pcDNA 3.2/V5-DEST and pcDNA 6.2/V5-DEST - t
Contents
1. Description Map 24 pcDNA 3 2 V5 GW CAT 6188 bp and pcDNA 6 2 V5 GW CAT 5818 bp are control vectors expressing chloramphenicol acetyltransferase CAT Each vector was constructed using the LR recombination reaction between an entry clone containing the CAT gene and the respective destination vector Note The CAT gene is in frame with the C terminal V5 epitope and does not contain a stop codon The molecular weight of the CAT fusion protein is 30 kDa The map below shows the elements of pcDNA 3 2 V5 GW CAT and pcDNA 6 2 V5 GW CAT The complete sequences of these vectors are available for downloading from our Web site www invitrogen com or by contacting Technical Service page 25 Comments for Y BG 3 Bore BEA eter pcDNA V5 GW CAT pcDNA 3 2 V5 GW CAT pcDNA 6 2 V5 GW CAT 6188 nucleotides 5818 nucleotides CMV promoter 232 819 232 819 T7 promoter priming site 863 882 863 882 attB1 site 911 935 911 935 CAT ORF 955 1611 955 1611 attB2 site 1628 1652 1628 1652 V5 epitope 1678 1719 1678 1719 V5 reverse priming site 1687 1707 1687 1707 TK polyadenylation signal 1746 2017 1746 2017 f1 origin 2053 2481 2053 2481 SV40 early promoter and origin 2508 2816 2508 2816 Neomycin resistance gene 2891 3685 EM7 promoter 2871 2937 Blasticidin resistance gene 2938 3336 SV40 early polyadenylation signal 3861 3991 3494 3624 pUC origin c 4374 5047 4007 4677 Ampicillin b2. Products pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST vectors are available from Invitrogen Ordering information is provided below Product Amount Catalog no Gateway LR Clonase II Enzyme Mix 20 reactions 11791 020 100 reactions 11791 100 Tag On Demand Suppressor 200 ul K400 01 Supernatant 5 x 200 ul K405 01 One Shot TOP10 Chemically 10 reactions C4040 10 Competent Cells 20 reactions 4040 03 PureLink HQ Mini Plasmid 100 preps K2100 01 Purification Kit PureLink HiPure Plasmid Midiprep Kit 25 preps K2100 04 Lipofectamine 2000 1 5 ml 11668 019 0 75 ml 11668 027 Geneticin 1g 11811 023 5g 11811 031 Blasticidin 50 mg R210 01 Detection of You can detect expression of your recombinant fusion Recombinant protein using the Anti V5 antibodies available from Proteins Invitrogen The amount of antibody supplied is sufficient for 25 Western blots or 25 immunostaining reactions FITC conjugated antibody only Product Epitope Catalog no Anti V5 Antibody Detects 14 amino acid epitope R960 25 Anti V5 HRP Antibody derived ramet dandy R961 25 proteins of the paramyxovirus Anti V5 AP Antibody SV5 Southern et al 1991 R962 25 Anti V5 FITC Antibody GKPIPNPLLGLDST R963 25 vi Overview Description Features Methods pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST are 7 7 kb and 7 3 kb vectors respectively that are adapted with t
3. Sample Positive Control Entry clone 50 150 ng rxn 1 7 ul Destination vector 150 ng ul 1 pl 1 ul pENTR gus 50 ng ul R 2 ul TE Buffer pH 8 0 to 8 ul 5 ul 10 Remove the LR Clonase II enzyme mix from 20 C and thaw on ice 2 minutes Vortex the LR Clonase II enzyme mix briefly twice 2 seconds each time To each sample above add 2 ul of LR Clonase II enzyme mix Mix well by pipetting up and down Reminder Return LR Clonase II enzyme mix to 20 C immediately after use Incubate reactions at 25 C for 1 hour Note Extending the incubation time to 18 hours typically yields more colonies Add 1 ul of the Proteinase K solution to each reaction Incubate for 10 minutes at 37 C Transform 1 ul of the LR recombination reaction into a suitable E coli host follow the manufacturer s instructions and select for expression clones Note You may store the LR reaction at 20 C for up to 1 week before transformation if desired continued on next page Creating an Expression Clone continued What You Should See Confirming the Expression Clone Sequencing If you use E coli cells with a transformation efficiency of 2 1 x 108 cfu ug the LR reaction should give gt 5 000 colonies if the entire reaction is transformed and plated The ccdB gene mutates at a very low frequency resulting in a very low number of false positives True expression clones will be ampici
4. or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Limited Use Label License No 19 Gateway Cloning Products Use of the pceDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST Gateway Vectors is covered under the licenses detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Life Technologies Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of ClonaseTM purchased from Life Technologies Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c ma
5. tag after recombination see page 6 for a diagram include the V5 epitope tag for use e should contain a TAG stop codon in the Tag On Demand System e should be in frame with the V5 epitope tag after recombination see page 7 for a diagram not include the V5 epitope tag e should contain a stop codon Creating an Expression Clone Introduction Experimental Outline Propagating the Vectors After you have generated an entry clone you will perform the LR recombination reaction to transfer the gene of interest into the pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST vector to create your expression clone To ensure that you obtain the best results we recommend that you read this section and the next section entitled Performing the LR Recombination Reaction pages 8 11 before beginning To generate an expression clone you will 1 Perform an LR recombination reaction using the attL containing entry clone and the attR containing pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST vector 2 Transform the reaction mixture into a suitable E coli host 3 Select for expression clones refer to pages 6 7 for a diagram of the recombination region of the resulting expression clones If you wish to propagate and maintain pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST we recommend using One Shot ccdB Survival 2 T1 Phage Resistant Cells Catalog no A10460 from Invitrogen for transformation The ccdB Su
