Home

BLOCK-iT™ Pol II miR RNAi Expression Vector Kits

1. Problem Reason Solution Cytotoxic effects Too much Lipofectamine 2000 Optimize the transfection conditions for your observed after Reagent used cell line by varying the amount of transfection Lipofectamine 2000 Reagent used Plasmid DNA not pure Prepare purified plasmid DNA for transfection We recommend using the PureLink HQ Mini Plasmid Purification Kit or PureLink HiPure Plamid Midiprep Kit to prepare purified plasmid DNA Targeted an essential gene Make sure that your target gene is not essential for cell viability or growth No gene knockdown miRNA with no activity chosen Select a different target region observed Order BLOCK iT miR RNAi Select for your target gene see page xi which allows you to generate four different miR RNAi expression vectors We guarantee that at least two out of the four BLOCK iT miR RNAi Select expression vectors will result in gt 70 knockdown of the target gene provided that the transfection efficiency in your experiment is at least 80 pre miRNA designed incorrectly Follow the guidelines on pages 14 18 to select the target sequence and design the single stranded oligos Non specific off target gene knockdown observed Target sequence contains strong homology to other genes Select a different target region Order BLOCK iT miR RNAi Select for your target gene see page xi which are designed to limit off target effects No fluorescence signal
2. Box Component Shipping Storage 1 BLOCK iT Pol II miR RNAi Expression Vector Dry ice 20 C Reagents or BLOCK iT Pol II miR RNAi Expression Vector Reagents with EmGFP 2 One Shot TOP10 Chemically Competent E coli Dry ice 80 C Continued on next page Kit Contents and Storage continued BLOCK iT Pol II miR RNAi Expression Vector Reagents The following reagents are included with the BLOCK iT Pol II miR RNAi Expression Vector Reagents or the BLOCK iT Pol II miR RNAi Expression Vector Reagents with EmGFP Box 1 Store the reagents at 20 C Reagent Composition Amount pcDNA 6 2 GW miR 5 ng pl in 4x10 ul linearized 10 mM Tris HCl pH 8 0 or l 1 mM EDTA pH 8 0 pcDNA 6 2 GW EmGFP mik linearized 10X Oligo Annealing Buffer 100 mM Tris HCl pH 8 0 250 ul 10 mM EDTA pH 8 0 1M NaCl DNase RNase Free Water 3x15 ml 5X Ligation Buffer 250 mM Tris HCl pH 7 6 80 ul 50 mM MgCl 5 mM ATP 5 mM DIT 25 w v polyethylene glycol 8000 T4 DNA Ligase 1 Weiss U plin 20 ul 10 mM Tris HCl pH 7 5 50 mM KCl 1mM DTT 50 v v glycerol miRNA forward sequencing 100 ng ul in TE Buffer pH 8 0 20 ul primer or EmGFP forward sequencing primer miRNA reverse sequencing 100 ng ul in TE Buffer pH 8 0 20 ul primer miR lacZ positive double 50 uM in 1X Oligo Annealing Buffer 4 ul stranded ds control oligo pcDNA 1 2 V5 GW lacZ 500 ng l in TE Buffer pH
3. The engineered miRNAs produced by the BLOCK iT Pol II miR RNAi Expression Vector Kits see below fully complement their target site and cleave the target mRNA Sequence analysis showed that the primary cleavage site at the phosphodiester bond in the mRNA found opposite the tenth and eleventh bases of the engineered miRNA as predicted for RNAi mediated cleavage Elbashir et al 2001 similar to siRNA mediated cleavage Use of siRNA diced siRNA or synthetic siRNA for RNAi analysis in mammalian cells is limited by their transient nature To address this limitations a number of groups have developed vector based systems to facilitate expression of engineered short hairpin RNA shRNA sequences in mammalian cells using Pol III promoters Brummelkamp et al 2002 Paddison et al 2002 Paul et al 2002 Sui et al 2002 Yu et al 2002 However the use of shRNA vectors for RNAi analysis requires the screening of large number of sequences to identify active sequences and the use of Pol III promoters limits applications such as tissue specific expression To overcome limitations with siRNA and shRNA we have developed Gateway adapted expression vectors that enable the expression of engineered miRNA sequences from Pol II promoters The pcDNA 6 2 GW x EmGFP miR expression vectors facilitate the generation of an expression clone containing a ds oligo encoding a pre miRNA sequence see page 8 The resulting expression construct may be i
4. 13 Methods Designing the Single Stranded DNA Oligos Introduction ee XN BIND cd 3 v o P E BLOCK iT miR RNAi Select 14 To use the BLOCK iT Pol II miR RNAi Expression Vector Kits you will first need to design two single stranded DNA oligonucleotides one encoding the target pre miRNA top strand oligo and the other its complement bottom strand oligo You will then anneal the top and bottom strand oligos to generate a double stranded oligonucleotide ds oligo suitable for cloning into the pcDNA 6 2 GW x EmGFP miR vector The design of the single stranded oligonucleotides ss oligos is critical to the success of both the cloning procedure and ultimately the RNAi analysis General guidelines are provided in this section to help you choose the target sequence and to design the ss oligos Note however that simply following these guidelines does not guarantee that the pre miRNA will be effective in knocking down the target gene For a given target gene you may need to generate and screen multiple pre miRNA sequences to identify one that is active in gene knockdown studies We strongly recommend using Invitrogen s RNAi Designer an online tool to help you design and order pre miRNA sequences for any target gene of interest The RNAi Designer incorporates the guidelines provided in this manual as well as other design rules into a proprietary algorithm to design pre miRNA sequences that are compatible
5. e The light shaded region corresponds to those DNA sequences that will be transferred from the initial pre miRNA expression vector into the Gateway destination vector e g pLenti6 V5 DEST Gateway Vector following recombination Note Following recombination with a Gateway destination vector the resulting expression clone will contain a pre miRNA expression cassette consisting of the 5 miR flanking region miRNA sequence and the 3 miR flanking region The complete sequence of peDNA 6 2 GW miR is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 65 For a map of pcDNA 6 2 GW miR see the Appendix page 56 GACTTTCCAA CTGAAAGGTT CGGTGGGAGG GCCACCCTCC CTTATCGAAA GAATAGCTTT AATGTCGTAA TTACAGCATT TATA o1 TCTATATAAG AGATATATTC TTAATACGAC AATTATGCTG attB1 CAACTCCGCC GTTGAGGCGG 3 end of CMV promoter CAGAGCTCTC GTCTCGAGAG TCACTATAGG AGTGATATCC Dra CAAGTTTGTA GTTCAAACAT CAAAAAAGCA GTT THARE 5 miR flanking region 1 GGCTTTAAAG QUGANATTTC BOGCOTTGUTG DOOCGANCGAC TTCCGACATA CGAJ e 1 T AAGGCTGT ARMON eE MEC AGGACA ds oligo EESTE T G T CACATGGAAC GTGTACOTTG 1 AAATGGCCOA TITACCOGOGT Bgl II GATCTGGCCG CTAGACCGEGC miRNA reverse sequencing primer site r a TACAAAGTGG TTGATCTAGA GGGCCCGCGG ATGTTTCACC AACTAGATCT CCCGGGCGCC CAAT rr 1 CCATTGACGC AAATGGGCGG TAGGCGTGTA G
6. with the same miR RNAi identifier Hmi Mmi or Rmi number according to the instructions on the next page The two matching BLOCK iT miR RNAi Select DNA oligos may arrive in separate shipments if only one strand is present in a shipment please wait for the remaining strand before proceeding Note BLOCK iT miR RNAi Select oligos come lyophilized store at 20 C If your single stranded oligos are supplied lyophilized resuspend them in water or TE Buffer to a final concentration of 200 uM before use Continued on next page 21 Generating the Double Stranded Oligo continued Amount of DNA You will anneal equal amounts of the top and bottom strand oligos to generate Oligo to Anneal the ds oligos We perform the annealing reaction at a final single stranded oligo concentration of 50 uM Annealing at concentrations below 5 uM significantly reduce the efficiency Note that the annealing step is not 100 efficient Re annealing If you plan to use the miR lacZ positive ds control oligo in the ligation reaction LacZ2 1 Control make sure to re anneal it along with the other oligos as described on the next Oligo page Since the miR lacZ positive ds control oligo already comes at a concentration of 50 uM in 1 x Oligo Annealing Buffer re anneal the miR lacZ positive ds control oligo without further dilution Materials Needed Have the following materials on hand before beginning e Your top strand single stranded oligo
7. EmGFP 487 509 For information on obtaining these filter sets contact Omega Optical Inc www omegafilters com or Chroma Technology Corporation www chroma com You may view the fluorescence signal of EmGFP in cells using an inverted fluorescence microscope with FITC filter or Omega XF100 filter available from www omegafilters com for viewing cells in culture or a flow cytometry system If desired you may use a color camera that is compatible with the microscope to photograph the cells We recommend using a digital camera or high sensitivity film such as 400 ASA or greater After transfection allow the cells to recover for 24 to 48 hours before assaying for fluorescence Medium can be removed and replaced with PBS during viewing to avoid any fluorescence due to the medium Be sure to replace PBS with fresh medium if you wish to continue growing the cells Note Cells can be incubated further to optimize expression of EmGFP See the Expected Results Section page 47 We have observed reduced EmGFP expression from miRN A containing vectors due to processing of the transcripts In most cases EmGFP expression should remain detectable 35 Generating a Stable Cell Line Introduction Blasticidin Selection Determining Antibiotic Sensitivity 36 Once you have determined that the miRNA in your pcDNA 6 2 GW x EmGFP miR expression clone is functional you may wish to establish stable cell
8. thoroughly by pipetting up and down Do not vortex Incubate for 5 minutes at room temperature Note Extending the incubation time may result in a higher yield of colonies Do not exceed 2 hours Place the reaction on ice and proceed to Transforming One Shot TOP10 Competent E coli next page Note You may store the ligation reaction at 20 C overnight 27 Transforming One Shot TOP10 Competent E coli Introduction Materials to Have on Hand One Shot TOP10 Transformation Procedure 28 Once you have performed the ligation reaction you will transform your ligation mixture into competent E coli One Shot TOP10 Chemically Competent E coli Box 2 are included with the kit to facilitate transformation Follow the guidelines and instructions provided in this section Note One Shot TOP10 E coli possess a transformation efficiency of 1 x 10 cfu ug DNA You will need the following materials on hand before beginning e Ligation reaction from Step 3 previous page e One Shot TOP10 Chemically Competent E coli supplied with the kit Box 2 one vial per transformation thaw on ice immediately before use e S OC Medium supplied with the kit Box 2 warm to room temperature e pUC19 positive control supplied with the kit Box 2 if desired e 42 C water bath e LB plates containing 50 ug ml spectinomycin two for each transformation warm at 37 C for 30 minutes before use See page 55 for rec
9. 1 5 CCTGAAATCGCTGATGTGTAGTCGTCAGTCAGTGGCCAAAACGACTACACAAATCAGCGATTTC 3 te sequence for 5 overhang Annealing 5 TGCTGAAATCGCTGATTTGTGTAGTCGTTTTGGCCACTGACTGACGACTACACATCAGCGATTT 3 3 CTTTAGCGACTAAACACATCAGCAAAACCGGTGACTGACTGCTGATGTGTAGTCGCTAAAGTCC 5 We generally order unpurified desalted single stranded oligos using Invitrogen s custom primer synthesis service see www invitrogen com for more information The ss oligos obtained anneal efficiently and provide optimal cloning results Note however that depending on which supplier you use the purity and quality of the ss oligos may vary If you obtain variable annealing and cloning results using unpurified desalted oligos you may want to order oligos that are HPLC or PAGE purified Continued on next page 17 Designing the Single Stranded DNA Oligos continued Cloning Site and Recombination Region of pcDNA 6 2 GW miR 18 501 561 621 681 741 791 851 Use the diagram below to help you design suitable DNA oligonucleotides to clone into pcDNA TM the diagram below 6 2 GW miR after annealing Note the following features in e The pcDNA 62 GW miR vector is supplied linearized between nucleotides 763 and 764 The linearized vector contains 4 nucleotide overhangs derived from miR 155 sequences Note that the annealed double stranded ds oligo must contain specific 4 nucleotide 5 overhangs on each strand as indicated
10. 16 C overnight This is not recommended for this application Follow the ligation procedure on page 27 For optimal results use approximately a 15 1 molar ratio of ds oligo insert vector for ligation We recommend a ligation with DNase RNase Free Water instead of oligo as negative control for the ligation reaction We recommend including the miR lacZ positive double stranded ds control oligo supplied with the kit as a positive control in your ligation experiment The miR lacZ positive ds control oligo is supplied as a 50 uM stock in 1X Oligo Annealing Buffer and needs to be re annealed and diluted 5000 fold before use in a ligation reaction see page 22 See page viii for the sequence of each strand of the lacZ ds control oligo Note Once you have cloned the lacZ ds control oligo into pcDNA 6 2 GW x EmGFP miR you may use the resulting expression clone as a positive control for the RNAi response in your mammalian cell line Simply co transfect the expression clone and the pcDNA 1 2 V5 GW lacZ reporter plasmid supplied with the kit into your mammalian cell line and assay for knockdown of B galactosidase expression Reminder When using the 10 nM ds oligo stock solution for cloning thaw the solution on ice Do not thaw the ds oligo by heating or the ds oligo duplexes may melt and form intramolecular hairpin structures After use return the tube to 20 C storage Continued on next page Performing the Ligation Rea
11. 200 uM in water or TE Buffer e Your bottom strand single stranded oligo 200 uM in water or TE Buffer e 50 uM stock of miR lacZ positive ds control oligo thaw on ice e 10X Oligo Annealing Buffer supplied with the kit Box 1 e DNase RNase Free Water supplied with the kit Box 1 e 0 5 ml sterile microcentrifuge tubes e 95 C water bath or heat block Setting up the Follow this procedure to set up the annealing reaction Note that the final Annealing concentration of the oligo mixture is 50 uM Reaction 1 Ina0 5 ml sterile microcentrifuge tube set up the following annealing reaction at room temperature Reagent Amount Top strand DNA oligo 200 uM 5 pl Bottom strand DNA oligo 200 uM 5 pl 10X Oligo Annealing Buffer 2 ul DNase RNase Free Water 8 ul Total volume 20 ul 2 Ifre annealing the miR lacZ positive ds control oligo centrifuge its tube briefly 5 seconds and transfer contents to a separate 0 5 ml sterile microcentrifuge tube Continued on next page 22 Generating the Double Stranded Oligo continued Annealing Follow this procedure to anneal your single stranded oligos to generate the Procedure ds oligo 1 Incubate the tubes from the previous section Setting up the Annealing Reaction at 95 C for 4 minutes 2 Remove the tube containing the annealing reaction from the water bath or the heat block and set on your laboratory bench 3 Allow the reaction mixture to cool to r
12. 8 0 20 ul control plasmid pcDNA 6 2 GW miR neg 500 ng l in TE Buffer pH 8 0 20 ul control plasmid or pcDNA 6 2 GW EmGFP miR neg control plasmid Continued on next page vii Kit Contents and Storage continued Unit Definition of T4 DNA Ligase Primer Sequences LacZ Control Oligo One Weiss unit of T4 DNA Ligase catalyzes the exchange of 1 nmol P labeled pyrophosphate into y p P ATP in 20 minutes at 37 C Weiss et al 1968 One unit is equal to approximately 300 cohesive end ligation units The table below provides the sequence and the amount of the primers included in the kit Primer Sequence Amount miRNA forward 5 TCCCAAGCTGGCTAGTTAAG 3 2ug sequencing primer 327 pmol or or or EmGFP forward 5 GGCATGGACGAGCTGTACAA 3 2ug sequencing primer 323 pmol miRNA reverse 5 CTCTAGATCAACCACTTTGT 3 2 ug sequencing primer 332 pmol The sequences of the miR lacZ positive ds control oligo are listed below The miR Sequences lacZ positive ds control oligo are annealed and are supplied in the kit as a 50 uM double stranded oligo The miR lacZ positive ds control oligo needs to be re annealed and diluted 5000 fold to 10 nM see page 22 before use in the ligation reaction page 26 LacZ DNA Oligo Sequence Top strand 5 TGCTGAAATCGCTGATTTGTGTAGTCGTTTTGGCCACTGACTGACGACTACACATCAGCGATTT 3 Bottom strand 5 CCIGAAATCGCTGATGTGTA
13. E coli as a result of the inverted repeat sequence within the ds oligo insert Note Expression clones containing mutated ds oligo inserts generally elicit a poor RNAi response in mammalian cells Identify expression clones with the correct ds oligo sequence and use these clones for your RNAi analysis TM To facilitate sequencing of your pcDNA 6 2 GW miR expression clones use the miRNA forward sequencing primer and miRNA reverse sequencing primer supplied with the kit Box 1 For pceDNA 6 2 GW EmGFP miR expression clones use EmGFP forward sequencing primer and miRNA reverse sequencing primer See the diagram on page 18 19 for the location of the priming sites If you download the sequence for pcDNA 6 2 GW miR or pcDNA 6 2 GW EmGFP miR from our Web site note that the overhang sequences will be shown already hybridized to their complementary sequences e g TGCT will be shown hybridized to ACGA and CAGG will be shown hybridized to GTCC Continued on next page 29 Analyzing Transformants continued EN 7 a RECO NOU l Alternative Sequencing Protocol In some cases you may have difficulty sequencing the ds oligo insert in your expression construct This is because the hairpin sequence is an inverted repeat that can form secondary structure during sequencing resulting in a drop in the sequencing signal when entering the hairpin If you have difficulty sequencing your expression constructs we su
