DNASIS MAX gt Contig Manager from the Start menu to display the Open Project dialog shown below in Cran a rra pramc Pro ect Flors 4 C pan axohng pramctnz pr Haie It Ea uct Pramche e Project
111. lue lower than the threshold value shown in the specified colors settings 1 000 When a contig is selected in Map View a list of the fragments composing it 1s displayed in List View 7 3 2 Tree View This view displays the contigs branching down from the folder containing them For each contig the contig name contig length number of fragments number of low QV bases and comments are displayed 16 ft 56 1 bp When a contig is selected in Tree View a list of the fragments composing it 1s displayed in List View 7 3 3 List View This view displays the contigs contained in the folder selected in Tree View For each contig the contig name and contig length are displayed Name Length Contig PE Contig10 ic Contigl 1 Contigl2 Contigl Chapter 7 Phrap Assembly 133 7 4 Contig Detail View In Map View Tree View or List View you can start the Contig Viewer and view contig fragment sequence and other detailed information either by double clicking a contig or clicking Open on the Navigat on Toolbar sme Contig Viewer 2 aj x File Edit wiew Help amp 4 HA amp ex spl 8 79 aa 18 2 000 4 000 4 831 bp CTICTASGAAACACTTACATTTACGCCATCTACTGAAAGTICACCT ad 30201132 30214630 ctCT bgaaificACTTACatte CTETAAGAAADACTTADATTTACGCCATCTACTGAAABTTCAC 30201110 CTCTAAGAAACACTTACATTTACGCCATCTACTGAAAGTTCAL 30201067 ct fit sAGAAACACTTACATTTACGCCATCTACTGAAAGTICAL 30
112. me Root A Mew Folder 11 3 14 4 Other Operations Sort Display Items It is possible to sort by clicking on the column header of each item X means the items are in descending order and P ascending order Contig 47501 bp 15 Column header Conte 3 130 bp 15 3019404 U bp J 30201135 O bp Expand Shrink Trees The folders with on the left mean they contain folders or contigs NNUS a a Root qe Chapter 3 Project Window 93 In reverse collapsing a tree so that the low order part of the tree will not be seen is called shrinking a folder Click EI to the left of the folder and the folder will shrink 3 15 Operations in List View In List View the following operations are possible Operations for contigs Operations for fragments Display data Sort data 3 15 1 Operations for Contigs Create Contigs l Select a fragment to create a contig 2 Select Contig gt Assemble gt Phrap Assemble from the menu or click Assemble on the Navigation Toolbar Asze mble Method Phrap Fwd Primer Hev Primer Fwd Terminator Rev Terminator DeL 3 Ina few moments analysis will complete When a contig is created its data is added Move Contigs Select a contig to move in Tree View and drag and drop it to the destination This operation is typical of Windows based programs such as the Windows Explorer Mame E Contiel e Contigl Contig
113. ming sequencing with the use of the primer working method from areas with high levels of sequence precision 6 Select 1050bp to 1100bp from the DNASIS MAX contig sequence and then press Primer Design in the DNA Search group A primer that increases the width of the relevant area will be designed when the sequence 1s selected Prirsar Durum Result of Primer Design 7 By performing analyses and linking with DNASIS MAX and by repeating the primer design sequencing and re assembly in this way it is possible to increase the accuracy of the contig sequence 1 3 9 Manage Sequence Data by Folder The most convenient method to manage a large volume of sequence data is to create hierarchical folders in Tree View and manage the sequence data by folder Managing sequence data by folder without dividing the projects enables work to be efficiently and simply carried out for such tasks as sequence clustering with contig creation adding sequences and performing re assembly after contigs have been created 30 Chapter 1 Contig Manager Tutorial 1 3 10 Create a New Folder 1 Right click the Root folder and select New Folder from the popup menu that appears Mew Folder Delete Property Popup menu 2 A folder named New Folder 1 is created under the Root folder New Folder 3 Right click the new folder and select Property from the popup menu that appears The Property dialog appears 4 The first text box o
114. nalty for identifying a degenerate sequence at beginning end of a read 2 trim_score Sets the minimum score for identifying a degenerate sequence at beginning end of a read 20 confirm length Sets the minimum size of confirming segments 8 confirm trim Sets the amount by which confirming segments are trimmed at the edges 1 confirm penalty Sets the penalty used in aligning against confirming reads 5 confirm score Sets the minimum alignment score for a read to be allowed to confirm part of another read 30 indexwordsize Sets the size of an indexing hashing word in words c This parameter has a small effect on run time and memory usage 10 Chapter 2 Window Descriptions 59 Assembly Phrap Method ParameterSet Editor X Scoring af pairwise alignments Others Miscellaneous Assembly Program Input data interpretation Output forcelewel Relases stringency to varying degree during final contig merge pass Ranges from O most stringent to 10 least stringent lb masqap Allowed in merging contigs 30 repeat stingenc Controls stringency of match required for joins 0 35 revise greedy Splits initial greedy assembly into pieces at weak joins shatter greedy Breaks assembly at weak joing force high Allows ignoring high quality Cancel Help Item Description Initial setting forcelevel Sets the stringency during final contig merge pass Values can range from 0 most stringent to 10