6. ug ml final concentration 4 Store plates at 4 C in the dark Plates containing Blasticidin are stable for up to 2 weeks continued on next page 19 Recipes continued Cell Lysis Buffer 4X SDS PAGE Sample Buffer 20 50 mM Tris pH 7 8 150 mM NaCl 1 Nonidet P 40 1 3 This solution can be prepared from the following common stock solutions For 100 ml combine 1M Tris base 5 ml 5M NaCl 3 ml Nonidet P 40 1ml Bring the volume up to 90 ml with deionized water and adjust the pH to 7 8 with HCI Bring the volume up to 100 ml Store at room temperature To prevent proteolysis you may add 1 mM PMSF 1 uM leupeptin or 0 1 uM aprotinin before use 1 2 3 Combine the following reagents 0 5 M Tris HCl pH 6 8 5 ml Glycerol 100 4ml B mercaptoethanol 0 8 ml Bromophenol Blue 0 04 g SDS 08g Bring the volume to 10 ml with sterile water Aliquot and freeze at 20 C until needed Blasticidin Molecular The formula for Blasticidin S is Ci7H2NgOs HCl and the Weight molecular weight is 458 9 The diagram below shows the Formula and structure of Blasticidin Structure ue Sn Ae N HOOC 7 HCI CH3 Sn NH NH2 O Handling Always wear gloves mask goggles and protective clothing Blasticidin e g a laboratory coat when handling Blasticidin Weigh out Blasticidin and prepare solutions in a hood Preparing and Blasticidin may be obtained separately from Invit
7. which inhibits protein synthesis in both prokaryotic and eukaryotic cells Takeuchi et al 1958 Yamaguchi et al 1965 Resistance is conferred by expression of either one of two blasticidin S deaminase genes bsd from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert blasticidin S to a nontoxic deaminohydroxy derivative Izumi et al 1991 continued on next page Creating Stable Cell Lines continued Determining Antibiotic Sensitivity Geneticin Selection Guidelines To successfully generate a stable cell line expressing your protein of interest you need to determine the minimum concentration of antibiotic Geneticin or Blasticidin required to kill your untransfected host cell line Test a range of concentrations see protocol below to ensure that you determine the minimum concentration necessary for your cell line Refer to page 21 for instructions on how to prepare and store Blasticidin 1 Plate or split a confluent plate so the cells will be approximately 25 confluent For each antibiotic prepare a set of 6 7 plates Add the following concentrations of antibiotic to each plate e For Blasticidin selection test 0 1 3 5 7 5 and 10 ug ml Blasticidin e For Geneticin selection test 0 50 125 250 500 750 and 1000 ug ml Geneticin 2 Replenish the selective media every 3 4 days and observe the percentage of surviving cells
8. 3 Count the number of viable cells at regular intervals to determine the appropriate concentration of antibiotic that prevents growth within 1 3 weeks after addition of the antibiotic Once you have determined the appropriate Geneticin concentration to use for selection you can generate a stable cell line expressing your pcDNA 3 2 V5 DEST construct Geneticin is available separately from Invitrogen see page vi for ordering information Use as follows 1 Prepare Geneticin in a buffered solution e g 100 mM HEPES pH 7 3 2 Use the predetermined concentration of Geneticin in complete medium 3 Calculate concentration based on the amount of active drug 4 Cells will divide once or twice in the presence of lethal doses of Geneticin so the effects of the drug take several days to become apparent Complete selection can take from 2 to 3 weeks of growth in selective medium continued on next page 17 Creating Stable Cell Lines continued Blasticidin Once you have determined the appropriate Blasticidin Selection concentration to use for selection you can generate a stable Guidelines cell line expressing your peDNA 6 2 V5 DEST construct Blasticidin is available separately from Invitrogen see page vi for ordering information Use as follows 1 Prepare a stock solution of 5 10 mg ml of Blasticidin in sterile water Filter sterilize the solution 2 Use the predetermined concentration of Blasticidi