14. attB expression clone 60 150 ng 1 7 ul pcDNA 6 2 GW miR neg control 50 ng pl 2 ul Donor vector 150 ng ul lpl Tul TE Buffer pH 8 0 to 8 ul 5 pl 2 Remove the BP Clonase II enzyme mix from 20 C and thaw on ice 2 minutes TM Vortex the BP Clonase II enzyme mix briefly twice 2 seconds each time To the sample above add 2 ul of BP Clonase II enzyme mix Mix well by pipetting up and down Reminder Return BP Clonase II enzyme mix to 20 C immediately after use Incubate the reaction at 25 C for 1 hour Important Unlike the standard BP reaction do not add Proteinase K but proceed immediately to the next step Transfer 3 ul from each of the BP reaction from Step 5 to clean sterile 0 5 ml microcentrifuge tubes Note Save the remaining BP reaction mix at 20 C You can transform the reaction mix into One Shot TOP10 Chemically Competent E coli as described on page 28 to check the efficiency of the BP reaction and will also allow you to isolate entry clones for future use Add the following components to the microcentrifuge tubes containing the 3 ul BP reaction at room temperature and mix Component Sample Positive Control Destination vector 150 ng ul 11d 1 yul TE Buffer pH 8 0 4 ul 4 ul Continued on next page Performing the Rapid BP LR Recombination Reaction Continued Setting Up the Protocol continued from the previous page Rapid BP LR 8 Recombinati
15. detected with expression clone containing EmGFP Incorrect filters used to detect fluorescence Be sure to use the recommended filter sets for detection of fluorescence see page 35 Be sure to use an inverted fluorescence microscope for analysis If desired allow the protein expression to continue for additional days before assaying for fluorescence Note We have observed reduced EmGFP expression from miRNA containing vectors due to processing of the transcripts In most cases EmGFP expression should remain detectable 53 Blasticidin Blasticidin Molecular Weight Formula and Structure Handling Blasticidin Preparing and Storing Stock Solutions 54 Appendix Blasticidin S HCl is a nucleoside antibiotic isolated from Streptomyces griseochromogenes which inhibits protein synthesis in both prokaryotic and eukaryotic cells Takeuchi et al 1958 Yamaguchi et al 1965 Resistance is conferred by expression of either one of two Blasticidin S deaminase genes bsd from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert Blasticidin S to a non toxic deaminohydroxy derivative Izumi et al 1991 The formula for Blasticidin S is Cz H5 N3Os HCI and the molecular weight is 458 9 The diagram below shows the structure of Blasticidin NH2 HOOC o CH3 Da NH NH O Always wear gloves mask goggles and protective clothin
16. gels Excise the vector fragment from the gel purify the fragment Purify the fragment TM using the Purelink Quick Gel Extraction Kit from Invitrogen or equivalent 4 Ligate the purified backbone and insert fragment at a 1 4 molar ratio using T4 DNA ligase from Invitrogen or equivalent 5 Transform competent cells such as E coli One Shot TOP10 as described on page 28 6 Analyze resulting clones by restriction analysis with Dra I no 750 bp fragment should be visible Transferring the Pre miRNA Expression Cassette to Destination Vectors Introduction Compatible Destination Vectors Important pcDNA 6 2 GW EmGFP miR expression vectors are Gateway compatible The pre miRNA is transcribed by RNA Pol II the pre mi RNA expression cassette can be transferred to other Gateway adapted destination vectors utilizing Pol II promoters which allows expression of the pre miRNA The various Gateway vectors have widely different transcriptional and technical properties which can be used to express the pre miRNA They offer custom promoter cloning tissue specific expression regulated expression and lentiviral transduction of the pre miRNA In addition destination vectors providing N terminal reporter genes can be used after removal of EmGFP Below is a list of destination vectors that are compatible with the BLOCK iT Pol II miR RNAi Expression Vector Kits For more information or to order the destination vector
17. hairpin structures These intramolecular hairpin structures will not clone into pcDNA 6 2 GW EmGFP miR If your diluted ds oligo stock solution is heated discard the ds oligo solution and prepare new diluted stocks using the procedure on the previous page Note If the 50 uM ds oligo solution undiluted stock becomes heated the oligos are sufficiently concentrated and may be re annealed following the annealing procedure on page 22 You may verify the integrity of your annealed ds oligo using agarose gel electrophoresis if desired We suggest running an aliquot of the annealed ds oligo 5 ul of the 500 nM stock and comparing it to an aliquot of each starting single stranded oligo dilute the 200 uM stock 400 fold to 500 nM use 5 ul for gel analysis Be sure to include an appropriate molecular weight standard We generally use the following gel and molecular weight standard e Agarose gel 4 E Gel Invitrogen Catalog no G5000 04 e Molecular weight standard 10 bp DNA Ladder Invitrogen Catalog no 10821 015 Note 4 E Gel resolves these fragments much better than regular 4 agarose gels Continued on next page Generating the Double Stranded Oligo continued What You Should When analyzing an aliquot of the annealed ds oligo reaction by agarose gel See electrophoresis we generally see the following e A detectable higher molecular weight band representing annealed ds oligo running around 60 70 bp e A f
18. lines that constitutively express your miRNA As negative control establish cell lines expressing pcDNA 6 2 GW EmGFP miR neg control plasmid The pcDNA 6 2 GW x EmGFP miR expression construct contains the Blasticidin resistance gene bsd Kimura et al 1994 to allow for Blasticidin selection Takeuchi et al 1958 Yamaguchi et al 1965 of mammalian cells that are stably transfected with the pcDNA 6 2 GW EmGFP miR construct Blasticidin is available separately from Invitrogen see page x for ordering information For more information about how to prepare and handle Blasticidin and determine the Blasticidin sensitivity refer to the Appendix page 54 Since you will be selecting for stably transduced cells using Blasticidin you must first determine the minimum concentration of Blasticidin required to kill your untransfected mammalian cell line i e perform a kill curve experiment Typically concentrations ranging from 2 10 ug ml Blasticidin are sufficient to kill most untransfected mammalian cell lines We recommend that you test a range of concentrations see protocol below to ensure that you determine the minimum concentration necessary for your cell line 1 Plate cells at approximately 25 confluence Prepare a set of 6 plates Allow cells to adhere overnight 2 The next day substitute culture medium with medium containing varying concentrations of Blasticidin e g 0 2 4 6 8 10 ug ml Blasticidin 3
19. promoter Overview Introduction System Components Introduction The BLOCK iT Pol II miR RNAi Expression Vector Kits facilitate the expression of microRNA miRNA for use in RNA interference RNAi analysis of a target gene in mammalian cells The kits provide a Gateway adapted expression vector designed to allow efficient transient or stable expression of miRNA If more specialized expression is required the vector allows easy recombination with other suitable destination vectors allowing tissue specific regulated or lentiviral expression of the miRNA in mammalian cells Note The BLOCK iT Lentiviral Pol II miR RNAi Expression Systems include the BLOCK iT Pol II miR RNAi Expression Vector Kits as well as the pLenti6 V5 DEST destination vector and other reagents required to generate a lentiviral RNAi construct For more information about the pLenti6 V5 DEST vector and how to generate lentivirus refer to the BLOCK iT Lentiviral Pol II miR RNAi Expression System manual This manual is supplied with the BLOCK iT Lentiviral RNAi Expression System but is also available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 65 The BLOCK iT Pol II miR RNAi Expression Vector Kits include e pcDNA 62 GW miR or pcDNA 6 2 GW EmGFP miR collectively referred to as pceDNA 6 2 GW x EmGFP miR e Reagents for production of an expression clone containing a d
20. twice with 70 ethanol Dissolve the DNA in TE Buffer pH 8 0 to a final concentration of 50 150 ng ul Follow this procedure to perform the Rapid BP LR reaction between your linearized expression clone PDONR TM 221 vector and Multisite Gateway destination vector 1 Add the following components to sterile 0 5 ml microcentrifuge tubes at room temperature and mix Component Sample Positive Control Linearized attB expression clone 60 150 ng 1 7 ul pcDNA 6 2 GW miR neg control 50 ng l 2 pl pDONR 221 vector 150 ng 11 1 ul 1 pl TE Buffer pH 8 0 to 8 ul 5 pl 2 Remove the BP Clonase II enzyme mix from 20 C and thaw on ice 2 minutes Vortex the BP Clonase II enzyme mix briefly twice 2 seconds each time TM To the sample above add 2 ul of BP Clonase II enzyme mix Mix well by pipetting up and down Reminder Return BP Clonase II enzyme mix to 20 C immediately after use Incubate the reaction at 25 C for 1 hour Important Unlike the standard BP reaction do not add Proteinase K but proceed immediately to the next step Transfer 6 ul from each of the BP reaction from Step 5 to clean sterile 0 5 ml microcentrifuge tubes Note Save the remaining BP reaction mix at 20 C You can transform the reaction mix into One Shot TOP10 Chemically Competent E coli as described on page 28 to check the efficiency of the BP reaction and will also allow you to isola
21. 07 Vere E For guidelines to design the oligonucleotides refer page 14 We recommend using Invitrogen s RNAi Designer at www invitrogen com rnai an online tool to help you design and order pre miRNA sequences for any target gene of interest TM The engineered pre miRNA sequence is cloned into the cloning site of BLOCK iT Pol II miR RNAi Expression Vectors that is flanked on either side with sequences from murine miR 155 to allow proper processing of the engineered pre miRNA sequence see page 18 19 for the flanking region sequences The pre miRNA sequence and adjacent miR 155 flanking regions are denoted as the pre miRNA expression cassette and are shown below This expression cassette is transferred between vectors during Gateway recombination reactions 5 miR flanking 5 G antisense Sense A2 nt 3 miR flanking region target sequence Loop sequence t arget sequence region Sense A2 nt 3 miR flanking target sequence region 5 miR flanking 5 G antisense region target sequence Loop sequence Once the engineered pre miRNA expression cassette is introduced into the mammalian cells for expression the pre miRNA forms an intramolecular stem loop structure similar to the structure of endogenous pre miRNA that is then processed by the endogenous Dicer enzyme into a 22 nucleotide mature miRNA Note The 21 nucleotides are derived from the target sequence while the 3 most nucleotide is derived from the nati
22. 1 Voinnet et al 1999 In experimental settings RNAi is widely used to silence genes through transfection of RNA duplexes or introduction of vector expressed short hairpin RNA shRNA In eukaryotic organisms dsRNA produced in vivo introduced by pathogens or through research is processed into 21 23 nucleotide double stranded short interfering RNA duplexes siRNA by an enzyme called Dicer a member of the RNase III family of double stranded RNA specific endonucleases Bernstein et al 2001 Ketting et al 2001 Each siRNA then incorporates into an RNA induced silencing complex RISC an enzyme complex that serves to target cellular transcripts complementary to the siRNA for specific cleavage and degradation or translational repression Hammond et al 2000 Nykanen et al 2001 MicroRNAs miRNAs are endogenous RNAs that trigger gene silencing Ambros 2001 Carrington amp Ambros 2003 MicroRNAs miRNAs are endogenously expressed small ssRNA sequences of 22 nucleotides in length which naturally direct gene silencing through components shared with the RNAi pathway Bartel 2004 Unlike shRNAs however the miRNAs are found embedded sometimes in clusters in long primary transcripts pri mi RNAs of several kilobases in length containing a hairpin structure and driven by RNA Polymerase II Lee et al 2004 the polymerase also responsible for mRNA expression Drosha a nuclear RNase III cleaves the stem loop structu
23. 4040 10 E coli 20 reactions C4040 03 40 reactions C4040 06 PureLink HO Mini Plasmid Purification Kit 100 preps K2100 01 PureLink HiPure Plamid Midiprep Kit 25 preps K2100 04 Lipofectamine 2000 Transfection Reagent 0 75 ml 11668 027 1 5 ml 11668 019 Lipofectamine LTX Reagent 1 0 ml 15338 100 Opti MEM I Reduced Serum Medium 100 ml 31985 062 500 ml 31985 070 Phosphate Buffered Saline PBS pH 7 4 500 ml 10010 023 4 E Gel Starter Pak 9 gels and Base G6000 04 2 E Gel Starter Pak 9 gels and Base G6000 02 10 bp DNA Ladder 50 ug 10821 015 293FT Cell Line 3 x 10 cells frozen R700 07 Blasticidin 50 mg R210 01 Purelink Quick Gel Extraction Kit 50 preps K2100 12 Gateway LR Clonase II Enzyme Mix 20 reactions 11791 020 100 reactions 11791 100 Gateway BP Clonase II Enzyme Mix 20 reactions 11789 020 100 reactions 11789 100 pDONR 221 6 ug 12536 017 LR Clonase Plus Enzyme Mix 20 reactions 12538 013 Continued on next page Accessory Products Continued Spectinomycin RNAi Designer and RNAi Express BLOCK iT miR RNAi Select BLOCK iT RNAi Products For selection of pcDNA 6 2 GW EmGFP miR transformants in E coli you will need to obtain spectinomycin Spectinomycin Dihydrochloride is available from Sigma Catalog no 54014 For a recipe to prepare spectinomycin for use see page 55 TM The BLOCK iT RNAi Designer is an online tool to help you design and order microRNA sequences fo
24. 5 DEST Gateway Vector following recombination The dark shaded region represents the EmGFP coding sequence Note Following recombination with a Gateway destination vector the resulting expression clone will contain a pre miRNA expression cassette consisting of the EmGFP coding sequence 5 miR flanking region miRNA sequence and the 3 miR flanking region The complete sequence of pcDNA 6 2 GW EmGFP miR is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 65 For a map of pcDNA 6 2 GW EmGFP miR see the Appendix page 60 Continued on next page 19 Designing the Single Stranded DNA Oligos continued 20 531 591 651 711 1433 1491 1541 1601 CAAT a2 CCATTGACGC AAATGGGCGG GGTAACTGCG TTTACCCGCC TAGGCGTGTA CGGTGGGAGG ATCCGCACAT GCCACCCTCC TATA 1Y d TCTATATAAG AGATATATTC Putative transcriptional start gt TGGCTAACTA ACCGATTGAT GAGTCCCAAG CTCAGGGTTC GAGAACCCAC TGCTTACTGG CTTATCGAAA TTAATACGAC CTCTTGGGTG ACGAATGACC GAATAGCTTT AATTATGCTG attB1 3 end of CMV promoter CAGAGCTCTC GTCTCGAGAG TCACTATAGG AGTGATATCC a CTGGCTAGTT AAGCTATCAA CAAGTTTGTA CAAAAAAGCA GACCGATCAA TTCGATAGTT GTTCAAACAT GTTTTTTCGT EmGFP coding sequence GGCTTTAAAA CCGAAATTTT CC ATG GTG GG TAC CAC Met Val GCTAAGCA COATTCOGT 5 EmGFP forward sequencing primer site r NE
25. C ANE CCC LM LC ML CEE Awe CAC CAC CIG TEE uae CCE EmGFP Coe Ne CWE Tue CAC sen miye Illy See See See Welty Wiehe eis Aan ibcnel Dral Sal CTTOGTOGCO GICGATOGTT TAAAGGGAGG TAGTCAGTCG GAAGCACCGG CAGCTAGCONA ATTTCOCTCGC ATCACTCAGC miR flanking region r COTOGAGGCT GGACCTCCGA TAC AAG TAA ARGH AENG FARE aaa E Om BamH ACCAGTGGAT TOGTCACCTA 3 miR flanking region 1 r TGCTGAAGGC TGTAMeMeNICEMIUMEMECA GGACACAAGG ACGACTTCCG ACATA C GALON Eee eT GTGTTCC o Q X gl I GCACTCACAT CGTGAGTGTA COTGTTACTA GGACAATGAT GGAACAAATG GCCCAGATCT CCTTGTTTAC CGGGTCTAGA miRNA reverse attB2 sequencing primer site f 1 R TCTTGTACAA AGTGGTTGAT CTAGAGGGCC Bees TT TCACCAACTA GATCTCCCGG GGCEGCACTE CCGGCGTGAG CGCGGTTCGC GCGCCAAGCG EL M GAGATATCTA GACCCAGCTT CLDOPATAGAT CDOGOTPTOGRNE start TK polyadenylation signal Y TGATGGGGGA GGCTAACTGA ACTACCCCCT CCGATTGACT Generating the Double Stranded Oligo Introduction Single Stranded Oligos Annealing BLOCK iT miR RNAi Select Oligos Resuspending the Oligos Once you have acquired the appropriate complementary single stranded DNA oligos you will anneal equal amounts of each single stranded oligo to generate a double stranded oligo ds oligo Guidelines and instructions are provided in this section Before beginning make sure that you have synthesized the single stranded oligos wit
26. GTCGTCAGTCAGTGGCCAAAACGACTACACAAATCAGCGATTTC 3 viii Continued on next page Kit Contents and Storage continued One Shot TOP10 Reagents Genotype of TOP10 Cells BLOCK iT Lentiviral RNAi Expression Reagents The following reagents are included in the One Shot TOP10 Chemically Competent E coli kit Box 2 Transformation efficiency is 2 1 x 10 cfu ug plasmid DNA Store Box 2 at 80 C Reagent Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at 4 C or 0 5 Yeast Extract room temperature 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose TOP10 cells 21 x50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCI 0 5 mM 50 ul EDTA pH 8 F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL Str end A1 nupG In addition to the BLOCK iT Pol II miR RNAi Expression Vector Kits and the BLOCK iT Lentiviral Pol II miR RNAi Expression Vector Systems also include the following components to facilitate production of a replication incompetent lentivirus that expresses your microRNA miRNA of interest e pLenti6 V5 DEST Gateway Vector e Gateway LR Clonase II Enzyme Mix TM e Gateway BP Clonase II Enzyme Mix e OneShot Stbl3 Chemically Competent E coli TM e ViraPower Bsd Lentiviral Support Kit e 293FT Cell Line e pDONR 221 Refer to the BLOCK iT Lentiviral Pol II m
