RNAi Duplex
Contents
1. lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 48 LENGTH 15 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEQUENCE 48 cegctgctgg accac lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 400 gt SEQ ID NO 49 LENGTH 150 TYPE DNA ORGANISM Homo sapiens SEQUENCE 49 tgtccaataa ctacattgtg gggaataagc ccccaaagga atgtggggac ctgtgtccag ggaccatgga ggagaagccg atgtgtgaga agaccaccat caacaatgag tacaactacc gctgctggac cacaaaccgc tgccagaaaa 210 211 212 213 220 223 lt 400 gt SEO ID NO 50 LENGTH 18 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEOUENCE 50 tacattgtgg ggaataag lt 210 gt lt 211 gt lt 212 gt SEQ ID NO 51 LENGTH 18 TYPE DNA Sep 13 2007 15 15 15 15 60 120 150 18 US 2007 0213284 A1 lt 213 gt ORGANISM Artificial lt 220 gt FEATURE lt 223 gt OTHER INFORMATION Antisense Oligonucleotide lt 400 gt SEQUENCE 51 gaccatggag gagaagcc 210 SEQ ID NO 52 211 LENGTH 18 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 52 ccgatgtgtg agaagacc 210 SEQ ID NO 53 211 LENGTH 18 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 2232. 14 ASO5 GTGGTCCAGCAGCGGTAGTT SEQ ID NO 15 Scr5 GACGTTAGCGTGCGATGTGC SEQ ID NO 16 ASO6 CTTATTCCCCACAATGTA SEO ID NO 17 Sep 13 2007 TABLE 3 continued Antisense oligonucleotides Mouse ASO6 CTTGTTCCCCACAATGTA SEO ID NO 18 Scr6 CATAGCACATTCTTCTCA SEO ID NO 19 Mouse Scr6 ACCGTTCATCAGTTCACT SEO ID NO 20 TSS TCCTCCGGAGCCAGACTT SEO ID NO 21 ScrTSS CAGCTACTCGCATGCTGC SEQ ID NO 22 EXAMPLE 3 TESTING OF RNAI DUPLEXES Cell Culture and Transfection 0080 The human and murine cell lines used in this study were cultured in RPMI 1640 plus 10 FCS at 37 C ina humidified atmosphere of 596 CO The cultures were nega tive when tested for Mycoplasma infection Cultures were passaged the day before transfection to achieve 30 5096 confluence the following day Initial transfections of ASOs used 1 2 5 ug ml Cytofectin Glen Research Sterling Va according to the manufacturer s instructions Latterly Oli gofectamine Life Sciences has been used for all ASO and RNAi transfections The method was as described see manufacturer s instructions and www dharmacon com with minor modifications For transfection of monolayers seeded in 6 well plates 5 ul phosphorothioate oligonucleotide or RNA duplex at 100x final concentration were mixed with 250 ul serum free Optimem Gibco BRL In a separate tube 2 ul Oligofectamine was mixed with 68 ul Optimem After 10 min incubation at room temperature the contents of the two tubes were mixed a
3. Antisense Oligonucleotide 400 SEQUENCE 7 tggtcttctc acacatcggc 210 SEQ ID NO 8 211 LENGTH 20 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 8 tggtcttctc acacatgggc 210 SEQ ID NO 9 211 LENGTH 20 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 9 cctgtacgcg ttgatctcca s2105 SEQ ID NO 10 211 LENGTH 20 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide lt 400 gt SEQUENCE 10 Sep 13 2007 20 20 18 20 20 20 US 2007 0213284 A1 13 continued agtcgcctag tcgagtcctt s2105 211 212 s2135 220 223 lt 400 gt SEO ID NO 11 LENGTH 20 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEOUENCE 11 attgttgatg gtggtcttct lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 12 LENGTH 20 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEQUENCE 12 tcatgcttgt tgatgtggtt lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 13 LENGTH 20 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMAT
4. ataactacat tgtggggaat aagcccccaa aggaatgtgg ggacctgtgt ccagggacca 600 tggaggagaa gccgatgtgt gagaagacca ccatcaacaa tgagtacaac taccgctgct 660 ggaccacaaa ccgctgccag aaaatgtgcc caagcacgtg tgggaagcgg gcgtgcaccg 720 agaacaatga gtgctgccac cccgagtgcc tgggcagctg cagcgcgcct gacaacgaca 780 cggcctgtgt agcttgccgc cactactact atgccggtgt ctgtgtgcct gcctgcccgc 840 ccaacaccta caggtttgag ggctggcgct gtgtggaccg tgacttctgc gccaacatcc 900 tcagcgccga gagcagcgac tccgaggggt ttgtgatcca cgacggcgag tgcatgcagg 960 agtgcccctc gggcttcatc cgcaacggca gccagagcat 1000 1 A method of preparing an siRNA reagent for use in gene silencing of a target gene by RNA interference which method comprises a preparing a scanning array of antisense oligonucle otides spanning a region of a transcript of the target gene b hybridising to the array labelled transcripts of the target gene c identifying an oligonucleotide within the array which hybridizes with the labelled transcripts and d preparing an siRNA reagent comprising a double stranded RNA of identical sequence to the oligonucle otide identified in step c 2 A method of preparing a pharmaceutical composition comprising an siRNA reagent capable of mediating gene silencing of a target gene by RNA interference which method comprises preparing an siRNA reagent capable of mediating gene silencing of a target gene by RNA interference accord ing to the method of claim 1 and formulating the siRNA reagent into a ph
5. t thymine 220 FEATURE 223 OTHER INFORMATION this is a combined DNA RNA sequence 400 SEQUENCE 30 cuacauugug gggaauaagn n 210 SEQ ID NO 31 211 LENGTH 21 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION siRNA reagent 220 FEATURE 221 NAME KEY misc feature 222 LOCATION 20 21 223 OTHER INFORMATION wherein n is t thymine 220 FEATURE 223 OTHER INFORMATION this is a combined DNA RNA sequence 21 21 21 21 Sep 13 2007 US 2007 0213284 A1 lt 400 gt 17 continued SEQUENCE 31 gaauaagggg uguuacaucn n lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 220 gt lt 221 gt lt 222 gt lt 223 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 32 LENGTH 21 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION siRNA reagent FEATURE NAME KEY misc_feature LOCATION 20 21 OTHER INFORMATION wherein n is t thymine FEATURE OTHER INFORMATION this is a combined DNA RNA sequence SEQUENCE 32 cuacauugug gggaacaagn n lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 220 gt lt 221 gt lt 222 gt lt 223 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 33 LENGTH 21 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION siRNA reagent FEATURE NAME KEY misc
6. C is particularly preferred since oligonucleotides which hybri dise at this temperature are more likely to be effective in vivo The compositions of standard hybridisation buffers which are preferred for use with the arrays are given in the accompanying examples 0021 Oligonucleotides which hybridise to the array are identified and double stranded RNA reagents also referred to herein as RNAi reagents or siRNAs having identical sequence are synthesised The inventors have demonstrated by experiment that hybridisation to the scanning array is directly predictive of effectiveness in RNA interference In this context identical sequence is not intended to be interpreted literally as requiring 100 sequence identity The sequence of the dsRNA may differ slightly from the antisense oligonucleotide ASO sequence For example the length of the dsRNA may be longer or shorter by several nt to optimise performance of the dsRNA The RNA duplex will preferably be less than 30 bp in length since duplexes of greater than 30 bp may induce non specific interferon mediated effects when introduced into cells in vivo RNA duplexes of 20 27 bp and typically 20 24 bp in length are particularly suitable as RNAi reagents If the dsRNA is made longer than the ASO then the extra sequence may corre spond to the native sequence of the mRNA The dsRNA may contain one or more substitute bases in order to optimise performance in RNAi Substitution of eve
7. England Making Scanning Arrays 1 Solid support derivatised glass or aminated polypropy lene Beckman Coulter Inc USA 2 DNA synthesiser ABI 3 A reaction mask of desired shape and size and assembly frame see Sohail and Southern FIG 4 for the assembly 4 DNA synthesis reagents standard dA dG dC and T phosphoramidites oxidizing agent acetonitrile activator solution deblock solution all from Cruachem 5 Reverse phosphoramidites bought from Glen Research Deprotection of Arrays 0050 1 Assembly for constructing deprotection bomb as shown in Sohail and Southern FIG 5 The assembly consists ofa high density polyethylene HDPE chamber 4 mm thick silicon rubber gasket and a stainless steel plate of the dimensions of the HDPE chamber and stainless steel M8 nuts and bolts 2 3096 ammonia solution AnalaR Merck 3 Water bath at 55 C In Vitro Transcription 1 Template DNA at 1 mg mL 2 T7 or SP6 RNA polymerase transcription buffer 5x transcription buffer is 200 mM Tris HCl pH 7 9 30 mM MgCl 10 mM spermidine 50 mM NaCl recombinant RNAsin 100 mM DTT and nuclease free distilled water Promega 3 a P UTP 3000 Ci mmol or a P UTP 2500 Ci mmol Amersham 4 rNTPs Pharmacia ATP GTP CTP stored as 10 mM solution and UTP as 250 mM solution in nuclease free distilled water Store all reagents at 20 C Quantitation of Transcripts 1 Scintillation counter e g Be
8. In each case the sequence given corresponds to the sense strand of the IGFIR mRNA 0077 Relative hybridisation intensities for selected oli gonucleotides were calculated relative to the most strongly hybridising sequence TABLE 1 Relative hybridisation intensity Hyb Rel hyb Oligo Sequence intensity intensity ASO2 ggtcttctcacacatcgg 56 026 1 00 ASO4 gcggtagttgtactcattgt 233 162 20 59 ASO1 ggcttctcctccatggtc 15583 0 28 ASO3 attgttgatggtggtcttct gt 7048 gt 0 13 ASO5 gtggtccagcagcggtagtt 24150 50 07 ASO6 cttattccccacaatgta 560 0 01 EXAMPLE 2 SYNTHESIS OF RNAI DUPLEXES 0078 Double stranded RNA duplexes for RNAi corre sponding in sequence to certain of the ASOs identified on the basis of the array screening as hybridising strongly or weakly with IGFIR mRNA were synthesised together with corresponding inverted controls mouse homologs and mutant variants see Table 2 RNA oligonucleotides were synthesised and HPLC purified at Cruachem Glasgow Lyophilised oligoribonucleotides were reconstituted in nuclease free water and diluted to 50 uM Complementary strands were annealed in 100 mM potassium acetate 30 mM Hepes KOH pH 7 4 2 mM magnesium acetate as described Elbashir et al Nature 2001 www dharmacon com to give a final concentration of 20 uM duplex Duplex formation was checked by electrophoresis through 5 low melting point agarose NuSieve GTG BioWhittaker Molecular Applications in 1xTBE US 2007 0213284 A1
