Home

SB-11-08 Addendum No. 1

Contents

1. 27 6 1 No Display on 27 6 2 1840008 Fault Codes and Remedies sse 27 29 8 0 CUSTOMER SUPPORT sikti fok ki an a kn a a an 30 9 0 APPENDIX C 31 9 1 TD 31 9 2 Specification S sei 32 9 3 Ordering Information 3 2 5 2 2 ania wii deae Ee eek nina eae 35 VE GENERAL MONITORS Model IR4000S Table of Figures Figure 1 IR4000S Outline and Mounting Dimensions in inches 1 Figure 2 IRA000S Terminal Block 3 Figure 3 1840005 Single Point 6 Figure 6 1840008 with IR400 Mounting Dimensions in inches 8 Figure 4 IRA000S Outline and Mounting Dimensions in inches 9 Figure 5 IR4000S Terminal Block 11 Figure 6 Push Type tert a 12 Figure 7 Screw Type Terminal Block 13 Figure 8 Connecting IR400 Signal Wires to the
2. atta atte thy Sand Red Micaceous Silty 0 020 in Slotted Screen with a Pea Gravel Filter Pack atte atts 4 9 24 07 Report TTL WELL LOG TemplateTTLENV GDT a P a a ants atte atte Sand Brown Micaceous Silty ry va arty a arte athe BORING TERMINATED AT 25 FEET G APROJECTSILANDFI 1 HENRY 600706 1 SVESYS 1 BORING LOGS GP3 LOG OF WELL SVE 10 CLOSED WINDY HILL ROAD MSWLF 8 WELL i Technology and gf HENRY COUNTY GEORGIA CONSTRUCTION Tradition X PROJECT NUMBER 600706189 GEOLOGIST T Hall LOCATION McDonough Henry County Georgia DATE S DRILLED 3 13 2007 DRILLING COMPANY TTL Inc CASING DIA TYPE 4 PVC DRILLER Kenn SCREEN SLOT TYPE 0 020 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING REMARKS GROUND ELEVATION DEPTH TO WATER WATER ELEVATION i SAMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION 4 Well Cover INTERVAL feet RECOVERY PID ppm Topsoil Brown Silty Sand Sand Orange Red Micaceous Silty 2 ft riser with No Fill ZZ Closed Windy Hill Road MSWLF Henry County Georaia Bentonite Seal e 9 45 M LL E _ ot PVC Riser with Pea Gravel Pack Se Sand Brown Micaceous Silty Saprolitic Becoming Harder Rock With Depth 2 0 etta 47 aste
3. einn ph tn ht ee a ERR a a ak TERR ERR ERR o 6 2 2 Features and Benefits eh ripe eu ax R Fans SEPA FINDER 6 3 0 INSTALLATION eec 7 3 1 Unpacking the 7 3 2 etus Lt 8 3 3 Cabling and Wiring RR 10 3 4 Applying Power and Starting 15 4 0 OPERATION AND 18 4 1 OVOTVIOW 18 4 2 Gas Ghecking the 00 2 ritorno xx a a xd 20 4 3 Pchsu sum 20 4 4 electum 21 4 5 OULU sac cs case Sec E 22 4 6 Resetting the Relays 23 5 0 MAIN TENG cm 25 5 1 Developing a Maintenance 25 5 2 Zeroing and 25 5 3 Lubricating Threads and 5 25 5 4 Maintaining the Integrity 25 5 5 Siem HM eR 26 c
4. 9 10 4 Sand micaceous silty atte a aste Yo RECOVERY PID ppm asa tek 44 Slotted Screen with a Pea Gravel Filter Pack 9 24 07 Report TTL WELL LOG Template TTLENV GDT lt A Se 497 a atta aea aea ue ae aea 7 BORING TERMINATED AT 30 FEET Te ee an nn a eee ee A abf i MAN AN AE 3 9 E o G PROJECTS LANDFI 1 HENRY 600706 7 SVESYS 1 BORING LOGS GPJ LOG OF WELL SVE 2 CLOSED WINDY HILL ROAD MSWLF amp WELL Technology and ag HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST T Hall LOCATION McDonough Henry County Georgia DATE S DRILLED 8 9 2006 DRILLING COMPANY Betts Environmental CASING DIA TYPE 4 PVC DRILLER C Pendarvis SCREEN SLOT TYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING 848 00 Ft AMSL REMARKS GROUND ELEVATION 846 00 Ft AMSL DEPTH TO WATER WATER ELEVATION WELL DIAGRAM LITHOLOGIC DESCRIPTION 8 gt 24 2 gt 2 Stick up Pipe Sand Dark brown micaceous silty Closed Windy Hill Road MSWLF Henry County Georgia Bentonite Seal Sand Gray black amp white Micaceous silly entoniie oes Sand Tan micaceous silty with some coarse grained quartz an
5. et AS arte at A aste ata ata A e t Ta at a atte a 0 020 in Slotted Screen with a Pea Gravel Filter Pack arte atte asie a arta atte atte atte a arte atte BORING TERMINATED 30 FEET GAPROJECTS LANDEI 1 HENRY 600706 1 SVESYS 1 BORING LOGS GPJ a 106 OF WELL SVE 11 CLOSED WINDY HILL ROAD MSWLF amp WELL Technology and gf HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST T LOCATION McDonough Henry County Georgia DATE S DRILLED 3 13 2007 DRILLING COMPANY TIL inc CASING DIA TYPE 4 PVC DRILLER Kenn SCREEN SLOT TYPE 0 020 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING REMARKS GROUND ELEVATION DEPTH TO WATER WATER ELEVATION SAMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION DEPTH feet GRAPHIC INTERVAL feet 4 Well Cover Topsoil Brown Silty Sand Sand Orange Micaceous Silty 2 riser with No Fill Closed Windy Hill Road MSWLE Henry County Georgia Bentonite Seal PVC Riser with Sand Tan Brown Micaceous Silty Pea Gravel Pack a 17442747 a asse a late TTLENV GDT atte ea een 9 24 07 Report TTL WELL LOG Temp 0 020 in Slotted Screen with a Pea Gravel Filter Pack arte at i RS art
6. Monitoring Size Surface Estimated Well NOE Location ID Completion Depth ft MM 1 1 PVC Flush 25 Manhole Cover MM 2 1 PVC Flush 20 Manhole Cover MM 3 1 PVC Flush 20 Manhole Cover MM 4 1 Flush 20 Manhole Cover MM 5 1 PVC Flush 20 Manhole Cover MM 6 1 PVC Flush 20 Associated Fixed Methane Monitor with Telemetry MM 8 1 Stand up 30 Locking Metal Housing MM 9 1 PVC Stand up 30 Locking Metal Housing MM 10 1 Stand up 30 Locking Metal Housing 11 1 Stand up 30 Locking Metal Housing MM 26 1 PVC Stand u F Locking Metal Housin ISPVC Locking Metal Housing MM 31 PVC Stand up 30 Locking Metal Housing Bid Number SB 11 08 081910 1 Bid Closing Date August 19 2010 Bid Closing Time 3 00 PM Commodity Landfill Monitoring Wells Bid Description To furnish all materials labor tools equipment and services required to construct thirteen 13 methane monitoring wells and to convert one 1 existing observation well to a soil vapor extraction SVE well and connect it to the existing SVE system at the Old Windy Hill Municipal Solid Waste Landfill MSWLEF in Henry County Georgia Must the drilling be performed under direction of a professional geologist or a professional engineer If so is the driller or the County or its consultants responsible for this supervision a Yes per Section 1 3 Methane Monitoring System Design and Construction Sub
7. a CLASS ZONE 1 GROUP 18 ee 4x REMOT E DETECTOR 40 C TO 75 C vec ZW eramo CONTACT RATINGS SEE MANU AL CAUTION open WHEN an EXPLOSIVE GAS ATMOSPHERE i A DO NOT OPEN WHILE ENERGIZED READ AND UNDERSTAND INSTRUCTION MANUAL COMBUSTIBLE GAS DETECTION INSTRUMENT BEFORE OPERATING OR SERVICING CERTIFIED CSA Standard C22 2 NO 152 USE CABLE WITH INSULATION RATED TO AT LEAST f Figure 3 1840005 Single Point Monitor 2 1 1840005 Monitor The Model 1840005 Single Point Monitor is a display and user interface for the Model IR400 point IR gas detector The monitor allows local calibration and displays gas concentration Relays are optional The relays provide output for Alarm Warn and Fault conditions 2 2 Features and Benefits The 1840008 system enhances the features and benefits of the IR400 in several important ways Local interface provides ease of maintenance and accessibility e Bright display permits clear indication Explosion proof enclosure and magnetic interface allow installation and calibration in hazardous locations e Optional 8 Amp relays expand system functions potentially eliminating the need for additional equipment such as a PLC Model IR4000S 2 GENERAL MONITORS gt gt 3 0 Installation CAUTION 1840005 Single Point Monitor contains components that can be damaged by static electricity Special care m
8. 1 949 581 4464 Fax 1 949 581 1151 Email info generalmonitors com Houston TX 9776 Whithorn Drive Houston Texas 77095 Tel 1 281 855 6000 Fax 1 281 855 3290 Email gmhouGgeneralmonitors com Ireland Ballybrit Business Park Galway Republic of Ireland Tel 353 91 751175 Fax 353 91 751317 Email info gmil ie Singapore No 2 Kallang Pudding Road 09 16 Mactech Building Singapore 349307 Tel 65 6748 3488 Fax 65 6748 1911 Email genmonGgmpacifica com sg United Arab Emirates P O Box 61209 Jebel Ali Dubai United Arab Emirates Tel 971 4 8815751 Fax 971 4 8817927 Email gmme emirates net ae United Kingdom Heather Close Lyme Green Business Park Macclesfield Cheshire United Kingdom SK11 OLR 44 1625 619583 Fax 44 1625 619098 Email info generalmonitors co uk ATTACHMENT Methane Monitoring Plan Old Windy Hill MSWLF VERSOS TI _ Methane Monitor See Attachments D amp E and below General Monitors IRA00S 0 1 02 1 0 1 0 100 LEL Methane Range Complete with IR 400 Sensor 3 Relays for Warning Low High and Fault Alarm 4 20 uA Output Telemetry System See Attachment F and below Mission Communications Model M110 NEMA 4 Enclosure with Sunshield Notes Henry County will provide the power for the monitoring station The contractor shall 1 Install the monitor and telemetry system Connect the
9. GENERAL MONITORS Model 1840005 3 Optional Configure additional IRA000S settings as needed You may wish to configure additional operating parameters directly after start up or you can use the default settings initially and change them later on For a summary of all the IRA000S Menu Configuration options see the topic Setup in Section 4 5 17 GENERAL MONITORS Model 1840005 4 0 Operation and Configuration 4 1 Overview The Model 1840005 Single Point Monitor front panel includes a digital display Alarm and Warn indicators The panel displays a set of menu options that provide the user with the most flexible detector system possible INFRARED GAS DISPLAY UNIT MODEL 184000 P N 31840 EExd IIB T5 40 C to 75 C lt GENERAL MONITORS Use cable with insulation rated to at least 110 C AKE FOREST CALIFORNIA USA A 5 24 VDC 7 W MAX CONTACT RATINGS SEE MANUAL gaz class i Div 1 lt gt GROUPS B n CLASS ZONE 1 GROUP TIB Ha TYPE 4X WITH SENSOR CAUTION Do Nor OPEN WHEN AN EXPLOSIVE GAS ATMOSPHERE IS PRESENT DOJ OPEN WHILE ENERGIZED READ AND UNDERSTAND INSTRUCTION MANUAL BEFORE OPERATING OR SERVICING Alarm Indicator ZERO PROCEDURE 1 ENSURE SENSOR IS IN CLEAN AIR 2 HOLD MAGNET ABOVE LOGO TO ENTER MENU 3WHEN HO IS DISPLAYED 3 Digit Display 4 SELE
10. GENERAL MONITORS Model 1840005 ADDENDUM Product Disposal Considerations This product may contain hazardous and or toxic substances EU Member states shall dispose according to WEEE regulations For further General Monitors product WEEE disposal information please visit www generalmonitors com customer support faq general html All other countries or states please dispose of in accordance with existing federal state and local environmental control regulations 36 Combustible bas GENERAL MONITORS Protection for life MODEL R400 Infrared Point Detector for Combustible Gas Detection Features Benefits No routine calibration required Low maintenance True fail to safe operation True gas detection performance Multiple communication outputs Provides complete status and control capability in the control room Heated optics Eliminates condensation Dirty optics indication Discriminates between true fault and cleaning requirements Wireless capability Compatible with ELPRO Technologies wireless devices Description The Model 18400 infrared IR point detector is a The 18400 is calibrated at the factory and needs no microprocessor based combustible gas detector that routine field calibration It requires only a periodic continuously monitors combustible gases in the lower cleaning of the windows and re zeroing to ensure explosive limit LEL range and provides a 4 to 20 mA de
11. OLD WINDY HILL LANDFILL ASBUILT DRAWING PROJECT NAME ine ht iD Lu rad cats Tabs No ELEV 849 19 eX GATE 849 85 1 60 VALVE ere X X Ao X x 50 HIGH NYLON NETTIN 4 CHAINLINK gt FENCE E xe x oo tem T s S Ne D gu GATE SVE 6 ELEV 855 43 1 30 TO VALVE 1 2058 FAS NIS WLS AWA 901 i jo AS RT LM rose oc 3AS 9 67158 59158 3 5 fa RO e x ae The un Dos An s co 0 SSELEV BS264 S TW ME ENS c2i e 4 CHAINLINK x d X NND v VAN 4 CHAINLINK e FENCE Windy Hill Stakeout dwa NYLON NETTING ARCHIVE DATE 7124107 x 50 HIGH 4 CHAINLINK _ FENCE X l a gt ki 3 Us E ts 5 2 e ki n a 2 j A a Bs M 3 pa DC 22 US 5 EE x EE ae An i A The Drawings Specifications and other Mi E EF vou M s P E documents prepared by Moore Bass a EE MM DU TM m ws a Dy CUR de eo i DEMNM os P ys Q for this Project ara GATE A RU 2 2 AT on at it Mn e dog vi