27. Invitrogen BLOCK iT Pol Il miR RNAi Expression Vector Kits Gateway adapted expression vector for the expression of microRNA miRNA in mammalian cells under control of Pol Il promoters Catalog nos K4935 00 K4936 00 K4937 00 K4938 00 Version F December 29 2010 25 0857 Table of Contents Table of Contents c seccion OR emen tissu inte fide ete iii Expression Clone Generation for Experienced Users v Kit Contents and Storage suere eee tine Reed eei set ii i eate tore enel ege re petet es iea vi Accessory PrOGCtsz adeo nube bte deu Pp canini etd t atate ned t x Introduction oxiceatecisceateceneseccaconicetcchteests aadants cuteyehs chan valcoidcndchatatbn staantbtaadcaydenuneautodeaticed 1 Overvie E M 1 Using miRNA for RNAi Analysis rinisin raes totinen eann taan iesse rinneas Senia EER anke tenerent tenentes 5 BLOCK iT Pol II miR RNAi Expression Vector KIHES 2nd onera kde a Ere ERU Rd M ROM GEM SERERE 9 Green Fluorescent Proteiri ih dee ese een E He Ee ese iu e a ie sets 11 Experimental Outline 5o ere et ege a e ae RUE ooh d d e o ee et eee 13 Methods nti ba Est ici ccoi codd a edendo rt 14 Designing the Single Stranded DNA Oligo ssssssssssssseeseeeeeeeenrne tenentes 14 Generating the Double Stranded Oligo sse tenente nennen 21 Performing the Ligation Reaction ssssssssssseseeeeenenenr eene tenente nennen tenen
28. Kim M Han J Yeom K H Lee S Baek S H and Kim V N 2004 MicroRNA genes are transcribed by RNA polymerase II Embo J 23 4051 4060 Li W X and Ding S W 2001 Viral Suppressors of RNA Silencing Curr Opin Biotechnol 12 150 154 Liebert C A Watson A L and Summers A O 1999 Transposon Tn21 Flagship of the Floating Genome Microbiol Mol Biol Rev 63 507 522 Liu J Carmell M A Rivas F V Marsden C G Thomson J M Song J J Hammond S M Joshua Tor L and Hannon G J 2004 Argonaute2 is the catalytic engine of mammalian RNAi Science 305 1437 1441 McManus M T and Sharp P A 2002 Gene Silencing in Mammals by Small Interfering RNAs Nature Rev Genet 3 737 747 Meister G Landthaler M Patkaniowska A Dorsett Y Teng G and Tuschl T 2004 Human Argonaute2 mediates RNA cleavage targeted by mi RNAs and siRNAs Mol Cell 15 185 197 Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor Laboratory Cold Spring Harbor New York Napoli C Lemieux C and Jorgensen R 1990 Introduction of a Chalcone Synthase Gene into Petunia Results in Reversible Co Suppression of Homologous Genes in trans Plant Cell 2 279 289 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 N
29. OTAACTGUG TTTACCCGCC ATCCGCACAT Putative transcriptional start gt TGGCTAACTA GAGAACCCAC TGCTTACTGG ACCGATTGAT CTCTTGGGTG ACGAATGACC miRNA forward sequencing primer site F 1 r GAGTCCCAAG CTGGCTAGTT AAGCTATCAA CTCAGGGTTC GACCGATCAA TTCGATAGTT Sall BamH m AGTCGOACCAG TGGATCCTGG DONDOOTGSTIOCOACOTNGONOS GGAGGTAGTG COTOCATCAC 3 miR flanking region CAAGGCOTGT TACTAGCACT GTTCCGGACA ATGATCGTGA Xho attB2 r BIDCIANGNCCCOERGCITICTTG TAGATCTGGG TCGAAAGAAC CACTCGAGAT GTGAGCTCTA start TK polyadenylation signal Y TTCGCTGATG GGGGAGGCTA ACTGAAACAC AAGCGACTAC CCCCTCCGAT TGACTTTGTG Continued on next page Designing the Single Stranded DNA Oligos continued Cloning Site and Recombination Region of pcDNA 6 2 GW EmGFP miR Use the diagram below to help you design suitable DNA oligonucleotides to clone into pcDNA 6 2 GW EmGFP miR after annealing Note the following features in the diagram below The pcDNA 6 2 GW EmGFP miR vector is supplied linearized between nucleotides 1518 and 1519 The linearized vector contains 4 nucleotide overhangs derived from miR 155 sequences Note that the annealed double stranded ds oligo must contain specific 4 nucleotide 5 overhangs on each strand as indicated The light shaded region corresponds to those DNA sequences that will be transferred from the initial pre miRNA expression vector into the Gateway destination vector e g pLenti6 V
30. Replenish the selective media every 3 4 days and observe the percentage of surviving cells 4 Determine the appropriate concentration of Blasticidin that kills the cells within 10 14 days after addition of antibiotic Continued on next page Generating a Stable Cell Line continued Materials Needed Have the following materials on hand before beginning Mammalian cell line of interest make sure that cells are healthy and gt 90 viable before beginning pcDNA 6 2 GW x EmGFP miR expression clone pcDNA 6 2 GW EmGFP miR neg control plasmid Transfection reagent of choice e g Lipofectamine 2000 Blasticidin 5 to 10 mg ml Appropriate tissue culture dishes and supplies Guidelines for Guidelines are provided below to transfect your pcDNA 6 2 GW EmGFP miR Transfection and expression clone and pcDNA 6 2 GW x EmGFP miR neg control plasmid into Selection the mammalian cell line of choice and to select for stable cell lines using Blasticidin 1 One day before transfection plate cells at a density recommended by the manufacturer of the transfection reagent you are using 2 On the day of transfection Day 1 transfect your pcDNA 6 2 GW x EmGFP miR expression construct and pcDNA 6 2 GW x EmGFP miR neg control plasmid into cells following the recommendations of the manufacturer of your transfection reagent Use separate wells for separate constructs 3 Four to six hours after transfection remove the medium
31. Technical Service see page 65 Continued on next page Overview Continued Alternative Expression Systems Gateway Technology Purpose of this Manual The pcDNA 6 2 GW EmGFP miR vectors express the pre miRNA in most mammalian cells at a high constitutive level using the human cytomegalovirus CMV immediate early promoter If different expression of the pre miRNA is required such as tissue specific regulated or lentiviral expression the vector allows easy recombination with other suitable destination vectors using Gateway Technology Gateway Technology is a universal cloning method that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 to provide a rapid and highly efficient way to move your DNA sequence of interest the miRNA sequence into multiple vector systems To transfer your pre miRNA expression cassette see page 8 into the destination vector first generate an entry clone by performing a BP recombination reaction between the pcDNA 6 2 GW x EmGFP miR expression clone and a suitable donor vector such as pDONR 221 then perform an LR recombination reaction between the resulting entry clone and a destination vector of choice See page 40 for more details For more in depth information about the Gateway Technology refer to the Gateway Technology with Clonase II manual which is available from our web site www invitrogen com or by contacting Techn
32. UGAU GUGUAGUCGUU N LLEEEEEEEE IL a KE keis uO ii PLT TLE TTI g a A GACAAUUACGAUUG AUCCUCAG GACUUUAGCGACUA CACAUCAGCAG 3 G UCC UCAGUC AG UCAGUC internal terminal internal terminal loop loop loop loop Continued on next page Using miRNA for RNAi Analysis Continued Structure of the Engineered Pre miRNA Pre miRNA Expression Cassette Chaining of miRNAs The peDNA 6 2 GW EmGFP miR vectors are designed to accept engineered pre miRNA sequences targeting your gene of interest The engineered pre miRNA sequence structure is based on the murine miR 155 sequence and the stem loop structure was optimized to obtain a high knockdown rate as described on the previous page For optimized knockdown results we recommend that the ds oligo encoding the engineered pre miRNA have the following structural features e A4nucleotide 5 overhang TGCT complementary to the vector required for directional cloning e A5 G short 21 nucleotide antisense sequence mature miRNA derived from the target gene followed by e A short spacer of 19 nucleotides to form the terminal loop and e A short sense target sequence with 2 nucleotides removed A2 to create an internal loop e A4nucleotide 5 overhang CAGG complementary to the vector required for directional cloning The structural features are depicted in the figure below 5 G antisense Sense A2 nt TGCT overhang target sequence Loop sequence target sequence
33. V5 GW lacZ control plasmid is fused to a V5 epitope and is approximately 119 kDa in size If you are performing Western blot analysis you may also use the Anti V5 Antibodies available from Invitrogen e g Anti V5 HRP Antibody Catalog no R961 25 or Anti V5 AP Antibody Catalog no R962 25 for detection For more information refer to our Web site www invitrogen com or call Technical Support see page 65 Detecting Fluorescence Introduction Filters for Use with EmGFP Fluorescence Microscope Color Camera Detecting Transfected Cells What You Should See Note You can perform analysis of the EmGFP fluorescent protein from the expression clone in either transiently transfected cells or stable cell lines Once you have transfected your expression clone into mammalian cells you may detect EmGFP protein expression directly in cells by fluorescence microscopy or other methods that use light excitation and detection of emission See below for recommended fluorescence microscopy filter sets The EmGFP can be detected with standard FITC filter sets However for optimal detection of the fluorescence signal you may use a filter set which is optimized for detection within the excitation and emission ranges for the fluorescent protein such as the Omega XF100 filter set for fluorescence microscopy The spectral characteristics of EmGFP are listed in the table below Emission nm Fluorescent Protein Excitation nm
34. W EmGFP miR expression clone using the BLOCK iT Pol II miR RNAi Expression Vector Kits Flow Chart TGCTG CCTG C Annealing TGCTG C GTCC Ligation 1 Design and synthesize comple mentary DNA oligos with each containing 4 nucleotide overhangs necessary for directional cloning Alternatively order miR Select oligos directed against your gene of interest 2 Anneal DNA oligos to generate a ds oligo 5 miR flanking CAGG 3 miR flanking EmGFP 5 miR flanking AGG 3 miR flanking region ACGA region region ACGA region or pcDNA 6 2 GW EmGFP miR 5699 bp Transformation ds miRNA 3 miR flanking oligo region 5 miR flanking region region oligo pcDNA 6 2 GW or pcDNA 6 2 GW miR neg control plasmid 5004bp 5759 bp N Recombination with destination vector Transfection 5 miR flanking ds MIRNA 3 miR flanking region EmGFP miR neg control plasmid 3 Clone the ds oligo into pcDNA 6 2 GW miR or pcDNA 6 2 GW EmGFP miR expression vector using T4 DNA Ligase 4 Transform E coli and analyze colonies for the desired expression clone 5 Transfect the expression clone for transient or stable RNAi analysis or recombine with a suitable destination vector to generate a different expression clone through a donor vector intermediate
35. W miR neg control plasmid 5759 nucleotides CMV promoter bases 1 588 miRNA forward sequencing primer site bases 654 673 attB1 site bases 680 704 5 miR flanking region bases 737 763 miR neg control bases 764 823 3 miR flanking region bases 824 868 attB2 site C bases 897 921 miRNA reverse sequencing primer site C bases 912 931 TK polyadenylation signal bases 950 1221 f1 origin bases 1333 1761 SV40 early promoter and origin bases 1788 2096 EM7 promoter bases 2151 2217 Blasticidin resistance gene bases 2218 2616 SV40 polyadenylation signal bases 2774 2904 pUC origin C bases 3042 3715 Spectinomycin resistance gene C bases 3785 4795 Spectinomycin promoter C bases 4796 4929 C Complementary strand 61 Map and Features of pcDNA 6 2 GW EmGFP miR neg control plasmid pcDNA 6 2 GW EmGFP miR neg control plasmid 62 The figure below shows the features of the pcDNA 6 2 GW EmGFP miR neg control plasmid The vector contains an insert between bases 1519 and 1578 that can form a hairpin structure just as a regular pre miRNA but is predicted not to target any known vertebrate gene The insert has been cloned according to the instructions in this manual see page 14 Thus this plasmid serves as a suitable negative control for pre miRNA experiments with pcDNA 6 2 GW EmGFP miR expression vectors The complete sequence of pcDNA 6 2 GW EmGFP miR neg control plasmid is available for down
36. aintly detectable lower molecular weight band representing unannealed oligos that form hairpins running at around 30 35 bp For an example of expected results obtained from agarose gel analysis see the next page If the band representing ds oligo is weak or if you do not see a band see Troubleshooting page 49 for tips to troubleshoot your annealing reaction Example of In this experiment lacZ control oligos see page viii for the sequence of each DNA Expected Results oligo were annealed 50 uM final concentration using the reagents supplied in the kit and following the procedure on page 22 to generate the lacZ ds control oligo The annealing reaction was diluted 100 fold in water to a concentration of 500 nM Aliquots of the diluted ds oligo 5 ul 2 5 pmol and the corresponding single stranded oligos mixed but not annealed 2 5 pmol per oligo were analyzed on a 4 E Gel Results The lacZ oligo annealing reaction shows a clearly detectable higher molecular weight band that differs in size from each component single stranded oligo Remaining unannealed ss oligos are also weakly detectable Note The agarose gel is non denaturing therefore the single stranded oligos do not resolve at the expected size due to formation of secondary structure 1 2 Lane 1 single stranded lacZ oligos Lane 2 annealed lacZ oligos 2 7 M dsoligo 40 30 ss oligo 20 25 Performing the Ligation Reaction I
37. an influence the degree to which expression of your gene of interest is reduced i e gene knockdown in an RNAi experiment including e Transfection efficiency e Transcription rate of the target gene of interest e Stability of the target protein e Growth characteristics of your mammalian cell line e Efficacy of the miRNA of interest e Activity of the promoter driving the miRNA expression cassette Take these factors into account when designing your RNAi experiments Once you have obtained your expression clone you must isolate plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic cells must be very clean and free from contamination with phenol or sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HQ Mini Plasmid Purification Kit PureLink HiPure Plamid Midiprep Kit or CsCl gradient centrifugation Continued on next page Transfecting Cells continued Methods of Transfection N gwENn 7 SECO Pd Z Nor Positive and Negative Controls For established cell lines e g COS HEK 293 consult original references or the supplier of your cell line for the optimal method of transfection Pay particular attention to media requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols i
38. and replace with fresh growth medium Incubate the cells overnight at 37 C 4 The following day Day 2 trypsinize and replate cells into a larger sized tissue culture format in fresh complete medium containing the appropriate concentrations of Blasticidin Example If transfecting cells in a 6 well format trypsinize and replate cells into 10 cm tissue culture plates in medium containing Blasticidin 5 Replace medium with fresh medium containing Blasticidin every 3 4 days until Blasticidin resistant colonies can be identified generally 10 14 days after selection 6 Pick at least 10 Blasticidin resistant colonies per construct and expand each clone 7 Assay for target gene knockdown compare to uninduced cells and cells stably transfected with pcDNA 6 2 GW x EmGFP miR neg control plasmid 37 Chaining pre miRNAs Introduction Restriction Strategy 38 miRNAs are sometimes expressed in clusters in long primary transcripts driven by RNA Pol II Lee et al 2004 Our vectors support chaining of miRNAs to express them in one primary transcript thus ensuring co cistronic expression of multiple miRNAs In the final construct the original pattern of restriction sites is regenerated making the construct amenable to multiples rounds of chaining The figure below shows the principle of chaining two miRNAs derived from two different miRNA vectors into one miRNA expression vector Note Chaining together miRNAs targeting d
39. as been described in a published review Tsien 1998 and is summarized below The amino acid mutations are represented by the single letter abbreviation for the amino acid in the consensus GFP sequence followed by the codon number and the single letter amino acid abbreviation for the substituted amino acid Fluorescent Protein GFP Mutations EmGFP S65T S72A N149K M153T 1167T Mutations listed are as described in the literature When examining the actual sequence the vector codon numbering starts at the first amino acid after the initiation methionine of the fluorescent protein so that mutations appear to be increased by one position For example the S65T mutation actually occurs in codon 66 of EmGFP The EmGFP from the peDNA 6 2 GW EmGFP miR expression vector has the following excitation and emission wavelengths as published in the literature Tsien 1998 Excitation nm Emission nm 487 509 The EmGFP can be detected with standard FITC filter sets However for optimal detection of the fluorescence signal you may use a filter set which is optimized for detection within the excitation and emission ranges for the fluorescent protein The filter set for fluorescence microscopy and the manufacturer are listed below Filter Set Manufacturer Omega XF100 Omega www omegafilters com Experimental Outline The figure below illustrates the major steps necessary to produce a pcDNA 6 2 GW miR or pcDNA 6 2 G
40. at 20 C Continued on next page 23 Generating the Double Stranded Oligo continued Important Storing the ds Oligo Important Checking the Integrity of the ds Oligo 24 The undiluted ds oligos are 5 000 fold more concentrated than the working concentration When performing the dilutions be careful not to cross contaminate the different ds oligo stocks Remember to wear gloves and change pipette tips after every manipulation Once you have diluted your ds oligo you should have three stocks of annealed ds oligo Use each stock as follows e 50 uM ds oligo undiluted Use this stock for long term storage and to prepare new diluted ds oligo stocks if existing stocks become denatured or cross contaminated e 500 nM ds oligo 100 fold dilution Use this stock for gel analysis see Checking the Integrity of the ds Oligo next page e 10nM ds oligo 5 000 fold dilution Use this stock for cloning see Ligation Procedure page 27 This stock is not suitable for long term storage Store the three ds oligo stocks at 20 C When using the diluted ds oligo stock solutions i e 100 fold or 5 000 fold diluted stocks thaw the solutions on ice Do not heat or allow the ds oligo solutions to reach greater than room temperature as this causes the ds oligos to melt The concentration of the oligos in the diluted solutions is not high enough to permit re annealing and instead favors the formation of intramolecular