9. Stripping of Arrays 1 The arrays can be used several times To strip heat an appropriate volume of the stripping solution to 90 C in a glass beaker 2 Immerse the array in the hot stripping solution and stir for 1 2 min 3 Remove the array and monitor with a Geiger counter to confirm that most of the radiolabel has been removed Repeat steps 1 2 if radioactivity on the surface of the array is still detectable 4 Allow the array to cool down to room temperature and wash it thoroughly with nuclease free distilled water 70 v v ethanol and finally with absolute ethanol 5 Air dry and store the array at 20 C until future use Notes 0060 1 The choice of array substrate material and attachment chemistry is important for making high quality arrays A flat impermeable surface is required for in situ synthesis of arrays Glass has a number of favourable qualities including its wide availability smooth surface transparency chemical stability and compatibility with the use of both radiolabelled or fluorescence labelled nucleic acids targets Glass is chemically derivatised as described in the methods section to produce a hexaethylene glycol linker which has a terminal OH group that allows condensation of nucleotide phosphoramidites Maskos U and Southern E M 1992 Nucleic Acids Res 20 1679 1684 Similarly polypropylene also has favourable physical and chemical properties Polypropylene is aminated to produce
10. TABLE 2 RNAi duplex seguences R2 GCCGAUGUGUGAGAAGACCTT SEO ID NO 23 TTCGGCUACACACUCUUCUGG R2 GCCGAUGUGUGACAAGTT SEO ID NO 24 18mer TTCGGCUACACACUCUUC R2 GCCGAUGUGUGAGAAGACCACCTT SEO ID NO 25 24mer TTCGGCUACACACUCUUCUGGUGG R2 GCCGAUGUGUGAGAAGACCACCAUCTT SEQ ID NO 26 27mer TTCGGCUACACACUCUUCUGGUGGUAG Inv2 CCAGAAGAGUGUGUAGCCGTT SEQ ID NO 27 TTGGUCUUCUCACACAUCGGC Mut2 GCCGAUGUGUGUGAAGACCTT SEQ ID NO 28 TTCGGCUACACACACUUCUGG MouseR2 GCCCAUGUGUGAGAAGACCTT SEQ ID NO 29 TTCGGGUACACACUCUUCUGG R6 CUACAUUGUGGGGAAUAAGTT SEQ ID NO 30 TTGAUGUAACACCCCUUAUUC Inv6 GAAUAAGGGGUGUUACAUCTT SEQ ID NO 31 TTCUUAUUCCCCACAAUGUAG MouseR6 CUACAUUGUGGGGAACAAGTT SEQ ID NO 32 TTGAUGUAACACCCCUUGUUC 0079 For comparison purposes the following antisense oligonucleotides were also synthesised TABLE 3 Antisense oligonucleotides AS01 18mer GGCTTCTCCTCCATGGTC SEQ ID NO 1 ASO1 20mer CGGCTTCTCCTCCATGGTCC SEQ ID NO 2 Mouse ASO1 GGGCTTCTCCTCCAATGTCC SEQ ID NO 3 Scrl TCTTCCGCGACTTGCTCCGC SEQ ID NO 4 Mouse Scrl CTGTTCACCGTGCACCCTGT SEQ ID NO 5 ASO2 18mer GGTCTTCTCACACATCGG SEQ ID NO 6 ASO2 20mer TGGTCTTCTCACACATCGGC SEQ ID NO 7 Mouse ASO2 TGGTCTTCTCACACATGGGC SEQ ID NO 8 Scr2 CCTGTACGCGTTGATCTCCA SEQ ID NO 9 Mouse Scr2 AGTCGCCTAGTCGAGTCCTT SEQ ID NO 10 ASO3 ATTGTTGATGGTGGTCTTCT SEQ ID NO 11 Scr3 TCATGCTTGTTGATGTGGTT SEQ ID NO 12 ASO4 GCGGTAGTTGTACTCATTGT SEQ ID NO 13 Scr4 TGTCGTTCGAGTTGATCGTA SEQ ID NO
11. Totowa N J Sohail M et al Nucleic Acids Res 2001 29 10 2041 2051 0006 The present inventors have now shown that the sequences selected for use in single stranded antisense oli gonucleotides on basis of array screening can also be used as the basis of siRNA reagents that are effective in gene silencing by RNAi DESCRIPTION OF THE INVENTION 0007 In accordance with a first aspect of the invention there is provided a method of preparing an siRNA reagent for use in gene silencing of a target gene by RNA interfer ence which method comprises 0008 a preparing a scanning array of antisense oligo nucleotides spanning a region of a transcript of the target gene 0009 b hybridising to the array labelled transcripts of the target gene Sep 13 2007 0010 c identifying an oligonucleotide within the array which hybridizes with the labelled transcripts and 0011 d preparing an siRNA reagent comprising a double stranded RNA of identical sequence to the oligo nucleotide identified in step c 0012 As aforesaid it is known to use scanning arrays of antisense oligonucleotides in order to identify regions of a particular transcript to target for inhibition of gene expres sion using antisense oligonucleotides However it was sur prising to observe that sequences identified using the scan ning array as being useful as antisense oligonucleotides may also mediate gene silencing by RNA interference because
12. allow com binatorial synthesis of a large number of oligonucleotides on a solid platform typically glass or polypropylene see note 1 in accompanying examples in a spatially addressable fashion and parallel measurement of the binding of all oligonucleotides complementary to the target mRNA 0016 The scanning arrays comprise sets of oligonucle otides of various lengths A series of oligonucleotides complementary to the target mRNA is made by sequential coupling of nucleotides to a solid surface The DNA syn thesis reagents are applied to a confined area on the surface of the solid support using a mask see below The mask is shifted along the surface after each round of coupling resulting in a series of oligonucleotides each complementary to a region of the target sequence 0017 The gene of interest may be essentially any gene for which it is desired to develop an siRNA RNAi reagent The method of the invention is of general utility thus the precise nature of this gene and the mRNAs transcribed therefrom is not material to the invention The target region may be a sub fragment of the gene of interest which it is desired to test in order to identify region s which may potentially be useful targets for gene silencing by RNA US 2007 0213284 A1 interference The target region may be an arbitrarily chosen sub fragment of the gene of interest or may have been selected on the basis of an assay for potentially suitability as
13. amine groups Matson R S Rampal J B and Coassin P J Sep 13 2007 1994 Anal Biochem 217 306 310 that also allow syn thesis to oligonucleotides using standard CE nucleotide phosphoramidites 0061 For the array fabrication method described here it is important that a tight seal is formed between the substrate material and the reaction mask Metals form tight seal with polypropylene but not with glass PTFE seals well against both glass and polypropylene 2 1M NaCl is used routinely Alternative buffers are i 1 M NaCl 5 10 mM MgCl 10 mM Tris HCl pH 7 4 1 mM EDTA 0 01 SDS w v and ii 150 mM NaCl 10 mM MgCl 10 mM Tris HCl pH 7 4 1 mM EDTA 0 01 SDS w v 3 Addition of more than 0 01 SDS can damage arrays 0062 4 Circular masks can also be made from PTFE Teflon Diamond shaped masks are more difficult to make with PTFE by the machining process but can be made by pressure moulding in a hydraulic press 150 ton force using a pre machined die 0063 5 Holes should be made as close as reasonably possible to the sealing edge without damaging it Care must be taken to de burr fully the holes at the point of entry into the reaction chamber For PTFE masks the holes should be 1 0 mm diameter which make virtually 100 leak tight seal In the case of metal masks the 0 02 mm interface indicated above also provides a leak tight seal without the use of any additional sealer Care must be taken not t
14. h 2 Remove the plates allow them to cool to room tempera ture and wash with ethanol and then with ether by squirting the liquid from a wash bottle 3 Incubate the plates in hexaethylene glycol containing a catalytic amount of sulfuric acid 25 mL L at 80 C for 10 h with stirring 4 Remove the plates allow them to cool to room tempera ture and wash with ethanol and ether Air dry and store at 20 C Machining of Masks 1 Both stainless steel or aluminium can be used to make diamond shaped and circular reaction masks Circular masks are made using a centre lathe and diamond shaped masks using a horizontal milling machine see Note 4 2 To make a diamond shaped mask from metal hold the Work piece at an angle of 45 to the axis of the bed of the milling machine the diagonal of the diamond running parallel to the axis of the bed 3 Machine the cavity to the required depth generally between 0 5 0 75 mm to create a reaction chamber Machine the outer lands to a depth of approximately 0 5 mm to form the sealing edge 0 3 0 5 mm wide Sohail and Southern FIG 4 4 Using the smallest possible diameter cutter 1 5 mm radius the internal corners of the reaction chamber Sep 13 2007 5 Finish the sealing edge by polishing flat with successively finer grades of wetted abrasive paper from P600 to P1200 and finally with a polishing grade crocus paper 0053 6 Drill holes of 1 08 mm diameter for reag