12. 1 is not being used a jumper must be placed between TB 2 pin 1 and a COM pin such as TB 2 pin 8 to complete the AO circuit 5 When wiring is complete replace the 1840008 cover and tighten the four captive Screws IR4000 TB1 Terminal Block IR400 BLACK COM pin 7 GREEN YELLOW RED 24V pin 8 WHITE 4 20mA IN pin 1 CAL IN pin 2 BROWN COM pin 3 BLUE MOD optional BLUE WHITE optional Figure 9 Connecting IR400 Signal Wires to the TB1 Block 3 3 3 Connecting Alarm Relay Devices to the TB3 Block Terminal block TB3 contains the connections for the relay contacts for alarm equipment such as sirens It is included on an optional circuit board module The 13 GENERAL MONITORS Model IR4000S A functioning of the Alarm and Warn relay connections varies depending on whether the relays are configured as Energized or De Energized NOTE The default IR4000S configuration menu setting for the Warn and Alarm relays is De Energized For further information see relay configuration information in Section 4 5 1 The Fault relay is normally Energized It will change state after power up Use the following table as a guide for determining the Normally Open NO and the Normally Closed NC contacts for the Energized versus De Energized settings Relay position De Energized Energized Normally Closed Normal
13. Stick up Pipe Sand Orange micaceous silty Grout Sand Brown micaceous silty Bentonite seal Closed Windy Hill Road MSWLF Henry County Georgia bee GRAPHIC SEE ETS Ma SE e RECOVERY PID 9 Sand Brwon micaceous silty 2444 440 aste a aot Sand Brown orange micaceous silfy with small amounts of quartz and white clay Slotted Screen with a Pea Gravel Filter Pack asse 4 asse 9 24 07 Report TTL WELL LOG Template TTLENV GDT POL asa A a atts BORING TERMINATED AT 25 FEET GAPROJECTS LANDE 4 HENRY 600706 1 SVESYS 1 BORING LOGS GPJ 9 24 07 WELL LOG Template TTLENV GDT GAPROJECTS LANDEI HENRY 600706 1 SVESYS 1 BORING LOGS GPJ LOG OF WELL B 7 CLOSED WINDY HILL ROAD MSWLF amp WELL ky A HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST T LOCATION McDonough Henry County Georgia DATE S DRILLED 5 31 2006 DRILLING COMPANY Watson Drillini CASING DIA TYPE 2 PVC DRILLER T Watson SCREEN SLOT TYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING 844 00 Ft AMSL REMARKS GROUND ELEVATION 834 00 Ft AMSL DEPTH TO WATER WATER ELEVATION WELL DIAGRAM LITHOLOGIC DESCRIPTION GRAPHIC LOG INTERVAL feet Yo RECOVERY Stick up Pipe Sand Orange m
14. FlatPak 775 h x 10 5 w x 1 5 d 2 analog inputs 0 5 VDC 4 20mA 10 bit resolution 4 alarm set Operating temperature 20 2 to 160 points per input Option board expands analogs to 6 2 pulse counter inputs optional rainfall or flowmeter or reading A All MISSION facilities secured and redundant 1 electronic key reader for site activity tracking SPONTE pe dA E la e Data center links real time with existing SCADA HMI software e 3 remotely controllable form C dry contact relay outputs l 1 12 VDC SPDT N O N C Wonderware Intellution etc that is OPC compliant e Supervised 1 2 amp power supply with battery backup included MISSION Website 8 vertical LEDs have two display modes diagnostic or signal strength Two websites full size screens and one for cell phones PDAs 8 digital input LEDs display alarm status and wiring faults Read only read write and control level access by password Includes Antenna Kit with mounting bracket and 11 of cable MISSION Web Software Omnidirectional outdoor antenna can be wall or pole mounted Very simple no programming upgrades included View key data from all units on one overview map screen MISSION Control Radio Units automatically self enroll no startup delays Radios make live Full graph and report options for your data which is held forever continuous encrypted socket connections with all da
15. Henry County Purchasing Department 140 Henry Parkway McDonough Georgia 30253 770 288 6027 770 288 6047 Fax August 10 2010 RE Sealed Bid SB 11 08 081910 1 Addendum No 1 This addendum is issued to change the original specifications as follows 5 6 Invitation to Bid et al The work to be bid consists of furnishing all materials labor tools equipment and services required to construct thirteen 13 methane monitoring wells and to convert one 1 existing observation well to a soil vapor extraction SVE well and connect it to the existing SVE system in Henry County Georgia Section 31 2 Revision dated 8 10 10 Attached Section 31 2 2 See Question Answer No 5 regarding the requirements for a Registered Land Surveyor Attachment Specifications for the fixed methane monitor with telemetry unit for methane monitoring well MM 6 Attachments D and methane monitor specifications Questions amp Answers 1 11 Attached Please include the changes in your bid proposal and return this form with your bid package All other terms and conditions of the original Invitation to Bid remain unchanged RECEIPT OF ADDENDUM NO 1 IS ACKNOWLEDGED AND IS MADE A PART OF THIS BID PROPOSAL By Company A n ei erii ibaa a COMMUNICATIONS Wireless Monitoring And Alarm System Simpler than an autodialer to use and with many SCADA features The co
16. arty arta att BORING TERMINATED AT 30 FEET a atte asa 42 atte GAPROJECTS LANDFI 1 MAENRYA600706 115VESYS 11BORI NG LOGS GPJ 8 GENERAL MONITORS Model 340005 Single Point Monitor The information and technical data disclosed in this document may be used and disseminated only for the purposes and to the extent specifically authorized in writing by General Monitors Instruction Manual 09 08 General Monitors reserves the right to change published specifications and designs without prior notice MANIR4000S Revision C 09 08 2 GENERAL MONITORS Model 1840005 This page intentionally left blank 2 GENERAL MONITORS Model 1840005 Table of Contents GQUICRK START GUIDE e kk 1 Bie em 2 Applying POWOE uidi Ended e er ce tu Ud Rad dale o bidon tip kak alee 4 1 0 INTRODUCTION c 5 1 1 Protection for Life Dio ee ER RIED M nice aer 5 1 2 Special Cautions and 5 1 3 Installation Operation and 5 2 0 PRODUCT DESCRIP TION cassis idend iue tp tk NEM kt n ke FR LN ED NIRE EDU aka 6 2 1 1840005 MORILOL
17. cras om d 5 nts of for use solely with a X x x P TIN Ee 0s 224 m s E E 2 ee EA XX respect to this Project and unless 4 otherwise provided MB shall be deemed a ge Cay 5 PM 7 au WM v 5 P tha author of these documents and shall 6 CHAINLINK e n e lle eset aod FENCE 58 868 8 959 T x x x X gt S E r E i i EE ene E lt 3 TM WINDY HILL ROAD had ald ki 8 507858 i m EEN ee LOCAL BENCHMARK ESTABLISHED BY ig ka SEILER amp ASSOCIATES INC i s S A CONTROL PT 21 PK NAIL IN B adu E 0 35 SLOPE 027 SLOPE 4 k j SIDEWALK ELEVATIUN 84575 a PIPE LINE H A mi x Ew SHEET TITLE 5 x COD E E oo 2 Wwe E P 2 Fs 6 CHAINLINK i 5 ou lt 7 ap sa 1 FENCE pg d ava a a Bal Ag Bigs B 259 gani Pop ali ti 501 VAPOR EXTRATION SYSFEMS amp B 1 5 s Ag wy BE ag 28 f8 98 L Y g che 7 Wo di 5 da D o S 29 3 ELEV 88076 N E g AMIESI im P 5 r SE be a hai a Fee 8 B 1 24
18. FF then this indicates a base unit fault or Maintenance Required with Detector Indicates the IR400 or IR2100 detector requires attention such as cleaning the windows ACTION Remove the splash guard and carefully clean the detector windows as described in the IR400 manual Recalibrate the IR400 following the procedure Calibrating the IR400 in Section 4 4 of this manual bF4 or F4 Signal Fault from Detector Indicates that the 1840005 did not detect mA input from the 18400 ACTION Check the wiring between the IR400 and 1840005 The 1840005 requires the current loop circuit is completed This means that the input current from the IR400 is connected to TB1 pin 1 and also the circuit is completed from TB2 pin 1 to ground In most installations the control room equipment is connected to 2 pin 1 to complete the circuit but if the 1840005 is used standalone then a load must be connected from TB2 pin 1 to TB1 pin 3 The load can simply be a suitable short piece of wire bF6 or F6 Input Voltage Low for 1840008 or Detector Indicates the 1840008 or IR400 voltage input is below 18 5 volts ACTION Check system wiring Adjust power supply if necessary 27 2 GENERAL MONITORS Model 1840005 bF7 or F7 Fault with 1840005 or IR400 Indicates the 1840008 or 18400 detector requires attention The bF7 and F7 faults indicate that there was a problem with the internal electronics Sometimes the IR4000 can correc
19. e 2 THIS SURVEY IS BASED ON THE 083 1994 HORIZONTAL DATUM amp NAVD 88 ie EAR Lagi 596 VERTICAL DATUM P d i A Mage ye al ee E ae a 5 d 4 CHAINLINK 4 CHAINLINK M A Em LINEAR AND ANGULAR MEASUREMENTS WERE OBTAINED USING A GEODIMETER 610 FENCE 28 220 ROBOTIC TOTAL STATION THE FIELDWORK WAS COMPLETED 7 06 07 ON THIS PROJECT FENCE a M 68 E 19 5 EE NE THIS SURVEY DEPICTS THE PIPE LINE LOCATION ALL OTHER INFORMATION TAKEN FROM a n I a x lt A PLAT BY SEILER amp ASSOC E NA J ELEV 852 98 Es T 50 HIGH I 5 1 25 TO VALVE NYLON NETTING RM 3 CLIENT NAME SVE 9 B 10 ELEV 851 94 ELEV 850 92 1 40 TO VALVE 0 75 TO VALVE is FENCE Li Fa V Le X X e X x 2 11 ELEV 852 39 se URN MED 420 5 bur 0 85 TO VAL 2 SAS dal 68668 4 ap Ho 9 TA NI 9 BAS 40 i 6v8 A 7 d i 7 PTS 3 7 0 000 FAS 801 2 IAS OL e Non 60 6 8 EE SE BAS dOL GAS HOU C NI 9 345 dO 5975678 SOIL VAPOR SYSTEM HENRY COUNTY BOARD OF COMMISSIONERS BAS Ni S ki l xr 450 HIGH ST 0 98 TO VALVE 4 CHAINLINK NYLON NETTING 4 CHAINUINK FENCE FENCE
20. 12 2007 DRILLING COMPANY Inc CASING DIA TYPE 4 PVC DRILLER Kenn SCREEN SLOT TYPE 0 020 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING REMARKS GROUND ELEVATION DEPTH TO WATER WATER ELEVATION SAMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION feet Closed Windy Hill Road MSWLF Henry County Georgia ACACACACACACACACAGAGAE E 76 RECOVERY INTERVAL lt Well Cover DEPTH feet GRAPHIC LOG Topsoil Sand Brown Orange Micaceous Silty 2 ft Riser with No Fill Grout PID ppm Bentonite Seal Sand Brown Micaceous Silty with Abundant Trash Debris Trash Layer PVC Riser with Pea Gravel Pack 0 020 in Slotted Screen with a Pea Gravel Filter Pack TT BORING TERMINATED AT 18 5 FEET G PROJECTS LANDFi 1 HENRY 600706 1 SVESYS 1 BORING LOGS GPJ ee LOG OF WELL SVE 7 CLOSED WINDY HILL ROAD MSWLF amp WELL Technology and HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST T Hall LOCATION McDonough Henry County Georgia DATE S DRILLED 3 12 2007 DRILLING COMPANY TIL Inc CASING DIA TYPE 4 PVC DRILLER Kenn SCREEN 51 0 020 in slotted 1 DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING REMARKS GROUND ELEVATION DEPTH TO WATER WATER ELEVATION SAMPLE WELL DIAGRAM LITHOLOGIC
21. C Humidity Range 5 to 100 RH non condensing 9 2 6 Modbus Interface The Model IR4000S does not have built in serial communications but can pass the Modbus signals from the attached detector to the control room It is not possible to communicate with the IR4000S directly For details on the Modbus registers refer to the IR400 Modbus programming manual or the user manual for the IR2100 available on General Monitors website 34 2 GENERAL MONITORS Model 1840005 9 3 Ordering Information 1840005 System Components IRA000S Model 1840005 Single Point Monitor MANIR4000S Model IR4000S Instruction Manual IR400 Model IR400 Combustible Gas Detector MANIR400 Model IR400 Combustible Gas Detector Manual IR4000S Spare Parts and Accessories To order spare parts and or accessories please contact your nearest General Monitors Representative or General Monitors directly with the following information 1 Number of Spare Part or Accessory 2 Description of Spare Part or Accessory 3 Quantity of Spare Part or Accessory Replacement Parts 32491 3 Control Board Electronics 32451 1 Output Board Electronics 32441 1 Display Board Electronics 32564 1 Enclosure Cover Assembly with Window 31195 2 Enclosure Base Assembly 30060 1 Calibration Magnet 925 5007 Cover Assembly O Ring Accessories 30051 1 Explosion Proof SPST Switch Recommended Spare Parts for One 1 Year 30060 1 Extra Calibration Magnet Qty 1 35