115. names and file names match relinking process will be performed Closes the Relink Trace File dialog l Inthe dialog the trace data with broken links to trace files are displayed Select data to relink 2 Type the correct path in the Path to a new directory text box 3 To browse to the path click select the folder to link and click OK The selected folder will display in the Path to a new directory text box 4 Check the path and click Set Jae gina mot unm nh imam grund ee Eden dace malus gren ids mom manu ee e Fiar pnt an m moe mue ble 5 Click OK to close the dialog Chapter 4 Import and Export 109 4 6 Export Sequences 4 6 1 Export Sequences of Fragments To export fragment sequences use the methods below Exporting by these methods will output sequences reflecting Phred basecall trimming and Phrap respectively Note that the data linked in reverse by Phrap will be output as complementary strands Method to Export from Contig Manager l Select the fragment sequence to export in List View of Contig Manager 2 Select File gt Export Sequence gt Export Sequence from the menu 3 When the Save As dialog opens designate the location and the file name to save and click Save 4 When performed in List View with more than one data item selected the sequence will be exported in multi Fasta Format Method to Export from Contig Viewer l Select the fragment sequen
116. nator Detail Hzsemble Navigation Toolbar Assembly Parameters Item Description Method Selects the algorithm used for assembly DNASIS Assemble Performs assembly using the DNASIS Assemble algorithm Phrap Performs assembly using the Phrap algorithm When Phrap is selected the following parameters are displayed To use Phrap you need to install the Contig Manager Fwd Primer Trace data is forward read using the dye primer method and when distinct name patterns are identified they are input Forward linking is given priority if the direction cannot be determined Example FP is input for C0001 FP C0002 FP Rev Primer Trace data is reverse read using the dye primer method and when distinct name patterns are identified they are input Reverse linking is given priority if the direction cannot be determined Example RP is input for CO001 RP C0002 RP Fwd Terminator Trace data is forward read using the terminator method and when distinct name patterns are identified they are input Forward linking is given priority if the direction cannot be determined Example FT is input for C0001 FT C0002 FT Rev Terminator Trace data is reverse read using the terminator method and when distinct name patterns are identified they are input Reverse linking is given priority if the direction cannot be determined Example RT is input for C0001 RT C0002 RT 7 8 Advanced Parameters It is possible to set other parame
117. ned in this manual are trademarks or registered trademarks of their OWNETS Under the approval of UK Medical Research Council TraceViewer program uses the io lib library developed by Staden Package of the UK Phred Phrap is licensed from the University of Washington The Phred Phrap option for DNASIS is a product of MiraiBio USA Contents Preface il Phred Phrap Option Installation and Default Settings 1 Chapter 1 Contig Manager Tutorial e eeeereeeeeeee nene P LUPO Folds MES E T 9 LR NC eda eT a A QUEUE CNET CETTE ee 9 hale Contigsand Frae mE coe otio D D E D mum Me e MM AMINO CMM E MM 9 RL Dat Mimose ment Dy PLO CCl see idiot eto ice tl da 9 ELA Startup the Cone Minan et u obti ON do de er ee trs pU utem uel 9 IUS e rcate AA atatum II MAL M itl M Ml MM t De M E MEME 9 11 6 Part Names and Descnpt ons ass sis Eth OU are essen 9 kis Close thet onto Mango Tiea ee aedi edet ee A etui M ctn 10 1 1 3 Data Used m the Lutortalos eo idiot on uS opc eisen ee 10 1 2 Analysis Example 1 Assembling Trace Data anno nnnnn serene 11 Startup the ontro MALA esee ee Ne eot aged edet rapi cute res ord dote 11 AA Y ANA O ee ee ee 11 Woo eae cio Data A A A meer Ten eee 12 12 4 Depay Tra DNS A E SDE EAN EA 13 T2 Pano Parameter Setup ae ee lada 15 12 6 2d doVecton Data ne ee ee ee ee ee ae use 16 122 7 PMN is P
118. ning key codes info bio hitachisoft de For other information or inquiries
119. ntig fragments selected in List View Reassembles the contig without the fragments selected for removal Copies the selected contig as a fragment When reassembling the contig use the copied fragment Resets the links to trace files Refer to 2 2 16 Relink Trace Files dialog for setting details Displays the parameter setting window Sets the trimming parameters Refer to 2 2 14 Trimming Parameter dialog for setting details Sets the Vector Database Manager Refer to 2 2 15 Vector Database Manager dialog for setting details Sets the Phrap parameters Refer to 2 2 13 Phrap Parameter dialog for setting details Set the parameters for DNASIS Assemble Refer to 2 2 12 DNASIS Assemble Parameter dialog for further details Displays the folder contig and fragment information selected in Tree View or List View The names and comments can be edited Description Displays online help Displays the User Forum website of DNASIS MAX Requires connection to the Internet Displays the version information Du td X Ba S 5 Icon Description 5 Opens a new project in a new window Displays Open Project dialog The same as selecting File gt New from the menu gt lt A hi Opens a specified project file It is also possible to specify multiple files to open The same as selecting File gt Open from the menu Stores a project by overwriting it The same as selecting File gt Save Project from the men
120. o the original sequence data from the List View ee 388448 A BIS33708 574 18 q amp amp BITO05456 580 bp d BE201185 639bp 18bp 5 2 Click Reset To Original Sequence on the Navigation Toolbar Open Dissolve Remove Fragment Reset To Original Sequence 3 A confirmation dialog will appear Click Yes to go ahead and clear the Phred trimming and Phrap results for the corresponding data ContigMgr X Execution of Reset clears Ehe results of analysis before Are you sure ko continue the operation 4 The trimming results will be cleared and the sequence will return to its previous status The corresponding trimming icon will disappear indicating that the trimming results have been cleared Name teng Tf vector to d BIBBB8448 662 bp d BI883708 574bp 18bp g BITO05456 580 bp d BE201185 639bp 18bp ia Chapter 7 Phrap Assembly 130 Chapter 7 Phrap Assembly Contents in this section assume that the Phred Phrap Option is installed Chapter 7 Phrap Assembly 131 7 1 Assembly The procedure for assembling a sequence is as follows 1 In List View select the data to be assembled To select all items listed press Ctrl A or select Edit gt Select All from the menu 2 Click Assemble in the Assemble group 3 After a few moments the assembly is complete and the resulting contig displays in List View with each fragment directional marker 7 2 Fully Automatic Assembly