15. the mechanisms of action of antisense oligonucleotides and RNA interference are very different see review by Brantl S Antisense RNA regulation and RNA interference Biochem Biophys Acta Vol 1575 1 3 15 25 2002 0013 The term siRNA reagent refers to a nucleic acid molecule that is capable of down regulating expression of a target gene by RNA interference The characteristics of siRNA reagents are generally known in the art siRNA reagents generally comprise a region of double stranded RNA although as discussed below one or more bases in the double stranded RNA may be replaced with DNA bases The double stranded RNA may be flanked by short single stranded overhangs as described below 0014 Scanning oligonucleotide arrays comprising oligo nucleotides complementary to a target region of a mRNA transcript of the gene of interest may be synthesised using the methods which are known in the art and described for example by Southern E M et al Nucleic Acids Res 1994 22 8 1368 1373 and Sohail M and Southern E M Using oligonucleotide scanning arrays to find effective antisense reagents Methods in Molecular Biology vol 170 DNA Arrays Methods and Protocols Ed J B Rampal Humana Press Inc Totowa N J the contents of which documents are incorporated herein by reference A detailed protocol for synthesis of scanning arrays is also given in the accompanying examples 0015 Scanning arrays are a simple tool that
16. 1 NAME KEY misc feature 222 LOCATION 20 21 US 2007 0213284 A1 16 continued lt 223 gt OTHER INFORMATION wherein n represents t thymine lt 220 gt FEATURE lt 223 gt OTHER INFORMATION this is a combined DNA RNA sequence lt 400 gt SEQUENCE 27 ccagaagagu guguagccgn n s2105 SEQ ID NO 28 211 LENGTH 21 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION wherein n represents t thymine 220 FEATURE 223 OTHER INFORMATION this is a combined DNA RNA sequence 220 FEATURE 221 NAME KEY misc feature 222 LOCATION 20 21 223 OTHER INFORMATION wherein n represents t thymine 400 SEQUENCE 28 gccgaugugu gugaagaccn n 210 SEQ ID NO 29 211 LENGTH 21 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION siRNA reagent 220 FEATURE 221 NAME KEY misc feature 222 LOCATION 20 21 223 OTHER INFORMATION wherein n represents t thymine 220 FEATURE 223 OTHER INFORMATION this is a combined DNA RNA sequence 400 SEQUENCE 29 gcccaugugu gagaagaccn n 210 SEQ ID NO 30 211 LENGTH 21 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION siRNA reagent 220 FEATURE 221 NAME KEY misc feature 222 LOCATION 20 21 223 OTHER INFORMATION wherein n is
17. 10445 B16 Murine melanoma 4524 72 x14 0090 In some cell lines eg human ME melanoma and A549 NSCLC 10 nM R6 was essentially inactive In all cases R2 caused more profound IGF1R downregulation than R6 This suggests that the structural features dictating access are robust and conserved between different cell lines and species v Effect of RNAi Duplexes of Varying Length 0091 Compared with the effects of R2 IGFIR down regulation is less profound after treatment with an 18mer duplex sequence as R2 but lacking the 3 RNA bases at the 3 end In contrast to the results of Elbashir et al 2001 a 24mer R2 duplex was observed to be as effective as R2 at 100 nM Results are illustrated in FIG 5 Panel a is an US 2007 0213284 A1 immunoblot showing the effect of various RNAis on IGFIR expression at 0 5 and 5 nM panel b is a graphical illustration showing the effect of RNAis of varying length results are presented as IGFIR level of that in cells transfected with the same concentration of an Inv2 control RNAi A 27mer R2 duplex was also observed to be as effective as the R220mer and 24mer duplexes data not shown EXAMPLE 4 DIFFERENTIAL EFFECTS OF RNAI DUPLEXES ON IGF SIGNALING 0092 ME cells were transfected with 100 nM RNA duplexes After 48 hr the monolayers were disaggregated and half of each culture was treated with 10 nM IGF 1 for 30 min The cells were lysed and lysates were analysed by immunoblotting for IGF1R p
18. 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 19 catagcacat tcttctca 18 210 SEQ ID NO 20 211 LENGTH 18 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 20 accgttcatc agttcact 18 210 SEQ ID NO 21 211 LENGTH 18 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 21 tcctccggag ccagactt 18 210 SEQ ID NO 22 211 LENGTH 18 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 22 cagctactcg catgctgc 18 210 SEQ ID NO 23 211 LENGTH 21 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE US 2007 0213284 A1 Sep 13 2007 15 continued lt 223 gt OTHER INFORMATION siRNA reagent lt 220 gt FEATURE lt 221 gt NAME KEY misc_feature lt 222 gt LOCATION 20 21 lt 223 gt OTHER INFORMATION wherein n represents t thymine lt 220 gt FEATURE lt 223 gt OTHER INFORMATION this is a combined DNA RNA sequence lt 400 gt SEQUENCE 23 gccgaugugu gagaagaccn n 21 lt 210 gt SEQ ID NO 24 lt 211 gt LENGTH 18 lt 212 gt TYPE DNA lt 213 gt ORGANISM Artificial lt 220 gt FEATURE lt 223 gt OTHE
19. A SCANNING ARRAY 0047 In the following protocol references to Figures and Tables from Sohail and Southern refer to Sohail M and Southern E M Using oligonucleotide scanning arrays to find effective antisense reagents Methods in Molecular Biology vol 170 DNA Arrays Methods and Protocols Ed J B Rampal Humana Press Inc Totowa N J 0048 Using a diamond shaped or a circular reaction mask Sohail and Southern FIG 1 it is possible to create arrays comprising sets of oligonucleotides of all lengths from monomers up to a maximum in a single series of couplings The maximum length of oligonucleotides syn thesised depends upon the ratio of the diagonal for a diamond shaped mask or diameter for a circular mask of the mask to the displacement at each coupling step For example a diamond shaped mask of 40 mm diagonal will produce 10 mers 16 mers or 20 mers using step sizes of 4 mm 2 5 mm or 2 mm respectively A diamond shaped template creates a series of small diamond shaped cells The longest oligonucleotides are found along the centre line and the monomers are located at the edge Sohail and Southern FIG 1 A circular template creates cells that differ in shape along the centre line they are lenticular but off this line they form a four cornered spearhead that diminishes in size towards the edge The arrays as synthesised are sym metrical above and below the centre line of the template and each ol
20. FORMATION this is a combined DNA RNA seguence SEOUENCE 39 ggucuucuca cacaugggen n lt 210 gt lt 211 gt 212 SEQ ID NO 40 LENGTH 21 TYPE DNA 27 21 21 21 Sep 13 2007 US 2007 0213284 A1 lt 213 gt lt 220 gt lt 223 gt lt 220 gt lt 221 gt lt 222 gt lt 223 gt lt 220 gt lt 223 gt lt 400 gt 19 continued ORGANISM Artificial FEATURE OTHER INFORMATION siRNA reagent FEATURE NAME KEY misc_feature LOCATION 20 21 OTHER INFORMATION wherein n is t thymine FEATURE OTHER INFORMATION this is a combined DNA RNA sequence SEQUENCE 40 cuuauuccce acaauguagn n lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 220 gt lt 221 gt lt 222 gt lt 223 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 41 LENGTH 21 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION siRNA reagent FEATURE NAME KEY misc_feature LOCATION 20 21 OTHER INFORMATION wherein n is t thymine FEATURE OTHER INFORMATION this is a combined DNA RNA sequence SEQUENCE 41 gauguaacac cccuuauucn n lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 220 gt lt 221 gt lt 222 gt lt 223 gt lt 220 gt lt 223 gt lt 400 gt SEO ID NO 42 LENGTH 21 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION siRNA reagent FEATURE NAME KEY mi
21. G 5 illustrates the activity of RNAi duplexes of 18 21 or 24 nt in MDA 231 breast cancer cells Panel a is an immunoblot showing the effect of various RNAis on IGF1R expression at 0 5 and 5 nM panel b is a graphical illustration showing the effect of RNAis of varying length results are presented as Yo IGFIR level of that in cells transfected with the same concentration of an Inv2 control RNAi 0044 FIG 6 illustrates the effect of RNAi duplexes on Akt phosphorylation in ME melanoma cells ME cells were transfected with 100 nM RNA duplexes After 48 hr the monolayers were disaggregated and half of each culture was treated with 10 nM IGF 1 for 30 min The cells were lysed and lysates were analysed by immunoblotting for IGF1R phospho Ser473 Akt and total Akt 0045 FIG 7 illustrates growth in vivo in C57BL mice of B16 melanoma cells transfected with RNA duplexes B16 melanoma cells were transfected with 200 nM duplexes RNA22 R2 22Inv Inv2 or oligofectamine alone OF for three consecutive days On the 4th day cells were injected into the flanks of C57BL mice using 2 5x10 cells mouse using groups of 5 mice Tumours were measured in 2 US 2007 0213284 A1 dimensions every 2 3 days Tumour volumes were calcu lated as n axb 6 where a is the larger and b the smaller dimension 0046 FIG 8 shows the complete cDNA sequence for human IGFIR The region evaluated using the scanning array is underlined EXAMPLE 1 SYNTHESIS OF
22. GGCCTCGAGAGCCTCGGAGACCTCTTCCCCAA 351 CCTCACGGTCATCCGCGGCTGGAAACTCTTCTACAACTACGCCCTGGTCA 401 TCTTCGAGATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGACA 451 TTACTCGGGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTC 501 TCCACTGT GACTGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACAT 551 IGTGGGGAATAAGCCCCCAAAGGAATGTGGGGACCTGTGTCCAGGGACCA 601 TGGAGGAGAAGCCGATGTGTGAGAAGACCACCATCAACAATGAGTACAAC 651 TACCGCTGCTGGAC cc TGTGCCCAAGCACGTG 701 TGGGAAGCGGGCGTGCACCGAGAACAATGAGTGCTGCCACCCCGAGTGCC 751 TGGGCAGCTGCAGCGCGCCTGACAACGACACGGCCTGTGTAGCTTIGCCGC 801 CACTACTACTATGCCGGTGTCTGTGTGCCTGCCTGCCCGCCCAACACCTA 851 CAGGTTTGAGGGCTGGCGCTGTGTGGACCGTGACTTCTGCGCCAACATCC 901 TCAGCGCCGAGAGCAGCGACTCCGAGGGGTTTGTGATCCACGACGGCGAG 951 TGCATGCAGGAGTGCCCCTCGGGCTTCATCCGCAACGGCAGCCAGAGCAT Underlined are translation start site and region screened by array Latter covers 150nt representing bases 536 685 of human IGF1R sequence US 2007 0213284 A1 METHOD OF SELECTING TARGETS FOR GENE SILENCING BY RNA INTERFERENCE FIELD OF THE INVENTION 0001 The invention relates to the preparation of double stranded RNA reagents for use in the specific down regu lation of gene expression by RNA interference by hybridi sation to scanning arrays of antisense oligonucleotides BACKGROUND TO THE INVENTION 0002 RNA interference RNAi is a process of sequence specific gene silencing initiated by double stranded RNA dsRNA that is homologous in sequence to a region of the silenced gene Fire A Trends Gene