22. Combustible bas RFI EMI Protection Cable Requirements Faults Monitored RS 485 Output Baud Rate HART optional Wireless Communication Complies with EN55011 EN50270 Max distance between IR400 and power source 24 VDC nominal 20 Ohm loop resistance 14 AWG 2 0 mm 2606 ft 794 m Max distance for analog output 500 Ohms max 14 AWG 2 0 mm 9000 ft 2740 m Re calibration Error EPROM Checksum Error Optics Failure Blockage Low Supply Voltage EEPROM Checksum Error Reference or Active Lamp Failure Heater Failure Time to Re zero unit Short circuit on CAL 10 wire Modbus RTU suitable for linking up to 128 units or up to 247 units with repeaters 2400 4800 9600 or 19200 BPS HART 6 HART Device Description Language available AMSAware Available with ELPRO Technologies wireless devices Mechanical Specifications Diameter Length Weight Mounting Housing Standard Configuration 2 9 inches 74 mm 8 87 inches 225 mm 3 Ibs 1 35 kg aluminum 6 Ibs 2 7 kg stainless steel 3 4 NPT Marine aluminum or stainless steel 18400 0 01 1 2 0 1 0 Methane Modbus aluminum splashguard w screen no junction box Specifications subject to change without notice Represented by Publication DS IR400 A0209 General Monitors Worldwide www generalmonitors com Lake Forest CA 26776 Simpatica Circle Lake Forest California 92630
23. DESCRIPTION GRAPHIC Well Cover 2 ft Riser with No Fill Grout Closed Windy Hill Road MSWLF Hen Bentonite Seal PVC Riser with Sand Brown Micaceous Silty Saprolitic with Depth Pea Gravel Pack 9 gt Some Trash Debris Encountered 5 5 0 020 Slotted Screen with Pea Gravel Filter Pack 9 24 07 Report TTL WELL LOG Temp Highly Weathered Granite BORING TERMINATED AT 19 5 FEET GAPROJECTS LANDFI 1 HENRY 600706 1 SVESYS 1 BORING LOGS GPJ l i i TM G PROJECTS LANDEI 1 HENRY 800706 LOG OF WELL SVE 8 CLOSED WINDY HILL ROAD MSWLF amp WELL Technology and gg HENRY COUNTY GEORGIA CONSTRUCTION PROJECT NUMBER 600706189 GEOLOGIST T Hail LOCATION McDonough Henry County Georgia DATE S DRILLED 3 13 2007 DRILLING COMPANY TTL Inc CASING DIA TYPE 4 PVC DRILLER Kenn SCREEN SLOT TYPE 0 020 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING REMARKS GROUND ELEVATION DEPTH TO WATER WATER ELEVATION WELL DIAGRAM Nn gt 79 m LITHOLOGIC DESCRIPTION DEPTH feet GRAPHIC LOG Well Cover INTERVAL feet RECOVERY PID ppm Asphalt Sand Red Micaceous Silty 2 ft Riser with No Fill Windy Hill Road MSWLF Henry Count
24. Power to the 1840005 must remain OFF until all wiring is completed and the start up readiness checklist has been verified Wire installation order 1 Common COM and Field Ground FG wires 2 Modbus MOD Analog mA CAL and relay wires RLY ALARM WARN and FAULT 3 24 VDC power GENERAL MONITORS Model IR4000S TB1 Detector TB2 Ch Jonon AA N gt CON Gab oh Figure 2 IR4000S Terminal Block Connectors TB1 Detector Terminal TB2 HOST Terminal Pin SIGNAL Pin SIGNAL 1 4 20 mA IN 1 4 20 mA out 2 CAL IN 2 MOD 3 COM 3 MOD 4 FGND 4 NOT USED 5 MOD 5 NOT USED 6 MOD 6 CAL ARGC 7 COM 7 RLY RST 8 24 V 8 COM 9 24 V 9 24 V IN TB 3 Relay Terminal Pin DE ENERGIZED ENERGIZED 1 ALARM NC ALARM NO 2 ALARM C ALARM C 3 ALARM NO ALARM NC 4 WARN NC WARN NO 5 WARN C WARN C 6 WARN NO WARN NC 7 FAULT NC FAULT NO 8 FAULT C FAULT C 9 FAULT NO FAULT NC 2 GENERAL MONITORS Model IR4000S Applying Power Before applying power for the first time check the following e Verify that the junction box lid is securely installed unless the area has been declassified e Inhibit any external devices such as Trip Amplifiers PLC devices or DCS systems e Verify that
25. V 24 absolute max V 36 Max Wattage at 24 VDC W 2 0 Max Current at 24 VDC mA 83 Display Accuracy 96 1 32 GENERAL MONITORS Model 1840005 Relay Ratings m XX 250 VDC 8A 30V Analog Input Input Range mA 0 21 7 Load 500 Ohms max Series resistance Ohms 91 1 Display Response For milliampere input from 4 mA through 20 mA Display 100 x mA input 4 16 Status Indicators Warn and Alarm indicators and Fault codes EIA 485 Output Modbus RTU signals are passed through the 1840005 from the attached detector unchanged Cable Length Requirements 3 wire shielded cable Maximum distance between the IR4000S and power source 24 VDC nominal 20 Ohm loop AWG Ohms 1K FEET METERS 12 1 588 4143 1263 14 2 525 2606 794 16 4 016 1638 499 18 6 385 1030 314 20 10 15 648 198 Table 3 24VDC Cable Lengths Table 4 Analog Output Cable Lengths RFI EMI Protection Complies with EN50270 NOTE European Union EU Approved Applications Power Supply noise and ripple voltage 1 0 Vpp max The customer supplied Power Supply must comply with IEC 61010 1 limiting current to 8 A under Fault conditions in order to comply with CE Marking requirements 33 2 GENERAL MONITORS Model 1840008 9 2 5 Environmental Specifications Temperature Range De Operating 40 F to 167 F 40 to 75 Storage 58 F to 185 F 50 C to 85
26. and Warnings This instruction manual includes numerous cautions and warnings that are included to prevent injury to personnel and prevent damage to equipment WARNING TOXIC COMBUSTIBLE AND FLAMMABLE GASES AND A VAPORS ARE VERY DANGEROUS USE EXTREME CAUTION WHEN THESE HAZARDS ARE PRESENT 1 3 Installation Operation and Maintenance Before power up verify wiring terminal connections and stability of mounting for all integral safety equipment Proper system operation should be verified by performing a full functional test of all component devices of the safety system ensuring that the proper levels of alarming occur Fault malfunction circuit operation should be verified Periodic testing calibrating should be performed per the manufacturer s recommendations and instructions When testing produces results outside of the manufacturer s specifications re calibration or repair replacement of the suspect device s should be performed as necessary Calibration check and calibration intervals should be independently established through a documented procedure including a calibration log maintained by plant personnel or third party testing services 2 GENERAL MONITORS 2 0 Product Description SINGLE POINT MONITOR COMBUSTIBLE GAS MODEL IR4000S P N32563 16 GENERAL MONITORS e Exd He T5 Tamb 40 75 LAKE FOREST CALIFORMA i Ex1D A21 1 66 7100 SIRA OBATEX 1095 uds 581 o 1 2 GROUPS
27. battery included 12 VDC Aux Transducer power out Radio Status LED z Should blink A IOS slowly when Outdoor NEMA 4X enclosure Transducer online Top and front sun shield 13 75 h x 13 25 w x 6 25 d with sun shield Transducer Output Status LEDs OR Buzzer Sounder output To analog output from PLC Default Assignments Antenna Connection Runtime Panel O Inputs default to normally open Runtime anes enclosure Use dry contacts only AIR Other Alarm Output relays Keyreader 11 25 h x 11 375 w x 3 5 d inpu Typically used in conjunction with low Use indoors wall mounting NO common wire used on loop Pump 2 3 Phase Runtime Trouble voltage interposing or or relays to remotely turn Alarm Other Alarm pumps on and off Pump 3 Pump 2 a Runtime Trouble or or Alarm Other Alarm High Wet Pump 1 Weil Level Mara Flatpak enclosure Other Alarm Other Alarm Pole 7 75 h x 10 5 w x 1 5 d 2 Wall Mount Use inside MCC cabinet Technical Specifications Hardware Physical 8 supervised digital inputs 3 changeable to runtime starts accumulators 110 NEMAT enclosure 11 25 h x 11 375 w x 3 5 4 additional built in alarms AC low battery and communications fail e M 112 NEMA 4X enclosure with sun shield 13 75 h x 13 25 w x 6 25 d input wiring fault Optionally expand to 16 digital inputs M 113 1
28. cycle 20 2 GENERAL MONITORS Model IR4000S 4 4 Calibrating the 18400 You can calibrate the IR400 which is connected to the 1840005 unit in order to make sure the LEL measurements are accurate During calibration the IR400 analog output is 1 5 mA in order to disable the Alarm and Warn relays Equipment required Calibration cup tubing calibration gas tank with regulator To Calibrate the IR400 Detector 1 The 18400 must be in a gas condition initially it will be zeroed as part of calibration Open the main menu Place the magnet on the 1840005 GM logo to move from normal operation to the main menu options Select Automatic Calibration Once AC appears remove the magnet AC will flash and zeroing will start When zeroing is complete OC will show on the display to confirm zero complete then the display will change to AC HL Apply gas to the detector Apply a 5096 LEL gas using a Gas Check Kit with portable purge calibrator equipment The display will show a steady Calibration in Progress If the gas drops below 20 LEL the display will revert to a flashing CP N In about one to two minutes depending on gas flow the IR400 will complete calibrating and display CC Calibration Complete Remove the gas You will continue to see CC until the gas gets below 5 of full scale The unit will then return to normal operation If the calibration does not proceed normall
29. the setting To finish and advance to the next option apply the magnet when Fi Finish appears 5 Return to normal operation When Lo and Hi settings are completed the 1840008 will display Lo Hi and Fi To return to normal operation apply and remove the magnet when Fi finish appears 4 6 Resetting the Relays rSt NOTE If the unit was ordered without relays changing the relay settings will still affect the operation of the high and low LEDs on the display The rSt main menu option is provided to reset Warn and Alarm relays if these relays are configured as latching they must be manually reset after an Alarm occurs The default setting for the IR4000S Warn relay is non latching and the default setting for the Alarm relay is latching NOTE Red indicators above and below the digital display are on when the Alarm and Warn relays are active Latching relays can only be reset if the gas concentration has fallen below the respective relay setpoint To Reset the Relays 1 Open the main menu Place the magnet on the 1840005 GM logo to move from the run display to the main menu options 2 Select the rSt option After a few seconds the rSt main menu option appears Remove the magnet to select this option POE The message r appears briefly to confirm that the relays are being cleared Then the unit returns to the default normal operation 23 GENERAL MONITORS Model IR4000S Alternate Methods for Resetting the Re
30. to monitor continuously for hydrocarbon gas leaks they do not have power switches to prevent accidental system shutdown 1 Verify that all the signal wiring except for 24 is installed correctly From each IR400 to a directly attached junction box FMD or 1840005 e Between IR400 junction boxes FMDs IR4000S s and control room devices e From each 1840005 or FMD to Alarm relays optional 2 If the analog 4 20 mA output is not used then the IR400 white signal wire must be connected to ground to prevent a fault condition F4 3 Make sure that the 1840008 and or junction box lids are securely installed unless the area has been declassified 4 Make sure to inhibit any external devices such as Trip Amplifiers PLC devices or DCS systems until after the start up sequence is completed 5 Once you are ready to begin the start up verify that the power supply is connected properly 1840005 and IR400 are powered by 24 VDC 20 to 36 voltage range The 18400 optional LED will output a low voltage fault at 18 5 VDC or below 15 2 GENERAL MONITORS Model 1840005 3 4 2 Start up Process for 1840005 System NOTE Powering on and off of the IR4000S and IR400 units is controlled from the external power supply refer to the power supply manual for instructions If you have any problems in the start up or testing of the detector system please refer to Section 6 0 Troubleshooting or conta