41. bits Expression of the Endogenous Gene in Transgenic Plants Mol Gen Genet 224 477 481 Sui G Soohoo C Affar E B Gay F Shi Y Forrester W C and Shi Y 2002 A DNA Vector Based RNAi Technology to Suppress Gene Expression in Mammalian Cells Proc Natl Acad Sci USA 99 5515 5520 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin 5 A New Antibiotic The Journal of Antibiotics Series A 11 1 5 Tsien R Y 1998 The Green Fluorescent Protein Annu Rev Biochem 67 509 544 van der Krol A R Mur L A Beld M Mol J N and Stuitje A R 1990 Flavonoid Genes in Petunia Addition of a Limited Number of Gene Copies May Lead to a Suppression of Gene Expression Plant Cell 2 291 299 Voinnet O Pinto Y M and Baulcombe D C 1999 Suppression of Gene Silencing A General Strategy Used by Diverse DNA and RNA Viruses of Plants Proc Natl Acad Sci USA 96 14147 14152 Weiss B Jacquemin Sablon A Live T R Fareed G C and Richardson C C 1968 Enzymatic Breakage and Joining of Deoxyribonucleic Acid VI Further Purification and Properties of Polynucleotide Ligase from Escherichia coli Infected with Bacteriophage T4 J Biol Chem 243 4543 4555 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 Yamaguchi H Yamamoto C and Ta
42. cDNA 6 2 GW EmGFP miR and pcDNA 6 2 GW miR expression vectors 110 100 90 80 70 60 50 40 30 20 10 0 B gal neg control ctrl lacZ luc neg ctrl lacZ luc neg pcDNA 6 2 GW EmGFP miR pcDNA 6 2 GW miR Pol Il miR RNAi vector Continued on next page Expected Results Continued Knockdown of Endogenous Lamin A C Detection lacZ miRNA Lamin A C miRNA HeLa cells transfected with pcDNA 6 2 GW EmGFP miR vectors containing lacZ top panel or lamin A C directed bottom panel miRNA inserts were fixed and stained four days after transfection A single field of cells is shown in each row to reveal nuclei Hoechst dye EmGFP auto fluorescence lamin A C immunofluorescence using mouse monoclonal sc 7292 Santa Cruz Biotechnology and the overlay of EmGFP and lamin A C signal Results The lamin A C miRNA transfected cells in which EmGFP fluorescence is detectable show markedly reduced lamin A C staining indicating tight correlation between EmGFP expression and lamin knockdown In the control lacZ miRNA transfected wells lamin signals in non EmGFP and EmGFP expressing cells are similar indicating no effect of the lacZ miRNA on lamin A C expression EmGFP Nuclei EmGFP Lamin A C Lamin A C Hoechst dye auto fluorescence immunofluorescence overlay Continued on next page 47 Expected Results Continued Knockdown by Chained miRNA R
43. ction continued Materials Needed Ligation Procedure Have the following reagents on hand before beginning Double stranded oligo of interest 10 nM in 1X Oligo Annealing Buffer thaw on ice before use pcDNA 6 2 GW miR linearized or pcCDNA 6 2 GW EmGFP miR linearized 5 ng ul supplied with the kit Box 1 thaw on ice before use 5X Ligation Buffer supplied with the kit Box 1 DNase RNase Free Water supplied with the kit Box 1 T4 DNA Ligase 1 U ul supplied with the kit Box 1 Follow the procedure below to perform the ligation reaction If you wish to include a negative control set up a separate ligation reaction but omit the ds oligo 1 Set up a 20 ul ligation reaction at room temperature using the following reagents in the order shown Reagent Sample Positive Negative control control 5X Ligation Buffer 4 ul 4ul 4 ul pcDNA 6 2 GW miR linearized 5 ng ul 2 ul 2 ul 2 ul or pcDNA 6 2 GW EmGFP miR linearized 5 ng ul miR ds oligo 10 nM i e 1 5 000 dilution page 23 4 ul a miR lacZ positive ds control oligo 10 nM i e 4 ul 1 5 000 dilution page 23 DNase RNase Free Water 9 ul 9 ul 13 ul T4 DNA Ligase 1 U ul lu lul lu Total volume 20 ul 20 ul 20 ul 2 Mix reaction well by pipetting up and down Note The presence of PEG and glycerol supplied by the Ligation Buffer and the T4 DNA Ligase will make the reaction mixture viscous Be sure to mix the reaction
44. ctor 150 ng ul in TE Buffer pH 8 0 e pcDNA 6 2 GW EmGFP miR neg control if desired supplied with the kit TM e BP Clonase II enzyme mix e LRClonase II enzyme mix e 2ug ul Proteinase K solution supplied with Clonase enzymes thaw and keep on ice until use e TE Buffer pH 8 0 10 mM Tris HCl pH 8 0 1 mM EDTA e Sterile 0 5 ml microcentrifuge tubes Continued on next page 43 Performing the Rapid BP LR Recombination Reaction Continued Linearizing Expression Clones Setting Up the Rapid BP LR Recombination Reaction 44 We recommend that you linearize the expression clone using Eag I or BsrD I 1 Linearize 1 2 ug of the expression clone with a restriction enzyme such as Eag I or BsrD I that does not digest within the region of interest and is located outside the attB region Ethanol precipitate the DNA after digestion by adding 0 1 volume of 3M sodium acetate followed by 2 5 volumes of 100 ethanol Pellet the DNA by centrifugation Wash the pellet twice with 70 ethanol Dissolve the DNA in TE Buffer pH 8 0 to a final concentration of 50 150 ng ul Follow this procedure to perform the Rapid BP LR reaction between your linearized expression clone suitable donor vector and regular Gateway destination vector 1 Add the following components to sterile 0 5 ml microcentrifuge tubes at room temperature and mix Component Sample Positive Control Linearized
45. e analysis is not necessary Note You may store the reaction at 20 C for up to 1 week before transformation if desired Once you have obtained your new expression clone we recommend you test it by transfecting an appropriate mammalian cell line to perform transient RNAi analysis if applicable see Transfecting Cells page 32 After that refer to the manual provided with the destination vector to take advantage of the features of the new expression clone Map and Features of pcDNA 6 2 GW miR pcDNA 6 2 GW miR The figure below shows the features of the pcDNA 6 2 GW miR vector The vector is supplied linearized between nucleotides 763 and 764 with 4 base pair 5 overhangs on each strand as indicated The complete sequence of pcDNA 6 2 GW miR is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 65 Note For an explanation of the features see page 63 W i E 9 S Ex fi MF 5 miR flanking CAGG 3 miR flanking region ACGA region Comments for pcDNA 6 2 GW miR 4944 nucleotides CMV promoter bases 1 588 miRNA forward sequencing primer site bases 654 673 attB1 site bases 680 704 5 miR flanking region bases 737 763 5 overhang C bases 760 763 5 overhang bases 764 767 3 miR flanking region bases 764 808 attB2 site C bases 837 861 miRNA reverse sequencing primer site C bases 852 871 TK polyadenylat
46. edures Reactions Problem Reason Solution Few spectinomycin resistant colonies obtained on the selective plate Single stranded oligos designed incorrectly Make sure that each single stranded oligo contains the 4 nucleotides on the 5 end required for cloning into pcDNA 6 2 GW EmGFP miR Top strand oligo include TGCT on the 5 end Bottom strand oligo include CCTG on the 5 end ds oligos were degraded Store the 10 nM ds oligo stock in 1X Oligo Annealing Buffer Avoid repeated freeze thaw cycles Aliquot the 10 nM ds oligo stock and store at 20 C Continued on next page 49 Troubleshooting continued Ligation and Transformation Reactions continued Problem Reason Solution Few spectinomycin resistant colonies obtained on the selective plate continued ds oligos stored incorrectly Store the ds oligo stocks at 20 C 500 nM ds oligo stock solution diluted into water instead of 1X Oligo Annealing Buffer To dilute the 50 uM ds oligo reaction Dilute the 50 uM stock 100 fold into DNase RNase free water to generate a 500 nM stock Dilute the 500 nM stock 50 fold into 1X Oligo Annealing Buffer to generate a 10 nM stock Use the 10 nM stock for cloning 10 nM ds oligo stock solution heated above room temperature prior to use Thaw ds oligo stock solution on ice or at 4 C prior to use Important Dilute ds oligos will melt and
47. ell spaced colonies For the pUC19 control plate 20 100 ul of the transformation reaction on LB plates containing 100 ug ml ampicillin 8 An efficient ligation reaction may produce several hundred colonies Analyzing Transformants Analyzing Transformants Important Sequencing Note To analyze positive clones we recommend that you 1 Pick 5 10 spectinomycin resistant colonies and culture them overnight in LB or SOB medium containing 50 ug ml spectinomycin Note Low salt LB containing 100 ug ml Blasticidin can also be used to grow transformants See page 54 and 55 2 Isolate plasmid DNA using your method of choice To obtain pure plasmid DNA for automated or manual sequencing we recommend using the PureLink HQ Mini Plasmid Purification Kit TM Sequence each pcDNA 6 2 GW x EmGFP miR expression construct see below to confirm the following a The presence and correct orientation of the ds oligo insert b The sequence of the ds oligo insert Note Because of the small size of the ds oligo insert we do not recommend using restriction enzyme analysis to screen transformants We highly recommend sequencing positive transformants to confirm the sequence of the ds oligo insert When screening transformants we find that up to 20 of the clones contain mutated inserts generally 1 or 2 bp deletions within the ds oligo The reason for this is not known but may be due to triggering of repair mechanisms within
48. en Cor poration 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Email outlicensing invitrogen com This product and its use is the subject of U S and foreign patents This product is produced and sold under license from the University of Michigan Use of this product is permitted for research purposes only Any other use requires a license from the University of Michigan Office of Technology Transfer 3003 S State St Suite 2071 Ann Arbor MI 48190 1280 Continued on next page 67 Purchaser Notification continued Limited Use Label License No 271 miRNA Constructs Limited Use Label License No 272 Humanized GFP 68 This product is produced and sold under license from Galapagos Genomics N V for research use only and not for therapeutic or diagnostic use in humans This product is not sold with license to use this product in conjunction with adenoviral vectors This product is the subject of U S and foreign patents licensed by Invitrogen Corpor ation This product is sold for research use only Not for therapeutic or diagnostic use in humans Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading fra
49. ers European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_service invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com Certificate of Analysis Material Data Safety Sheets MSDSs Limited Warranty Product qualification is described in the Certificate of Analysis CofA available on our website by product lot number at www invitrogen com cofa MSDSs are available on our Web site at www invitrogen com On the home page click on Technical Resources and follow instructions on the page to download the MSDS for your product Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that doe
50. ers are familiar with the principles of gene silencing vector based production of miRNA transfection in mammalian systems and cloning We highly recommend that users possess a working knowledge of the RNAi pathway and lipid mediated transfection For more information about miRNA and the RNAi pathways and expression of miRNA in mammalian cells refer to published references Ambros 2004 Bartel 2004 Boden et al 2004 Cullen 2004 Kim 2005 McManus amp Sharp 2002 Zeng et al 2002 Refer to Molecular Biology handbooks such as Current Protocols in Molecular Biology Ausubel et al 1994 if you are not familiar with the cloning steps involved Using miRNA for RNAi Analysis Introduction The RNAi Pathway miRNA Pathway RNA interference RNAi describes the phenomenon by which short homologous RNA duplexes induce potent and specific inhibition of eukaryotic gene expression via the degradation of complementary messenger RNA mRNA and is functionally similar to the processes of post transcriptional gene silencing PTGS or cosuppression in plants Cogoni et al 1994 Napoli et al 1990 Smith et al 1990 van der Krol et al 1990 and quelling in fungi Cogoni amp Macino 1997 Cogoni amp Macino 1999 Romano amp Macino 1992 In plants the PTGS response is thought to occur as a natural defense against viral infection or transposon insertion Anandalakshmi et al 1998 Jones et al 1998 Li amp Ding 200
51. esults of experiment co transfecting luciferase and lacZ reporter plasmids with single or dual miRNA vectors with the indicated inserts GripTite 293 MSR cells Invitrogen Catalog no R795 07 were grown to 90 confluence Individual wells in a 24 well plate were transfected using Lipofectamine 2000 Reagent with 100 ng each of the pcDNA 1 2 V5 GW lacZ and pcDNA 5 FRT luc reporter plasmid and co transfected with 300 ng of the indicated pre miRNA expression vectors as indicated Cell lysates were prepared 48 hours after transfection and assayed for B galactosidase and luciferase activity Luciferase and B galactosidase activities are normalized to the single neg or dual neg neg miRNA negative control inserts Results Both for single and dual miRNA expressing vectors vectors expressing miRNA lacZ inhibit p galactosidase activity while vectors expressing miRNA luc inhibit luciferase activity Bl9 galactosidase Vector 140 120 T 100 o b 8096 gt 9 6096 S 9 40 ra 2096 096 miR 1 miR 2 48 piluciferase neg lacZ luc neg neg luc luc neg lacZ neg lacZ miRNA combination Troubleshooting Introduction Use the information in this section to troubleshoot the annealing cloning transformation and transfection procedures Annealing The table below lists some potential problems and possible solutions that may Reaction help you troubleshoot t
52. for use in cloning into ppDNA 6 2 GW EmGFP miR Success rates exceeding 7076 have been achieved with the RNAi Designer i e more than 70 of designed miRNAs reduce target gene expression by at least 70 To use the RNAi Designer see www invitrogen com rnai Note Invitrogen s RNAi Designer is the only online tool for miRNA design at the moment this manual is printed Other online RNAi designers not intended for miRNA will not necessarily design good pre miRNA sequences Invitrogen has pre designed miR RNAi sequences called BLOCK iT miR RNAi Select targeting gt 70 of the human mouse and rat RefSeq genes with a guaranteed rate of success See page xi for more details Continued on next page Designing the Single Stranded DNA Oligos continued Features of Pre miRNA Insert When designing the oligos encoding the pre miRNA consider that a pre miRNA insert contains the following features from 5 to 3 end 5 nucleotides TGCTG derived from the endogenous miR 155 an endogenous murine miRNA that is the basis of the miRNA vector system developed in the laboratory of David Turner Chung ef al 2006 This also provides a four nucleotide 5 overhang compatible with a 4 nucleotide overhang in the provided linearized pcDNA 6 2 GW EmGFP miR to clone the double stranded oligo Reverse complement of the 21 nucleotide target sequence mature miRNA sequence When transcribed this is the core sequence that
53. form intramolecular hairpins if heated above room temperature These hairpins will not clone into pcDNA 6 2 GW EmGFP miR Incorrect vector insert ratio used in ligation reaction Forgot to dilute annealed target ds oligo or miR acZ positive ds control oligo 1 5 000 before use Annealed ds oligo diluted incorrectly Dilute the 50 uM ds oligo mixture as instructed on page 23 to generate a 10 nM stock Use the 10 nM ds oligo stock for cloning Ligation reaction not adequately mixed or incorrectly mixed prior to incubation Mix the ligation reaction well by pipetting up and down Note Flicking the tube is not adequate to mix the reagents Do not vortex the ligation reaction Did not use the 5X Ligation Buffer supplied with the kit Use the T4 DNA Ligase and 5X Ligation Buffer supplied with the kit for ligation as these reagents have been optimized to facilitate 5 minute ligation at room temperature Important Other T4 DNA Ligase and ligation buffers may not support 5 minute room temperature ligation Ligation reaction not incubated for long enough Extend the incubation time of the ligation reaction up to 2 hours at room temperature Ligation reaction incubated overnight at 16 C The ligation conditions used to clone the ds oligo into pcDNA 6 2 GW x EmGFP miR differ from traditional ligation conditions Incubate the ligation reaction at room temperature for 5 minutes 50 Co
54. g e g a laboratory coat when handling Blasticidin Weigh out Blasticidin and prepare solutions in a hood Blasticidin may be obtained separately from Invitrogen Catalog no R210 01 in 50 mg aliquots Blasticidin is soluble in water Sterile water is generally used to prepare stock solutions of 5 to 10 mg ml e Dissolve Blasticidin in sterile water and filter sterilize the solution e Aliquot in small volumes suitable for one time use see next to last point below and freeze at 20 C for long term storage or store at 4 C for short term storage e Aqueous stock solutions are stable for 1 2 weeks at 4 C and 6 8 weeks at 20 C e pH ofthe aqueous solution should be 7 0 to prevent inactivation of Blasticidin e Do not subject stock solutions to freeze thaw cycles do not store in a frost free freezer e Upon thawing use what you need and store the thawed stock solution at 4 C for up to 2 weeks e Medium containing Blasticidin may be stored at 4 C for up to 2 weeks Recipes Spectinomycin LB Luria Bertani Medium and Plates Low Salt LB Plates with Blasticidin Use this procedure to prepare a 10 mg ml stock solution of spectinomycin Materials Needed e Spectinomycin Dihydrochloride Sigma Catalog no 54014 e Sterile deionized water Procedure 1 Weigh out 50 mg of spectinomycin and transfer to a sterile centrifuge tube 2 Resuspend the spectinomycin in 5 ml of sterile deionized water to p