23. ION Antisense Oligonucleotide SEQUENCE 13 gcggtagttg tactcattgt lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 14 LENGTH 20 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEQUENCE 14 tgtcgttcga gttgatcgta lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 15 LENGTH 20 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEQUENCE 15 gtggtccage agcggtagtt lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 16 LENGTH 20 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEQUENCE 16 gacgttagcg tgcgatgtgc lt 210 gt SEO ID NO 17 Sep 13 2007 20 20 20 20 20 20 20 US 2007 0213284 A1 Sep 13 2007 14 continued lt 211 gt LENGTH 18 lt 212 gt TYPE DNA lt 213 gt ORGANISM Artificial lt 220 gt FEATURE lt 223 gt OTHER INFORMATION Antisense Oligonucleotide lt 400 gt SEQUENCE 17 cttattcccc acaatgta 18 210 SEQ ID NO 18 211 LENGTH 18 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 18 cttgttcccc acaatgta 18 210 SEQ ID NO 19 211 LENGTH 18 212 TYPE DNA
24. OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 53 agaagaccac catcaaca 210 SEQ ID NO 54 211 LENGTH 18 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 54 aatgagtaca actaccgc 210 SEQ ID NO 55 211 LENGTH 18 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 55 ctaccgctgc tggaccac 210 SEQ ID NO 56 211 LENGTH 1000 212 TYPE DNA 213 ORGANISM Homo sapiens 400 SEQUENCE 56 tttttttttt ggaggagggt tggccgacga ctgaagcgcc aaggccgagg ctgctgttcc ttttgagaaa ccccgacctc gtggagaaat tggagaactg actaccgcag gagtggctgg gggaatttca gctgtggggg ctgcgggcca cacggtgatc ctaccgcttc cctcgagagc tcccaaataa ctcctgtttc ggcatcgaca gagggctacc cccaagctca ctcggagacc 21 continued aaggaatgaa tctccgccgc tccgcaacga tccacatcct cggtcattac tcttccccaa gtctggctcc gctctcgctc ctatcagcag gctcatctcc cgagtacttg cctcacggtc 18 18 18 18 18 60 120 180 240 300 360 Sep 13 2007 US 2007 0213284 A1 Sep 13 2007 22 continued atccgcggct ggaaactctt ctacaactac gccctggtca tcttcgagat gaccaatctc 420 aaggatattg ggctttacaa cctgaggaca ttactcgggg ggccatcagg attgagaaaa 480 atgctgacct ctgttacctc tccactgtgg actggtccct gatcctggat gcggtgtcca 540
25. Preparing and Quantifying Radiolabelled Transcripts 0057 1 Set an in vitro transcription reaction 20 uL by adding the following components to a microfuge tube at room temperature 5x transcription buffer 100 mM DTT RNAsin TM 10 mM ATP GTP and CTP 250 mM UTP Template DNA 2 a 32P UTP or a 33P JUTP T7 or SP6 RNA polymerase Total Volume Mix and incubate at 37 C for 1 h N o 8 B see Note 10 EGREEE CEE NN 2 Remove 1 uL for quantitation see below 3 Remove unincorporated label by Sephadex G25 column chromatography see Note 11 4 Save 1 uL of the purified transcript for quantitation see below 5 Check the integrity of the transcript by denaturing poly acrylamide gel electrophoresis 10 6 Add 10 uL of the scintillation fluid to the samples saved in Steps 2 and 4 7 Mix by vortexing and count the samples in a scintillation counter for 1 min 8 Calculate the per cent incorporation incorporated cpm x 100 incorporations total cpm 9 Calculate the amount of RNA made 20 uCi 6 6 x10 nmol 3000 u Ci nmol Amount of 2PJUTP Amount of cold UTP 1 uLx250 uM 0 250 nmol Total UTP 6 6 x 10 40 25 0 256 nmol For a reaction with 50 incorporation the amount of UTP incorporated 0 256 nmol 2 0 128 nmol Supposing equal incorporation of all four nucleotides total nucleotides incorporated 0 128 nmolx4 0 512 nmol Amoun
26. R INFORMATION siRNA reagent lt 220 gt FEATURE lt 221 gt NAME KEY misc feature lt 222 gt LOCATION 17 18 lt 223 gt OTHER INFORMATION wherein n represents t thymine lt 220 gt FEATURE lt 223 gt OTHER INFORMATION this is a combined DNA RNA sequence lt 400 gt SEQUENCE 24 gccgaugugu gagaagnn 18 lt 210 gt SEQ ID NO 25 lt 211 gt LENGTH 24 lt 212 gt TYPE DNA lt 213 gt ORGANISM Artificial lt 220 gt FEATURE lt 223 gt OTHER INFORMATION siRNA reagent lt 220 gt FEATURE lt 221 gt NAME KEY misc_feature lt 222 gt LOCATION 23 24 lt 223 gt OTHER INFORMATION wherein n represents t thymine lt 220 gt FEATURE lt 223 gt OTHER INFORMATION this is a combined DNA RNA sequence lt 400 gt SEQUENCE 25 gccgaugugu gagaagacca ccnn 24 lt 210 gt SEQ ID NO 26 lt 211 gt LENGTH 27 lt 212 gt TYPE DNA lt 213 gt ORGANISM Artificial lt 220 gt FEATURE lt 223 gt OTHER INFORMATION siRNA reagent lt 220 gt FEATURE lt 221 gt NAME KEY misc feature lt 222 gt LOCATION 26 27 223 OTHER INFORMATION wherein n is t thymine 220 FEATURE 223 OTHER INFORMATION this is a combined DNA RNA sequence 400 SEQUENCE 26 gccgaugugu gagaagacca ccaucnn 27 210 SEQ ID NO 27 211 LENGTH 21 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION siRNA reagent 220 FEATURE 22
27. TED WITH RNAI DUPLEXES IN VIVO 0094 B16 cells were transfected with 200 nM RNA duplexes RNA22 R2 22Inv Inv2 or oligofectamine alone OF for three consecutive days On the 4th day cells were injected into the flanks of C57BL mice using 2 5x10 cells mouse using groups of 5 mice Tumours were mea sured in 2 dimensions every 2 3 days Tumour volumes were calculated as m axb 6 where a is the larger and b the smaller dimension 0095 B16 cells transfected with R2 showed reduced growth rate in vivo syngeneic C57BL mice compared with cells transfected with inverted control RNA duplex FIG 7 This results indicates that an RNAi reagent selected on the basis of hybridisation to a scanning array is effective in vivo 18 20 20 US 2007 0213284 A1 12 continued lt 223 gt OTHER INFORMATION Antisense Oligonucleotide lt 400 gt SEQUENCE 4 tcttccgcga cttgctccgc lt 210 gt SEQ ID NO 5 211 LENGTH 20 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 5 ctgttcaccg tgcaccctgt lt 210 gt SEQ ID NO 6 211 LENGTH 18 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 6 ggtcttctca cacatcgg 210 SEQ ID NO 7 211 LENGTH 20 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION
28. UDOYIRJUSTIO ee ee ELI 06T exa3uss 38114 UO uvour peae2suni t xepaog 7 E686 ZT o i i FOFAPT 328 JO SLT PT 2358730 666 St Ypa saurana PAN 393 301 dr 2 Tes O0TXJ5T dud Treyosu SeDenr d cago DEDHEHH32692621 5 POT St ON drOds 26o2v42essoAEEB 9b ON aroas 22peses Bec3ve86553513o LPCONGTOHS soepewnesa k WE Eb ON AI OFS ON aroas QA AL US 2007 0213284 A1 Patent Application Publication Sep 13 2007 Sheet 2 of 9 0000T 0 eBuez eweg 0 81Sug day 2 uoT3YS1109 STRIOS 0001 or39ex 32odsy TUPSU pagpount 9 uoT3w3uerzo t xepiog 6867 LT o M zoper ELT 06T ez3uoo 381g SLT PI 395330 666 PST DIA due hath UM 302 402 AFTO T S QU T3351 dui t yuqosu soSeur 6 ON CI Oas ON GI OAS d i l _ OS ONGIOAS C9TE an x PS ON dI OES 92095 ooebee6e8 57892825 TS ON GI OFS ZL UL Patent Application Publication Sep 13 2007 Sheet 3 of 9 US 2007 0213284 A1 200 c 8 ASO1 gt r ASO2 m ASO3 x ASO6 u 100 0 TSS ASO R2 0 0 100 200 300 400 Conc nM Patent Application Publication Sep 13 2007 Sheet 4 of 9 US 2007 0213284 A1 SIC ZB a Pro IGF1R IGF1R B nag B tubulin Ks iLipid COC OCG O oO O OOc Conc nM 0 0 200 200 200 200 20 200 20 200 O Agent 0 0 ASO Scr RNAi InvRNA 0 IGF1R B B tubulin Conc nM O 01 4 10 011 10 Agent O RNAi InvRNA C IR B IGF1R B B tubu
29. US 20070213284A1 a2 Patent Application Publication ao Pub No US 2007 0213284 A1 as United States Sohail et al 43 Pub Date Sep 13 2007 54 METHOD OF SELECTING TARGETS FOR GENE SILENCING BY RNA INTERFERENCE 76 Inventors Muhammad Sohail Oxford GB Valentine Moya Macaulay Oxford GB Correspondence Address FOLEY amp LARDNER LLP 111 HUNTINGTON AVENUE 26TH FLOOR BOSTON MA 02199 7610 US 21 Appl No 10 996 865 22 Filed Nov 24 2004 Related U S Application Data 63 Continuation of application No PCT GB03 02307 filed on May 28 2003 30 Foreign Application Priority Data May 28 2002 GB 0212302 4 Publication Classification 51 Int CI A6IK 31 7105 2006 01 A6IK 31 713 2006 01 CO7H 21 02 2006 01 CI2N 15 64 2006 01 521 U S Cl Sonidos 514 44 435 91 4 536 24 5 57 ABSTRACT The invention relates to the selection of target regions of RNA transcripts for specific down regulation of gene expression by RNA interference Target regions of the transcript are identified on the basis of hybridisation to scanning arrays of antisense oligonucleotides and siRNA reagents comprising double stranded RNAs corresponding to the target regions are then synthesised RNAi Duplex 10nM IGF I IGFIR B Akt Ser 473 Total Akt US 2007 0213284 A1 Patent Application Publication Sep 13 2007 Sheet 1 of 9 00001 0 aburz 0 ieiBue X H eme 330 UOTIDI IIOD ere U J
30. Y misc_feature LOCATION 26 27 0 HOHE TO THER INFORMATION wherein n is t thymine FEATURE OTHER INFORMATION this is a combined DNA RNA sequence SEQUENCE 36 gauggugguc uucucacaca ucggcnn 210 211 212 213 220 223 220 221 222 223 220 223 400 SEQ ID NO 37 LENGTH 21 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION siRNA reagent FEATURE NAME KEY misc feature LOCATION 20 21 OTHER INFORMATION wherein n is t thymine FEATURE OTHER INFORMATION this is a combined DNA RNA sequence SEQUENCE 37 cggcuacaca cucuucuggn n 210 211 212 213 220 223 220 221 222 223 220 223 400 SEQ ID NO 38 LENGTH 21 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION siRNA reagent FEATURE NAME KEY misc feature LOCATION 20 21 OTHER INFORMATION wherein n is t thymine FEATURE OTHER INFORMATION this is a combined DNA RNA sequence SEQUENCE 38 ggucuucaca cacaucggcn n 210 211 212 213 220 223 220 221 222 223 220 223 lt 400 gt SEO ID NO 39 LENGTH 21 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION siRNA reagent FEATURE NAME KEY misc_feature LOCATION 20 21 OTHER INFORMATION wherein n is t thymine FEATURE OTHER IN