121. older Of the 17 items of trimmed data input with this tutorial 5 are judged to have short high quality regions 8 The Blast search results that have vector sequences were deleted high quality regions longer than 500bp and the low quality regions have been masked by N are output to the Blast Search Result folder Double click on the data to display the search results graphically Chapter 1 Contig Manager Tutorial 43 A 1 AF A Era taurus riboacaa l prrkmiri Lil FA rrapistm cri 32 1 MIT FR yr 1502 erai Ee gorda olor FA IE cop lee secare 48 1 1 0231 4 gr id1542 AF idi 2 Fel z cabos ripra Fee i micrcastel lite aurea ili 1 13 Len Galen HUP Felip caktue clone FFRE DEALMA complete cecnerce 1 01 H py d ioca iia Dur serefe clera FPi4 11H8Fil rrapimtm rszcamrcz il 2050 Blast search results Chapter 2 Window Descriptions Chapter 2 Window Descriptions 47 2 1 Online Help Online Help is available in Contig Manager Select Help gt Contents from the menu or click 7 on the Toolbar Also by clicking Help of each dialog Help for the dialog will appear 2 2 Project Window Toolbar Menu Bar MA Bem He Navigation Toolbar Dein ETE a EMI zxxa 7 1 das Lm ITA AA L i 5 EL in N Ea tar 1 E i LIE ya LIE 18 sa ben Sue de a amp d zu nur Y In za i U mmm a T a J a UE i s Ln 0 TELA Mae zu i omms e n T rn mii i en Tree View npe
122. ononnnnnnnnnccnonnnnnnnonnnnnnnnnnnncnnnnnnnnnn nns 37 VAS TAIN TENA TAS GN costa ae aa ase eta creuse dup dee e aa deu 38 Iac AA a a E II iM M A MM ieri 39 Er Enter Trace BEIC O DI 40 Contents lii A dung E hein elt teenie Bean adaatsoanladest hau duesiwaimdaceteled 41 Chapter 2 Window Descriptions 22 200200 200n002000n0nnun nun nun nnn nun nnn 45 A Me 47 2 2 PFOJECL WINdOW ir a a loaves ad N 47 A T 48 PARRA RRA 49 2 2 3 INaviBation T00lDAE iri a esse ce eed 50 2 Status Babes a sd eM ALMA MEA Na MARE A ate iMd A M UR 51 2 25 Tc eee T NO 51 22 NS OA 51 A ALS A ee ENTIENDEN 52 AA a ee ee a ee a ee ee 52 22 POpen Project PP ee ae RR EEE 22 a as RR A A E 53 2 2 11 Check o dialo9 ae u ur A RRO RO ns 54 22 A DNASIS Assemble Parameter 438 adn 55 2 2 15 Phrap Parameter d1alo8 une A eds aM MM MEM UTEM TE 56 2 2 12 Erimmmo Parameters diglo Nessie Na Sees Nenn el 62 22 15 Vector Database Manager dolotar ose eta ea dos 63 22 Lo elink Trace Pies AO queen ee ee ee ee een er 64 2 3 CONIO WINDOW iia 65 A ee RT 65 DIRS MAI Foro lo 1 re T 67 ES i Soc do 67 2 3 E Ewa otia ob ut tan st ta torto A
123. ons Sort Displayed Items It is possible to sort by clicking on the column header of each item k d means the items are in descending order and P ascending order Column header 2 Lengh trim wen tom We Comment nc pu a ZR Ez E 1 Us Ob 30201094 919 bp axo Be 30201132 921 bp 30214649 899 bp 23bp Tutorial 10 30220405 898 bp 25 bp Tutorial mas In List View it is possible to sort Name Length with without Phred with without Trimming linking direction and comments Chapter 4 Import and Export Chapter 4 Import and Export 103 4 1 Import Trace Files It 1s possible to directly import trace files output from DNA Auto sequencer The formats of trace in ABI and SCF formats can be imported l Select File gt Import gt Import sequence from the menu The Open Files dialog will display aix Look in E TraceDatal_1 da t E Ex 38150201132 38150214649 23150207169 30201135 30207178 30220405 a 30201093 30201147 30214630 30220406 a 30201094 30207122 30214632 30220436 30201104 30207146 30214635 in 30220443 30207163 30214639 30220454 Files of type All Files L ancel Jl 2 Select a file to import and click Open More than one file can be selected at the same time 3 The data is imported and the Import Summary dialog will display Check the contents and click OK nat Summa
124. ont used to display bases l Select View gt Preferences from the menu or click 9 on the Toolbar A dialog displays like the one shown below Lontig Trace Viewer Parameters Color BasePair Font Mame Courier Size 12 Select View Font Mame Courier Size 12 Select Color of Quality Bar Oo Duality score is between 0 and 18 3 Quality score is between 0 and 39 Cancel Help Background A Others Selection of Sequence E Selection of Trace 156 Chapter 9 Trace Display 2 Enter the desired settings and click OK Refer to 2 4 5 Trace Viewer Parameters for a description of the Preferences dialog 9 5 Search a Sequence It is possible to search for a specific sequence within a contig sequence or fragment sequence l Select Edit gt Find from the menu or click BY on the Toolbar The Search dialog is displayed 2 Input the search string of letters bases in the text box A ala Find what Eind Next Cancel 3 Click Find Next 4 Ifa matching string is found that string is selected I A TTATCAETETERGTTACAGATGG Ment You can click Find Next to continue searching as long as there are matching base sequences left To quit the search click Cancel In the parallel data display mode the search covers all the data that is being displayed If you select a sequence of bases in the data that you wish to search and then
125. opied into another application such as Microsoft Excel for editing It is also possible to drag and drop portions of traces to paste them directly to a new location The selected portion of a trace cannot be pasted as an image DD Eg EE oh A E WIND I nn ne utu xd A uw HHA m UM m pers m m MEA CE TOA MT pr LT A er err er el AEREA Ri X77 ri bt Lr A GALEN A AD e 7 P u 14 d al H m t q a ia m 1 m 1 n m m LI i a i Li as T7 La i a Ls E z E ha E E a m T M Y E E E Db i m i rr F E im LI ri I E F a L E j jn ndn Es ias e Pe a mmi Apa TU qun vrl 9 6 4 Hide Specific Traces To hide traces for A C G or T one or more click the corresponding lane button or buttons The specified traces disappear from the display and the associated bases are displayed in an italic font For example click M to hide A traces The display then appears as shown below Chapter 10 Output 160 Output This chapter explains how to print and how to copy windows For information on project and sequence export functions please refer to chapter 4 Import and Export Chapter 10 Output 161 10 1 Printing It is possible to print the various views from Contig Manager The procedure and the print format are described in this section 10 1 1 Print from the Project Window From the project window you can print th