9. CAAAAAAGC AGG CIN NAC 3161 attB 2 TGTTCAAACA TGTTTTTTCG TCC GAN GENE NTG CCA GET TTC GGT CGA AAG Pro Ala Phe V5 epitope TTG AAC Leu TAC ATG Tyr 1 AAA GTG GTT GAT CTA GAG GGC CCG CGG TTC GAA TTT CAC CAA CTA GAT CTC CCG GGC GCC AAG CTT Lys Val Val Asp Leu Glu Gly Pro Arg Phe Glu V5 reverse priming site GGT AAG CCT Gly Lys Pro GGT TAG TAA Gly KKK KKK ATC Ile TGA KK CCT Pr AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT ACC Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr GTTTAAACGG GGGAGGCTAA CTGAAACACG GAAGGAGACA continued on next page Creating an Expression Clone continued Recombination Region for Use in the Tag On Demand System CAAT The recombination region of the expression clone resulting from pcDNA 3 2 V5 DEST x entry clone or pcDNA 6 2 V5 DEST x entry clone is shown below Note The gene of interest must contain a TAG stop codon for use in the Tag On Demand System see page 3 for more information Features of the Recombination Region Shaded regions correspond to DNA sequences transferred from the entry clone into pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST by recombination Non shaded regions are derived from the pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST vector The underlined nucleotides flanking the shaded region correspond to bases 918 and 3161 of the pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST vector sequence Putative _ TATA 3 e
10. R recombination reaction with pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST In addition each Ultimate hORF Clone contains a TAG stop codon making it fully compatible for use in the Tag On Demand System For more information about the Ultimate hORF Clones available refer to our Web site www invitrogen com or contact Technical Service page 25 continued on next page 3 Generating an Entry Clone continued Kozak Consensus Sequence Points to Consider Before Recombining Your insert should contain a Kozak translation initiation sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1991 Kozak 1990 An example of a Kozak consensus sequence is provided below The ATG initiation codon is shown underlined G A NNATGG Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring consensus sequence pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST are C terminal fusion vectors however you may use these vectors to express native proteins or C terminal fusion proteins You may also use these vectors in the Tag On Demand System see previous page Consider the following when generating your entry clone If you wish to Then your insert System include the V5 epitope tag and e should NOT contain a stop codon NOT use the Tag On Demand e should be in frame with the V5 epitope
11. acilitate generation of entry clones For more information refer to our Web site www invitrogen com or contact Technical Service page 25 Refer to the manual for the specific entry vector you are using for detailed instructions to construct an entry clone The pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST vectors are compatible with the Tag On Demand System which allows expression of both native and C terminally tagged recombinant protein from the same expression construct The System is based on stop suppression technology originally developed by RajBhandary and colleagues Capone et al 1985 and consists of a recombinant adenovirus expressing a tRNAs suppressor When an expression vector encoding a gene of interest with the TAG amber stop codon is transfected into mammalian cells the stop codon will be translated as serine allowing translation to continue and resulting in production of a C terminally tagged fusion protein For more information refer to the Tag On Demand Suppressor Supernatant manual This manual is available for downloading from our Web site www invitrogen com or contact Technical Service page 25 If you wish to express a human gene of interest from pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST we recommend using an Ultimate Human ORF hORF Clone available from Invitrogen Each Ultimate hORF Clone is a fully sequenced clone provided in a Gateway entry vector that is ready to use in an L
12. and are searchable by product lot number which is printed on each box Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility
13. ation signal f1 origin SV40 early promoter and origin Neomycin resistance gene EM7 promoter Blasticidin resistance gene SV40 early polyadenylation signal pUC origin c Ampicillin bla resistance gene c bla promoter c c complementary strand pcDNA 3 2 V5 DEST 7711 nucleotides 232 819 863 882 911 1035 1464 1769 2111 2770 3051 3175 3201 3242 3210 3230 3269 3540 3576 4004 4031 4339 4414 5208 5384 5514 5897 6570 6715 7575 7576 7674 attR2 V5 epitope pcDNA 6 2 V5 DEST 7341 nucleotides 232 819 863 882 911 1035 1464 1769 2111 2770 3051 3175 3201 3242 3210 3230 3269 3540 3576 4004 4031 4339 4394 4460 4461 4859 5017 5147 5530 6200 6345 7205 7206 7304 22 continued on next page Features of pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST Features pcDNA 3 2 V5 DEST 7711 bp and pcDNA 6 2 V5 DEST 7341 bp contain the following elements All features have been functionally tested Feature Benefit Human cytomegalovirus CMV immediate early promoter enhancer Allows efficient high level expression of your recombinant protein Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 T7 promoter priming site Allows in vitro transcription in the sense orientation and sequencing through the insert attR1 and attR2 sites Allows recombinational cloning of the gene of interest from an entry clone ccdB gene Allows negative sel