31. _feature LOCATION 20 21 OTHER INFORMATION wherein n is t thymine FEATURE OTHER INFORMATION this is a combined DNA RNA sequence SEQUENCE 33 ggucuucuca cacaucggen n 210 211 212 213 220 223 220 221 222 223 220 223 400 SEQ ID NO 34 LENGTH 18 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION siRNA reagent FEATURE NAME KEY misc feature LOCATION 17 18 OTHER INFORMATION wherein n is t thymine FEATURE OTHER INFORMATION this is a combined DNA RNA sequence SEQUENCE 34 cuucucacac aucggcnn 210 211 212 213 220 223 220 221 222 223 220 223 lt 400 gt SEO ID NO 35 LENGTH 24 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION siRNA reagent FEATURE NAME KEY misc_feature LOCATION 23 24 OTHER INFORMATION wherein n is t thymine FEATURE OTHER INFORMATION this is a combined DNA RNA sequence SEQUENCE 35 gguggucuuc ucacacaucg genn 21 21 21 18 24 Sep 13 2007 US 2007 0213284 A1 lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 220 gt lt 221 gt lt 222 gt lt 223 gt lt 220 gt lt 223 gt lt 400 gt 18 continued SEQ ID NO 36 ENGTH 27 YPE DNA RGANISM Artificial EATURE THER INFORMATION siRNA reagent EATURE NAME KE
32. acid in combination with any standard physiologically and or pharmaceutically accept able carriers known in the art Pharmaceutically accept able means a non toxic material which does not interfere with the activity of the pharmaceutically active ingredients in the composition Physiologically acceptable refers to a non toxic material that is compatible with a biological system such as a cell tissue or organism Physiologically and pharmaceutically acceptable carriers may include dilu ents fillers salts buffers stabilizers solubilizers etc 0035 For delivery into cells in vivo siRNAs may be formulated with lipid based carriers including for example oil in water emulsions micelles and liposomes Liposomes are the most preferred carriers and there use is well known in the art Liposomes are commercially available from Gibco BRL for example as LIPOFECTIN and OLIGO FECTAMINE which are formed of cationic lipids Meth ods for making liposomes are well known in the art and have been described in many publications Liposomes may be targeted to a particular tissue by coupling the liposome to a particular tissue by coupling the liposome to a specific ligand such as a monoclonal antibody sugar glycolipid or protein 0036 Liposomes may also be used to deliver vectors encoding siRNAs In the field of human gene therapy it is well known to deliver expression vectors such as plasmids via nucleic acid liposome comple
33. ail and Southern Table 2 added at the 5 end 0070 11 Sephadex G25 columns are available from several commercial suppliers including Promega and Phar macia Spin columns made in house as described in Sam brook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor N Y can also be used 0071 12 For hybridisation below 37 C care must be taken not to touch the plates because this can lead to melting of short duplexes For hybridisation below room tempera ture the cling film and the phosphor screen must be cooled to hybridisation temperature and exposed at the same tem perature EXAMPLE 2 USE OF SCANNING ARRAY TO SELECT RNAI REAGENTS 0072 The following is give by way of example of the utility of scanning arrays in the selection of RNAi reagents The invention is of general utility in the selection of RNAi reagents thus it is not in any way intended to limit the scope of the invention to this specific example 0073 Scanning arrays complementary to the region of the IGFIR mRNA from position 537 685 were prepared using the standard techniques described above The maxi mum length of the oligonucleotides in the array was either 18 or 20 nt 0074 In this study hybridisation to the arrays was carried out at physiological temperature 37 C in addition to room temperature 23 C in order to select sequences which are more likely to have activity in intact cel
34. an RNAi target For example the target region may be one which is relatively accessible in the mRNA transcript because of a relative lack of secondary structure Regions of mRNA transcripts which are poten tially accessible for gene silencing may be identified by RNaseH mapping see Sohail et al Nucleic Acids Res 2001 29 10 2041 2051 0018 The scanning arrays will generally containing all complements of the selected target sequence up to a maxi mum length determined by the size of the template and template displacement used in the synthesis of the scanning array Southern et al 1994 ibid Typically the maximum length of the oligonucleotides in the array will be around 18 20 nt but this may be varied if required The short dsRNAs siRNAs used for RNA interference are typically 21 23 bp in length hence it would be appropriate to include similar length sequences in the array 0019 The scanning arrays are hybridised with a probe which is a transcript of the gene of interest labelled with a revealing label which may be essentially any type of revealing label which permits visualisation and quantitation of the hybridisation intensity Radiolabels are particularly preferred Suitable labelled RNA probes may be conve niently synthesised using standard techniques known in the art see accompanying examples 0020 Typically the hybridisation will be carried out at a temperature in the range 20 37 C Hybridisation at 37
35. armaceutical composition comprising the siRNA reagent and one or more diluents excipients or carriers 3 A method of preparing an expression vector capable of expressing an siRNA reagent for use in gene silencing of a target gene by RNA interference which method comprises a preparing a scanning array of antisense oligonucle otides spanning a region of a transcript of the target gene b hybridising to the array labelled transcripts of the target gene c identifying an oligonucleotide within the array which hybridizes with the labelled transcripts and d preparing an expression vector capable of expressing an siRNA reagent comprising a double stranded RNA of identical sequence to the oligonucleotide identified in step c 4 A method of preparing a pharmaceutical composition comprising an expression vector capable of expressing an siRNA reagent for use in gene silencing of target gene by RNA interference which method comprises preparing an expression vector capable of expressing an siRNA reagent for use in gene silencing of a target gene by RNA interference according to the method of claim 3 and formulating the expression vector into a phar maceutical composition comprising the expression vec tor and one or more diluents excipients or carriers
36. ckman LS 1710 2 Scintillation Vials and Scintillation Fluid Amersham 0051 Hybridisation Imaging and Analysis 1 Hybridisation buffer IM NaCl 10 mM Tris HCl pH 7 4 1 mM EDTA 0 01 SDS w v see Note 2 2 50 100 fmol radiolabelled transcript US 2007 0213284 A1 3 A glass plate of the size of the array when using an array made on glass a moist chamber a large plastic or glass lidded box containing wetted paper towels and an incubator set to the desired temperature 4 A hybridisation tube and oven used in standard Southern hybridisation e g Techne when using an array made on polypropylene 5 Esco rubber tubing of OD 1 mm Sterlin for use in Section 3 8 6 Storage phosphor screen Fuji or Kodak 7 PhosphorImager or STORM Molecular Dynamics 8 A SUN Solaris work station for image analysis and the computer software xvseg L Wand and J K Elder unpub lished available by anonymous ftp at ftp bioch ox ac uk pub xvseg tar gz Stripping of Arrays 1 Stripping solution 100 mM sodium carbonate bicarbon ate buffer pH 10 0 01 SDS w v see Note 3 2 Geiger Miiller counter Mini Instruments Ltd Methods Derivatisation of Glass 0052 1 Prepare a mixture of di isopropylethylamine glycidoxypropyl trimethoxysilane and xylene 1 17 8 69 v v v in a glass cylinder and completely immerse the glass plates in the mixture Incubate as shown in Sohail and Southern FIG 3 at 80 C for 9
37. elanoma cells The transfection protocol was as above using either Cytofectin C or Oligofectamine O Gibco BRL After 48 hr the cells were lysed and IGFIR and IR levels were determined by immunoblotting Representative immunoblots are shown in FIG 3 a MDA 231 breast cancer cells transfected with ASO 2 or scrambled control Scr or RNAi sequence R2 given above or inverted RNA duplex control InvRNA at 20 or 200 nM b MDA 231 cells were transfected with Oligofectamine and RNAi or Inverted control InvRNA at 0 1 10 nM c ME melanoma cells were transfected with Oligofectamine and RNAi or Inv control duplex at 5 500 nM 0084 Quantitative analysis of these results is incorpo rated into the graph of ASO effects in MDA 231 FIG 2 0085 It is clear that RNAi causes much more profound inhibition of IGFIR expression than occurs with ASOs Note that the quantification methods may not be linear at very low protein levels and it is possible that these analyses underestimate the true extent of IGF1R downregulation For example the immunoblots FIG 5 show almost complete inhibition of IGFIR expression even on these overnight Sep 13 2007 exposures in MDA 231 breast cancer and ME melanoma cells treated with 10 200 nM RNAi 0086 A second RNAi R6 in FIG 4 sequence R6 in Table 2 was synthesised corresponding to ASO 6 which hybridizes to IGF1R mRNA on the array with a relative intensity of 0 01 While this does cause do