126. ort from List View Tree View or Map View of Contig Manager 2 Select File gt Export Sequence gt Export Sequence or File gt Export Sequence gt Export Original Sequence from the menu 3 When the Save As dialog opens assign an appropriate name and click Save 4 When performed in List View with more than one data item selected the sequence will be exported in multi Fasta Format Method to Export from Contig Viewer 1 Double click the contig data to export from List View Tree View or Map View of Contig Manager 2 The corresponding contig will display in the Contig Viewer 3 Select File gt Export Consensus from the Contig Viewer menu Chapter 4 4 Import and Export 111 When the Save As dialog opens assign an appropriate name and click Save 4 6 4 Export Contig Sequence to DNASIS MAX Follow the procedure below to export contig sequences directly to DNASIS MAX Double click the contig data to export from List View Tree View or Map View of Contig Manager The corresponding contig will display in the Contig Viewer Select File gt Export Contig to DNASIS MAX from the Contig Viewer menu or click ra on the Toolbar The contig sequence will display in DNASIS MAX 4 7 Export Trace Files It is possible to export trace files not only by original basecall but also by Phred basecall 4 7 1 Export Original Basecall as Trace Data l 2 3 4 gt Double click the trace data
127. pter 1 Search target Contig Manager Tutorial Pattern 1 44494512 Pattern 2 Ar Pattern 3 12 Pattern 4 AA40777 Search Pattern Entry A494612 Searches for data with a sequence name of AA494612 AI Searches for data for which the sequence name starts with AI e 12 Searches for data for which the sequence name ends with 12 AA49 Searches for data for which the sequence name starts with AA49 and contains four other random characters consecutively 4 Select all of the contigs and folders on the Select target folder contig list and then click Find When selecting multiple elements from the list click the mouse button while pressing the Ctrl button to add required selections or click the mouse button while pressing the Shift button to sequentially select all of the data between the first click and the second click Find Results Number of search results for each pattern Im Search result 5 The Find Results shows that the AA494612 fragment entered in Pattern 1 resides in TutorialFolderl and those three fragments that start with the AI entered in Pattern 2 reside in Contig6 1 in Contig9 60 in the Root folder 26 in TutorialFolderl and 10 in TutorialFolder2 6 Click on the cell for search results to display a list of the fragments that match the search conditions in the Fragments list Chapter 1 Contig Manager Tutorial 35 Fragments
128. quence in the Contig Viewer and can be changed accordingly Click the contig sequence in the Contig Viewer or the base value on the fragment sequence to re sort and display the trace data based on the selected base value 22 Chapter 1 Contig Manager Tutorial 1370 1350 1330 in a habil A AM PE errr horse GAGGTATGGATTTIBABHAGGTEAAGAE GABGTATEGATTTIG A T IGAGRTATGGATTTIASAGGTCAAGAS Eom HH apr n aum JLILLLLLLLLL LAIL LE es A TW MM N ulii Ii LEN mM u mM ll Al JU i Fl i MOM Thy NI iy Wit m Fr Eu T 1450 144 ICACTTICOCTAAAGE ILALTTCHETA ILALTTLERTAAALG ILALTTLEGETAAAGG The linked display of the trace data when the base value on the fragment is clicked 1 2 11 Reassembly This section explains how to add a new sequence and perform reassembly with the added fragments included l Select Programs gt DNASIS MAX gt Tutorial Data from the Start menu to open the TutorialData folder 2 Then open ContigManager gt TutorialDatal gt TraceDatal 2 3 Drag and drop the data contained in the folder to the Root folder in Tree View 4 The name of the sequence and the number involved entered on the Import Summary dialog will be displayed Click OK to close the dialog 5 Select the Root folder in Tree View and confirm that the corresponding fragments have been added to the List View 6 Select the required fragment and click Basecall on the Navigation Toolbar to perform Phred basecalling and calculate the qua
129. r 3 The assembled contigs will appear in Tree View Contig Contig Contig10 Gantiell Gortiel2 Contigl3 Cantigl 4 Contigl6 Contisl z 2 2 e 3 3 3 3 4 4 4 4 4 4 5 Standard All Fragments Composition Results 4 36 contigs will be created if analysis is performed with the default values This may be interpreted as the entered fragment groups forming 36 clusters Chapter 1 Contig Manager Tutorial 27 1 3 5 Adjust the QV Threshold It is possible to specify different colors for the Map View and set up high low threshold values as the parameters for the Low QVs count in Tree View and List View In this tutorial low QV can be changed from 1 to 29 and high QV from 30 to 99 l Select View gt Preferences from the menu or click Preferences 9 on the Toolbar to display the Preferences dialog Preferences E Luality Color of Quality Bar EN Quality score is between and NE Quality score is between f 20 Fr 3 Preferences dialog 2 Change the value circled in the dialog above between 20 and 30 then click OK to close the dialog 3 The Map View will be redrawn and the values in Tree View and List View will be re calculated 1 3 6 Examine Assembly Results Contig34 created through analysis with the default values is used in this tutorial Contig34 The view above shows a Contig34 length of 2807bp consisting of 48 fragments and a base
130. r elect Vector Vector Name el Cpu DO pBluescript SK QI pGL3 Promoter Vector DO pBluescript KSce O Phage M13 genome JpBluescript SKH Utorialvector 4 Select or 2 cloning sites rui J pBluescript KS Select the vector and cloning site check boxes 18 Chapter 1 Contig Manager Tutorial 4 Repeat the same procedure to select the TutorialVectorB and PrimerB check boxes and the TutorialVectorC and PrimerC check boxes Check the imported vectors and corresponding cloning sites when performing actual analysis 5 Seta value that is lower than the default value for the Minimum matching percentage considered as contamination parameter with the tutorial data Amend the default value to 8596 Minimum matching percentage considered as contamination 85 y 6 Click OK to close the Trimming Parameters dialog once this setting has been made 7 Return to the main window and select the Trimming check box on the Navigation Toolbar Trimming Detail Trim 1 2 8 Perform Auto Assemble This section explains how to perform basecalling trimming and assembly of trace data 1 Select all of the fragments displayed in List View on the main Contig Manager window an easy way to select all data is to click on any data item in List View then press Ctrl A or select Edit gt Select All from the menu 2 Confirm that all fragments are highlighted then click Auto Assemble on the N