31. workmanship or material under normal use and service within two 2 years from the date of shipment General Monitors will repair or replace without charge any such defective equipment found to be defective during the warranty period Full determination of the nature of and responsibility for defective equipment will be made by General Monitors personnel Defective or damaged equipment must be shipped prepaid to General Monitors plant or representative from which shipment was made In all cases this warranty is limited to the cost of the equipment supplied by General Monitors The customer will assume all liability for the misuse of this equipment by its employees or other personnel NOTE The Model 1840005 Single Point Monitor is easy to install however you should read and understand this manual before attempting to install or operate the device It includes important safety information All warranties are contingent upon proper use in the application for which the product was intended and do not cover products which have been modified or repaired without General Monitors approval or which have been subjected to neglect accident improper installation or application or on which the original identification marks have been removed or altered Except for the express warranty stated above General Monitors disclaims all warranties with regard to the products sold including all implied warranties of merchantability and fitness and the ex
32. 1 GRAPHIC 106 Sand Brown Black micaceous silty Grout Bentonite Seal Closed Windy Hill Road MSWLE Henry County Georgia a atte atte Sand Orange micaceous silty late TTLENV GDT arty aste aste Slotted Screen with a Pea Gravel Filter Pack Sand Tan micaceous silty slightly moist 9 24 07 Report TTL WELL LOG Temp A e t e at a at Ma arty a art arte Sand Brown micaceous silty wet BORING TERMINATED AT 30 FEET RECOVERY PID ppm 2 27 7424 5 1 1 amp 600706 4 5 5 5 1 LOGS GPJ LOG OF WELL B 12 CLOSED WINDY HILL ROAD MSWLF amp WELL Technology and 4 HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST LOCATION McDonough Henry County Georgia DATE S DRILLED 6 1 2006 DRILLING COMPANY Watson CASING DIA TYPE 2 PVC DRILLER T Watson SCREEN SLOT TYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING 864 40 Ft AMSL REMARKS GROUND ELEVATION 854 40 Ft AMSL DEPTH TO WATER WATER ELEVATION WELL DIAGRAM LITHOLOGIC DESCRIPTION t Stick up Pipe 4 GRAPHIC LOG INTERVAL feet Sand Orange micaceous silty Grout Bentonite seal MISERE 5 A asta at Ta
33. 23 5 FEET LOG OF WELL 7 7 Z B 3 CLOSED WINDY HILL ROAD MSWLF 8 WELL pce HENRY COUNTY GEORGIA CONSTRUCTION PROJECT NUMBER 600706189 GEOLOGIST T Hall i 1 LOCATION McDonough Henry County Georgia DATE S DRILLED 5 31 2006 DRILLING COMPANY Watson Drillin CASING 2 PVC DRILLER T Watson SCREEN SLOT TYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING 868 80 Ft AMSL REMARKS GROUND ELEVATION 858 80 Ft AMSL DEPTH TO WATER WATER ELEVATION SAMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION GRAPHIC LOG feet Yo RECOVERY PID ppm a S947 ee Be ae uev Saetta att INTERVAL Stick up Pipe Sand Orange brown micaceous silty Grout Bentonite seal Closed Windy Hill Road MSWLF Henry County Georgia atta atta Se BE at 94 her 4 EO a SEU aste arte aste n OF gt 2 Li S E arte atts A art Slotted Screen with a Pea Gravel Filter Pack arts et Sand Tan brown micaceous silty 9 24 07 Repart TTL WELL LOG Tem BORING TERMINATED AT 20 FEET GAPROJECTSILANDFI 1HENRY1800706 118VESYS 11BORING LOGS GPJ 77 LOG OF WELL 2 B 4 CLOSED WINDY HILL ROAD MSWLF amp WELL HENRY COUNTY GEORGIA CONSTRUCTION PROJECT NUMBER 600706189 GEOLOGIST T Hall DRILLING COMPANY Watson Drillin C
34. AMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION Stick up Pipe o d z 9 ZF Z Sand Orange micaceous silty Grout Bentonite seal et a at USE a a e e RA Sand Brown micaceous silty 4 Sand Tan micaceous silty with quartz aste atte arte Slotted Screen with a Pea Gravel Filter Pack arty Li at a Cha arte arty 3 24 07 Report TTL WELL LOG Template Sand Brown micaceous silty a a oor atte at Ta atte atte Sand Mottled brown orange white micaceous quartz silty art a BORING TERMINATED AT 25 GAPROJECTSILANDFI 11HENRY41600706 115 VESYS 11BORING LOGS GPJ LOG OF WELL 6 CLOSED WINDY HILL ROAD MSWLF amp WELL Hei HENRY COUNTY GEORGIA CONSTRUCTION PROJECT NUMBER 600706189 GEOLOGIST T Hail j LOCATION McDonough Henry County Georgia DATE S DRILLED 5 31 2006 DRILLING COMPANY Watson Drillin CASING DIAJTYPE 2 PVC DRILLER T Watson SCREEN SLOT TYPE 0 010 slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING 864 60 Ft AMSL REMARKS GROUND ELEVATION 854 60 Ft AMSL DEPTH TO WATER WATER ELEVATION WELL DIAGRAM LITHOLOGIC DESCRIPTION feet INTERVAL 4
35. ASING DIAJTYPE _2 PVC DRILLER T Watson SCREEN SLOT TYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK Pea Gravel eee TOP OF CASING 869 30 Ft AMSL REMARKS GROUND ELEVATION 859 30 Ft AMSL DEPTH TO WATER WATER ELEVATION SAMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION LOCATION McDonough Henry County Georgia DATE S DRILLED 5 31 2006 feet INTERVAL 4 Stick up Pipe Sand Orange micaceous silty Grout Bentonite seal Closed Windy Hili Road MSWLF Henry County Georgi Sand Brown micaceous silty INO 9 24 07 Report WELL LOG Tempiate TTLENV GDT Slotted Screen enam Pee ee ed with a Pea Gravel i Filter Pack Sand Brown micaceous silty BORING TERMINATED AT 20 ZIN PID ppm GAPROJECTSILANDFI THHENRY 6007061 ASVESYS 11BORING LOGS GPJ LOG OF WELL B 5 CLOSED WINDY HILL ROAD MSWLF amp WELL Technology and HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST T Hall LOCATION McDonough Henry County Georgia DATE S DRILLED 5 31 2006 DRILLING COMPANY Watson Drillin CASING DIAJTYPE 2 PVC DRILLER T Watson SCREEN SLOT TYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel LLL OF CASING 870 40 Ft AMSL REMARKS GROUND ELEVATION 860 40 Ft AMSL DEPTH TO WATER WATER ELEVATION S
36. CT Ni 5 WHEN HC IS DISPLAYED lager WHILE ZEROING ALIBRATJON PROCEDURE 1 WHEN C STOPS FLASHING APPLY MAGNET TO START GAS CREIBRATION IF DESIRED 2 APPLY GAS DISPLAY CHANGES TO CP REMOVE GAS WHEN CC IS DISPLAYED SIN Warning Indicator CONFIG 6 1 Figure 11 Front Panel Display and Indicators The IR4000S menus allow you to complete many operational tasks for the IR400 e Reset Alarm and Warn relays e Zero calibrate or initiate a gas check e Select Alarm and Warn relay settings NOTE If you begin navigating within the 1840005 menus then leave the device idle without returning to normal operation a timeout will occur after 15 minutes and the 1840005 will display a fault code F8 Reapplying the magnet to the GM logo will clear the F8 fault 18 GENERAL MONITORS Model 1840008 LEL RM HM 94 relay setpoint Gs relay setpoint 9 9 RG T L e 1840000 MENU LEGEND HM STATIC MENU OPTION HOLD MAGNET TIMEOUT 0 9 OS 28 RM RG REMOVE MAGNET pe GAS REMOVED M AG FLASHING MENU OPTION gt APPLY MAGNET WAITING FOR GAS Figure 12 IRA000S Menu Structure 19 2 GENERAL MONITORS Model 1840005 4 2 Gas Checking the 18400 You can gas an IR400 unit to verify response without tripping relays During gas check mode the Alarm and Warn relays are disa
37. ELL B 9 CLOSED WINDY HILL ROAD MSWLF amp WELL Technology and HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST T Halt LOCATION McDonough Henry County Georgia DATE S DRILLED 6 1 2006 DRILLING COMPANY Watson Drillin CASING DIAJTYPE 2 DRILLER T Watson SCREEN SLOT TYPE 0 010 in siotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel OF CASING 859 50 Ft AMSL REMARKS GROUND ELEVATION 849 50 Ft AMSL DEPTH TO WATER WATER ELEVATION SAMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION INTERVAL feet Sand Red orange micaceous silty c GRAPHIC mus 10 a Ma Jean NENE MM NN NENNEN QUE gt RECOVERY Grout Bentonite Seal A 1 Closed Windy Hill Road MSWLF Henry County Georg a Sand Brown micaceous silty Sand Tan micaceous silty Slotted Screen with a Pea Gravel Filter Pack at ME asi BORING TERMINATED 25 PID ppm LOG OF WELL B 10 CLOSED WINDY HILL ROAD MSWLF amp WELL no GP HENRY COUNTY GEORGIA CONSTRUCTION A PROJECT NUMBER 600706189 GEOLOGIST T Hall LOCATION McDonough Henry County Georgia DATE S DRILLED 6 1 2006 j DRILLING COMPANY Watson Drillin CASING 2 PVC DRILLER T Watson SCREEN SLOT TYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin
38. FILTER PACK TYPE Pea Gravel TOP OF CASING 860 60 Ft AMSL REMARKS GROUND ELEVATION 850 60 Ft AMSL DEPTH TO WATER WATER ELEVATION SAMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION County Georaia feet INTERVAL feet RECOVERY PID ppm a 94 Stick up Pipe Sand Brown micaceous silty Grout Bentonite Seal EE A bi am at Ta ae T Sa Sand Red micaceous clayey lt att atte a aot 2 7 9 2407 Report WELL LOG Template at a aa aeta Sand Brown micaceous silty Slotted Screen with a Pea Gravel Filter Pack 227474 atte atte BORING TERMINATED AT 25 FEET 1 1 ES GAPROJECTS LANDFI 4 HENRY 600706 1 SVESYS 1 BORING LOGS GPJ LOG OF WELL B 11 CLOSED WINDY HILL ROAD MSWLF amp WELL Technology and a HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST T Hall LOCATION McDonough Henry County Georgia DATE S DRILLED 5 31 2006 DRILLING COMPANY Watson Drillin CASING DIA TYPE 2 DRILLER T Watson SCREEN SLOT TYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING 862 30 Ft AMSL REMARKS GROUND ELEVATION 852 30 Ft AMSL DEPTH TO WATER WATER ELEVATION WELL DIAGRAM LITHOLOGIC DESCRIPTION feet INTERVAL 4 Stick up Pipe
39. NC Contact with PCB components should be avoided to prevent damage by static electricity All wire connections are made to the terminal blocks NOTE It is recommended that you use three wire shielded cable to make power and signal connections to the Model 1840005 The push terminal blocks accept 14 AWG to 20 AWG stranded or solid wire The screw terminal blocks accept 12 AWG to 18 AWG You must strip each wire before wiring the 1840005 Remove 3 8 to 1 2 inch 10 to 12 mm of insulation To Attach Wiring to an 1840005 Terminal Block 1 Remove the 1840008 enclosure cover by loosening the four captive screws and lifting the cover straight up 2 For push terminals insert a screwdriver into the orange tab and press down opening the terminal For screw terminals turn the screw counterclockwise to open 3 Insert the stripped wire into the terminal For push terminals release the orange tab to clamp the wire in the terminal For screw terminals turn the screw clockwise to clamp the wire GENTLY tug on the wire to make sure it is locked securely in place EE ermina 3lock Operation Figure 7 Push Type Terminal 12 2 GENERAL MONITORS Model 1840005 Figure 8 Screw Type Terminal 4 Connectthe wires in the following order e COM and Field Ground FG wires e Modbus MOD Analog mA CAL and relay wires RLY ALARM WARN and FAULT 24 VDC power NOTE If the 4 20 mA Out TB 2
40. POINT OF BEGINNING i a m EL CATCH BASIN CALC CALCULATED DISTANCE P O C POINT OF COMENCEMENT 8 uk N M a BOX BOX CE WATER METER MEASURED END OF FO MS e d PROPERTY LINE CD BELLSOUTH MANHOLE MTS NOT TO SCALE 2 049 bass 1 f m PARKING METER CENTERLINE CURB INLET Z water easement lt lt DRIVEWAY EASEMENT I 5 ASPHALT CONCRETE a 7 i of GAS GAS LINE m _ lt SS SANITARY SEWER LINE 38 3 E OVERHEAD ELECTRIC ENS CN MP Oz TELEPHONE DIRAN EE EN LM j 6 CHAINLINK FENCE LINE 5 Ec ee W WATER LINE 6 GHAINLINK RN AA OG NEUEN RIDE FENCE EP i Box SVE 10 ge NT ES x ELEV 851 58 SURVEY NOTES ee ii UTILITIES SHOWN ARE LOCATIONS OF GROUND IDENTIFIABLE ITEMS ADDITIONAL UTILITIES m an NIS a 2 8 MAY EXIST ABOVE OR BELOW GROUND THE SURVEYOR ACCEPTS NO RESPONSIBILITY E FOR THE COMPLETENESS OF THIS DATA M 5 NTY GIS a Seo 6 CHAINLINK ee A TAMEO MW T xe THE SOURCE OF THE VERTICAL DATUM IS HENRY x um K r FENCE LA ie B n CHAINGINE S dere 7 E