55. gation of the ds oligo insert into the pcDNA 6 2 GW EmGFP miR vector One Shot TOP10 Chemically Competent E coli for high efficiency transformation of the ligation reaction The BLOCK iT Pol II miR RNAi Expression Vector Kits also includes a negative control plasmid and a ds positive control oligo TM The pcDNA 6 2 GW x EmGFP miR neg control plasmid contains an insert that can form a hairpin structure that is processed into mature miRNA but is predicted not to target any known vertebrate gene Thus this plasmid serves as a suitable negative control for pre miRNA experiments with pcDNA 6 2 GW x EmGFP miR expression vectors The neg control sequence without 5 overhangs is shown below for map see page 61 62 5 GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT 3 The miR acZ positive double stranded ds control oligo serves as a positive control during the miRNA expression vector generation Use this oligo to TM generate a pcDNA 6 2 GW x EmGFP miR lacZ expression clone Co transfecting the resulting pcDNA 6 2 GW x EmGFP miR lacZ expression clone targeting the lacZ gene and the pcDNA 1 2 V5 GW lacZ reporter plasmid supplied with the kit into mammalian cells provide a means to assess the RNAi response in your cell line by assaying for knockdown of B galactosidase Continued on next page BLOCK iT Pol Il miR RNAi Expression Vector Kits continued Generating an miRNA Express
56. ggest trying the following to improve your sequencing results Use high quality purified plasmid DNA for sequencing We recommend preparing DNA using Invitrogen s PureLink HQ Mini Plasmid Purification Kit Add DMSO to the sequencing reaction to a final concentration of 5 Increase the amount of template used in the reaction up to twice the normal concentration Standard sequencing kits typically use dITP in place of dGTP to reduce G C compression Other kits containing dGTP are available for sequencing G rich and GT rich templates If you are using a standard commercial sequencing kit containing dITP obtain a sequencing kit containing dGTP e g dGTP BigDye Terminator v3 0 Cycle Sequencing Ready Reaction Kit Applied Biosystems Catalog no 4390229 and use a 7 1 molar ratio of dITP dGTP in your sequencing reaction If sequencing problems persist use an alternative sequencing protocol that employs Msc I digestion 1 Before sequencing digest the vector with Msc I which cuts once within the miRNA loop and once elsewhere in the backbone Purify the digested product by cleanup on a miniprep column or extraction and precipitation it is not necessary to gel purify Sequence the digested vector in independent runs with the forward and reverse primers The reads will terminate in the middle of the Msc I site but should be very strong and clear to that point For an example of the sequence of the pre miRNA insert of the
57. grees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party who has a license from Invitrogen under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of t
58. gy including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 69 References Ambros V 2001 MicroRNAs Tiny Regulators with Great Potential Cell 107 823 826 Ambros V 2004 The functions of animal microRNAs Nature 431 350 355 Anandalakshmi R Pruss G J Ge X Marathe R Mallory A C Smith T H and Vance V B 1998 A Viral Suppressor of Gene Silencing in Plants Proc Natl Acad Sci USA 95 13079 13084 Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Bartel D P 2004 MicroRNAs genomics biogenesis mechanism and function Cell 116 281 297 Bernstein E Caudy A A Hammond S M and Hannon G J 2001 Role for a Bidentate Ribonuclease in the Initiation Step of RNA Interference Nature 409 363 366 Boden D Pusch O Silbermann R Lee F Tucker L and Ramratnam B 2004 Enhanced gene silencing of HIV 1 specific siRNA using microRNA desig
59. h the appropriate sequences required for cloning into the pcDNA 6 2 GW EmGFP miR vector and for annealing See the figure below for an illustration e Top strand oligo Make sure that this oligo contains the sequence TGCTG at the 5 end e Bottom strand oligo Make sure that this oligo contains the sequence CCTG at the 5 end has a C at the 3 end and is complementary to the top strand Top strand oligo 5 TGCTG 4 3 T Bottom strand oligo 5 CCTG 4 C3 Annealing 5 TGCTG 4 3 3 C 4 GTCC 5 Note BLOCK iT miR RNAi Select oligos have been designed to contain all these sequence elements ds oligo If you have ordered BLOCK iT miR RNAi Select you will receive up to 8 tubes containing 4 top oligos and 4 bottom DNA oligos per gene enough to clone up to four different miR RNAi expression vectors Each tube is marked with a unique code an example is shown below Hmi123456 top SYMB The code consists of three parts separated by dashes e Aunique miR RNAi identifier starting with Hmi for human Mmi for mouse and Rmi for rat RNAi oligos followed by six digits e A strand indicator top for the top strand bot for the bottom strand e The gene symbol may be partly abbreviated due to space constraints Make sure you anneal the two matching single stranded oligos Anneal the two oligos marked top and bot
60. he annealing reaction Problem Reason Solution Weak band Single stranded oligos designed Verify that the sequence of the bottom strand representing ds oligo observed on an agarose gel incorrectly oligo is complementary to the sequence of the top strand oligo If not re synthesize the bottom strand oligo Allowed oligos to cool at 4 C instead of room temperature during annealing procedure After heating to 95 C anneal the oligos by setting the microcentrifuge tube at room temperature for 5 10 minutes see the procedure on page 22 Did not anneal equal amounts of top and bottom strand oligo Anneal equal amounts of the top and bottom strand oligo using the procedure on page 22 No band representing ds oligo observed on an agarose gel Single stranded oligos designed incorrectly Verify that the sequence of the bottom strand oligo is complementary to the sequence of the top strand oligo If not re synthesize the bottom strand oligo Used the wrong single stranded oligos Make sure that you mix single stranded oligos with complementary sequence Did not anneal or annealed incorrect BLOCK T miR RNAi Select oligos Anneal the two oligos marked top and bot with the same miR RNAi identifier see page 21 Ligation and The table below lists some potential problems and possible solutions that may Transformation help you troubleshoot the ligation and transformation proc
61. he foregoing patents was used in the manufacture of such product Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the use of this product to man ufacture a protein for sale provided that no method claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 For additional information about Invitrogen s policy for the use and distribution of Gateway clones see the section entitled Gateway Clone Distribution Policy page 69 Continued on next page Purchaser Notification continued Limited Use Label License 51 Blasticidin and the Blasticidin Selection Marker Limited Use Label License No 127 GFP with Heterologous Promoter Limited Use Label License No 198 Fluorescent Protein Products Limited Use Label License No 267 Mutant Green Fluorescent Products Limited Use Label License No 270 miRNA Vectors Blasticidin and the blasticidin resistance gene bsd are the subject of U S patents sold under patent license for research purposes only For inf
62. hey will be 90 95 confluent at the time of transfection Increase the amount of plasmid DNA transfected Optimize the transfection conditions for your cell line by varying the amount of Lipofectamine 2000 used Low levels of gene knockdown observed other causes Didn t wait long enough after transfection before assaying for gene knockdown Repeat the transfection and wait for a longer period of time after transfection before assaying for gene knockdown Perform a time course of expression to determine the point at which the highest degree of gene knockdown occurs ds oligo insert in your pcDNA 6 2 GW x EmGFP miR construct contains mutations When analyzing spectinomycin resistant transformants sequence the ds oligo insert to verify its sequence Select constructs containing the correct ds oligo insert for use in RNAi analysis miRNA sequence not optimal due to selected target region Select a different target region Order BLOCK iT miR RNAi Select for your target gene see page xi which allows you to generate four different miR RNAi expression vectors We guarantee that at least two out of the four BLOCK iT miR RNAi Select expression vectors will result in gt 70 knockdown of the target gene provided that the transfection efficiency in your experiment is at least 80 52 Continued on next page Troubleshooting continued Transfection and RNAi Analysis continued
63. iR RNAi Expression System manual supplied with Catalog nos K4937 00 and K4938 00 for a detailed description of the lentiviral expression reagents provided with the kit and instructions to produce lentivirus For instructions to grow and maintain the 293FT Cell Line refer to the 293FT Cell Line manual available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 65 Accessory Products Introduction Accessory Products The products listed in this section may be used with the BLOCK iT Pol II miR RNAi Expression Vector Kits For more information refer to our Web site www invitrogen com or call Technical Service see page 65 Some of the reagents supplied in the BLOCK iT Pol II miR RNAi Expression Vector Kits as well as other products suitable for use with the kit are available separately from Invitrogen Ordering information is provided below Item Amount Catalog no BLOCK iT Lentiviral Pol II miR RNAi 20 reactions K4937 00 Expression Vector System BLOCK iT Lentiviral Pol II miR RNAi 20 reactions K4938 00 Expression System with EmGFP BLOCK iT Pol II miR XXXX Validated 10 ug V49300 01 miRNA DuoPak through XXXX gene symbol V49300 53 BLOCK T miR RNAi Select 50 nmol scale See page xi T4 DNA Ligase 100 units 15224 017 500 units 15224 025 One Shot TOP10 Chemically Competent 10 reactions C
64. ia Shimomura et al 1962 GFP emits fluorescence upon excitation and the gene encoding GFP contains all of the necessary information for posttranslational synthesis of the luminescent protein GFP is often used as a molecular beacon because it requires no species specific cofactors for function and the fluorescence is easily detected using fluorescence microscopy and standard filter sets GFP can function as a reporter gene downstream of a promoter of interest and upstream of one or more pre miRNAs Modifications have been made to the wild type GFP to enhance its expression in mammalian systems These modifications include amino acid substitutions that correspond to the codon preference for mammalian use and mutations that increase the brightness of the fluorescence signal resulting in enhanced GFP Zhang et al 1996 Mutations have also arisen or have been introduced into GFP that further enhance and shift the spectral properties of GFP such that these proteins will emit fluorescent color variations reviewed in Tsien 1998 The Emerald GFP EmGFP is such a variant of enhanced GFP We have observed reduced EmGFP expression from miRNA containing vectors due to processing of the transcripts In most cases EmGFP expression should remain detectable Continued on next page 11 Green Fluorescent Protein Continued EmGFP EmGFP Fluorescence Filter Sets for Detecting EmGFP Fluorescence 12 The EmGFP variant h
65. ical Service see page 65 This manual provides the following information e An overview of the pathway by which miRNA facilitates gene knockdown in mammalian cells e Rules to design the appropriate single stranded oligonucleotides representing the target gene e Instructions to anneal the single stranded oligonucleotides to generate a double stranded oligonucleotide ds oligo e Instructions to clone the ds oligo into the pcDNA 6 2 GW EmGFP miR vector and transform the ligation reaction into competent E coli TM e Guidelines to transfect your pcDNA 6 2 GW EmGFP miR construct into mammalian cells for transient analysis or to generate stable cell lines e Guidelines to perform the chaining reaction to enable co cistronic expression of multiple pre miRNAs from one construct e Guidelines for detection of the EmGFP expressed from pcDNA 6 2 GW EmGFP miR e Information to perform a Rapid BP LR recombination reaction with a suitable Gateway destination vector to generate an expression clone Continued on next page Overview continued Important The BLOCK iT Pol II miR RNAi Expression Vector Kits are designed to help you generate a CMV promoter based vector to express miRNA in mammalian cell lines for RNAi analysis Although the kit has been designed to help you express miRNA representing a particular target sequence in the simplest most direct fashion use of the kit for RNAi analysis assumes that us
66. id sse 61 Map and Features of pcDNA 6 2 GW EmGFP miR neg control plasmid sss 62 Explanation of Features of pcCDNA 6 2 GW EmGEPP miR eese nter tettentntententenn 63 Map of pcDNA T 2 VX5 GW lacZ siiitetit tete t deerat on temo a t on ires 64 deehrnicabSeryice s ain c tm e eite ae to eda 65 Purchaser Notification cosi Cur tute ie Ce EU DUE IRAE INS 66 Gateway Clone Distribution Policy 2d danda pali beenden Hae dn Debet Meet LER ed eB o ede 69 REFETEN zi RE E ER RN NI Biante iat et EE Tat A AS he i ata LG ls tale ES 70 Expression Clone Generation for Experienced Users Introduction This quick reference sheet is provided for experienced users of the BLOCK iT TM Pol II miR RNAi Expression Vector Kits If you are performing the annealing cloning or transformation procedures for the first time follow the detailed protocols provided in the manual Step Action Design single stranded DNA oligos Follow the guidelines on pages 14 18 to design single stranded DNA oligos encoding the pre miRNA of interest Anneal the single stranded 1 Set up the following annealing reaction oligos to generate a ds oligo 200 uM top strand oligo 5 ul 200 uM bottom strand oligo 5 ul 10X Oligo Annealing Buffer 2 ul DNase RNase free water 8 ul Total volume 20 ul 2 Heatthe reaction mixture at 95 C for 4 minutes 3 Remove the sample and set on the labora
67. ifferent genes usually results in slightly reduced knockdown of each gene Chaining different miRNAs targeting the same gene or repeating one miRNA can enhance knock down Due to increased processing EmGFP expression is attenuated by miRNA chaining Sal I Xho I pre miRNA Expression Cassette 1 BamHI j Bel Il Sal I ES Xho I pre miRNA Expression Cassette 2 BamHI i Bel II 44 Dual pre miRNA Sal I T ae I Expression iia ii Cassette 1 amp 2 Two strategies of restriction digestions are possible e Acombination of BamH I and Xho I to excise the pre miRNA insert and Bgl II and Xho I to digest the pre miRNA expression vector used as backbone e A combination of Sal I and Bgl II to excise the pre miRNA insert and Sal I and BamH I to digest the pre miRNA expression vector used as backbone Below the procedure for the first strategy is described For the second strategy change the restriction enzymes used in the procedure Continued on next page Chaining pre miRNAs continued Procedure for Chaining Below is a protocol for chaining of miRNAs 1 Insert Digest 2 ug pcDNA 6 2 GW EmGFP miR 1 with 10 units BamH I and 10 units Xho I for 2 hours at 37 C Backbone Digest 1 ug pcDNA 6 2 GW x EmGFP miR 2 with 10 units Bgl II and 10 units Xho I for 2 hours at 37 C Run fragments on 296 E Gel or other high percentage agarose gels Excise the backbone and insert fragments from the gel Purify the fragments u
68. ion Vector Using the Kit Features of the pcDNA 6 2 GW x EmGFP miR Vectors 10 Using the reagents supplied in the BLOCK iT Pol II miR RNAi Expression Vector Kits you will perform the following steps to generate an expression clone in pcDNA 6 2 GW x EmGFP miR 1 Design and synthesize two complementary single stranded DNA oligonucleotides with one encoding the miRNA of interest Alternatively TM order BLOCK iT miR RNAi Select oligos targeting your gene s see page xi Anneal the single stranded oligonucleotides to generate a double stranded oligo ds oligo Clone the ds oligo into the linearized pcDNA 6 2 GW x EmGFP miR vector Transform the ligation reaction into One Shot TOP10 chemically competent E coli and select for spectinomycin resistant transformants TM Use the pcDNA 6 2 GW x EmGFP miR expression construct for transient RNAi analysis in mammalian cells isolate stable cell lines expressing the miRNA or perform a Gateway recombination reaction with a suitable Gateway destination vector to generate a different expression clone The pcDNA 6 2 GW x EmGFP miR Vectors contain the following features Human CMV promoter for high level constitutive expression of the miRNA from a RNA Polymerase II dependent promoter 5 and 3 miR flanking regions for formation of an engineered pre miRNA Cloning site containing 4 nucleotide 5 overhangs on each DNA strand for directional cloning of