14. bla resistance gene for selection in E coli continued on next page 1 Overview continued The Gateway Technology The Gateway Technology is a universal cloning method that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 to provide a rapid and highly efficient way to move your gene of interest into multiple vector systems To express your gene of interest using Gateway Technology simply 1 Clone your gene of interest into a Gateway entry vector to create an entry clone 2 Generate an expression clone by performing an LR recombination reaction between the entry clone and a Gateway destination vector e g p DNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST 3 Transfect your expression clone into the cell line of choice for transient or stable expression of your gene of interest For more information on the Gateway Technology refer to the Gateway Technology with Clonase II manual This manual is available for downloading from our Web site www invitrogen com or by contacting Technical Service page 25 Generating an Entry Clone Introduction Tag On mi Demand System Note To recombine your gene of interest into ppDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST you will need an entry clone containing the gene of interest see below and the next page for recommendations Many entry vectors including pENTR D TOPO are available from Invitrogen to f
15. c Resistance with a Bacterial Gene Under Control of the SV40 Early Region Promoter J Molec Appl Gen 1 327 339 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic The Journal of Antibiotics Series A 11 1 5 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 2002 2008 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal of human therapeutic or diagnostic use 31 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
16. ce Gene for Transfection of Mammalian Cells Biochim Biophys ACTA 1219 653 659 continued on next page 30 References continued Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 115 887 903 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Biochem 58 913 949 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Southern P J and Berg P 1982 Transformation of Mammalian Cells to Antibioti
17. cells must be clean and free contamination with from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 the PureLink HiPure Plasmid Midiprep Kit Catalog no K2100 04 or CsCl gradient centrifugation For established cell lines e g HeLa consult original references or the supplier of your cell line for the optimal method of transfection We recommend that you follow exactly the protocol for your cell line Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 For high efficiency transfection in a broad range of mammalian cell lines we recommend using Lipofectamine 2000 Reagent Catalog no 11668 027 available from Invitrogen For more information about Lipofectamine 2000 and other transfection reagents refer to our Web site www invitrogen com or contact Technical Service page 25 continued on next page Transfection continued Pos
18. ection of plasmid Chloramphenicol resistance gene Allows counterselection of plasmid V5 epitope Allows detection of the recombinant fusion protein by the Anti V5 antibodies Southern et al 1991 V5 reverse priming site Allows sequencing of the insert Herpes Simplex Virus Thymidine Kinase TK polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Cole and Stacy 1985 fl origin Allows rescue of single stranded DNA SV40 early promoter and origin Allows efficient high level expression of the neomycin or Blasticidin resistance gene and episomal replication in cells expressing the SV40 large T antigen Neomycin resistance gene pcDNA 3 2 V5 DEST only Allows selection of stable transfectants in mammalian cells Southern and Berg 1982 EM7 promoter pcDNA 6 2 V5 DEST only Allows expression of the Blasticidin resistance gene in E coli Blasticidin bsd resistance gene pcDNA 6 2 V5 DEST only Allows selection of stable transfectants in mammalian cells Kimura et al 1994 SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin Allows high copy number replication and growth in E coli Ampicillin bla resistance gene B lactamase Allows selection of transformants in E coli 23 Map of pcDNA 3 2 V5 GW CAT and pcDNA 6 2 V5 GW CAT
19. electrophoresis apparatus are available from Invitrogen For more information refer to our Web site www invitrogen com or contact Technical Service page 25 To detect expression of your recombinant fusion protein by Western blot analysis you may use the Anti V5 antibodies available from Invitrogen see page vi for ordering information or an antibody to your protein of interest In addition the Positope Control Protein Catalog no R900 50 is available from Invitrogen for use as a positive control for detection of fusion proteins containing a V5 epitope The ready to use WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescent methods For more information refer to our Web site www invitrogen com or contact Technical Service page 25 Note The C terminal peptide containing the V5 epitope will add approximately 4 kDa to your protein Detecting CAT Protein If you use the provided positive control vector in your experiment you may assay for CAT expression using your method of choice Note that CAT is fused to the C terminal V5 epitope tag so you can use Western blot analysis and an Anti V5 antibody to detect expression of CAT Other commercial kits are available for assaying CAT expression The molecular weight of the CAT fusion protein is approximately 30 kDa 15 Creating Stable Cell L