131. r Contig sequence a a Sem s EEE a MOTTO ETIN EDI EE tacuit we rr ee ee Fra FIG FIR eem FRE PR FE sn eo A EEE A ESTY Mn ARRE ca PET meses Tools ERIC i icum rot rera kribri TER Te Te cies M MTS fex Seen ee ROTEN ien aras TA AS AAC DA MAPUTO CM ne IR ADA A NICHE ar Fe pe en CREE Hi AAA AA C Ehe c fire ER Cua AAA iss uoa O A ARAN idis dea sal jalapa far Er nas gen ige og cde xd REP Sene m ndr eit tLe nir ze cg pa a RANTS ye tr ZEN IE La A ALA a eke P d oia dl ARE Pd NE em REED we Alignment The sequence shown at the very top is the contig consensus sequence and the lines displayed below it each correspond to fragment sequences The names of the fragment sequences are displayed at the left edge of the window The names of fragments linked by complementary strands are displayed in bold type The colors and fonts used to display different bases can be changed from the Preferences dialog Refer to 2 3 6 Contig Viewer Parameter Sequence Tab for details Ruler A ruler is displayed above the contig sequence Since the 5 end of a contig sequence is always 1bp the ruler may begin with a negative bp value if there is a portion of a fragment sequence that does not compose part of the contig In addition the ruler is calculated with gaps included Chapter 8 Mismatch Display Contig Editing 143 Bases that do not match the contig sequence are highlighted in yellow Gaps are indicated by
132. rameter dialog for setting details Trims the fragments selected in List View based on the settings in Detail Sets the assembly parameters Selects the algorithm to use for assembling DNASIS Assemble Aligns using DNASIS Assemble Phrap Chapter 2 Window Descriptions 51 Item Description Aligns using Phrap When Phrap is selected the following parameters will be displayed To use Phred you need to install the Contig Manager Fwd Primer Trace data is forward read using the dye primer method and when distinct name patterns are identified for a fragment they are input Forward linking is given priority if the direction cannot be determined Rev Primer Trace data 1s reverse read using the dye primer method and when distinct name patterns are identified for a fragment they are input Reverse linking is given priority 1f the direction cannot be determined Fwd Terminator Trace data is forward read using the terminator method and when distinct name patterns are identified for a fragment they are input Forward linking is given priority if the direction cannot be determined Rev Terminator Trace data is reverse read using the terminator method and when distinct name patterns are identified for a fragment they are input Reverse linking 1s given priority if the direction cannot be determined Detail When selecting DNASIS Assemble in Method Displays the DNASIS Assemble Parameter dialog Refer to 2 2 12 DNASIS Assemble Parame
133. rand as the entered sequence This icon is displayed when assembly has been performed with complementary strands of the entered sequence Displays a character string when a comment has been entered for the corresponding data 20 Chapter 1 Contig Manager Tutorial 1 2 9 Display Contig Results l Select any of the contigs displayed in Tree View on the main window to display the fragment information ofthe new contig 2 A list of the fragments forming the contig selected from the List View together with each assembly direction will display Tusorialyecior A 005bp Ibo TutorialVectorB HO GO 84 bp 25bp TutorialVeciorC 290 9 S She 22bp Tutorials 337 9 G amp EX bp 22bp TutorialVecipro 10 0 i amp Mk 3Dbp TutorialVecior8 306 fis amp gbp Jbp TutorisivectorS mage amp gbp 25Ebp TutarislVeriprG 307 3 3 amp Frhr 26bp Tutorial 252 fJ 5 x Mbp 25bp Tetra 416 3 5 amp amp hp 25be TutriasfVecierA 207 3 O 4 amp I2hp Mbp TutarielVerier 274 3 E 5 606 bn 27bp TutarafVecterA 240 G O 007 bp 25bp TutarefVecierA 406 3 E 3 Si 27bp TutarialVectorA 1 D t Standard All Contigs All Fragments List of Fragments Forming the Contig 3 Double click Contigl on the Tree View 4 The Contig Viewer will start up and the status of the Contigl fragment assembly will be displayed graphically File Edit wee Heb amp Amare ma Decora TCEC TC ET ET E Ba i DA ET TA CA
134. rent copies of a repeat lead to low LLR scores 20 62 Chapter 2 Window Descriptions 2 2 14 Trimming Parameters dialog Trimming Parameters e Trim End e 5 END Trim at least 10 Bp e Trim the first 10 bp while the quality i less than G0 3 le 3 END Trim at least 10 bp Trim the first 10 bp while the quality ts less than Or X Same as 5 END Select Vector Select or 2 cloning sites Vector Name Cloning Site Position Position DJ pBluescript KSt pBR222 J pBluescript SK DO pBluescript SK Opucne DO pBluescript KS OD oGL3 Promoter Vector Phage M13 genome Window size for vector trimming Minimum matching percentage considered as contamination Vector Database Manager Item Description Trim End Sets whether to trim off any base pairs at the ends of reads 5 End When checked trims from the 5 end When both Trim at least and Trim the first are checked first run Trim at least followed by Trim the first Trim at least Unconditionally trims the length of sequence specified from the 5 end Trims when checked Sequence lengths must be integers greater than 0 Trim the first When checked trims where quality is low from the 5 end When determining the quality set integers greater than 0 for window lengths and quality thresholds Below is the trimming procedure 1 Calculate the quality of the sequence length called a window set from t