69. ion of 50 ng pl TM Do not use the pEXP7 tet supplied with the BP Clonase II Enzyme Mix or pENTR gus supplied with the LR Clonase II Enzyme Mix as a positive control for the rapid protocol You will need the following materials e Expression clone see page 29 e pDONR 221 vector or other suitable donor vector resuspend to 150 ng pl in sterile water e Appropriate Multisite Gateway vectors 150 ng ul in TE Buffer pH 8 0 e pcDNA 62 GW x EmGFP miR neg control if desired supplied with the kit e BP Clonase IT enzyme mix e LRClonase Plus enzyme mix e 2 ug ul Proteinase K solution supplied with Clonase enzymes thaw and keep on ice until use e TE Buffer pH 8 0 10 mM Tris HCI pH 8 0 1 mM EDTA e Sterile 0 5 ml microcentrifuge tubes Continued on next page Performing the Rapid BP LR Recombination Reaction for Multisite Gateway Vectors Continued Linearizing Expression Clones Setting Up the Rapid BP LR Recombination Reaction Multisite Gateway We recommend that you linearize the expression clone using Eag I or BsrD I 1 Linearize 1 2 ug of the expression clone with a restriction enzyme such as Eag I or BsrD I that does not digest within the region of interest and is located outside the attB region Ethanol precipitate the DNA after digestion by adding 0 1 volume of 3M sodium acetate followed by 2 5 volumes of 100 ethanol Pellet the DNA by centrifugation Wash the pellet
70. ion signal bases 890 1161 f1 origin bases 1273 1701 SV40 early promoter and origin bases 1728 2036 EM7 promoter bases 2091 2157 Blasticidin resistance gene bases 2158 2556 SV40 polyadenylation signal bases 2714 2844 pUC origin C bases 2982 3655 Spectinomycin resistance gene C bases 3725 4735 Spectinomycin promoter C bases 4736 4869 C Complementary strand 59 Map and Features of pcDNA 6 2 GW EmGFP miR pcDNA 6 2 GW EmGFP miR 60 The figure below shows the features of the pcDNA 6 2 GW EmGFP miR vector The vector is supplied linearized between nucleotides 1518 and 1519 with 4 base pair 5 overhangs on each strand as indicated The complete sequence of pcDNA 6 2 GW EmGFP miR is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 65 Note For an explanation of the features see page 63 Dra T Sal I BamH I Bgl II 7 Xho I Dral EmGFP 5 miR flanking CAGG 3 miR flanking region ACGA region pcDNA 6 2 GW EmGFP miR Comments for pcDNA 6 2 GW EmGFP miR 5699 nucleotides CMV promoter bases 1 588 attB1 site bases 680 704 EmGFP bases 713 1432 EmGFP forward sequencing primer site bases 1409 1428 5 miR flanking region bases 1492 1518 5 overhang C bases 1515 1518 5 overhang bases 1519 1522 3 miR flanking region bases 1519 1563 attB2 site C bases 1592 1616 miRNA reverse seq
71. ionic Liposome Mediated Transfection Nature 337 387 388 Hammond S M Bernstein E Beach D and Hannon G J 2000 An RNA Directed Nuclease Mediates Genetic Interference in Caenorhabditis elegans Nature 404 293 296 Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exp Cell Res 197 229 233 Jones A L Thomas C L and Maule A J 1998 De novo Methylation and Co Suppression Induced by a Cytoplasmically Replicating Plant RNA Virus EMBO J 17 6385 6393 Ketting R F Fischer S E Bernstein E Sijen T Hannon G J and Plasterk R H 2001 Dicer Functions in RNA Interference and in Synthesis of Small RNA Involved in Developmental Timing in C elegans Genes Dev 15 2654 2659 Kim V N 2005 MicroRNA biogenesis coordinated cropping and dicing Nat Rev Mol Cell Biol 6 376 385 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin S Deaminase Gene from Aspergillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Cells Biochim Biophys ACTA 1219 653 659 Lagos Quintana M Rauhut R Yalcin A Meyer J Lendeckel W and Tuschl T 2002 Identification of tissue specific microRNAs from mouse Curr Biol 12 735 739 Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Biochem 58 913 949 Lee Y
72. ipe e LB plates containing 100 ug ml ampicillin if transforming pUC19 control e 37 C shaking and non shaking incubator Note low salt LB agar plates containing 100 pg ml Blasticidin can also be used to select for transformants Be sure to use low salt agar plates and check pH carefully for Blasticidin to work efficiently For more information on Blasticidin and recipes see page 54 and 55 Use this procedure to transform your ligation reaction into One Shot TOP10 Chemically Competent E coli For a positive control transform 10 pg 1 ul of pUC19 plasmid into a vial of One Shot TOP10 chemically competent E coli 1 Add 2 ul of the ligation reaction from Step 3 previous page into a vial of One Shot TOP10 chemically competent E coli and mix gently Do not mix by pipetting up and down 2 Incubate on ice for 5 to 30 minutes Note Longer incubations seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C Medium Cap the tube tightly and shake horizontally 200 rpm at 37 C for 1 hour po ON SOM pes o9 Spread 50 200 ul from each transformation on a pre warmed LB agar plate containing 50 ug ml spectinomycin and incubate overnight at 37 C We recommend plating two different volumes to ensure that at least one plate will have w
73. ired BLOCK iT miR RNAi Select TM A large variety of BLOCK iT RNAi products are available from Invitrogen to facilitate RNAi analysis including Stealth RNAi Validated Stealth RNAi Collection Validated miRNA Vector Collection and a large selection of RNAi vectors For details visit the RNAi Central portal or contact Technical Service page 65 Continued on next page xi Accessory Products Continued Gateway Destination Vectors xii A large selection of Gateway destination vectors are available from Invitrogen to facilitate the transfer of the pre miRNA sequence into a suitable destination vector to allow the miRNA expression in multiple systems including viral expression systems and tissue specific expression See below for a list of compatible destination vectors Destination Vector Catalog No pLenti6 V5 DEST V496 10 pLenti6 UbC V5 DEST V499 10 pEF DEST51 12285 011 pT REx DEST30 12301 016 pEF5 FRT V5 DEST Flp In V6020 20 pDEST R4 R3 12567 023 pLenti6 R4R2 V5 DEST K591 10 N terminal reporter tag vectors e g pcDNA 6 2 nGeneBLAzer DEST pcDNA 6 2 N YFP DEST 12578 068 12578 050 V358 20 Note Transferring the pre miRNA expression cassette from pcDNA 6 2 GW EmGFP miR to the pLenti6 BLOCK iT DEST destination vector will not yield a functional miRNA expression vector Expression of the pre miRNA requires the destination vector to supply a Pol II
74. it Use the One Shot TOP10 Chemically Competent E coli supplied with the kit trans formation efficiency is gt 1 x 109 cfu ug DNA Poor sequencing results Loss of sequencing signal in the hairpin region due to secondary structure formation Use high quality purified plasmid DNA for sequencing Add DMSO to the sequencing reaction to a final concentration of 5 Increase the amount of template used for sequencing up to twice the normal amount Use a 7 1 molar ratio of dITP dGTP in your sequencing reaction Cut your construct with Msc I and purify before sequencing see page 30 No colonies obtained on the selective plate Used the wrong antibiotic for selection Select for transformants on LB agar plates containing 50 ug ml spectinomycin Continued on next page 51 Troubleshooting continued Transfection and RNAi Analysis The table below lists some potential problems and possible solutions that may help you troubleshoot your transfection and knockdown experiment Problem Reason Solution Low levels of gene knockdown observed due to low transfection efficiency Antibiotics added to the media during transfection if using TM Lipofectamine 2000 Reagent Cells too sparse at the time of transfection Not enough plasmid DNA transfected Not enough Lipofectamine 2000 used Do not add antibiotics to the media during transfection Plate cells such that t
75. ith an attP substrate donor vector to create an attL containing entry TM clone This reaction is catalyzed by BP Clonase II enzyme mix LR Reaction Facilitates recombination of an attL substrate entry clone with an attR substrate destination vector to create an attB containing expression clone This TM reaction is catalyzed by LR Clonase II enzyme mix The two recombination reactions are both needed to transfer the pre miRNA expression cassette from pcDNA 6 2 GW EmGFP miR to a new destination vector BP Reaction TM pcDNA 6 2 GW x EmGFP miR is an expression clone that contains attB sites and thus needs to be recombined with a attP substrate such as PDONR 221 first to form an entry clone LR Reaction The destination vectors mentioned in this section all contain attR substrates therefore an entry clone formed by recombination of pceDNA 6 2 GW x EmGFP miR and a donor vector like pDONR 221 can be recombined with these destination vectors to form a new miRNA expression clone Performing the Rapid BP LR Recombination Reaction Introduction Important Positive Control Materials Needed The Rapid BP LR protocol is used to transfer a gene from one expression clone into another destination vector in two consecutive steps a BP reaction using a donor vector followed by an LR recombination reaction using a destination vectors without purification of the intermediate entry clone Using this pro
76. lation of Quelling Defective qde Mutants Impaired in Posttranscriptional Transgene Induced Gene Silencing in Neurospora crassa Proc Natl Acad Sci USA 94 10233 10238 Cogoni C and Macino G 1999 Gene Silencing in Neurospora crassa Requires a Protein Homologous to RNA Dependent RNA Polymerase Nature 399 166 169 Cogoni C Romano N and Macino G 1994 Suppression of Gene Expression by Homologous Transgenes Antonie Van Leeuwenhoek 65 205 209 Cole C N and Stacy T P 1985 Identification of Sequences in the Herpes Simplex Virus Thymidine Kinase Gene Required for Efficient Processing and Polyadenylation Mol Cell Biol 5 2104 2113 Cullen B R 2004 Derivation and function of small interfering RNAs and microRNAs Virus Res 102 3 9 Cullen B R 2004 Transcription and processing of human microRNA precursors Mol Cell 16 861 865 Curradi M Izzo A Badaracco G and Landsberger N 2002 Molecular Mechanisms of Gene Silencing Mediated by DNA Methylation Mol Cell Biol 22 3157 3173 Continued on next page 70 References continued Elbashir S M Harborth J Lendeckel W Yalcin A Weber K and Tuschl T 2001 Duplexes of 21 Nucleotide RNAs Mediate RNA Interference in Cultured Mammalian Cells Nature 411 494 498 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L a and Ringold G M 1989 Cat
77. loading from our Web site www invitrogen com or by contacting Technical Service see page 65 Note For an explanation of the features see page 63 es T Hc fs a Ansa m x j WV V 5 miR flanking miR neg 3 miR flanking region control region pcDNA 6 2 GW EmGFP miR neg control plasmid Comments for pcDNA 6 2 GW EmGFP miR neg control plasmid 5759 nucleotides CMV promoter bases 1 588 attB1 site bases 680 704 EmGFP bases 713 1432 EmGFP forward sequencing primer site bases 1409 1428 5 miR flanking region bases 1492 1518 miR neg control bases 1519 1578 3 miR flanking region bases 1579 1623 attB2 site C bases 1652 1676 miRNA reverse sequencing primer site C bases 1667 1686 TK polyadenylation signal bases 1705 1976 f1 origin bases 2088 2516 SV40 early promoter and origin bases 2543 2851 EM7 promoter bases 2906 2972 Blasticidin resistance gene bases 2973 3371 SV40 polyadenylation signal bases 3529 3659 pUC origin C bases 3797 4470 Spectinomycin resistance gene C bases 4540 5550 Spectinomycin promoter C bases 5551 5684 C Complementary strand Explanation of Features of pcDNA 6 2 GW EmGFP miR Explanation of pcDNA 6 2 GW x EmGFP miR vectors contain the following elements All Features features have been functionally tested and the vectors have been fully sequenced Feature Benefit CMV promoter Permits high level constitutive exp
78. mes created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technolo
79. n Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen amp Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1989 Felgner amp Ringold 1989 and electroporation Chu et al 1987 Shigekawa amp Dower 1988 Choose the method and reagent that provides the highest efficiency transfection in your mammalian cell line For a recommendation see below For high efficiency transfection in a broad range of mammalian cell lines we recommend using the cationic lipid based Lipofectamine 2000 Reagent Catalog no 11668 027 available from Invitrogen Ciccarone et al 1999 Using Lipofectamine 2000 to transfect plasmid DNA into eukaryotic cells offers the following advantages e Provides the highest transfection efficiency in many mammalian cell types e DNA Lipofectamine 2000 complexes can be added directly to cells in culture medium in the presence of serum e Removal of complexes medium change or medium addition following transfection are not required although complexes can be removed after 4 6 hours without loss of activity TM For more information on Lipofectamine 2000 Reagent refer to our Web site www invitrogen com or call Technical Service see page 65 If you have performed the positive control reaction and have cloned the miR lacZ positive ds control oligo supplied with the kit into pcDNA 6 2 GW x EmGFP miR we recommend using the resulti
80. naka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 Yekta S Shih I H and Bartel D P 2004 MicroRNA directed cleavage of HOXB8 mRNA Science 304 594 596 Yi R Qin Y Macara I G and Cullen B R 2003 Exportin 5 mediates the nuclear export of pre microRNAs and short hairpin RNAs Genes Dev 17 3011 3016 Yu J Y DeRuiter S L and Turner D L 2002 RNA Interference by Expression of Short interfering RNAs and Hairpin RNAs in Mammalian Cells Proc Natl Acad Sci USA 99 6047 6052 Yu Z Raabe T and Hecht N B 2005 MicroRNA122a Reduces Expression of the Post Transcriptionally Regulated Germ Cell Transition Protein 2 Tnp2 Messenger RNA mRNA by mRNA Cleavage Biol Reprod 18 Zeng Y Wagner E J and Cullen B R 2002 Both Natural and Designed MicroRNAs Can Inhibit the Expression of Cognate mRNAs When Expressed in Human Cells Mol Cell 9 1327 1333 Zeng Y Yi R and Cullen B R 2005 Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha Embo J 24 138 148 Zhang G Gurtu V and Kain S 1996 An Enhanced Green Fluorescent Protein Allows Sensitive Detection of Gene Transfer in Mammalian Cells Biochem Biophys Res Comm 227 707 711 2005 2007 2010 Invitrogen Corporation All rights reserved For research use only Not intended for a
81. ndersson et al 1989 Boshart et al 1985 Nelson et al 1987 We have chosen the human CMV promoter to control vector based expression of miRNA molecules in mammalian cells for the following reasons e The promoter is recognized by RNA Polymerase II and controls high level constitutive expression of miRNA and co cistronic reporter genes e The promoter is active in most mammalian cell types Note Although highly active in most mammalian cell lines activity of the viral CMV promoter can be down regulated in some cell lines due to methylation Curradi et al 2002 histone deacetylation Rietveld et al 2002 or both Design of the The engineered pre miRNA sequence structure is based on the murine miR 155 Engineered Pre sequence Lagos Quintana et al 2002 The 5 and 3 flanking regions derived miRNA from the miR 155 transcript were inserted in the vector to preserve as much as possible of the miR 155 structure We optimized the stem loop structure and a 2 nucleotide internal loop results in higher knockdown rate than the 5 nucleotide 3 nucleotide internal loop found in native miR 155 molecule An Msc I site was incorporated in the terminal loop to aid in sequence analysis Below the changes are shown made to the native miR 155 to form an engineered pre miRNAs directed against lacZ targeting sequence in bold native miR 155 optimized miR acZ Mscl 5 UG UGUGA UUGGCC UG UU UUGGCC CUGUUAAUGCUAAU UAGGGGUU N CUGAAAUCGC
82. ned hairpins Nucleic Acids Res 32 1154 1158 Bohnsack M T Czaplinski K and Gorlich D 2004 Exportin 5 is a RanGTP dependent dsRNA binding protein that mediates nuclear export of pre miRNAs RNA 10 185 191 Boshart M Weber F Jahn G Dorsch Hasler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Brummelkamp T R Bernards R and Agami R 2002 A System for Stable Expression of Short Interfering RNAs in Mammalian Cells Science 296 550 553 Carrington J C and Ambros V 2003 Role of MicroRNAs in Plant and Animal Development Science 301 336 338 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Chung K H Hart C C Al Bassam S Avery A Taylor J Patel P D Vojtek A B and Turner D L 2006 Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC miR 155 Nucleic Acids Res 34 e53 Ciccarone V Chu Y Schifferli K Pichet J P Hawley Nelson P Evans K Roy L and Bennett S 1999 Lipofectamine 2000 Reagent for Rapid Efficient Transfection of Eukaryotic Cells Focus 21 54 55 Cogoni C and Macino G 1997 Iso
83. nerate the pcDNA 1 2 V5 GW lacZ vector B galactosidase is expressed as a C terminal V5 fusion protein with a molecular weight of approximately 119 kDa The complete sequence of pcDNA 1 2 V5 GW lacZ is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 65 Comments for pcDNA 1 2 V5 GW lacZ 6498 nucleotides attB4 bases 5 25 CMV promoter bases 137 724 attB1 bases 614 637 LacZ fusion protein bases 643 3798 LacZ ORF bases 643 3714 attB2 bases 3716 3739 V5 epitope bases 3739 3780 lacZ forward 2 priming site 840 859 lacZ reverse 2 priming site 1820 1839 C TK polyadenylation signal bases 3807 4078 attB3 bases 4079 4099 bla promoter bases 4603 4701 Ampicillin b a resistance gene bases 4702 5562 pUC origin bases 5707 6380 C complementary strand Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquart
84. ng pcDNA 6 2 GW x EmGFP miR lacZ expression construct as a positive control to assess the RNAi response in your cell line Simply co transfect the pcDNA 6 2 GW x EmGFP miR acZ expression TM construct and the pcDNA 1 2 V5 GW lacZ reporter plasmid supplied with the kit into your mammalian cells and assay for knockdown of B galactosidase expression 24 48 hours post transfection using Western blot analysis or activity assay For more information about the pcDNA 1 2 V5 GW lacZ reporter plasmid recommendations for transfection and methods to assay for p galactosidase activity see the next page TM As negative control perform parallel transfections with the pcDNA 6 2 GW EmGFP miR neg control plasmid Continued on next page 33 Transfecting Cells continued pcDNA 1 2 V5 GW lacZ Reporter Plasmid Transfecting the LacZ Containing Reagents Assaying for p galactosidase Expression Note 34 The pcDNA 1 2 V5 GW lacZ reporter plasmid is supplied with the kit for use as a positive control to assay for the RNAi response in your mammalian cell line In this vector D galactosidase is expressed as a C terminally tagged fusion protein under the control of the human cytomegalovirus CMV promoter Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 See page 64 for more information The pcDNA 1 2 V5 GW lacZ vector is supplied as 500 ng l of plasmid DNA in TE Buffer pH 8 0 Dilute the stock as nece
85. ngle stranded DNA SV40 early promoter and origin Allows high level expression of the selection marker and episomal replication in cells expressing the SV40 large T antigen EM7 promoter Synthetic prokaryotic promoter for expression of the selection marker in E coli Blasticidin bsd resistance gene Permits selection of stably transfected mammalian cell lines Kimura et al 1994 SV40 polyadenylation signal Allows transcription termination and polyadenylation of mRNA pUC origin Permits high copy replication and maintenance in E coli Spectinomycin resistance gene aad A1 Allows selection of the plasmid in E coli Liebert et al 1999 Spectinomycin promoter Allows expression of the spectinomycin resistance gene in F coli 63 Map of pcDNA 1 2 V5 GW lacZ Description 64 pcDNA 1 2 V5 GW lacZ 6498 bp is a control vector expressing a C terminally tagged B galactosidase fusion protein under the control of the human cytomegalovirus CMV promoter Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 and was generated using the MultiSite Gateway Three Fragment Vector Construction Kit available from Invitrogen Catalog no 12537 023 Briefly a MultiSite Gateway LR recombination reaction was performed with pDEST R4 R3 and entry clones containing the CMV promoter lacZ gene and V5 epitope and TK polyadenylation signal Cole amp Stacy 1985 to ge
86. nsfecting Cells page 32 After that refer to the manual provided with the destination vector to take advantage of the features of the new expression clone 45 Expected Results Knockdown of Reporter Gene 46 In this experiment pcCDNA 6 2 GW EmGFP miR or pcDNA 6 2 GW miR expression vectors containing ds oligo encoding miRNA targeting the lacZ luciferase reporter genes or a negative control neg were generated following the recommended protocols and using the reagents supplied in the BLOCK iT Pol II miR RNAi Expression Vector Kits Note that the miR lacZ positive double stranded ds control oligo and negative control vectors used in this experiment are supplied with the kit GripTite 293 MSR cells Invitrogen Catalog no R795 07 were grown to 90 confluence Individual wells in a 24 well plate were transfected using Lipofectamine 2000 Reagent with 100 ng of the pcDNA 1 2 V5 GW lacZ reporter plasmid and co transfected with 300 ng of the lacZ luc or neg pre miRNA expression vectors as indicated Non specific plasmid DNA was added to a total of 500 ng DNA Cell lysates were prepared 48 hours after transfection and assayed for B galactosidase activity using the FluoReporter lacZ Galactosidase Quantitation Kit Catalog no F 2905 TM Results Potent and specific inhibition of galactosidase activity is evident from the lacZ derived miRNA and not from the luciferase derived or negative control miRNA for both the p
87. ntinued on next page Troubleshooting continued Ligation and Transformation Reactions continued Problem Reason Solution Few spectinomycin resistant colonies obtained on the selective plate continued Not enough transformation mixture plated Increase the amount of the transformation mixture plated Selective plates contained too much spectinomycin Use LB agar plates containing 50 ug ml spectinomycin for selection Did not use the competent cells supplied with the kit Use the One Shot TOP10 Chemically Competent E coli supplied with the kit trans formation efficiency is gt 1 x 109 cfu ug DNA Not enough of the ligation reaction transformed Increase the amount of ligation reaction transformed Did not perform the 1 hour grow out period before plating the transformation mixture After the heat shock step add S O C Medium and incubate the bacterial culture for 1 hour at 37 C with shaking before plating Many clones contain inserts with sequence mutations Poor quality single stranded oligos used Oligo preparation contains mutated sequences Oligo preparation contains contaminants Use mass spectrometry to check for peaks of the wrong mass Order HPLC or polyacrylamide gel PAGE purified oligos Order oligos from Invitrogen s custom primer synthesis service see our Web site for more information Did not use the competent cells supplied with the k
88. ntroduced into mammalian cells for transient expression of the miRNA sequence or stable transfectants can be generated If desired the pre miRNA sequence may be easily and efficiently transferred into the pLenti6 V5 DEST vector or other suitable destination vector by Gateway recombination reactions see page 40 Continued on next page Using miRNA for RNAi Analysis Continued Types of miRNA The BLOCK iT Pol II miR RNAi Expression Vector Kits are supplied with one of Vectors the following expression vectors that allow the expression of your engineered pre miRNA e pcDNA 6 2 GW miR Allows expression of the engineered pre miRNA under the control of the strong Pol II human CMV cytomegalovirus promoter and Herpes Simplex virus HSV thymidine kinase TK polyadenylation signal e pcDNA 62 GW EmGFP miR This vector is similar to pcDNA6 2 GW miR except the coding sequence of EmGFP Emerald Green Fluorescent Protein is incorporated into the vector such that the pre miRNA insertion site is in the 3 untranslated 3 UTR region of the fluorescent protein mRNA Addition of EmGFP allows tracking of the miRNA expression and provides strong correlation of EmGFP expression with the knockdown of the target gene by your miRNA Human CMV The BLOCK iT Pol II miR RNAi Expression Vectors contain the human Promoter cytomegalovirus CMV immediate early promoter to allow high level constitutive miRNA expression in mammalian cells A
89. ntroduction Important Amount of ds Oligo to Use Ligation Controls Important 26 Once you have generated your ds oligo and have diluted it to the appropriate concentration you will clone the ds oligo into the pcDNA 6 2 GW EmGFP miR vector and transform your ligation reaction into competent TOP10 E coli It is important to have everything you need set up and ready to use to ensure that you obtain the best results We suggest that you read the sections entitled Performing the Ligation Reaction pages 26 27 and Transforming One Shot TOP10 Competent E coli page 28 before beginning Note If you want to perform miRNA chaining refer to page 38 You will use T4 DNA Ligase and a 5X Ligation Buffer supplied with the kit to facilitate ligation of your ds oligo with the linearized pcDNA 6 2 GW EmGFP miR vector When performing the ligation reaction note the following The T4 DNA Ligase and the 5X Ligation Buffer supplied with the kit have been optimized to permit ligation of the ds oligo into the pcDNA 6 2 GW x EmGFP miR vector in 5 minutes at room temperature T4 DNA Ligase preparations and reaction buffers available from other manufacturers may not be appropriate for use in this application Note The T4 DNA Ligase and reaction buffer supplied in the BLOCK iT Pol II miR RNAi Expression Vector Kits are available separately from Invitrogen Catalog no 15224 017 e Traditional ligation reactions are performed at
90. ny animal or human therapeutic or diagnostic use 72 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
91. of U S patents and or other pending U S and foreign patent applications owned by Invitrogen Corporation The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Invitrogen Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of Clonase purchased from Invitrogen Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator a
92. on Reaction Continued 10 11 12 13 14 TM Remove the LR Clonase II enzyme mix from 20 C and thaw on ice 2 minutes Vortex the LR Clonase II enzyme mix briefly twice 2 seconds each time TM To the samples above add 2 ul of LR Clonase II enzyme mix Mix well by pipetting up and down Reminder Return LR Clonase II enzyme mix to 20 C immediately after use Incubate the reaction at 25 C for 2 4 hours Note The incubation time may be extended from 4 hours to overnight if more colonies are required Add 1 ul of the Proteinase K solution to each reaction Incubate for 10 minutes at 37 C Note You may store the reaction at 20 C for up to 1 week before transformation if desired Transform an appropriate E coli strain as recommended for your destination vector Important do not transform the LR recombination reaction into E coli strains that contain the F episome e g TOP10F These strains contain the ccdA gene and will prevent negative selection with the ccdB gene Isolate DNA using PureLink HQ Mini Plasmid Purification Kit or equivlent and perform restriction analysis to find a clone that has incorporated the pre miRNA expression cassette sequence analysis is not necessary What to Do Next Once you have obtained your new expression clone we recommend you test it by transfecting an appropriate mammalian cell line to perform transient RNAi analysis if applicable see Tra
93. oom temperature for 5 10 minutes The single stranded oligos will anneal during this time 4 Place the sample in a microcentrifuge and centrifuge briefly 5 seconds Mix gently 5 Remove 1 pl of the annealing mixture and dilute the ds oligo as directed in Diluting the ds Oligo next page 6 Store the remainder of the 50 uM ds oligo mixture at 20 C stable for at least a year Diluting the ds To clone your ds oligo or miR lacZ positive ds control oligo into pcDNA 6 2 Oligo GW EmGFP miR you must dilute the 50 uM stock to a final concentration of 10 nM i e 5 000 fold dilution We generally perform 100 fold and 50 fold serial dilutions the first into DNase RNase free water and the second into the Oligo Annealing Buffer supplied with the kit Follow the procedure below to dilute the ds oligo 1 Dilute the 50 uM ds oligo mixture from Annealing Procedure Step 5 previous page 100 fold into DNase RNase free water to obtain a final concentration of 500 nM Vortex to mix thoroughly 50 uM ds oligo lul DNase RNase free water 99 ul Total volume 100 pl 2 Dilute the 500 nM ds oligo mixture from Step 1 50 fold into Oligo Annealing Buffer as follows to obtain a final concentration of 10 nM 500 nM ds oligo lul 10X Oligo Annealing Buffer 5 pl DNase RNase free water 44 ul Total volume 50 ul Vortex to mix thoroughly Store the remaining 500 nM ds oligo stock at 20 C 4 Aliquot the 10 nM ds oligo stock and store
94. ormation on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 This product and its use is the subject of U S and foreign patents This product is sold under license from Columbia University Rights to use this product are limited to research use only and expressly exclude the right to manufacture use sell or lease this product for use for measuring the level of toxicity for chemical agents and environ mental samples in cells and transgenic animals No other rights are conveyed Not for human use or use in diagnostic or therapeutic procedures Inquiry into the availability of a license to broader rights or the use of this product for commercial purposes should be directed to Columbia Innovation Enterprise Columbia University Engineering Terrace Suite 363 New York New York 10027 This product and its use is the subject of U S and foreign patents Any use of this product by a commercial entity requires a separate license from either GE Healthcare or Invitrogen Corporation For information on obtaining a commercial license to use this product please refer to the contact information located at the bottom of this statement No rights are conveyed to modify or clone the gene encoding GFP contained in this product For information on licensing contact Licensing Department Invitrog
95. orming the Rapid BP LR Recombination Reaction for Multisite Gateway Vectors Introduction Important Positive Control Materials Needed 56 The Rapid BP LR protocol is used to transfer a gene from one expression clone into another destination vector in two consecutive steps a BP reaction using a donor vector followed by an LR recombination reaction using a destination vectors without purification of the intermediate entry clone Using this protocol allows you to generate expression clones more rapidly than the standard BP and LR protocols for Multisite Gateway destination vectors Fewer expression clones are obtained at least 10 20 of the total number of expression clones using the Rapid BP LR protocol If you wish to maximize the number of expression clones generated do not use this protocol Use the standard BP and LR as described in the Gateway Technology with Clonase II manual which is available from our web site www invitrogen com or by contacting Technical Service see page 65 This protocol is for experienced Gateway users If you are unfamiliar with the Gateway system refer to the Gateway Technology with Clonase II manual We recommend using the pcDNA 6 2 GW x EmGFP miR neg Control Plasmid supplied with the BLOCK iT Pol II miR RNAi Expression Kits as a positive control for the Rapid BP LR protocol Dilute the supplied negative control plasmid 1 10 in sterile water to obtain a final concentrat
96. ouble stranded oligonucleotide ds oligo encoding a pre miRNA oligos have to be ordered separately e Positive and negative controls for the generation and use of the expression clone Note The BLOCK iT Lentiviral Pol II miR RNAi Expression Systems additionally include components for Gateway recombination and lentiviral production Refer to the BLOCK iT Lentiviral Pol II miR RNAi Expression System manual supplied with the BLOCK iT Lentiviral Pol II miR RNAi Expression System available for downloading from our Web site www invitrogen com or available from Technical Service see page 65 Continued on next page Overview continued Advantages of the BLOCK iT Pol II miR RNAi Expression Vector Kits The BLOCK iT Pol Il miR RNAi Technology Using the BLOCK iT Pol II miR RNAi Expression Vector Kits for vector based expression of miRNA provides the following advantages e Offers a rapid and efficient way to clone ds oligo duplexes encoding a desired miRNA target sequence into a vector containing a Pol II promoter for use in RNAi analysis e Allows transient or stable expression of miRNA into mammalian cells e Enables targeting multiple genes or increasing knockdown of a single target gene with one construct e Permits visual or automated selection of cells expressing the pre miRNA through co cistronic expression of EmGFP in the BLOCK iT Pol II miR RNAi Expression Vector with EmGFP e Offe
97. positive control pcDNA 6 2 GW miR lacZ after Msc I digestion see below TAAA TORET TOO ar ea Be a 0 X amp G C COH DT TX 808 MNR 30 BigDye is a registered trademark of Applied Biosystems Continued on next page Analyzing Transformants continued Long Term Storage What to Do Next Once you have identified the correct expression clone be sure to purify the colony and make a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 5 Streak the original colony out for a single colony on an LB plate containing 50 ug ml spectinomycin Isolate a single colony and inoculate into 1 2 ml of LB containing 50 ug ml spectinomycin Grow until the culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial Store the glycerol stock at 80 C Note Low salt LB containing 100 ug ml Blasticidin can also be used to grow transformants TM Once you have obtained your pcDNA 6 2 GW x EmGFP miR expression clone you have the following options Transfect the expression clone directly into the mammalian cell line of interest to perform transient RNAi analysis see Transfecting Cells next page Transfect the expression clone directly into the mammalian cell line of interest and isolate stable transfectants that knock down the gene of interest constitutively see Generating a Stable Cell Line page 36 Pe
98. products listed below Product Catalog no BLOCK iT Pol II miR RNAi Expression Vector Kit K4935 00 BLOCK iT Pol II miR RNAi Expression Vector Kit with EmGFP K4936 00 BLOCK iT Lentiviral Pol II miR RNAi Expression System K4937 00 BLOCK iT Lentiviral Pol II miR RNAi Expression System with K4938 00 EmGFP The BLOCK iT Pol II miR RNAi Expression Vector Kits and BLOCK iT Lentiviral Pol II miR RNAi Expression Systems include the following components For a detailed description of the contents of the BLOCK iT miRNA Expression Vector Kits see pages vii ix For a detailed description of the contents of the BLOCK iT Lentiviral Pol II miR RNAi Expression reagents see the BLOCK iT Lentiviral Pol II miR RNAi Expression System manual TM Component Catalog no K4935 00 K4936 00 K4937 00 K4938 00 BLOCK iT Pol II miR RNAi y Expression Vector Kit BLOCK iT Pol II miR RNAi Y Expression Vector Kit with EmGFP 4 BLOCK iT Lentiviral Pol II miR RNAi Expression Reagents The BLOCK iT miRNA Expression Vector Kits are shipped as described below Upon receipt store each item as detailed below Note For information about the BLOCK iT Lentiviral Pol II miR RNAi Expression Reagents Box 3 11 supplied with the BLOCK iT Lentiviral Pol II miR RNAi Expression Systems refer to the BLOCK iT Lentiviral Pol II miR RNAi Expression System manual