38. ent inlet and outlet respectively at the bottom and the top of the reaction chamber in the corners of the diamonds Inlet and outlet connections to the DNA synthesiser are made using standard 19SWG syringe needles 1 1 mm diameter with chamfered ends ground off and de burred see Note 5 Fabrication of Arrays 0054 1 Cut glass or polypropylene to the correct size The process of making an array is the same when using either glass or polypropylene Polypropylene has to be mounted on a glass plate e g 3 mm thick soda glass see Note 6 The total area covered by an array for N bases using a mask of diagonal or diameter D mm and step size 1 mm is Nx1 D mm 2 3 mm are added to margins to allow easy manipulations 2 Fix the assembly Sohail and Southern FIG 4 to the front of a DNA synthesiser and connect its inlet and outlet to the synthesiser s reagent supply 3 Program the DNA synthesiser with an appropriate syn thesis cycle A slightly modified cycle is used for example the one given in Table 1 Sohail and Southern Also check all the reagent bottles 4 Enter the sequence antisense strand in 5 to 3 direction 0055 5 Mark the first footprint of the reaction mask on the support by placing it against the mask on the assembly in the desired starting position see Sohail and Southern FIG 6 A knife is used to make notches in polypropylene A diamond scriber can be used to mark glass 0056 6 Tighten the plate a
39. gainst the mask with the pressure clamp to produce a seal Sohail and Southern FIG 4b Sufficient pressure is applied to stop leakage 500 800 Newton force but not enough to create indentations in the polypropylene surface which can lead to leakage of reagent from the mask during subsequent synthesis steps 7 Start the DNA synthesiser to go through the pre pro grammed cycle to couple the appropriate nucleotide The first condensation on the substrate is of base at the 3 end of the sequence 8 After completion of the step during the interrupt see Sohail and Southern Table 1 and Note 7 slacken the pressure clamp and move the plate one increment Sohail and Southern FIG 4b 9 Tighten the pressure clamp and start the synthesiser for the next nucleotide in the sequence Continue the process until the full sequence length is synthesised see Note 8 Deprotection of Arrays 1 Place the glass or polypropylene array s into the HDPE chamber see Note 9 and add 3096 ammonia into the chamber to cover the array s completely 2 Place the silicon rubber gasket around the rim of the chamber and the stainless steel plate on top of the gasket 3 Place bolts through the metal plate the gasket and the HDPE chamber and tighten US 2007 0213284 A1 4 Incubate in a water bath at 55 C for 12 18 h in a fume hood 5 Cool the assembly to 4 C before opening The arrays are ready to be used in hybridisation at this stage
40. hospho Ser473 Akt and total Akt see FIG 6 0093 The IGFIR downregulation that follows transfec tion with R2 was sufficient to inhibit IGF 1 induced Akt phosphorylation while R6 caused modest IGFIR down regulation that was not sufficient to block IGF I signalling to Akt FIG 6 This is significant because it indicates that R2 SEQUENCE LISTING lt 160 gt NUMBER OF SEQ ID NOS 56 210 SEQ ID NO 1 211 LENGTH 18 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 1 ggcttctcct ccatggtc 210 SEQ ID NO 2 211 LENGTH 20 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 2 cggcttctcc tccatggtcc 210 SEQ ID NO 3 211 LENGTH 20 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE 223 OTHER INFORMATION Antisense Oligonucleotide 400 SEQUENCE 3 gggcttctcc tccaatgtcc 210 SEQ ID NO 4 211 LENGTH 20 212 TYPE DNA 213 ORGANISM Artificial 220 FEATURE Sep 13 2007 which corresponds to an ASO hybridising strongly to the scanning array not only caused more potent IGFIR down regulation but that this translated to a significant biological advantage Akt phosphorylation is the major anti apoptosis pathway downstream of the IGFIR EXAMPLE 5 GROWTH OF CELLS TRANSFEC
41. igonucleotide is represented twice allowing for dupli cate hybridisation measurements 0049 For each length of oligonucleotides s there are N s 1 s mers covering a total length of N bases For example if a 150 nt long sequence is covered in a 150 step synthesis there will be 150 monomers and 131 20 mers The last 20 positions in the sequence will be represented by shorter oligonucleotides only in this case from 19 mer to monomer Therefore for making 200 20 mers an additional 19 nt synthesis steps need to be added at the end i e total coupling steps N s 1 Materials Derivatisation of Glass 1 Glass cylinder and apparatus shown in Sohail and South ern FIG 3 2 Glass sheets of required dimension 3 mm thick Pilking ton UK 3 3 Glycidoxypropyl trimethyoxysilane 98 v v Aldrich 4 Di isopropylethylamine 99 596 v v Aldrich 5 Xylene AnalaR Merck 6 Hexaethylene glycol 9796 v v Aldrich 7 Sulfuric acid AnalaR Merck 8 Ethanol AnalaR Merck Sep 13 2007 9 Ether AnalaR Merck 10 Water bath at 80 C Making Reaction Masks 1 Stainless steel or aluminium square metal piece or PTFE Teflon Dimensions of the workpiece may vary according to the size of the mask 2 A centre lathe or a horizontal milling machine 3 A drilling machine 4 Abrasive paper from P600 to P1200 3M Inc USA and polishing grade crocus paper J G Naylor amp Co Ltd Woodley Stockport Manchester
42. ising agent At lower temperatures it will take longer to reach the top of the reaction cell Iodine can also be replaced with sulfurising agent Cruachem to make arrays of phosphorothioate oli gonucleotides 9 When using the standard phosphoramidites the exocyclic amines of the bases are protected chemically to prevent side US 2007 0213284 A1 reactions during synthesis These protecting groups need to be removed from the coupled bases before hybridisation 0068 Before deprotection detach the polypropylene arrays from glass by peeling from one end PhotoMount can be removed with ethanol acetone or dichloromethane 0069 10 An internally radiolabelled RNA is used as target to hybridise to a scanning array which is generated by in vitro transcription carried out in the presence of a P UTP or a P UTP or a P CTP using an appropriate DNA template A plasmid containing the desired DNA fragment under the transcriptional control of a T7 or SP6 promoter such as pGEM Promega can be used as tem plate The plasmid is linearised with an appropriate restric tion endonuclease to produce transcripts of defined length without contaminating vector sequence Alternatively a template with T7 or SP6 RNA promoter can also be gener ated using the polymerase chain reaction primers are used to amplify the required fragment from a plasmid genomic DNA or cDNA such that the sense primer has a T7 or SP6 promoter leader sequence Soh
43. l The intensity of the autoradiographic bands was quan tified by densitometry and IGFIR levels were corrected for loading differences The results are shown as IGFIR level of that in cells transfected with the same concentration of an appropriate control This was a scrambled control oligo nucleotide for ASOs and an inverted RNA duplex for RNAi 0041 FIG 3 illustrates the effect of ASOs and RNAi on IGF1R and IR levels in MDA 231 human breast cancer cells and ME melanoma cells Cells were transfected using either Cytofectin C or Oligofectamine O Gibco BRL After 48 hr the cells were lysed and IGFIR and IR levels were determined by immunoblotting a MDA 231 breast cancer cells transfected with ASO 2 or scrambled control Scr or RNAi or inverted RNA duplex control InvRNA at 20 or 200 nM b MDA 231 cells were transfected with Oligofectamine and RNAi or Inverted control InVRNA at 0 1 10 nM c ME melanoma cells were transfected with Oligofectamine and RNAi or Inv control duplex at 5 500 nM 0042 FIG 4 illustrates the effects of various RNAi duplexes in MDA 231 breast cancer cells MDA 231 cells were transfected with oligofectamine and 21mer RNA duplexes at 0 5 5 and 50 nm After 48 hr IGFIR expression was analysed by immunoblotting panel a Panel b is a graphical illustration results are presented as IGFIR level of that in cells transfected with the same concentration of an inverted control RNAi 0043 FI
44. lin Conc nM 500 50 5 o 500 50 5 Agent RNAi 0 Inv RNA US 2007 0213284 A1 WU vonenusdu09 001 ol I 0 uljngn ULADI 8 414391 aul gaul 9H JIN CININ TAS AU xajdn JOHUOD POH AUI SE MLADO LEZ YAN Ul IVNM gi SMO EF SR Patent Application Publication Sep 13 2007 Sheet 5 of 9 US 2007 0213284 A1 Patent Application Publication Sep 13 2007 Sheet 6 of 9 OL Wu uonenusouog L g NG 00 ZAU1 41391 v PAS PA SO S 909 0 S GO G GO 6 IU YNYS c u JOWZZ lowpg Jeuljz JeulgL 17 Patent Application Publication Sep 13 2007 Sheet 7 of 9 US 2007 0213284 A1 Inv2 pa D png SE g y 22553 X K S 8 S N 3 Patent Application Publication Sep 13 2007 Sheet 8 of 9 US 2007 0213284 A1 ted injec dad 2 O a 3 o E Lr 2 5x10 5 cells Days after Injection O 7 o e o Ga N o gyuB owuro an tun Patent Application Publication Sep 13 2007 Sheet 9 of 9 US 2007 0213284 A1 ES IGF1R cDNA sequence bases 1 1000 SEO ID NO 56 1 TITITITITITTTTGAGAAAGGGAATTTCATCCCAAATAAAAGGAATGAA 51 X GTCTGGCTCCGGAGGAGGGTCCCCGACCTCGCTGTGGGGGCTCCTGTTTC 101 TCTCCGCCGCGCTCTCGCTCTGGCCGACGAGTGGAGAAATCTGCGGGCCA 151 GGCATCGACATCCGCAACGACTATCAGCAGCTGAAGCGCCTGGAGAACTG 201 CACGGTGATCGAGGGCTACCTCCACATCCTGCTCATCTCCAAGGCCGAGG 251 ACTACCGCAGCTACCGCTTCCCCAAGCTCACGGTCATTACCGAGTACTTG 301 CTGCTGTTCCGAGTGGCT