135. review Displays the print image of the currently active view Print preview shows the area displayed in each view File menu Print Setup Exit Edit menu Cut Copy Copy Image Paste Select All Deselect All Find Jump to Next Marker Jump to Previous Marker View menu Toolbar Status Bar Display Type Sequence Quality Map Quality Numeric Chromatograms Window Descriptions Description Displays the standard print setup dialog for setting the paper size printing direction Closes the Contig Viewer Description Not supported in the current version When clicking the contig sequence copies the names of fragments and bases to the clipboard as tab delimited text for all aligned fragments Copies the contents of the active view to the clipboard in meta file format Not supported in the current version Selects all the bases in all fragment sequences Cancels the selection of all the bases in all fragment sequences Displays the Search dialog and searches designated sequence in the contig Valid when a contig sequence is selected in Sequence View Jumps to the mark to the right of the cursor in the Sequence View Jumps to the mark to the left ofthe cursor in the Sequence View Description Displays hides the Toolbar Displays hides the Status Bar Sets the display style in Sequence View Displays only the sequence The same as clicking is on the Toolbar Displays a diagram of the sequence and qu
136. rimming If masked by a vector sequence in trimming displays the name of the vector For fragments resulting from Phred basecalling of a trace the total bp number in the region where the Phred QV value of the fragment is low will display Displays the process done to the corresponding fragment Phred Phred basecalled fragments Trimmed Trimmed fragments Assemble N Fragments linked with a Normal strand Assemble C Fragments linked with a complementary strand Displays the comment of the corresponding fragment Chapter 2 Window Descriptions 55 2 2 12 DNASIS Assemble Parameter dialog Parameterset Editor Farameterset Name Parameterset Type Hs K DNASIS Assemble Parameters Min Overlap Length Min Match Rate Homology Compare M Max Match Compare M Gontig Header Bee dert Item Min Overlap Length Min Match Rate Homology Compare NA MaxMatch Compare NA Contig Header Description Initial setting Sets the minimum overlap of the fragments necessary to determine whether the pieces of the fragments can be linked The setting can range from 1 to 100 and it cannot be smaller than the value set in Homology Compare NA 30 Sets the minimum percentage of the matching fragments to determine whether the pieces of the fragments can be linked The setting can range from 1 to 100 90 Sets the number of bases bp to compare when searching for regions of fragment homology The starting an
137. rimming parameters Refer to 6 1 Set up Vectors for details 2 Place a check in the Trimming check box on the Navigation Toolbar Wm Assemble Method Phrap 3 Select the fragments to be trimmed from the List View Chapter 6 Vector Trimming 125 Th pi i je O DOF amp TT m zu m cm mn ee e E f ams KJ m m ala s nI 4 Click Trim under Trimming on the Navigation Toolbar AAA wv rimming Assemble Method Phrap 5 The Progress dialog will appear and analysis will run A symbol will be displayed in the 5 column beside the fragments that have been trimmed once the process completes fame tenah TJ vV to B x 30194804 951 bp 30201067 966 bp 30201093 966 bp 30201094 919 bp 30201104 343 bp 2 30201110 960 bp 30201132 921 bp 6 4 Display Trimming Results Displaying trimming results is different for trace data and sequence data 6 4 1 Trace Trimming Results The trace trimming results are sorted sequentially and displayed Double click on the trimmed trace data 126 Chapter 6 Vector Trimming bei 30194804 az bp Z4bp TutorialWector he 30201067 a40 bp 266p TutorialWector be 30201093 9416p Z56p Tutorialvectort Trimmed Trace Data The Contig Trace Viewer will start up and display the sequence data and trace data The series of N s are the areas that have been trimmed 6 4 2 Trimming Results of Sequence Data Double
138. rom the menu 926 bp 926 bp 338 bp 30214630 953 bp 6 All ofthe fragments composing the contig are moved to the new folder Next add any other fragments to be assembled to the folder 136 Chapter 7 Be 30227332 h 30227276 30227258 30227255 30220463 30220457 30220454 30220443 30220436 30220406 M bl Z M 7 Select the new folder and select all of the fragments in the folder 8 Click Assemble on the Navigation Toolbar Assemble Method Phrap Fwd Primer Hev Primer Fwd Terminator Rev Terminator Detail Phrap Assembly 9 The program begins to reassemble the fragments composing the contig and displays a confirmation dialog with the message Some of the selected fragments are connected Are you sure to dissolve the connection and continue operation To dissolve the contig and realign it with the added fragments included click Yes ContigMgr AN Some of the selected Fragments are connected Are you sure to dissolve the connection and continue operation Be 30227332 Be 30227276 Be 30227258 Be 30227255 30220463 30220457 30220454 m m m h 30220443 m bel 0220436 30220406 Chapter 7 Phrap Assembly 137 7 7 Parameters The assembly parameters on the Navigation Toolbar are listed below Assemble Method Phrap Fwd Primer Rev Primer Fwd Terminator Rev Termi
139. s 52 Chapter 2 Window Descriptions 2 2 7 List View List View displays the contents of the folder selected in Tree View Refer to 3 11 3 List View for the details 2 2 8 Preferences dialog Preferences ____ M Wd Settable Range Quality g Displaying colors of Contig Color of Quality B ar Xx Quality score iz between O and 19 IN en d IB Quality score is between DE 33 Cancel Help Item Description Quality score is between X and Y Sets the boundaries when coloring the contigs in Map View based quality values Boundary values can range is from 1 to 99 Displaying colors of Contig Sets the display color when quality value is within the set range When double clicking the display color with the mouse the color setting dialog will display 2 2 9 Open Project dialog Crests a rem promt Project Haras 4 f Open acum pragetz cmm Hane La l Balt Prametz Project Hore T Pra ect Ij Pramciz T Tus el ig Tutorial kpr Ext Item Description Create a new project Creates a new project Project Name Enter a project name Up to 120 characters can be used The following characters cannot be used in the project name O 3 New Creates a new project with the name input in the Project Name textbox Open existing project Opens an existing project Server Name Specifies the server to store data In the current version the server cannot be changed Select Projects Disp