20. esersersersnr 29 Referenc s snena a a E a A N a 30 Important Information Gateway This manual is supplied with the following products Vectors Product Catalog no pcDNA 3 2 V5 DEST Gateway Vector 12489 019 pcDNA 6 2 V5 DEST Gateway Vector 12489 027 The pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST Important Gateway Vectors have been renamed to be more descriptive and to better reflect the functionality of the vector Shipping and The pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST Storage Gateway Vectors are shipped on wet ice Upon receipt store at 20 C Contents The pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST Gateway Vector components are listed below Item Concentration Volume Gateway Destination Vector 6 ug at 150 ng pl in TE 40 pl pcDNA 3 2 V5 DEST or buffer pH 8 0 10 mM Tris pcDNA 6 2 V5 DEST HCI 1 mM EDTA pH 8 0 Control Plasmid 10 ug at 0 5 ug ul in TE 20 ul pcDNA 3 2 V5 GW CAT or buffer pH 8 0 10 mM Tris pcDNA 6 2 V5 GW CAT HCI 1 mM EDTA pH 8 0 Product The Certificate of Analysis provides detailed quality control Qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box Accessory Products Additional Additional products that may be used with the
21. g information Do not transform the LR reaction mixture into E coli strains that contain the F episome e g TOP10F These strains contain the ccdA gene and will prevent negative selection with the ccdB gene The presence of the EM7 promoter and the Blasticidin resistance gene in peDNA 6 2 V5 DEST allows for selection of E coli transformants using Blasticidin For selection use Low Salt LB agar plates containing 100 ug ml Blasticidin see page 19 for a recipe For Blasticidin to be active the salt concentration of the medium must remain low lt 90 mM and the pH must be 7 0 Blasticidin is available separately from Invitrogen see page vi for ordering information Refer to page 21 for instructions on how to prepare and store Blasticidin Note continued on next page Performing the LR Recombination Reaction continued LR Clonase II Enzyme Mix Materials Needed LR Clonase II enzyme mix is available separately from Invitrogen Catalog no 11791 020 to catalyze the LR recombination reaction The LR Clonase II enzyme mix combines the proprietary enzyme formulation and 5X LR Clonase Reaction Buffer previously supplied as separate components in LR Clonase enzyme mix into an optimized single tube format for easier set up of the LR recombination reaction Use the protocol provided on page 10 to perform the LR recombination reaction using LR Clonase II enzyme mix Note You may perform the LR recombi
22. he Gateway Technology and allow high level constitutive expression of the gene of interest in a variety of mammalian hosts For more information on the Gateway Technology see the next page pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST contain the following elements e Human cytomegalovirus immediate early CMV promoter enhancer for high level expression in a wide range of mammalian cells e Two recombination sites attR1 and attR2 downstream of the CMV promoter for recombinational cloning of the gene of interest from an entry clone e The ccdB gene located between the two attR sites for negative selection e Chloramphenicol resistance gene located between the two attR sites for counterselection e The V5 epitope tag for detection using Anti V5 antibodies e The Herpes Simplex Virus thymidine kinase polyadenylation signal for proper termination and processing of the recombinant transcript e fl intergenic region for production of single strand DNA in F plasmid containing E coli e SV40 early promoter and origin for expression of the neomycin pcDNA 3 2 V5 DEST or Blasticidin pcDNA 6 2 V5 DEST resistance gene and stable propagation of the plasmid in mammalian hosts expressing the SV40 large T antigen e Neomycin pcDNA 3 2 V5 DEST or Blasticidin pcDNA 6 2 V5 DEST resistance gene for selection of stable cell lines e The pUC origin for high copy replication and maintenance of the plasmid in E coli e The ampicillin
23. ines Introduction Og Ui E RECO Geneticin Blasticidin 16 The pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST vectors contain the neomycin and Blasticidin resistance genes respectively to allow selection of stable cell lines If you wish to create stable cell lines transfect your construct into the mammalian cell line of choice and select for foci using Geneticin pcDNA 3 2 V5 DEST only or Blasticidin pcDNA 6 2 V5 DEST only General information and guidelines are provided below To obtain stable transfectants we recommend that you linearize your pcCDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST construct before transfection While linearizing the vector may not improve the efficiency of transfection it increases the chances that the vector does not integrate in a way that disrupts elements necessary for expression in mammalian cells To linearize your construct cut at a unique site that is not located within a critical element or within your gene of interest Geneticin blocks protein synthesis in mammalian cells by interfering with ribosomal function It is an aminoglycoside similar in structure to neomycin gentamycin and kanamycin Expression in mammalian cells of the bacterial aminoglycoside phosphotransferase gene APH derived from Tn5 results in detoxification of Geneticin Southern and Berg 1982 Blasticidin S HCI is a nucleoside antibiotic isolated from Streptomyces griseochromogenes