45. ls The arrays were probed with labelled IGFIR mRNA and also with labelled insulin receptor mRNA in order to identify oligonucleotides which have high specificity for IGFIR mRNA IGFIR Template Probe Preparation 0075 Human IGFIR cDNA in plasmid pCVN was a generous gift from Renato Baserga The 5 region of IGFIR cDNA was cloned into vector pBluescript KS Stratagene using restriction sites HindIII pCVN derived site at 5 end of IGF1R cDNA and Asp718 cuts IGFIR cDNA at posi tion 1581 This construct template 1 1 6 kb included Sep 13 2007 approximately 100 bp of polylinker sequence between the T7 promoter and the start of the IGFIR sequence It was thought that this extraneous vector derived sequence might influence folding of the transcript Therefore this region was shortened by restriction digest using Notl filling in with Klenow enzyme digestion with EcoRV and re ligating to make construct 2 1 6 kbA55 Both constructs were lin earised at the 3 end of the IGFIR insert using Asp718 to make templates for in vitro transcription End labelled tran scripts 1 1 6 kb and 2 1 6 kbA55 see FIG 1 were generated using T7 RNA polymerase and y P GTP Amer sham Pharmacia Results 0076 Representative plots of hybridisation intensity across the array for 15mers and 18mers probed with labelled IGF1R mRNA are shown in FIG 1 The plots are annotated to show the position of selected individual oligonucleotide sequences
46. n a single nucleotide may have a profound effect on activity of the RNAi duplex The dsRNA may further contain non natural bases or non natural backbone linkages for example to enhance stability in vivo or enhance resistance to degrada tion by nucleases The dsRNA may also include single stranded overhangs at one or both ends of the duplex In a Sep 13 2007 particularly preferred embodiment the dsRNA may contain 3 overhanging nucleotides preferably 3 overhanging thy midines dTdT or uridines UU 0022 siRNA reagents may be formed of RNA DNA chimeras These chimeras include for example the siRNA reagents comprising a double stranded RNA with 3 over hangs of DNA bases e g dTdT as discussed above and also siRNA reagents comprising a double stranded RNA in which one or more of the RNA bases or even an entire strand are replaced with DNA bases 0023 Ina further embodiment rather than being formed of two separate RNA strands annealed together the si RNA reagent may comprise a dsRNA having a foldback stem loop or hairpin structure wherein the two strands of the dsRNA are covalently linked RNAs having this structure are typical if the dsRNA is synthesised by expression in vivo or by in vitro transcription The precise nature and sequence of the loop linking the two RNA strands is generally not material to the invention except that it should not impair the ability of the double stranded part of the molecule t
47. nalysis 0058 The hybridisation images are analysed using xvseg see Sohail and Southern FIG 7 This program reads and displays images generated by a PhosphorImager or STORM and can also perform standard image manipulation such as scaling clipping and rotation Although visual inspection of an image reveals the results generally computer aided analysis is needed to obtain quantitative information about hybridisation intensities and the oligonucleotide sequences that generated them xvseq calculates and displays inte grated intensities of the array oligonucleotides each of which corresponds to an image cell formed by intersection of overlapping array templates 0059 The user can specify the template size shape and location step size between successive templates as well as the sequence that was used to make the array The template grid is superimposed on the image and the template param eters are adjusted interactively to achieve correct and accu rate registration of the grid with the hybridisation pattern It can be difficult to achieve precise registration by reference to the hybridisation pattern alone especially if the signals at either edge of the array are weak or undetectable Avoid placing the template grid so that it appears to be registered but is in fact misaligned by one or more template steps Registration can be aided by the use of fixed reference points on an array such as those shown in Sohail and Southern FIG 6
48. nd 2 in an incubator at desired temperature for 30 min Also put approximately 100 mL of the hybridi sation buffer in the oven this is to be used to wash the array at the end of hybridisation 4 Using a micropipette pipette the hybridisation mix in a line evenly along the length of the non array glass plate avoiding formation of air bubbles 5 Starting at one end carefully place the scanning array face down on top of the hybridisation mix The mix will spread out and form a thin film between the two plates Incubate for 3 4 h 6 Separate the plates from each other and wash the array plate with hybridisation buffer to remove unbound mix Drain the plate air dry cover with cling film and expose to a storage phosphor screen for 16 20 h 7 Scan the screen on PhosphorImager or STORM and analyse the image using xvseq see below Alternative Hybridisation Protocol for Glass or Polypropy lene 1 Assemble with clips the array plate or polypropylene array pasted with PhotoMount on a glass plate and the non array plate using rubber tubing as spacers on two sides 2 Dilute the Radiolabelled Transcript in approximately 5 10 mL of hybridisation buffer 3 Follow Step 3 Protocol 3 7 4 Inject the hybridisation mix into the space between the two plates with a needle and syringe 5 Incubate the assembly in horizontal position at desired temperature US 2007 0213284 A1 6 Follow Steps 6 and 7 Protocol 3 7 Image A
49. nd incubated for a further 25 min at room temperature Monolayers were washed with 1 2 ml Optimem To the cells were added 175 ul Optimem followed by the 325 ul complexes Volumes were scaled up by factors of 2 22 or 6 05 for transfection in 60 mm or 100 mm dishes respectively Cultures were incubated at 37 C for 4 hr and then 50 ul FCS and 3 5 ml RPMI plus 5 FCS were added to each well After 48 hr incubation effects on IGF1R and IR expression were determined by immunoblotting Some transfected cultures were disaggregated using 3 mM EDTA in PBS for 2 4 min washed in serum free RPMI divided into two aliquots and treated with 10 nM Long R3 IGF I GroPep Adelaide or diluent for 30 min at 37 C prior to lysis Immunoblotting 0081 IGFIR expression was assessed by immunoblot ting as previously described Macaulay et al 2001 After washing in ice cold PBS cells were lysed in 50 mM Hepes pH 7 5 100 mM NaCl 10 mM EDTA 1 Triton X 100 4 mM sodium pyrophosphate 2 mM sodium orthovanadate 10 mM sodium fluoride 1 mM PMSF 2 pg ml each leu peptin and aprotinin Lysates were centrifuged for 15 min utes at 14 000 g the protein concentration of supernatants was measured using BCA assay reagent Pierce and equivalent amounts of protein were separated on 7 5 SDS PAGE gels and transferred to nitrocellulose Target protein levels were assessed using antibodies to the f sub unit of the IGFIR or IR Santa Cruz phospho Ser 473 Akt or t
50. o insert the end of the syringe needle into the reaction chamber void 0064 6 Unlike glass polypropylene is not rigid and thus needs to be mounted on a solid flat surface for its precise movement against the reaction mask during synthesis Even mounting of polypropylene on glass is important to produce a good seal between the sealing edge of the reaction mask and the polypropylene surface Glass used must be clean and free from dust particles because they can cause bulging of the polypropylene which can hinder the formation of a proper seal A very thin layer of PhotoMount 3M Inc USA which can be used to paste polypropylene to glass should be sprayed on glass and not polypropylene 0065 7 At the start of each synthesis cycle an interrupt step can be introduced to halt the process at the first step of the next nucleotide condensation cycle to allow the operator to move the plate and restart the program Alternatively a long wait step at the beginning of the program can be introduced see Sohail and Southern Table 1 if the operator does not wish to use the interrupt step The operator is also advised to consult the user s manual for the DNA synthe siser 0066 8 With the use of standard phosphoramidites in the synthesis the oligonucleotides are attached to the solid support at their 3 ends Reverse phosphoramidites can be used to make oligonucleotides that are attached at their 5 ends 0067 Iodine is used as an oxid
51. o mediate RNAi 0024 The double stranded RNA will preferably com prise 20 27 or 20 24 consecutive nucleotides of the target mRNA sequence since duplexes of this length are particu larly effective in RNAi 0025 Double stranded RNAs may be synthesised in vitro using chemical or enzymatic RNA synthesis techniques well known in the art In one approach the two separate RNA strands may be synthesised separately and then annealed to form double strands 0026 In a further embodiment double stranded RNAs may be synthesised by intracellular expression from a suit able expression vector Thus the invention further provides a method of preparing an expression vector capable of expressing an siRNA reagent for use in gene silencing of a target gene by RNA interference which method comprises 0027 a preparing a scanning array of antisense oligo nucleotides spanning a region of a transcript of the target gene 0028 b hybridising to the array labelled transcripts of the target gene 0029 c identifying an oligonucleotide within the array which hybridizes with the labelled transcripts and 0030 d preparing an expression vector capable of expressing an siRNA reagent comprising a double stranded RNA of identical sequence to the oligonucleotide identified in step c 0031 A number of expression vector systems for in vivo expression of short double stranded RNAs for use as RNAi reagents also referred to as small inte