140. sion numbers of vectors Edits vector cloning sites Displays a list of cloning sites Displays cloning site names Displays the cloning site positions of Normal strands Displays the cloning site positions of complementary strands Displays the update window to update the cloning site selected in the cloning site list Displays the registration window to add a new cloning site Deletes the cloning sites selected in the list Sets the vector features Displays a list of features Displays the starting position of the corresponding feature Displays the ending position of the corresponding feature Displays the features Displays the update window to update the features selected in the list Displays the registration window to add a new feature Deletes the features selected in the list Changes vector contents selected in the vector list Adds a new vector Deletes the vectors selected in the vector list Imports vectors by specifying vector data files Outputs the vector information selected in the vector list into a vector data file so that the file can be exported to DNASIS on other PCs Exits the Vector Database Manager Displays the reference information of the vectors selected in the vector list Displays online help 2 2 16 Relink Trace Files dialog Spini Trace Piles Tores dais lores ong Bin do original trece file Placa rai up the pah da the trace dia Hare Charan Poth Mares a 31132314 i XENTI 0
141. t Chapter 3 Project Window Chapter 3 Project Window 77 3 1 What is a Project In the Contig Manager a project is an analytical unit in which operations are performed A project contains information on sequences how they are linked how contigs are formed and user defined parameters 3 2 Components of a Project A project is composed of a folder s contig s and fragment s 3 2 1 Folders A folder is a place to store data A folder can contain folders contigs and fragments and manage a hierarchical structure of data The folder at the top hierarchy is called a root folder Folders are displayed with icons as in the following figure Users can give a folder any non duplicate name However the root folder cannot be renamed 3 2 2 Contigs A sequence made by linking fragments s called a contig and displayed using the ki icon 3 2 3 Fragments Fragments are classified into trace data and sequence data with only base alignments Trace Data The data output from a sequencer in ABI Format and SCF Format can be imported as trace data On the Contig Manager trace data is displayed using the bei icon Sequence Data The kinds of data that can be imported as sequence data are Fasta Format Multi Fasta Format Genbank Format Multi Genbank Format EMBL Format Multi EMBL Format DNASIS for Windows Format and Simple Text Format In a view sequence data is displayed using the icon 78 Chapter 3 Project Window
142. ta has reduced the low region quality value from 1758bp to 1402bp and that the accuracy of the contig sequence has been improved 1 3 14 Dissolve Assembled Sequences To dissolve assembled sequences select the contig assembly to dissolve from Tree View or List View and then click Dissolve on the Navigation Toolbar In this example Contig36 will be dissolved A new folder will also be created for easy confirmation of dissolving results All fragments will be moved to this folder to perform dissolving l Right click on the Root folder and then select New Folder from the popup menu 2 Right click on the New Folder 1 created in the previous step and then select Property from the popup menu 3 The Property dialog for the folder will appear Amend the folder name from New Folder 1 to TutorialFolder2 4 Select Contig36 from Tree View to display a list of fragments that make up this contig in List View 5 Click on any item of data displayed in List View and then press Ctrl A or select Edit gt Select All from the menu 6 Drag and drop the fragments selected in List View and move them to TutorialFolder2 7 Select Contig36 from the List View and then click Dissolve on the Navigation Toolbar 8 Aconfirmation dialog with a message Are you sure to dissolve contigs will display Click Yes to continue with the dissolving process ContigMgr E AN Are vou sure ta dissolve contigs 9 Click TutorialFolder2 on t
143. ter dialog for details When selecting Phrap in Method Displays the Phrap Parameter dialog Refer to 2 2 13 Phrap Parameter dialog for details Assemble Assembles the fragments selected in List View based on the settings Jump Searches for fragments Enter the name of the fragment you want to search in the box and click Jump Fragments with identical names will be selected when List View is active Open Opens the selected fragment or contig in an active view Dissolve Removes the contig alignment selected in the currently active view Remove Removes contig fragments selected in List View Reassembles the contig without the fragments selected for removal Fragments Displays Check Fragment dialog Refer to 2 2 11 Check Fragment dialog for setting details Reset To Original Sequence Returns the selected fragments to the sequence at the time of input When the fragments are linked the links are removed 2 2 4 Status Bar The Status Bar displays the names of each menu button of menu and Toolbar at the mouse cursor and each application on the application palette RE Standard All Contigs All Fragments Save the active project 2 2 5 Map View Map View graphically displays the project contigs with quality values Refer to 3 11 1 Map View for the details 2 2 6 Tree View Tree View displays the project structure with folders contigs and fragments that compose it Refer to 3 11 2 Tree View for the detail