24. invitrogen pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST Gateway Vectors Gateway adapted destination vectors for cloning and expression of C terminal V5 fusion proteins in mammalian cells Catalog nos 12489 019 and 12489 027 Version E 27 October 2010 25 0500 Table of Contents Important Information mserevserrrrorerersererrererersersrreverseversrsevessaversssevessevesseversssenersns v Accessory Prod ucts usunn uuavsnneginanansinnemengnesedees vi LEIALO Lo Lo Eaa EEn Na NEE AE A EEA elste 1 Ove O a vesen 1 Generating an Entry Clone ccccscssessssessessssessssessessesessessseesessssesssessesessensseensees 3 Creating an Expression Clone sssini siiin 5 Performing the LR Recombination Reaction mrresrvrrverrrrererrerersrsrererrerererserrrsnne 8 TransfecHon usagstrussestvroreruakesstesdeestekgaoint 12 Expression and Analysis mmvrverrerrrrererrrrerersererreverrerererseresseversssevssseverssserersererse 14 Creating Stable Cell Lines tssirini i esii 16 AppendiX sssi iirinn enana ennea ceases eaa aan Saaai edanan Recipes Blasticidin Map of pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST snnrvrrvrsvrsververren 22 Features of pcCDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST eo 23 Map of pcDNA 3 2 V5 GW CAT and pcDNA 6 2 V5 GW CAT 24 Technical Servicesusualkkunvataadneamduted ease erat Purchaser Notification Gateway Clone Distribution Policy mrsrrsvrrerrersvrvrsersersesersersersesersersers
25. itive Control pcDNA 3 2 V5 GW CAT or pcDNA 6 2 V5 GW CAT is provided as a positive control vector for mammalian cell transfection and expression see page 24 for a map and may be used to optimize recombinant protein expression levels in your cell line These vectors allow expression of a C terminally tagged chloramphenicol acetyl transferase CAT fusion protein that may be detected by Western blot or functional assay To propagate and maintain the plasmid 1 Prepare a 1 50 dilution of the positive control vector in sterile water i e 1 ul vector 49 ul water for a 10 ng ul stock solution Use 10 ng of the stock solution to transform a recA endA E coli strain like TOP10 DH5a JM109 or equivalent 2 Select transformants on LB agar plates containing 50 100 ug ml ampicillin 3 Prepare a glycerol stock of a transformant containing plasmid for long term storage 13 Expression and Analysis Introduction Expression of your gene of interest from the expression clone can be performed in either transiently transfected cells or stable cell lines see page 16 for guidelines to create stable cell lines You may use a functional assay or a Western blot analysis to detect your recombinant protein see below Preparing Cell To detect your fusion protein by Western blot you will need Lysates to prepare a cell lysate from transfected cells A sample protocol is provided below Other protocols are suitable To lyse cel
26. la resistance gene c 5192 6052 4822 5682 bla promoter c 6053 6151 5683 5781 c complementary strand Technical Service World Wide Visit the Invitrogen website at www invitrogen com for Web e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters European Headquarters Invitrogen Corporation Invitrogen Ltd 5791 Van Allen Way Inchinnan Business Park Carlsbad CA 92008 USA 3 Fountain Drive Tel 1 760 603 7200 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Tech Fax 44 0 141 814 6117 E mail E mail techsupport invitrogen com eurotech invitrogen com MSDS Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds continued on next page 25 Technical Service continued Certificate of Analysis Limited Warranty 26 The Certificate of Analysis CofA provides detailed quality control information for each product CofAs are available on our website at www invitrogen com support
27. llin resistant and chloramphenicol sensitive Transformants containing a plasmid with a mutated ccdB gene will be both ampicillin and chloramphenicol resistant To check your putative expression clone test for growth on LB plates containing 30 ug ml chloramphenicol A true expression clone will not grow in the presence of chloramphenicol To confirm that your gene of interest is in frame with the C terminal V5 epitope you may sequence your expression construct if desired We suggest using the following primer sequences Refer to the diagram on page 6 for the location of the primer binding sites For your convenience Invitrogen offers a custom primer synthesis service For more information refer to our Web site www invitrogen com or contact Technical Service page 25 Primer Sequence T7 Promoter 5 TAATACGACTCACTATAGGG 3 V5 Reverse 5 ACCGAGGAGAGGGTTAGGGAT 3 11 Transfection Introduction Plasmid Preparation Methods of Transfection 12 This section provides general information for transfecting your expression clone into the mammalian cell line of choice We recommend that you include a positive control vector pcDNA 3 2 V5 GW CAT or pcDNA 6 2 V5 GW CAT and a mock transfection negative control in your experiments to evaluate your results Once you have generated your expression clone you must isolate plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic
28. ls 1 Wash cell monolayer 5 x 10 to 1 x 10 cells once with phosphate buffered saline PBS Invitrogen Catalog no 10010 023 2 Scrape cells into 1 ml PBS and pellet the cells at 1500 x g for 5 minutes 3 Resuspend in 50 ul Cell Lysis Buffer see page 20 for a recipe Other cell lysis buffers are suitable Vortex 4 Incubate cell suspension at 37 C for 10 minutes to lyse the cells Note You may prefer to lyse the cells at room temperature or on ice if degradation of your protein is a potential problem 5 Centrifuge the cell lysate at 10 000 x g for 10 minutes at 4 C to pellet nuclei and transfer the supernatant to a fresh tube Assay the lysate for protein concentration Note Do not use protein assays utilizing Coomassie Blue or other dyes NP 40 interferes with the binding of the dye with the protein 6 Add SDS PAGE sample buffer see page 20 for a recipe to a final concentration of 1X and boil the sample for 5 minutes 7 Load 20 ug of lysate onto an SDS PAGE gel and electrophorese Use the appropriate percentage of acrylamide to resolve your fusion protein continued on next page 14 Expression and Analysis continued Polyacrylamide Gel Electrophoresis Detecting Recombinant Fusion Proteins To facilitate separation and visualization of your recombinant fusion protein by polyacrylamide gel electrophoresis a wide range of pre cast NuPAGE and Novex Tris Glycine polyacrylamide gels and
29. n in complete medium 3 Cells differ in their susceptibility to Blasticidin Complete selection can take up to 10 days of growth in selective medium Refer to page 21 for instructions on how to prepare and store Blasticidin 18 Recipes LB Luria Bertani Medium and Plates Low Salt LB Medium with Blasticidin Appendix Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 4 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter Autoclave on liquid cycle for 20 minutes at 15 psi Allow solution to cool to 55 C and add antibiotic if needed Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving Autoclave on liquid cycle for 20 minutes at 15 psi After autoclaving cool to 55 C add antibiotic if needed and pour into 10 cm plates Let harden then invert and store at 4 C Low Salt LB Medium 10 g Tryptone 5g NaCl 5g Yeast Extract 1 Combine the dry reagents above and add deionized distilled water to 950 ml Adjust pH to 7 0 with 1 N NaOH Bring the volume up to 1 liter For plates add 15 g L agar before autoclaving 2 Autoclave on liquid cycle at 15 psi and 121 C for 20 minutes 3 Allow the medium to cool to at least 55 C before adding the Blasticidin to 100
30. nation reaction using LR Clonase enzyme mix if desired To use LR Clonase enzyme mix follow the protocol provided with the product Do not use the protocol for LR Clonase II enzyme mix as reaction conditions differ You should have the following materials on hand before beginning e Purified plasmid DNA of your entry clone 50 150 ng ul in TE pH 8 0 e pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST 150 ng ul in TE pH 8 0 e LRClonase II enzyme mix Invitrogen Catalog no 11791 020 keep at 20 C until immediately before use e TE Buffer pH 8 0 10 mM Tris HCI pH 8 0 I mM EDTA e 2ug pl Proteinase K solution supplied with LR Clonase II enzyme mix thaw and keep on ice until use e pENTR gus supplied with LR Clonase II enzyme mix use as a control for the LR reaction 50 ng ul e Appropriate competent E coli host and growth media for expression e S O C Medium e LB agar plates containing 100 ug ml ampicillin or Low Salt LB plates containing 100 ug ml Blasticidin continued on next page Performing the LR Recombination Reaction continued Setting Up the LR Reaction Follow this procedure to perform the LR reaction between your entry clone and a destination vector To include a negative control set up a second sample reaction but omit TM the LR Clonase II enzyme mix Add the following components to 1 5 ml microcentrifuge tubes at room temperature and mix Component
31. nd of CMV promoter transcriptional start n y T 771 CAAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CTGGCTAACT T7 promoter priming site 831 AGAGAACCCA CTGCTTACTG GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA r I 1 891 GCTGGCTAGT TAAGCTATCA ACAAGTTIGT ACAAAAAAGC AGG CTN 3161 3153 CCA GCT TTC GGT CGA AAG Pro Ala Phe V5 epitope ne attB 1 TGTTCAAACA TOTT TCC GAN attB 2 TTG AAC Leu 1 TAC AAA GTG GTT GAT CTA GAG GGC CCG CGG TTC GAA ATG TTT CAC CAA CTA GAT CTC CCG GGC GCC AAG CTT Tyr Lys Val Val Asp Leu Glu Gly Pro Arg Phe Glu V5 reverse priming site 3201 GGT AAG CCT Gly Lys Pro 3249 GGT TAG TAA Gly xxx ATC Tle TGA KK CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT ACC Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr GTTTAAACGG GGGAGGCTAA CTGAAACACG GAAGGAGACA Performing the LR Recombination Reaction Introduction Once you have obtained an entry clone containing your gene of interest you may perform an LR recombination reaction between the entry clone and pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST and transform the reaction mixture into a suitable E coli host see below to select for an expression clone We recommend including a negative control no LR Clonase II in your experiment to help you evaluate your results E coli Host You may use any recA endA E coli strain including TOP10 DH5a or equivalent for transformation see page vi for orderin