41. T EZ PERRA INCL e aste aste APA atta 2 arte a atte a av WELL DIAGRAM K sa d DULL arts s 4 a e t a atte ote aot a a a Well Cover Bentonite Seal Slotted Screen with a Pea Gravel Filter Pack 9 24 07 Report TTL WELL LOG Tem plate TTLENV GDT GAPROJECTSILANDEI HENRY 600706 S VESYS TIBORING LOGS GPJ Technology and Tradition PROJECT NUMBER LOCATION DRILLING COMPANY DRILLER DRILLING METHOD REMARKS GRAPHIC LOG INTERVAL 600706189 cDonough Henry County Georgia Watson Drillin T Watson H ollow Stem Auger w SPT Samplin SAMPLE RECOVERY LOG OF WELL B 2 CLOSED WINDY HILL ROAD MSWLF amp WELL HENRY COUNTY GEORGIA CONSTRUCTION GEOLOGIST T Hall DATE S DRILLED 5 30 2006 CASING DIAJTYPE 2 PVC SCREEN SLOT TYPE 0 010 slotted PVC FILTER PACK TYPE Pea Gravel TOP OF CASING 871 30 Ft AMSL GROUND ELEVATION 861 30 Ft AMSL DEPTH TO WATER WATER ELEVATION WELL DIAGRAM LITHOLOGIC DESCRIPTION Stick up Pipe Sand Orange micaceous silty Grout Bentonite seal Sand Red brown micaceous silty Slotted Screen with a Pea Gravel Filter Pack Sand Mottled red brown white micaceous quartz silty atta art BORING TERMINATED
42. TB1 13 Figure 9 Relay Protection for DC and AC 14 Figure 10 Front Panel Display and 18 Figure 11 IR4000S Menu 19 Table of Tables Table 1 IR400 IR4000S Installation Overview esses 7 Table 2 TB3 Relay Contacts Energized De Energized 14 Table 3 24V DGC Cable Lengths a is tee ad e a pk a a ki ki kaa n e n 33 Table 4 Analog Output Cable 8 33 GENERAL MONITORS Model 1840005 Quick Start Guide Special tools e 5mm Allen wrench for cover included with unit e 0 1 flat head screwdriver for wiring included with unit e Adjustable wrench for conduit or cable gland connections not included Mounting Allow convenient access to the front panel display and magnet switch input Leave sufficient room to attach cabling Keep cable run distances below specified limits Although the Model IR4000S is RFl resistant where possible mount it away from heavy power cabling radio transmitters or similar equipment Where possible locate the IR4000S away from excessive heat and vibration and as free as possible from wind dust water and direct sunli
43. TO VALVE jp vg ou 4 2 d 1 1 PsP fi P 8 d 1 20 TO VALVE ASSETS 5 f 0 7 55119505 47 ES AE ti ki za j a 3 8 8 2 gt TER g B 4 ELEV 859 00 B 2 1 30 TO VALVE ELEV 861 07 1 44 TO VALVE 01 LE TIVA 198 VOC SHEET 1 0 i Projects i79 001 Workfiles Windy Hill Stakeout dwg Layout rowenby Sep 14 2007 9 05 08am A 10 E Moore Bass Consulting OF WELL B 1A CLOSED WINDY HILL ROAD MSWLF amp WELL P HENRY COUNTY GEORGIA CONSTRUCTION LOCATION McDonough Henry County Georgia DATE S DRILLED 5 30 2006 DRILLING COMPANY Watson Drillin CASING DIA JTYPE 2 PVC DRILLER T Watson SCREEN SLOT TYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea gravel TOP OF CASING 872 20 Ft AMSL REMARKS GROUND ELEVATION 862 20 Ft AMSL DEPTH TO WATER WATER ELEVATION WELL DIAGRAM LITHOLOGIC DESCRIPTION DEPTH feet Stick up Pipe INTERVAL feet RECOVERY Sand Red tan micaceous silty WN GRAPHIC LOG a PROJECT NUMBER 600706189 GEOLOGIST T Hall Grout 2 Bentonite seal Closed Windy Hill Road MSWLF Henry County Georg Slotted Screen 1 8 with a Pea Gravel BealBcu e e Filter Pack pot 98 14 15 Sand Brown tan micaceo
44. XIDAZTIPSET100 C SIRAOBATEX1095 A m uus GLASS DV 2 GROUPS B a CLASS l ZONE 1 GROUP IB H 68 TYPEX WITH REMOTE DETECTOR RATED n voc 7 28 MAX CONTACT RATINGS SEE MANUAL CAUTION open wien aN ExPLOSVE ATMOSPHERE 1S PRESENT DO NOT OPEN WHILE WARN LED ENERGIZEO READ AND UNDERSTAND INSTRUCTION J T TG OR SERVICING COMBUSTIBLE GAS DETECTION INSTRUMENT CERTIFIED CSA Standard C22 2 NO 152 ISE CABLE WITH INSULATION RATED TO AT LEAST 0 C conne 4 vean ceconemucron MAN j L D Figure 5 1840005 Outline and Mounting Dimensions in inches mm Applying Sealants to Conduit Entries Please keep the following warnings and cautions in mind when you install the 1840008 to make sure that the equipment maintains the appropriate seals for a Class hazardous location WARNING Each conduit run from an IR400 junction box IR4000S housing within a hazardous location and from a hazardous to a non hazardous location must be sealed so that gases vapors and or flames cannot pass beyond the seal The purpose of seals in a Class hazardous location is to prevent the passage of gases vapors or flames from one electrical installation to another through the conduit system For information on Class location seals see Articles 501 5 and 500 3d WARNING Unused cable entry holes must be sealed with approved explosion proof stopping plugs Red caps supplied by Gene
45. bled CAUTION The analog output from the 1840008 is directly connected to the 18400 being used and this analog output will indicate gas present when the 1840008 is in Gas Check Mode Make sure that any equipment monitoring the analog output is in alarm bypass mode before performing a gas check To Gas Check the 18400 Unit 421 Open the main menu Place the magnet on the 1840005 GM logo to access the main menu options 422 Select Gas Check Once the Gas Check option appears remove the magnet The 96 LEL display will flash Apply gas After gas is removed the IR40008 will return to normal operation and display 9e LEL 4 3 Zeroing the 18400 You can zero the IR400 detector in order to eliminate any background gas fluctuations using the ZrO option During zeroing mode the analog output for the IR400 is kept at 1 5 mA and the Alarm and Warn relays are disabled To Zero the IR400 Unit 1 Open the main menu Place the magnet on the 1840008 GM logo to access the main menu options 2 Select zeroing Once the ZrO option appears remove the magnet AC Automatic Calibration will flash for 20 seconds When zeroing is complete the display shows zero complete by displaying OC for 10 seconds The 1840005 will then return to normal operation and display LEL NOTE Reapplying the magnet during the ZrO option will return the unit to normal operation Reapplying the magnet while OC is displayed will start the calibration
46. cilities Maintenance Department at 770 288 6516 upon award of this contract to establish a schedule for the installation of the power to operate the units Also on page 15 of the bid document it states that the County will stake the well locations in the field Who is responsible for the as built survey and map a Please see the response for question 5 Will specifications for the Fixed Combustible Gas Monitor with Telemetry be provided to the bidders a Yes please see the response for question 7 FLARE FUEL BLOWER TANK SKID 9576 d 8 231 Sg z 8 NE ATLANTA A E 6678586 5 958 121 M 3 784 SLOPE 998 I LEGEND av oP bra POWER POLE R W RIGHT OF WAY LIGHT POLE CMP CORRUGATED METAL PIPE CONCRETE R W MONUMENT COMPUTED POINT B 9 ELEV 850 05 3 35 TO VALVE os sra Qvd NOD MS 2 CURB INLET B GEORGIA POWER MANHOLE N F OR FORMERLY 2 zi E Os xx e 170 TO VALVE B E S SEWER MANHOLE REINFORCED CONCRETE PIPE RON PIN FOUND 8 D BOX OPEN TOP PIRE A GAS METER v E j 2 WATER VALVE TOP PIPE na DE i DROP INLET RB RE BAR FOUND gt 9 E TEE MS 3 FRE HYDRANT RECORDED DISTANCE
47. ct General Monitors Technical Support The Model IR400 should be allowed to stabilize for approximately 60 minutes while each detector attains the proper operating temperature 1840005 display sequence on power up 1 000 and Alarm indicator on for 1 second 2 All display elements 8 8 8 and both Alarm and Warn indicators on for 2 seconds 3 Software revision on for 2 seconds example r A 4 bSU base Start Up for 12 seconds 5 SU IR400 Start Up for 1 minute 45 seconds 6 Gas concentration in Yo LEL If a fault code is displayed after power up please refer to Section 6 0 Troubleshooting 3 4 3 1840005 Start up Operation and Configuration Tasks In order to make sure that the IR400 detector and 1840005 menu functions are working correctly you should perform several tasks immediately after the system is powered on This section points you to detailed instructions for completing several start up operation and configuration tasks using the 1840008 menu system 1 Zero each connected IR400 Zeroing eliminates any background gas fluctuations e For instructions see Zeroing the 400 in Section 4 3 2 Perform a gas check test for each connected IR400 Verify that the IR400 is measuring a known 96 LEL correctly by placing it in Gas Check Mode using the 1840008 menu options e You will need to use the GM Gas Check Kit P N 31468 to complete this task e For instructions see Gas Checking the IR400 in Section 4 2 16
48. ctors TB1 TB2 and TB3 which hold the wiring that connects the IR4000S to the 18400 Detector local alarms Relay and control room equipment HOST You must remove the cover from the IR4000S enclosure to access these connectors The inside of the cover includes a label that lists the function of each connector location WARNING For safety ground cabling must always be connected first before other cabling is connected The 24 VDC power cabling should be connected last and disconnected first Power supply connections to the 1840008 must remain OFF until all wiring is completed and the start up readiness checklist has been verified Refer to the manual for the power supply being used for instructions gt Figure 6 IR4000S Terminal Block Connectors 11 2 GENERAL MONITORS Model IR4000S TB1 Detector Terminal Pin 1 I COO TO gt SIGNAL 4 20mA IN CAL IN COM FRAME GND MOD MOD COM 24V 24V CAUTION TB2 Host Terminal Pin SIGNAL 4 20mA out MOD MOD NOT USED NOT USED CAL ARGC RLY RST COM 24V IN Pin 1 DE ENERGIZED ALARM NC ALARM C ALARM NO WARN NC WARN C WARN NO FAULT NC FAULT C FAULT NO ENERGIZED ALARM NO ALARM C ALARM NC WARN NO WARN C WARN NC FAULT NO FAULT C FAULT
49. d also white clay Slightly moist at feet BGS 15 feet BGS Slotted Screen with a Pea Gravel Filter Pack 9 24 07 WELL LOG Template ITLENV GDT PID ppm BORING TERMINATED AT 20 FEET i i GAPROJECTSILANDEI HENRY 600706 S VESYS TBORING LOGS GPJ 9 24 07 ReportiTTIL WELL LOG Templale TTLENV GDT GAPROJECTSXLANDFI 1 HENRY 600706 1 SVESYS 1 BORING LOGS GPJ Closed Windy Hill Road MSWLF Henry County Georgia Technology and Tradition PROJECT NUMBER LOCATION 600706189 LOG OF WELL SVE 3 CLOSED WINDY HILL ROAD MSWLF amp WELL HENRY COUNTY GEORGIA CONSTRUCTION GEOLOGIST T Hall McDonough Henry County Georgia DATE S DRILLED 8 8 2006 DRILLING COMPANY Betts Environmental DRILLER DRILLING METHOD REMARKS GRAPHIC INTERVAL feet C Pendarvis CASING DIAJTYPE 4 PVC SCREEN SLOT TYPE 0 010 slotted PVC Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel SAMPLE RECOVERY TOP OF CASING 854 25 Ft AMSL GROUND ELEVATION 852 25 Ft AMSL DEPTH TO WATER WATER ELEVATION WELL DIAGRAM LITHOLOGIC DESCRIPTION 4 Stick up Pipe Sand Dark brown micaceous silty Sand Orange m caceous silty Bentonite Seal Sand Tan micaceous silty with coarse quartz grains and lenses of white clay Slotted Screen with a Pea Gravel Filter Pack Sand Brown orange m
50. ecify the equipment part number and the serial number Both on the cover of the 1840008 2 GENERAL MONITORS Model 1840005 3 2 Mounting Allow convenient access to the monitor in order to input local configurations and calibrate via the magnetic switch on the cover Leave sufficient room to attach cabling Keep cable run distances below specified limits Although the Model 1840008 is RFl resistant where possible mount it away from heavy power cabling radio transmitters or similar equipment Locate the IR4000S away from concentrated sources of heat or light It should be mounted in areas that are free from excessive vibration and as free as possible from wind dust water and direct sunlight i C MULTI POINT MONITOR COMBUSTIBLE GAS MODEL IR4000M Pin 32580 wo aaa CON pwenn CLASS DIV 1 2 GROUPS B a CLASS LERAP G NE SSW Y gen por p COMBUSTIBLE GAS DI CSA St TION INSTRUMENT G22 2NO 152 ece 1 Figure 4 1840005 with IR400 Mounting Dimensions in inches mm GENERAL MONITORS J S MULTI POINT MONITOR COMBUSTIBLE GAS MODEL IR4000M P N32580 C GENERAL MONITORS Exd IIB H2 T5 Tamb 40 C to 75 C C eN LUKE FOREST CAFORNA O E