52. otal Akt Cell Signalling New England Biolabs or US 2007 0213284 A1 B tubulin Sigma Primary antibodies were detected with HRP conjugated secondary antibodies Dako and ECL Plus Amersham Pharmacia Results i Down regulation of IGFIR in MDA 231 cells by anti sense oligonucleotides and RNAi comparison of the activity of ASOs and RNAi 0082 ASOs and RNAi duplexes were transfected into MDA 231 cells using Cytofectin or Oligofectamine as described above After 48 hr the cells were lysed and IGFIR and IR levels were measured by immunoblotting The inten sity of the autoradiographic bands was quantified by densi tometry and IGFIR or IR levels were corrected for loading differences The specific IGF1R or IR results are presented as 96 IGF1R or IR level of that in cells transfected with the same concentration of an appropriate control This was a scrambled control oligonucleotide for ASOs and an inverted RNA duplex for RNAi The results are shown in Table 4 and FIG 2 TABLE 4 Effect of IGFIR ASOs on IGFIR and IR expression in MDA 231 cells Protein Level control IGFIR IR ASO 30 nM 300 nM 30 nM 300 nM 1 66 x 23 38 6 112 135 2 84 11 47 5 nd nd 3 105 18 104 22 nd nd 4 7322 49 2 97 92 6 nd 100 nd 100 TSS 141 10 64 19 144 59 0083 The effects of an ASO and RNAi duplex of equiva lent sequence ASO2 and R2 on IGFIR and IR expression were compared in MDA 231 human breast cancer cells and ME m
53. rfering RNAs or siRNAs are known in the art Generally siRNAs are expressed as stem loops which may be rapidly processed within the cell to produce the free siRNA see review by Tuschl Nature Biotechnology Vol 20 5 446 448 2002 Vector systems for expression of siRNAs are often based on RNA Pol III promoters since these are particularly suited to accurate expression of very short RNA sequences Suitable vector systems are described in Brummelkamp T R et al Science Vol 296 550 553 2002 Lee N S et al Nature US 2007 0213284 A1 Biotechnology Vol 20 500 505 2002 Miyagashi M Taira K Nature Biotechnology Vol 20 497 500 2002 Paul C P et al Nature Biotechnology Vol 20 505 508 2002 the contents of which are incorporated herein by reference 0032 Ina further aspect the invention provides a method of preparing a pharmaceutical composition comprising an siRNA reagent capable of mediating gene silencing of a target gene by RNA interference which method comprises 0033 preparing an siRNA reagent capable of mediating gene silencing of a target gene by RNA interference accord ing to the method described above and formulating the siRNA reagent into a pharmaceutical composition compris ing the siRNA reagent and one or more diluents excipients or carriers 0034 siRNA reagents may be formulated into pharma ceutical compositions comprising a therapeutically effective amount of the siRNA nucleic
54. sc_feature LOCATION 20 21 OTHER INFORMATION wherein n is t thymine FEATURE OTHER INFORMATION this is a combined DNA RNA sequence SEQUENCE 42 cuuguucccc acaauguagn n 210 211 212 213 220 223 400 SEQ ID NO 43 LENGTH 15 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEQUENCE 43 attgtgggga ataag 210 211 212 213 220 223 lt 400 gt SEO ID NO 44 LENGTH 15 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEOUENCE 44 catggaggag aagcc lt 210 gt SEQ ID NO 45 21 21 21 15 15 Sep 13 2007 US 2007 0213284 A1 lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 400 gt 20 continued LENGTH 15 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEQUENCE 45 atgtgtgaga agacc lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 46 LENGTH 15 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEQUENCE 46 agaccaccat caaca lt 210 gt lt 211 gt lt 212 gt lt 213 gt lt 220 gt lt 223 gt lt 400 gt SEQ ID NO 47 LENGTH 15 TYPE DNA ORGANISM Artificial FEATURE OTHER INFORMATION Antisense Oligonucleotide SEQUENCE 47 gagtacaact accgc
55. t Vol 15 358 363 1999 Sharp P A Genes Dev Vol 15 485 490 2001 0003 Elbashir et al Nature 411 494 498 2001 have demonstrated effective RNAi mediated gene silencing in mammalian cells using dsRNA fragments of 21 nucleotides in length also termed small interfering RNAs or siRNAs These short siRNAs demonstrate effective and specific gene silencing whilst avoiding the interferon mediated non spe cific reduction in gene expression which has been observed with the use of dsRNAs greater than 30 bp in length Stark G R et al Ann Rev Biochem 1998 67 227 264 Manche L et al Mol Cell Biol 1992 12 5238 5248 Thus siRNAs represent promising candidate gene specific therapeutic agents providing an alternative to anti sense oligonucle otides 0004 One potential problem to be overcome in the development of siRNA agents for any given gene is the selection of an appropriate region of the gene to target in order to achieve effective gene silencing by RNAi 0005 In the field of anti sense oligonucleotide technol ogy suitable single stranded antisense oligonucleotides for a given gene may be selected with the use of scanning arrays Southern E M et al Nucleic Acids Res 1994 22 8 1368 1373 Sohail M and Southern E M Using oligo nucleotide scanning arrays to find effective antisense reagents Methods in Molecular Biology vol 170 DNA Arrays Methods and Protocols Ed J B Rampal Humana Press Inc
56. t of full length transcript 0 512 total length of transcript Sep 13 2007 Hybridisation to Arrays Made on Polypropylene 1 Place the array in the hybridisation tube coiling it in a spiral 2 Dilute the radiolabelled transcript in an appropriate vol ume 10 20 mL depending upon the size of the array and the hybridisation tube of hybridisation buffer The mix should cover the array along the length of the tube 3 Place items 1 and 2 in the oven at desired temperature for 30 min Also put approximately 100 mL of the hybridisation buffer in the oven this is to be used to wash the array at the end of hybridisation 4 Pour the hybridisation mix into the tube containing the array and hybridise for 3 4 h 5 Remove the hybridisation mix Briefly wash the array with the hybridisation buffer from Step 3 air dry cover with cling film and expose to a storage phosphor screen for 16 20 h see Note 12 6 Scan the screen on PhosphorImager or STORM and analyse the image using xvseq see below Hybridisation to Arrays Made on Glass 1 Clean the non array glass plate with acetone and ethanol to ensure it is grease free and siliconise it by treatment with dimethyl dichlorosilane solution and place it in lidded box Also place moist paper towel in the box 2 Dilute the radiolabelled transcript in an appropriate vol ume of the hybridisation buffer for example for an array of 250 mmx50 mm use 500 750 uL 3 Place items 1 a
57. wnregulation of the IGF1R the effects were significantly less potent than that of the RNAi corresponding to ASO2 R2 in FIG 4 sequence R2 in Table 2 RNAi R2 is more effective than RNAi R6 in the following cell lines DU145 prostate A549 NSCLC UC101 ovary U20S osteosarcoma MCF7 breast ER positive 0087 This result indicates that intensity of hybridisation to the scanning oligonucleotide array is predictive of the activity of RNAi reagents 0088 The inhibitory effect of RNAi R2 is partially though not completely blocked by the presence of a single base pair mutation sequence Mut2 in FIG 4 see FIG 4 compare R2 with Mut2 The effect of R6 was less than the effect of the mutant duplex Mut2 This indicates that the efficacy of synthetic 21mer RNAi molecules is influenced by secondary structure in and hence access to the target region of the mRNA iv Comparison of RNAi Duplexes R2 and R6 in a Range of Human and Murine Cell Lines 0089 Tumour cells were transfected with 10 nM duplexes and IGF1R levels were measured after 48 hr After correction for loading differences IGFIR levels in cells transfected with RNAi were expressed as of levels in cells transfected with equivalent inverted control duplex TABLE 4 Effect of R2 and R6 RNAi duplexes in human and murine cell lines Cell line Cell type R2 R6 DU145 Human prostate cancer 34 13 74 8 A549 Human non small cell lung 22 2 102 16 ME Human melanoma 53 3
58. xes 0037 For use in human therapy pharmaceutical compo sitions including the siRNAs ofthe invention will be admin istered to a patient in need of treatment in a therapeutically acceptable amount A therapeutically acceptable amount is an amount of a pharmaceutical preparation that alone or together with further doses produces the desired response in the condition being treated The precise amount of the composition administered will however generally be deter mined by a medical practitioner based on the circumstances pertaining to the disorder to be treated such as the severity of the symptoms the composition to be administered the age weight and response of the individual patient and the chosen route of administration 0038 The invention will be further understood with reference to the following experimental protocols together with the accompanying Figures in which Sep 13 2007 0039 FIG 1 shows representative plots of hybridisation intensity across the array for a 15mers and b 18mers probed with labelled IGFIR mRNA 0040 FIG 2 illustrates the effect of ASCs and RNAi on IGFIR levels in MDA 231 human breast cancer cells The cells were transfected at 30 4096 confluence with phospho rothioate ASOs complexed with the lipid Cytofectin Glen GSV After 48 hr the cells were lysed and equivalent amounts of soluble protein were separated by SDS PAGE and immunoblotted for IGFIR and P tubulin loading con tro
Download Pdf Manuals
Related Search