144. ters by clicking Detail in the Assemble group on the Navigation Toolbar Refer to 2 2 12 DNASIS Assemble Parameter dialog and 2 2 13 Phrap Parameter dialog for an explanation of advanced parameters Chapter 8 Contig Editing Chapter 8 Contig Editing 141 8 1 Contig Viewer It is possible to view contig details in Contig Viewer by clicking on it in Contig Manager The Contig Viewer window appears as shown below The top pane 1s the Map View and the bottom is the Sequence View CA sd Be Git Wee Heb CERES PEA TE CATCAT AG TG TGGA TG TAAG AAT TCA GC GC DC TCR GT amp T TT TA amp GOAT CA GA DC RA GT GAAGAC TA TACA TGA TA MATA TGEATCET AC TCR Godt ot aiio A ST TOES RC li CC TCEABT AT TT TA E o c po O inis EG AC TA Te ct p eT E TC CATCAT AC TO TOCA TC TA GC GA KT TOCA GC DC CC TC ET AT TT TAA DEAT CA EA QC A ET EA AGAC TA TA CA TG AT hA E TC EA TC AT AC TC TC CA TC TARGA AT TODA BC BC DC TC EA BT AT TT TARA BC AT C BA BC 8 BT Rh A AC TA TACA TORT n ke ATCAT AC TCTCCA TC TAREA AT TO CARI DC DC TCR ET n bd Bm c DC AT CA GA D GT DA AG AG T TACA TGAT c bc Us Mies ct o s DOSE ot cmt p ET E Sequence View abi snm 1a 3014530 sn IT ca da bk som re aes 35 JEPF ETE arius 90134524 pe es ETA E bran dT Dee _ DE Finary ea s 0 8 2 Contig Map View This view displays the contig and the fragments that compose it in graphical form The upper gray bar is the contig Above t
145. the QV from the 3 end and performs masking while the QV is less than or equal to XX average value is XX or less Masking ends when the average value exceeds the value specified here Moving average window size Specifies the window size for obtaining the moving average when masking with 3 end sequences Mask as N Select this check box if the base value is to be replaced with N for the relevant area when the moving average of the 3 end sequence s QV is the same or less than the threshold value Middle Sets whether or not to perform masking with the QV set for the entire sequence Select this check box if masking is to be performed Mask while moving average of Obtains the moving average of the QV from the closest 5 end to the closest 3 end of QV is less than or equal to XX non masked regions and performs masking while the average value is XX or less Moving average window size Specifies the window size for obtaining the moving average when masking with the entire sequence Mask as N Select this check box if the base value is to be replaced with N for the relevant region 38 Chapter 1 Contig Manager Tutorial Item Description when moving average of the entire sequence s QV is the same or less than the threshold value Output Parameters Sets the parameters for the folder where masking result data is output If high QV bp is less than or equalThe results are output to the NG folder ifthe length of unmasked region is X
146. to the clipboard Refer to 9 6 2 Copying Bases and 9 6 3 Copying Traces for details of operation Select AII Selects the whole original sequence of the selected data Find Searches a particular base from the displayed data Refer to 9 5 Searching a Sequence for the details of operation 12 Chapter 2 Window Descriptions View menu Description Toolbar Toggles the Toolbar to display hide it Status Bar Toggles the status bar to display hide it Show Single Data Switches to the Single Data mode Show All Data Switches to the Parallel Data mode Preference Displays the parameter dialog of the view Refer to 2 4 5 Trace Viewer Parameter for the details Help menu Description Contents Displays the help for Contig Trace Viewer About Contig Trace Viewer Displays the version information of Contig Trace Viewer 2 4 2 Toolbar Button Description Displays the previous data in the Single Data mode Displays the next data in the Single Data mode 802071 22 Displays the data list in the Single Data mode Switches to the Single Data mode Switches to the Parallel Data mode Stores the original sequence in a file The same as selecting File gt Export from the menu Prints the window The same as selecting File gt Print from the menu Displays the Search dialog for bases The same as selecting Edit gt Find from the menu Decreases the vertical width of a trace Increases the vertical width o
147. u Not supported in the current version 50 Chapter 2 Window Descriptions Icon Description menu 3 x ollo qs Copies data selected in Tree View or List View to the clipboard The same as selecting Edit Copy from the Not supported in the current version Carries out printing The same as selecting File gt Print from the menu Displays a print image The same as selecting File gt Print Preview from the menu Displays the Preferences dialog For details refer to 2 2 8 Preferences dialog The same as selecting View gt Preference from the menu Displays online help The same as selecting Help gt Contents from the menu 2 2 3 Navigation Toolbar Mahod Fitt se Faro Fares Fed T renta Fue Tomes Jue peer Hann jum PRLS cae qiu da LE Fuegsari Ame finas Item Auto Assemble Basecall Use Phred Basecall Trimming Detail Trim Assemble Method Description Based on the Navigation Toolbar Settings performs basecalling trimming and assembly Sets trace basecall parameters Selects the parameter to use for basecalling Original Basecalling using the sequence information stored in the trace file Phred Basecalling using Phred To use Phred you need to install the Contig Manager Perform a basecall using the trace selected in List View Performs trimming if Auto Assemble is checked Displays the Trimming Parameter dialog Refer to 2 2 14 Trimming Pa
148. value of 1758bp for the QV set at 30 or less for this example It is also clear that the low quality areas are situated on both ends and in the center of the contig 1 3 7 Display Assembly Status Details 1 Double click on Contig34 to view actual assembly details in List View 28 Chapter 1 Contig Manager Tutorial Map View 2 The layout of fragments in Map View of the Contig Viewer indicates that both ends of the contig have been read comparatively well whereas the central area has not 3 Viewing the sequence enables us to estimate that a Poly A region exists near the 3 end of the contig sequence GERAL fou 2230 2 FER R E E E E E R E E E E E R E E R E R E E E E E E R E E E R E R E E alaaacccaaaaaaaaaaaaaaaaaaaaaaaglacc alaaacccaaaaaaaaaaaaaaaaaaaaaaaglacc atackcccasaaaaaaaaaaaa Poly A Region 1 3 8 Link with DNASIS MAX l Select File gt Export Contig to DNASIS MAX from the Contig Viewer menu or click Export Contig to DNASIS MAX Fa on the Toolbar to analyze the new contig sequence with DNASIS MAX 2 DNASIS MAX will start up when the contig sequence is read Fin fui Sapara Ama Heb Dumb mmm eant Tu aausmiczsmtttff LA Fresh batwar EY Herpes z firenza Ermini un rema a a a a a ee Tunisa bcacrgogico sstceacgci tctcaggtgt icttmiprgt ccatcascet gqeggtctctt f Hass Ue a i E im r X

User Manual - Hitachi Solutions America

Contents

Download Pdf Manuals

Related Search

Related Contents