51. ght A MULTI POINT MONITOR COMBUSTIBLE GAS O MODEL IR4000M P N 32580 1 NEI amp Exd IIB Hz 5 Tamb 40 C to 75 C EUDAZIIPSSTIOC SIRA OBATEKIOSS A ca CLASS DIV 1 2 GROUPS B C amp D a CLASS ZONE 1 GROUP IB e TYPE 4X WITH REMOTE DETECTOR Ta 40 C TO 15 C lt a gt RATED 24 VDC 2W MAX CONTACT RATINGS SEE MANUAL COMBUSTIBLE GAS DETECTION INSTRUMENT CERTIFIED CSA Standard C22 2 NO 152 USE CABLE WITH INSULATION RATED TO ATLEAST 90 C Figure 1 1840005 Outline and Mounting Dimensions in inches mm 2 GENERAL MONITORS Model IR4000S gt gt Cabling and Wiring WARNING Seal conduit entries per Class hazardous location requirements Under NO circumstances should equipment be connected or disconnected when under power Equipment damaged in this manner is not covered under warranty CAUTION Do not use a sealant that contains acetic acid Use precautions to avoid equipment damage by static electricity The cable armor must be connected to safety earth in the safe area The cable screen drain wire must be connected to an instrument earth in the safe area Three wire shielded cable is recommended for power and signal connections The push terminal blocks accept 14 AWG to 24 AWG stranded or solid wire The screw terminal blocks accept 12 to 28 AWG
52. icaceous silty BORING TERMINATED AT 20 FEET LOG OF WELL SVE 5 CLOSED WINDY HILL ROAD MSWLF amp WELL Technology ond f HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST T Hall LOCATION McDonough Henry County Georgia DATE S DRILLED 8 7 2006 DRILLING COMPANY Betts Environmental CASING DIA TYPE 4 PVC DRILLER C Pendarvis SCREEN SLOT TYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel CASING 862 50 Ft AMSL REMARKS GROUND ELEVATION 860 50 Ft AMSL DEPTH TO WATER WATER ELEVATION SAMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION GRAPHIC feet RECOVERY INTERVAL PID ppm Stick up Pipe Sand Red orange micaceous silty Closed Windy Hill Road MSWLF Henry County Georgia Sand Brown tan micaceous silty with coarse quartz grains and white clay lenses 9 24 07 Report TTL WELL LOG Tem plate TTL ENV GDT BEntonite Seal UU LTD Sand Tan micaceous silty Sapolitic moist at 24 feet BGS Slotted Screen with a Pea Gravel Filter Pack BORING TERMINATED AT 25 FEET GAPROJECTSILANDEI TIHENRY 60070671 SVESYS 1 BORING LOGS GPJ LOG OF WELL SVE 6 CLOSED WINDY HILL ROAD MSWLF amp WELL Technology ag HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST LOCATION McDonough Henry County Georgia DATE S DRILLED 3
53. icaceous silty Grout Bentonite seal Sand Brown micaceous silty with quartz Closed Windy Hill Road MSWLF Henry County Georgia Slotted Screen with a Pea Gravel Filter Pack Sand Tan micaceous silty BORING TERMINATED AT 15 FEET PID ppm 9 24 07 Report TTL WELL LOG Template TTLENV GDT GAPROJECTSILANDF I 1 HENRY 600706 1 SVESYS 1 BORING LOGS GPJ LOG OF WELL B 8 CLOSED WINDY HILL ROAD MSWLF amp WELL noatra HENRY COUNTY GEORGIA CONSTRUCTION Tradition PROJECT NUMBER 600706189 GEOLOGIST T Hall LOCATION McDonough Henry County Georgia DATE S DRILLED 5 31 2006 DRILLING COMPANY Watson Drillin CASING DIAJTYPE 2 PVC DRILLER T Watson SCREEN SLOTITYPE 0 010 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING 856 30 Ft AMSL REMARKS GROUND ELEVATION 846 30 Ft AMSL TO WATER WATER ELEVATION SAMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION feet INTERVAL DEPTH feet GRAPHIC LOG Stick up Pipe Sand Brown micaceous silty Grout Bentonite seal OBERE Closed Windy Hill Road MSWLF Henry County Georcia Sand Black brown micaceous silty with wood and gravel Slotted Screen with a Pea Gravel Filter Pack PID ppm BORING TERMINATED AT 15 FEET GAPROJECTSILANDF 11HENRY1600706 115 VESYS 11BORING LOGS GPJ LOG OF W
54. ion white papers and product literature for its complete selection of safety products These documents are available online at our website http www generalmonitors com Contacting Customer Support Worldwide Customer Service and Technical Support are available by calling one of several General Monitors offices listed in the following table General Monitors Offices AREA PHONE FAX EMAIL UNITED STATES Corporate Office Phone 1 949 581 4464 24 hours 26776 Simpatica Circle Fax 1 949 581 1151 Lake Forest CA 92630 Email info generalmonitors com Texas Office Phone 1 281 855 6000 9776 Whithorn Drive Fax 1 281 855 3290 Houston TX 77095 Email gmhou generalmonitors com IRELAND Ballybrit Business Park Phone 353 91 751175 Galway Fax 353 91 751317 Republic of Ireland Email service qmil ie MIDDLE EAST LOB12 G20 P O Box 61209 Phone 971 4 8815751 Jebel Ali Dubai Fax 971 4 8817927 United Arab Emirates Email gmme emirates net ae SINGAPORE No 2 Kallang Pudding Rd Phone 65 6748 3488 09 16 Mactech Building Fax 65 6748 1911 Singapore 349307 Email genmon gmpacifica com sg UNITED KINGDOM Lyme Green Business Park Phone 44 1625 619 583 Macclesfield Cheshire Fax 44 1625 619 098 United Kingdom SK11 OLR Email info generalmonitors co uk 30 2 GENERAL MONITORS Model 1840005 9 0 Appendix 9 1 Warranty General Monitors warrants the Model 1840005 to be free from defects in
55. is and transfer and dispose of it at a facility that is approved to accept such waste As info the landfill debris that was encountered during the installation of the SVE System at the Old Windy Hill MSWLF was disposed of at the Clayton County Landfill in Lovejoy Georgia b Yes material containing landfill debris shall be removed as described above c Thecontractor will be responsible for providing containers to transfer any landfill debris that is encountered and collected during the operation Will a surveyor be required the RFP states that the County will do the staking for the wells a Asthe RFP states the County will provide a survey crew from the Henry County Department of Transportation to perform the stakeout for the well construction Per EPD guidelines the wells shall be installed within fifty 50 feet of the staked out point Additionally an as built survey and map will be required content for the well installation report Again per EPD guidelines the as built survey and map production must be performed under the direction of and signed and sealed by a Registered Land Surveyor registered to practice in Georgia The contractor shall be responsible for providing and adhering to this requirement 10 In the bid document Section 31 2 page 15 provides a table of each methane well s specifications In the first line it s stated construct and develop the methane wells What procedure does the County intend to be used
56. isplay Modules Accessories Classification Warranty Approvals Infrared absorption type Oto 100 LEL Methane propane ethane butane hexane pentane benzene Consult factory for other gases Greater than 5 years 3 LEL at lt 50 LEL reading 5 LEL at gt 50 LEL reading 2 per year with 10096 LEL methane applied T50 lt 7 s T60 8s T90 lt 10s DC110 DC130 TA102A 184000 display and relay alarms Junction box duct mount junction box calibration cup flow block splash guard rain guard portable purge calibrator Class 1 Divisions 1 amp 2 Groups B C amp D Ex d IIB H2 T5 IP66 Type 4X Ex tD A21 T100 C Two years ATEX IECEx CE Marking FM 6310 6320 and CSA 22 2 No 152 M1984 Performance Approved HART Registered SIL 3 suitable Environmental Specifications Operating Temperature Range 40 F to 167 F 40 C to 75 C Storage Temperature Range 58 F to 185 F 50 C to 85 C Humidity 5 to 100 RH non condensing Electrical Specifications Input Power Analog Signal 20 36 VDC 200 mA max 24 VDC nominal 0 21 7 mA 600 Ohms max Start up Fault non HART OmA Start up Fault HART 1 25 mA Cal Zero Gas Check 1 5 mA Dirty Optics 2 0 mA Oto 100 LEL 4 to 20 mA proportional Over range 20 to 21 7 mA Under HART the analog output minimum level can be configured as 3 5 mA or as stated above depending on user selection
57. lays In addition to the rSt menu option the relays can be reset by connecting a normally open switch between the 1840005 terminal TB2 7 and TB2 8 relay reset and COM momentarily using a General Monitors explosion proof switch P N 30051 1 24 2 GENERAL MONITORS Model 1840005 5 0 Maintenance WARNING Disconnect or inhibit external devices such as trip amplifiers PLC s A or DCS systems before performing any maintenance NOTE The system s full two year warranty will be voided if customer personnel or third parties damage the system during repair attempts or maintenance activities 5 1 Developing a Maintenance Schedule Maintenance requirements will vary with each installation General Monitors recommends that a schedule for periodic maintenance be established and followed and that a maintenance logbook be kept for each unit in operation More frequent cleaning and calibration checks are recommended if the equipment is impacted by unusual environmental conditions such as mud collecting on the detector windows detectors accidentally being painted over etc General Monitors is not implying that the customer should expect problems with detector life or stability but calibration checks ensure the integrity of the life protecting equipment 5 2 Zeroing and Recalibration For detailed instructions on initiating gas checks zeroing and calibration using the 1840005 menus see Sections 4 2 4 4 5 3 Lubricating Thread
58. ly Open Common Common Normally Open Normally Closed Warn Normally Closed Normally Open Common Common Normally Open Normally Closed Fault Not Applicable Normally Open Fault Relay Always Common Energized Normally Closed Table 2 TB3 Relay Contacts Energized De Energized Settings WARNING Relay contacts must be protected against transient and over voltage conditions see Figure 10 Figure 10 Relay Protection for DC and AC Loads European Union EU Approved Applications The ALARM relay contact ratings are 8 A 30 VRMS 42 4 V peak or 8 A 30 VDC resistive max North American Approved Applications The ALARM relay contact ratings are 8 240 VAC and 8 A 30 VDC resistive max 14 2 GENERAL MONITORS Model 1840005 3 4 Applying Power and Starting Operation Once the mounting cabling and alarm relay installation is complete your IR400 IR4000S detection system is ready to begin the power on sequence Please review this section carefully before powering on your GM standalone detectors or your IR400 IR4000S Monitor system 3 4 1 Start up Readiness Checklist Prior to applying power to the system for the first time check the following items for a stand alone 18400 detector and for an 1840005 monitor configuration NOTE The 24 V wire s to the power supply supplies should be connected after the readiness checklist is verified to protect the system from shorting Since the IR400 and IR4000S are designed
59. monitor and telemetry system to the power source including providing transformers as needed 3 Calibrate the sensor 4 Test alarm notifications 5 Establish initial service for the telemetry system and transfer said service contract to Henry County upon job completion
60. mplete system includes the M 110 field RTU all wireless connections report and graph software all alarms and two websites for remote access Flatpak NEMAI Enclosure Option Shown One M 110 Is a Complete Wireless Monitoring System Each M 110 includes a field RTU wireless communications through cellular data MISSION based computers and software amazing alarm notifications and two customer websites The whole system is up and running in a few hours Customer has no computers or networks to maintain The M 110 RTU Comes With Everything You Need Each RTU has 8 digital inputs plus 4 built in 2 analog 2 pulse counter optional and 1 key reader inputs 3 remotely controllable relay outputs Optionally expand to 6 analog or 16 digital inputs It also includes a radio enclosure antenna antenna cable power supply and backup battery Remarkable Wireless Coverage and Reliability The M 110 uses the data side of any cellular system not the part you talk on It works reliably even where your voice cell phone doesn t and with multiple cell carriers available to it MISSION can make almost any site communicate reliably Centralized Web Software and or Direct Into Yours MISSION s web based software is very simple we set it up for you and upgrades are included and automatic Send your data directly into your existing HMI software like Wonderware or Intellution Full Suite of Cost Saving Software Features It tracks hourly run time