32. oduct or its components are resold for use in research continued on next page 27 Purchaser Notification continued Limited Use Label License No 19 Gateway Cloning Products continued Gateway Clone Distribution Policy Limited Use Label License No 51 Blastici din amp the Blasti cidin Selection Marker 28 Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents ased upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product de veloped in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the use of this product to manufacture a protein for sale provided that no method claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information on purchasing a license to For additional information about Invitrogen s policy for the use and distribution of Gateway clones see the section entitled Gateway Clone Distrib
33. rogen Storing Stock Catalog no R210 01 in 50 mg aliquots Blasticidin is Solutions soluble in water Sterile water is generally used to prepare stock solutions of 5 to 10 mg ml e Dissolve Blasticidin in sterile water and filter sterilize the solution e Aliquot in small volumes suitable for one time use see next to last point below and freeze at 20 C for long term storage or store at 4 C for short term storage e Aqueous stock solutions are stable for 1 2 weeks at 4 C and 6 8 weeks at 20 C e pH of the aqueous solution should be 7 0 to prevent inactivation of Blasticidin e Do not subject stock solutions to freeze thaw cycles do not store in a frost free freezer e Upon thawing use what you need and store the thawed stock solution at 4 C for up to 2 weeks e Medium containing Blasticidin may be stored at 4 C for up to 2 weeks 21 Map of pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST Map The map below shows the elements of pcDNA 3 2 V5 DEST and pcDNA 6 2 V5 DEST DNA from the entry clone replaces the region between bases 918 and 3161 The complete sequences of these vectors are available for downloading from our Web site www invitrogen com or by contacting Technical Service page 25 gt Es cmt Comments for CMV promoter T7 promoter priming site attR1 site ccaB gene c Chloramphenicol resistance gene c attR2 site V5 epitope V5 reverse priming site TK polyadenyl
34. rvival 2 T1 Phage Resistant E coli strain is resistant to CcdB effects and can support the propagation of plasmids containing the ccdB gene To maintain the integrity of the vector select for transformants in media containing 50 100 ug ml ampicillin and 15 30 ug ml chloramphenicol Note Do not use general E coli cloning strains including TOP10 or DH5a for propagation and maintenance as these strains are sensitive to CcdB effects continued on next page Creating an Expression Clone continued Recombination The recombination region of the expression clone resulting Region 714 831 891 3153 3201 3249 CAAT from pcDNA 3 2 V5 DEST x entry clone or pcDNA 6 2 V5 DEST x entry clone is shown below Features of the Recombination Region Shaded regions correspond to DNA sequences transferred from the entry clone into ppDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST by recombination Non shaded regions are derived from the pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST vector The underlined nucleotides flanking the shaded region correspond to bases 918 and 3161 of the pcDNA 3 2 V5 DEST or pcDNA 6 2 V5 DEST vector sequence y Putative TATA 3 end of CMV promoter transcriptional Siart y f CAAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CTGGCTAACT T7 promoter priming site AGAGAACCCA CTGCTTACTG GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA 918 attB 1 GCTGGCTAGT TAAGCTATCA ACAAGTTIGT A
35. s and Wiley Interscience Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Capone J P Sharp P A and RajBhandary U L 1985 Amber Ochre and Opal Suppressor tRNA Genes Derived from a Human Serine tRNA Gene EMBO J 4 213 221 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Cole C N and Stacy T P 1985 Identification of Sequences in the Herpes Simplex Virus Thymidine Kinase Gene Required for Efficient Processing and Polyadenylation Mol Cell Biol 5 2104 2113 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L a and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exp Cell Res 197 229 233 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin S Deaminase Gene from Aspergillus terreus BSD A New Drug Resistan
36. scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 29 References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associate
37. terials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party who has a license from Life Technologies under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Com mercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such pr
38. ution Policy page 29 Blasticidin and the blasticidin resistance gene bsd are the subject of U S Patent No 5 527 701 sold under patent license for research purposes only For information on purchasing a license to this product for purposes other than research contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for
Download Pdf Manuals
Related Search