61. n Union EU Approved Cable Armor and Screens Interconnecting cables must have an overall screen or screen and armor Cables BS5308 Part 2 Type 2 or equivalent are suitable Note that the terms screen and shield are equivalent for the purpose of this manual The cable armor must be terminated in a suitable cable gland at the detector to ensure a positive electrical connection 3 3 1 2 Cable Termination in Non Hazardous Areas The cable armor must be connected to safety earth in the safe area The cable screen drain wire must be connected to an instrument earth in the safe area The power supply OV return must be connected to an instrument earth in the safe area The interconnecting cables should be segregated from power and other noisy cables Avoid proximity to cables associated with radio transmitters welders switch mode power supplies inverters battery chargers ignition systems generators switch gear arc lights and other high frequency or high power switching process equipment In general maintain separation of at least 1 meter between the instrument and other cables Greater separations are required where long parallel cable runs are unavoidable Avoid running instrument cable trenches close to lightning conductor earthing pits 10 GENERAL MONITORS Model 1840005 Complete all cable insulation testing before connecting the cable at either end 3 3 2 Wiring Figure 6 shows the IR4000S terminal block conne
62. nduit can be attached to the housing When an 18400 Gas Detector or other device is attached to the 1840005 housing it must be screwed into the housing using five to seven turns to ensure that the explosion proof integrity of the housing is maintained 5 5 Storage The 1840008 Single Point Monitor should be stored in a clean dry area and within the temperature and humidity ranges noted for environmental specifications in Section 9 2 5 Insert red dust caps into any vacant cable entry holes 26 2 GENERAL MONITORS Model 1840005 6 0 Troubleshooting CAUTION Component level repair must be undertaken either by General A Monitors personnel or by competent authorized service engineers SMT PCB repair shall only be performed at a General Monitors facility Failure to comply with this requirement will invalidate the warranty Be sure to inhibit or disconnect the external alarm wiring before making any check which might send the unit into alarm 6 1 No Display on Power Up If the display is not on after power is applied make sure that the wiring is correct especially the power wires 24V and COM Visually verify that insulation is above the terminal contacts Gently pull each wire to assure adequate contact and insertion length 6 2 1840005 Fault Codes and Remedies The Model 1840008 has its own separate set of fault codes that appear on the 1840008 3 digit display If the letter b precedes the two digit fault code from FO
63. pendable performance analog signal proportional to the O to 10096 LEL concentration The detector also monitors other Applications conditions such as supply voltage and optical path integrity Chemical Plants The 18400 detection principle is based on measuring Compressor Stations the absorption of infrared radiation passing through a volume of gas using a dual beam single detector and Freduegon method The IR detector measures the intensity of two Fuel Loading Facilities specific wavelengths one at an absorption wavelength and another outside of the absorption wavelength The LNG LPG Processing and Storage Facilities gas concentration is determined by a comparison of these two values Well Logging Refineries Configurations with analog output Modbus and HART are available The IR400 provides a two wire RS 485 Wastewater Treatment Facilities addressable communications link conforming to the Modbus protocol that is used to monitor the IR400 s status and settings in order to simplify installation and maintenance Data available through HART or Modbus such as configuration device settings and stored maintenance records can be used to perform diagnostics and take corrective action before a problem MODEL 400 System Specifications Detector Type Measuring Range Gases Detector Life Accuracy 25 Zero Drift Response Time Readout Relay D
64. plied to all connected online IR400 units The Warn relay setpoint must be set lower than the Alarm relay setpoint neither the Warn nor Alarm setpoints can be higher than 6096 LEL To Change the Warn and Alarm Relay Settings The steps to change the Alarm and Warn relay settings are the same 1 Open the main menu Place the magnet on the 1840008 GM logo to move from normal operation to the main menu options 2 Select SE from the main menu Once the SE option appears remove the magnet to open the SE submenu 3 Apply magnet to select Lo or Hi The Lo submenu includes options to configure the Warn relay settings the Hi submenu includes identical options to configure the Alarm relay settings 22 2 GENERAL MONITORS Model 1840005 4 Configure the settings for the Lo or Hi submenu Three relay settings will appear in turn for the Lo or Hi submenu Once you select each setting using the magnet you will move to the next setting then to Finish The first relay setting is En or dE for energized or de energized respectively Apply and remove the magnet to select En or dE The second relay setting is La or nL for latching or non latching respectively Apply and remove the magnet to select La or nL e The third relay setting is the Yo LEL setpoint Available Lo setpoints are from 5 to the Hi setpoint in 5 LEL increments Available Hi setpoints are from the Lo setpoint to 6096 LEL Apply and remove the magnet to select
65. press warranty stated herein are in lieu of all obligations or liabilities on the part of General Monitors for damages including but not limited to consequential damages arising out of or in connection with the use or performance of the product 31 GENERAL MONITORS Model 1840005 9 2 Specifications 9 2 1 Agency Approvals e CSA certified to C22 2 No 152 M1984 R2001 when connected to a detector that also meets the standard e FM 6310 6320 approved when connected to a detector that also meets the standard Complies with ANSI ISA 12 13 01 2000 ATEX safety and IECEx approved e Marking SIL 2 suitable e HART Registered FM requires the following statement This Approval does not include or imply Approval of apparatus to which the subject instrumentation may be connected In order to maintain an FM Approved system the apparatus to which this instrument is connected must also be Approved by FM Approvals 9 2 2 System Specifications Electrical Classification CSA FM Class 1 Division 1 2 Groups D and Class Zone 1 IIB H2 T5 Type 4X ATEX Ex d IIB H2 T5 Gb 40C to 75 C Ex t IIIB T100 C Db IP66 9 2 3 Mechanical Specifications Length 6 5 inches 165 mm Width 6 0 inches 152 mm Height 3 21 inches 82 mm Weight 5 5 lbs 2 5 kg Mounting Holes 5 05 inches 128 mm center to center 9 2 4 Electrical Specifications Input Power SS absolute min V 20 nominal
66. ral Monitors are for dust protection only and must not be left on the unit when installed Model IR4000S 2 GENERAL MONITORS Model 1840005 CAUTION Acetic acid wil cause damage to metal components metal hardware ceramic ICs etc If damage results from the use of a sealant that contains acetic acid RTV silicone the warranty will be void To prevent corrosion due to moisture or condensation it is recommended that the conduit connected to the Model IR4000S housing be sealed or contain a drain loop 3 3 Cabling and Wiring gt gt 3 3 1 Cabling Safety Notices CAUTION The 1840008 contains components that can be damaged by static electricity Special care must be taken when wiring the system to ensure that only the connection points are touched WARNING Under NO circumstances should equipment be connected or disconnected when under power This is contrary to hazardous area regulations and may also lead to serious damage to the equipment Equipment damaged in this manner is not covered under warranty gt gt WARNING For safety ground cabling must always be connected first before other cabling is connected The 24 VDC power cabling should be connected last and disconnected first Power supply connections to the IR4000S must remain OFF until all wiring is completed and the start up readiness checklist has been verified Refer to the manual for the power supply being used for instructions gt 3 3 1 1 Europea
67. s and Seals If neoprene rubber gasket O ring in the cover of the 1840008 enclosure is found dry it should also be lubricated with the lubricant sealant that is included with the IR400 IR4000S units or is available on order from General Monitors P N 610 010 As an alternative to grease PTFE Teflon tape may be used 5 4 Maintaining the X P Integrity The Model 1840008 is rated explosion proof for use in hazardous locations Before the cover of the 1840008 is removed or the cover bolts are loosened and power is to be left on it is necessary to declassify the area When replacing the cover the gap between the lid and the housing should be less than 0015 inch 038 mm Make sure that the flame path is clear of dirt and debris before replacing the cover Tighten the cover bolts to a torque setting of 50 inch pounds 25 2 GENERAL MONITORS Model 1840005 Use a feeler gauge to ensure the gap between the cover and the housing is less than 0015 inch 038 mm There are four entry holes in the 1840005 housing These holes can be used to attach an IR400 or IR2100 unit directly as well as for wiring conduits to alarm relays and control room equipment Each hole is tapped for 34 NPT threads If a particular entry hole is not used it must be plugged during operation in the field The factory installs plugs in the unused entry holes except one A red plastic cap is placed into the remaining hole and must be removed before co
68. s and starts graphs them analyzes them and calls you if there s a problem False alarm suppression features and real time data during alarms saves time and money Flexible Alarm Notifications Tracked to Alarm Site Alarms can be delivered via voice phone calls all pagers email fax or OPC Full alarm dispatch logs track and record every call Electronic RTU service keys log personnel site arrival and maintenance times Website Provides Remote Data Access and Reports Customers get their own secure web sites to view data anywhere including in the field through cell phones Data for CMOM State EPA reporting is all there One M 110 Is a Complete Wireless Monitoring System The M 110 RTU Comes With Everything You Need Remarkable Wireless Coverage and Reliability Centralized Web Software and or Direct Into Yours Full Suite of Cost Saving Software Features Flexible Alarm Notifications Tracked to Alarm Site Website Provides Remote Data Access and Reports Details MISSION uses AT amp T Nextel Sprint Verizon and centralized computer services to offer a revolutionary real time monitoring and control SCADA system It can also economically replace or complement existing radio or phone line based SCADA systems AC input from Optional Carrier LED solid green Transformer Connector Board indicates unit is online leads included 120 VAC to 12 VAC Radio Daughterboard Assembly 12 VDC
69. section 1 3 4 Well Protection on sheet 3 of the Methane Monitoring Plan the installation of the methane monitoring system which includes the drilling must be performed under the supervision of a qualified professional geologist or professional engineer registered to practice in Georgia b Thecontractor who the bid is awarded to is responsible for providing this supervision What are the sub surface conditions that are expected to be encountered when drilling Bedrock Fractured bedrock Dirt Gravel a Please see the boring logs for the SVE System that was installed at the Old Windy Hill MSWLF from May 1 to June 22 2007 A lithologic description at the recorded depths is provided for each well that was installed For location a copy of the as built survey for said SVE System is provided as well Are drilling logs from previous drillers available that we can have copies for our review as well as who was the driller a Yes copies of the boring logs for the SVE System that was installed from May to June 2007 at the Old Windy Hill MSWLF are provided The name of the driller who performed the boring is provided in the logs If trash is excavated during drilling or trenching what shall the contractor do with the trash Will we need to remove excavated trash off site since this is a closed site Can the County provide dumpsters a In accordance with applicable regulations the contractor shall remove any material that contains landfill debr
70. t the problem itself and sometimes the problem must be repaired by General Monitors ACTION Turn off the 24V power to the 1840008 and the attached IR400 Wait for 1 minute then turn the power back on After 2 minutes the 1840008 will show one of the following faults F7 The fault could not be corrected Contact your local General Monitors representative See Section 8 0 Customer Support F8 The fault was found but the setup menu items had to be reset to default values You must check every value in the SE menu and check it is set correctly Failure to do so could result in unexpected operation F2 The fault was found and corrected but the attached IR400 must be recalibrated See the procedure Calibrating the IR400 in Section 4 4 of this manual 28 2 GENERAL MONITORS Model 1840005 7 0 Modbus Interface The 1840005 does not have a built in Modbus interface The Modbus signals from the single Modbus interface on the connected detector either an IR400 or IR2100 that is connected to the 1840008 is passed through the 1840008 and made available as MOD and MOD on TB2 Be aware that the commands are sent directly to the IR400 or IR2100 detector not the 1840009 For details on the Modbus registers and a programming guide a separate Modbus manual for the IR400 is available on General Monitors website 29 GENERAL MONITORS Model IR4000S 8 0 Customer Support General Monitors provides extensive documentat
71. ta and alarms MISSION Notification being end to end acknowledged MISSION does not use SMS Full logs and delivery results of every attempt to call out an alarm text messaging for any communications with the M 110 or M 800 all voice alarms recorded Know who got what alarm and when Powerful alarm notification scheduler changes call list by time date AT amp T Nextel Sprint or Verizon radios all with 128 bit encryption or alarm type simple to adjust through the web or by MISSION and all using the data transmission protocol 0 6 to 2 watt maximum transmit power and 112dBm sensitivity COMMUNICATIONS 3060 C Business Park Dr Norcross GA 30071 Toll Free 877 993 1911 Email sales 123mc com www 123mc com 2009 MISSION Communications The MISSION Communications logo is property of MISSION Communications Wonderware is a registered trademark of Invensys PLC Intellution is a registered trademark of Intellution Inc All Rights Reserved Protected under patents 7216 145 7015 819 Specifications subject to change without notice Literature Code M110 0609 8 10 10 31 2 Methane Monitoring Wells Construct the following thirteen 13 permanent wells in accordance with Attachment A Methane Monitoring Plan Henry County McDonough Old Windy Hill MSWLFE October 2009 approved by the Georgia Environmental Protection Division April 19 2010
72. the power supply is connected properly The Model 1840005 and IR400 are powered by 24 VDC 20 to 36 VDC voltage range The 1840005 will display a fault code of bF6 if the power supply voltage is below 18 5 VDC e Power up Sequence 1 2 5 6 000 and Alarm indicator on for 1 second All display elements 8 8 8 and both Alarm and Warn indicators on for 2 seconds Software revision on for 2 seconds for example revision A will display r A bSU base Start Up for 12 seconds SU IR400 Start Up for 1 minute 45 seconds Gas concentration in 96 LEL Please consult the remainder of the manual for more information on calibration operation and other product features NOTE The 1840005 is compatible with point detectors Model IR400 and Model IR2100 This manual refers to the connected detector as IR400 throughout but all instructions also apply to the IR2100 unless otherwise noted 2 GENERAL MONITORS Model 1840005 1 0 Introduction 1 1 Protection for Life General Monitors mission is to benefit society by providing solutions through industry leading safety products services and systems that save lives and protect capital resources from the dangers of hazardous flames gases and vapors The safety products you have purchased should be handled carefully and installed calibrated and maintained in accordance with this instruction manual Remember these products are for your safety 1 2 Special Cautions
73. to develop a methane well a The word develop was placed in error and will be removed from the bid document everywhere that it appears Please see the addendum to the bid document Well MM 6 is to have a fixed methane monitor with a telemetry unit The methane plan sheet 3 doesn t have the specifications for this monitor or the telemetry unit Does the County have a preferred manufacturer and model for these two items a Yes please see the addendum to the bid document Specifications from a preferred manufacturer are provided for both the monitor and telemetry unit Another manufacturer may be used if the specifications are provided and determined to be equivalent and approved by the County Well MM 29 is listed as requiring a surface stand up completion with a man hole cover Since man hole covers are for subsurface installations is this an error a Yes please see the revised table in Section 31 2 of the addendum to the bid document The surface completion for MM 29 is Stand up with a Locking Metal Housing as the revised table shows On page 15 of the bid document for well MM 6 is AC power available at this location and who will be the responsible party to provide the power connection to the monitor and the telemetry unit a AC power will be available at the proposed location for MM 6 The power will be provided by the Henry County Facilities Maintenance Department Please contact Chris Painter Supervisor Henry County Fa
74. us silty 3 m w 19 20 us a we ente n eo mal era Go pom lat 24 25 a Sand Brown micaceous silty S amp 1 1 w e Sand Medium to coarse quartz sand with white cla BORING TERMINATED AT 40 FEET PID ppm 1 FS GAPROJECTS LANDFI 1 HENRY 600706 1 SVESYS 1 BORING LOGS GPJ 44 9124107 Report WELL LOG Tempfate TTLENV GDT TIL Technology and Tradition PROJECT NUMBER 600706189 LOCATION Henry Coun DRILLING COMPANY Watson Drillin DRILLER Watson CLOSED WINDY HILL ROAD MSWLF HENRY COUNTY GEORGIA Georgia DRILLING METHOD Hollow Stem Auger w SPT Samplin REMARKS GEOLOGIST DATE S DRILLED CASING DIA TYPE SCREEN SLOT TYPE FILTER PACK TYPE TOP OF CASING GROUND ELEVATION DEPTH TO WATER LOG OF WELL B 1B amp WELL CONSTRUCTION T Hall 6 1 2006 1 PVC 0 010 slotted PVC Pea Gravel 864 90 Ft AMSL 861 90 Ft AMSL 20 GAPROJ ECTSILANDFI 1 HENRY 600706 1 SVESYS 1 BORING LOGS GPJ WATER ELEVATION SAMPLE LITHOLOGIC DESCRIPTION DEPTH feet Sand Red brown micaceous silty GRAPHIC LOG INTERVAL feet RECOVER PID ppm Closed Windv Hill Road MSWLE Henry County Georgia Sand Brown micaceous silty Sand Quartz with clay BORING TERMINATED 60 FEE
75. ust be taken when wiring the system to ensure that only the connection points are touched Installation and Maintenance must be carried out by suitably skilled and competent personnel only Special Tools e 5mm Allen wrench for lid included with unit 0 1 flathead screwdriver for terminal block connections included with unit e Adjustable wrench for conduit or cable gland connections not included Model IR4000S Installation Step Refer to Section 1 Unpack the equipment and prepare for installation Section 3 1 2 Attach each IR400 to a junction box or directly to the Section 3 3 IR4000S REMIS 3 Mount the IR400 1840008 units in place Steps 3 and 4 can be swapped if it is easier to attach cabling before Section 3 2 the units are mounted in place 4 Wire 1840005 to the IR400 and any remote devices Section 3 3 5 Power on the equipment Section 3 4 6 Gas check or calibrate the IR400 Section 4 2 or 4 4 Table 1 IR400 IR4000S Installation Overview 3 1 Unpacking the Equipment All equipment shipped by General Monitors is packaged in shock absorbing containers which provide considerable protection against physical damage The contents should be carefully removed and checked against the packing list If any damage has occurred or there is any discrepancy in the order please notify General Monitors as soon as possible All subsequent correspondence with General Monitors must sp
76. v Georgia Closed S ZAM Bentonite Plug PVC Riser with Pea Gravel Pack arts Sand Brown Micaceous Silty a 4 ry ta a e 4 CUTER n Sand Red Orange Micaceous Silty with Small Amounts of Quartz and White Clay 0 020 in Slotted Screen with a Pea Gravel Filter Pack 4 7472444 at 9 24 07 Report WELL LOG Template TTLENV GDT wa esta ee Ya asi av 4 1 SVESYS 1 BORING LOGS GPJ LOG OF WELL SVE 9 CLOSED WINDY HILL ROAD MSWLF amp WELL Theb ey and HENRY COUNTY GEORGIA CONSTRUCTION PROJECT NUMBER 600706189 GEOLOGIST T Hail 4 LOCATION McDonough Henry County Georgia DATE S DRILLED 3 13 2007 DRILLING COMPANY TTL Inc CASING DIAJTYPE 4 PVC DRILLER Kenn SCREEN SLOT TYPE 0 020 in slotted PVC DRILLING METHOD Hollow Stem Auger w SPT Samplin FILTER PACK TYPE Pea Gravel TOP OF CASING REMARKS GROUND ELEVATION DEPTH TO WATER WATER ELEVATION SAMPLE WELL DIAGRAM LITHOLOGIC DESCRIPTION 4 Well Cover DEPTH GRAPHIC INTERVAL RECOVERY PID ppm Asphalt Sand Brown Micaceous Silty 2 ft Riser with No Fill Grout Bentonite Seal PVC Riser with Pea Gravel Pack Closed Windy Hill Road MSWLE Henry County Georgia Sand Black Brown Micaceous Silty with Abundant Wood and Sparse Trash Debris a
77. y such as if the gas was too low or too late in getting to IR400 the IR400 will show a calibration fault F6 21 2 GENERAL MONITORS Model 1840005 NOTE Once gas has been applied it is not possible to stop calibration If no gas is applied for 6 minutes after calibration is selected from the IR4000S menus the detector automatically reverts to a fault condition A fault also occurs if the gas is not removed within 6 minutes from the beginning of calibration You must re apply the magnet over the GM logo and recalibrate If no gas has been applied calibration can be aborted by reapplying the magnet 4 5 Setup This section describes the tasks that you can accomplish using the SE Setup submenu which provides numerous configuration options The second half of the 1840005 menu shows the SE Base submenu which provides more configuration options Lo and Hi Submenus These submenus configure the 96 LEL setpoint for the Warn and Alarm relays as well as Energized De energized and Latching Non Latching 4 5 1 Configuring Warn and Alarm Relay Settings The 1840008 menus allow you to configure the following Alarm and Warn relay settings Latching versus Non Latching Energized versus De Energized and the 96 LEL setpoint The default Warn relay settings are Non Latching De Energized 3096 LEL setpoint The default Alarm relay settings are Latching De Energized 6096 LEL setpoint NOTE The settings you select are ap

Download Pdf Manuals

Related Search

Related Contents

コンバージド・ネットワーク・拡張ボード 取扱説明書  取扱説明書 - Libec  ダウンロード  Samsung GT-I9506 User Manual  Christie G Series - Projector Central  Brodit ProClip 513276  熟大メイト カタログPDF  

Copyright © All rights reserved. Failed to retrieve file