99. ptions may occur Length The target sequence should be 21 nucleotides in length Complexity e Make sure that the target sequence does not contain runs of more than three of the same nucleotide e Choose a sequence with low to moderate GC content 30 50 GC content is suggested e Do not choose a target sequence that is a known site for RNA protein interaction e Avoid the following restriction sites which may be used for optional advanced features later Restriction site Sequence Advanced Feature Page MscI TGGCCA Alternate sequencing protocol 30 BamH I GGATCC miRNA chaining 38 Bel II AGATCT miRNA chaining 38 Sall GTCGAC miRNA chaining 38 Xho I CTCGAG miRNA chaining 38 Dra I TTTAAA Removal EmGFP 40 Homology Make sure that the target sequence does not contain significant homology to other genes as this can increase off target RNAi effects Orientation Choose a target sequence encoding the sense sequence of the target mRNA To generate the top oligo sequence combine these elements from 5 end to 3 end 1 5 TGCTG 2 Reverse complement of the 21 nucleotide sense target sequence This is the Mature miRNA Sequence GTTTIGGCCACTGACTGAC terminal loop Nucleotides 1 8 5 3 of sense target sequence 5 Nucleotides 11 21 5 3 of sense target sequence Continued on next page Designing the Single Stranded DNA Oligos continued Generating the Bottom Oligo Sequence E
100. r any target gene of interest The RNAi Designer incorporates the guidelines provided in this manual as well as other design rules into a proprietary algorithm to design microRNA sequences that are compatible for use in cloning into the BLOCK iT Pol II miR RNAi Expression Vectors Invitrogen has predesigned miR RNAi sequences called BLOCK iT miR RNAi Select targeting gt 70 of the human mouse and rat RefSeq genes TM BLOCK iT miR RNAi Select provides up to 4 miR sequences per gene that are supplied as 8 tubes containing 4 top oligos and 4 bottom DNA oligos Upon annealing and cloning into one of the BLOCK iT Pol II miR RNAi Expression vectors pcDNA 6 2 GW miR or pcDNA 6 2 GW EmGFP miR these oligos generate up to four different miR RNAi expression vectors directed against your gene of interest The resulting miR RNAi expression vectors can be transfected into cells to knock down the gene of interest or the hairpins can be transferred into lenti vectors to knock down the gene of interest in hard to transfect or primary cells We guarantee that at least two out of the four miR RNAi expression vectors will result in gt 70 knockdown of the target gene provided that the transfection efficiency in your experiment is at least 80 Order BLOCK iT miR RNAi Select online using the BLOCK iT RNAi Express search engine www invitrogen com rnaiexpress Just enter the gene name accession number or keyword and choose your des
101. re of the pri miRNA to generate small hairpin precursor miRNAs pre miRNAs which are 70 nucleotides in length Zeng et al 2005 The pre miRNAs are exported from the nucleus to the cytoplasm by exportin 5 a nuclear transport receptor Bohnsack et al 2004 Yi et al 2003 Following the nuclear export the pre miRNAs are processed by Dicer into a 22 nucleotides miRNA mature miRNA molecule and incorporated into an miRNA containing RNA induced silencing complex miRISC Cullen 2004 Continued on next page Using miRNA for RNAi Analysis Continued Translational Repression versus Target Cleavage Using a Vector Based System to Express Engineered miRNA The mature miRNAs regulate gene expression by mRNA cleavage mRNA is nearly complementary to the miRNA or translational repression mRNA is not sufficiently complementary to the miRNA Target cleavage can be induced artificially by altering the target or the miRNA sequence to obtain complete hybridization Zeng et al 2002 In animals most miRNAs imperfectly complement their targets and interfere with protein production without directly inducing mRNA degradation Ambros 2004 Nonetheless these miRNAs are found associated with the RNAi nuclease AGO2 Liu et al 2004 Meister et al 2004 and at least two miRNAs with close matches to their target sequences particularly in their 5 regions have been shown to cleave cognate mRNAs Yekta et al 2004 Yu et al 2005
102. ression of the gene of interest Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 miRNA forward sequencing primer Allows sequencing of the insert for pcDNA 6 2 GW miR vectors attB1 and attB2 sites Bacteriophage A derived recombination sequences that allow recombinational cloning of a gene of interest in the expression construct with a Gateway destination vector Landy 1989 EmGFP coding sequence Allows visual detection of transfected mammalian cells using fluorescence microscopy for pcDNA 6 2 GW EmGFP miR vector EmGFP forward sequencing primer Allows sequencing of the insert for pcDNA 6 2 GW EmGFP miR vector 5 miR flanking region Allows formation of functional engineered pre miRNA 5 overhangs Allows ligase mediated directional cloning of the double stranded oligonucleotide of interest miR neg control Allows formation of a pre miRNA hairpin sequence predicted not to target any known vertebrate gene only for pcDNA 6 2 GW EmGFP miR neg control Sequence without 5 overhangs is shown below 5 GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT 3 3 miR flanking region Allows formation of functional engineered pre miRNA miRNA reverse sequencing primer Allows sequencing of the insert TK polyadenylation signal Allows transcription termination and polyadenylation of mRNA f1 origin Allows rescue of si
103. rform miRNA chaining to express multiple pre miRNAs from one single construct see Chaining multiple pre mi RNAs page 38 Remove the EmGFP coding sequence from your pcDNA 6 2 GW EmGFP miR expression clone see Removing EmGFP Coding Sequence page 36 Perform an LR recombination reaction with your expression construct and a suitable Gateway destination vector to generate an expression clone in an alternative backbone see Performing the Rapid BP LR Recombination Reaction page 40 31 Transfecting Cells Introduction Factors Affecting Gene Knockdown Levels Plasmid Preparation 32 TM This section provides general guidelines to transfect your pcDNA 6 2 GW EmGFP miR expression construct into the mammalian cell line of interest to perform transient RNAi analysis Performing transient RNAi analysis is useful to e Quickly test multiple miRNA sequences to a particular target gene e Quickly screen for an RNAi response in your mammalian cell line e Test the effect of gene knock down on your particular transient assay Once you have tested various miRNA target sequences using transient transfection you may use the most efficient miRNA expression clone for further transient assays generate stable transfectants or transfer the optimal miRNA expression cassettes into suitable destination vectors for use in other RNAi applications e g use of alternative promoters and or viral transduction A number of factors c
104. roduce a 10 mg ml stock solution 3 Filter sterilize 4 Store the stock solution at 4 C for up to 2 weeks For long term storage store at 20 C Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes at 15 psi Allow solution to cool to 55 C and add antibiotic if needed Store at room temperature or at 4 C For LB agar plates Prepare LB medium as above but add 15 g L agar before autoclaving Autoclave on liquid cycle for 20 minutes at 15 psi After autoclaving cool to 55 C add antibiotic if needed and pour into 10 cm plates 9 Let harden then invert and store at 4 C Oy OVE Composition 10 g Tryptone 5 g NaCl 5 g Yeast Extract 1 Combine the dry reagents above and add deionized distilled water to 950 ml Adjust pH to 7 0 with 1 N NaOH and bring the volume up to 1 liter For plates add 15 g L agar before autoclaving 2 Autoclave on liquid cycle at 15 psi and 121 C for 20 minutes 3 Allow the medium to cool to at least 55 C before adding the Blasticidin to 100 g ml final concentration 4 Let harden then invert and store at 4 C Store plates at 4 C in the dark Plates containing Blasticidin S HCl are stable for up to 2 weeks 55 Perf
105. rs easy transfer of the pre miRNA expression cassette into Gateway adapted viral expression systems or vectors driven by a variety of promoters including tissue specific and regulated promoters for in vivo experiments e Permits design of predictable RNAi constructs with a high rate of success TM e n conjunction with the pre designed BLOCK iT miR RNAi Select oligos covers gt 70 of the human mouse and rat RefSeq genes with a guaranteed rate of success The BLOCK iT Pol II miR RNAi Technology is a next generation RNAi technology employing miRNA expression vectors that allow flexible expression of knockdown cassettes driven by RNA Polymerase II Pol II promoters in mammalian cells See page 5 for more details The BLOCK iT Pol II miR RNAi Expression Vectors are specifically designed to allow expression of miRNA sequences and contain specific miR flanking sequences that allow proper processing of the miRNA The expression vector design is based on the miRNA vector system developed in the laboratory of David Turner U S Patent Publication No 2004 0053876 and includes the use of endogenous murine miR 155 flanking sequences see page 7 for details TM A variety of BLOCK iT RNAi products are available from Invitrogen to facilitate RNAi analysis in mammalian and invertebrate systems For more information about any of the BLOCK iT RNAi products see the RNAi Central application portal at www invitrogen com rnai or contact
106. s refer to our Web site www invitrogen com or contact Technical Service see page 65 Destination Vector Catalog No pLenti6 V5 DEST V496 10 pLenti6 UbC V5 DEST V499 10 pEF DEST51 12285 011 pT REx DEST30 12301 016 pEF5 FRT V5 DEST Flp In V6020 20 pDEST R4 R3 12567 023 pLenti6 R4R2 V5 DEST K591 10 N terminal reporter tag vectors e g pcDNA 6 2 nGeneBLAzer DEST 12578 068 12578 050 pcDNA 6 2 N YFP DEST V358 20 Note the pLenti6 V5 DEST vector is also provided in the BLOCK iT Lentiviral Pol II miR RNAi Expression Systems TM Transferring the pre miRNA expression cassette from pcDNA 6 2 GW x EmGFP miR to the pLenti6 BLOCK iT DEST destination vector will not yield a functional miRNA expression vector because these vectors do not carry a Pol II promoter upstream of the att R1 site Transfer to pLenti6 V5 DEST as described in the BLOCK iT Lentiviral Pol II miR RNAi Expression System manual available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 65 Continued on next page 41 Transferring the Pre miRNA Expression Cassette to Destination Vectors continued Recombination Reactions Generation of new miRNA expression clones 42 Two recombination reactions constitute the basis of the Gateway Technology BP Reaction Facilitates recombination of an attB substrate like a linearized attB expression clone w
107. s not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 65 Purchaser Notification Introduction Limited Use Label License No 19 Gateway Cloning Products Gateway Clone Distribution Policy 66 Use of the BLOCK iT miRNA Expression Vector Kits are covered under the licenses detailed below This product and its use is the subject
108. sing the Purelink Quick Gel Extraction Kit from Invitrogen or equivalent Ligate the purified backbone and insert fragment at a 1 4 molar ratio using T4 DNA ligase from Invitrogen or equivalent Transform competent cells such as E coli One Shot TOP10 as described on page 28 Analyze resulting clones as described on pages 29 31 Test construct for both miRNAs by transfecting cells as described on page 32 and page 46 For an example of results obtained from knockdown by a chained miRNA vector experiment see page 48 39 Removing EmGFP Coding Sequence Introduction Note Procedure for Removing EmGFP 40 Depending on your experiment it may not wish to express EmGFP from the pre miRNA expression construct If you have previously established a pcDNA 6 2 GW EmGFP miR clone that works well you can remove the EmGFP coding sequence by Dra I digestion and self ligation of the vector forming a pcDNA 6 2 GW miR clone expressing the same pre miRNA This section describes a procedure for removing the EmGFP coding sequence from pcDNA 6 2 GW EmGFP miR TM The EmGFP coding sequence is not present on the pcDNA 6 2 GW miR vector and therefore does not have to be removed TM Below is a protocol for removing the EmGFP Coding Sequence from pcDNA 6 2 GW EmGFP miR Digest 1 ug pcDNA 6 2 GW EmGFP miR with 10 units Dra I for 2 hours at 37 C Run fragments on 0 8 E Gel or other low percentage agarose
109. ssary for use in transfection see below If you wish to propagate the plasmid transform a recA endA E coli strain such as TOP10 Use 10 ng of plasmid for transformation and select on LB agar plates containing 100 ug ml ampicillin To perform RNAi analysis using the lacZ control reagents you will co transfect the pcDNA 1 2 V5 GW lacZ reporter plasmid and the pcDNA 6 2 GW EmGFP mik lacZ expression construct that you have generated into your mammalian cell line For optimal results we recommend using 6 fold more expression construct DNA than reporter plasmid DNA in the co transfection For example use 600 ng of pcDNA 6 2 GW miR lacZ DNA and 100 ng of pcDNA 12 V5 GW lacZ DNA when transfecting cells plated in a 24 well format If you perform RNAi analysis using the control expression clone containing the lacZ ds oligo i e pcDNA 6 2 GW miR lacZ or pcDNA 6 2 GW EmGFP miR lacZ you may assay for p galactosidase expression by western blot analysis using B gal Antiserum Catalog no R901 25 by activity assay using cell free lysates Miller 1972 and FluoReporter lacZ Galactosidase Quantitation Kit Catalog no F 2905 or by staining the cells for activity using the B Gal Staining Kit Catalog no K1465 01 for fast and easy detection of B galactosidase expression For an example of results obtained from a B galactosidase knockdown experiment see page 46 TM The B galactosidase protein expressed from the pcDNA 1 2
110. te entry clones for future use Continued on next page 57 Performing the Rapid BP LR Recombination Reaction for Multisite Gateway vectors Continued Setting Up the Rapid BP LR Recombination Reaction Multisite Gateway continued What to Do Next 58 Protocol continued from the previous page 7 Add the following components to the microcentrifuge tubes containing the 6 ul Component Sample Positive Control Multisite Gateway Destination vector 1g lul 60ng ul 5 pENTR vector 60ng ul lul 1 pl 3 pENTR vector 60ng ul lul 1 pl 5X LR Clonase Plus Buffer 3 ul 3 ul TE Buffer pH 8 0 4ul 4ul BP reaction at room temperature and mix 8 Remove the LR Clonase Plus enzyme mix from 20 C and thaw on ice 2 minutes 9 Vortex the LR Clonase Plus enzyme mix briefly twice 2 seconds each time 10 To the samples above add 4 ul of LR Clonase Plus enzyme mix Mix well by pipetting up and down Reminder Return LR Clonase Plus enzyme mix to 20 C immediately after use 11 Incubate the reaction at 25 C overnight 12 Add 1 ul of the Proteinase K solution to each reaction Incubate for 10 minutes at 37 C 13 Transform an appropriate E coli strain as recommended for your destination TM vector Isolate DNA using PureLink HQ Mini Plasmid Purification Kit or equivlent and perform restriction analysis to find a clone that has incorporated the pre miRNA expression cassette sequenc
111. te nnne nnns 26 Transforming One Shot TOPIO Competent E 6l eese dee ated id ule hane 28 Analyzing Transformants cccccccccscscssssescecscesescscscenesesescsnananesesesesnsnenssesessesesesescecesescseseecanesesssesnananesesesnanenenens 29 Transfecting Cellss aet o ee eh eo epe iode e e adeste ee pte e ree eet 32 Detecting Fluorescence aee e I efie e he HIERO Lesh i Pes ECHO I E d EUIS ende bre ie tens 35 Gen rating a Stable Cell Eine eoe eee ede piae etd ae ha eed res 36 Chaining pre milRNNAS eon cnn e epe EA E ORE een HERI e rei te et Rd P eee ied 38 Removing EmGFP Coding Sequence sis ien a Ee a EENS AEE EE EEEE SESE E 40 Transferring the Pre miRNA Expression Cassette to Destination Vectors esses eee 41 Performing the Rapid BP LR Recombination Reaction ccccccccsesescsceseseseeceesesesssneneesesesnsneeneseseseeenenes 43 Expected Results oe Ren Aedui e E Gee a bt dH ease 46 Troubleshooting Re RR d eie aetate dee os ished nee iere E RUP Eee dee Hee Tenet odd 49 App peN di e aiaiai 54 Blastichd ities ET 54 iei 55 Performing the Rapid BP LR Recombination Reaction for Multisite Gateway Vectors 56 Map and Features of ppDNA 6 2 GW miR Sees eite reiten ER M RARE UMS NEA RS 59 Map and Features of pcDNA 6 2 GW EmGFP miR esee eterne tte tentettentnn entente tsntenten tein 60 Map and Features of pcDNA 6 2 GW miR neg control plasm
112. the ds oligo encoding the pre miRNA of interest Two recombination sites attB1 and attB2 sites flanking the pre miRNA expression cassette for recombinational cloning of the pre miRNA expression cassette into a Gateway destination vector Herpes Simplex virus HSV thymidine kinase TK polyadenylation signal for termination and polyadenylation of the transcript Spectinomycin resistance gene for selection in E coli pUC origin for high copy maintenance of the plasmid in E coli Blasticidin resistance gene for selection in E coli and mammalian cells to generate cell lines stably expressing the miRNA Additionally the vector pcDNA 6 2 GW EmGFP miR also contains an EmGFP coding sequence for co cistronic expression with the pre miRNA Green Fluorescent Protein Description Green Fluorescent Protein GFP GFP and Spectral Variants Note The BLOCK iT Pol II miR RNAi Expression Vector with EmGFP contains the Emerald Green Fluorescent Protein EmGFP derived from Aequorea victoria GFP within the pre miRNA expression cassette After transferring the pre miRNA expression cassette into pLenti6 V5 DEST you may produce lentiviruses that simultaneously express the EmGFP protein and miRNA allowing you to visually track the cells in which knockdown is occurring or sort the cells using a flow cytometer Green Fluorescent Protein GFP is a naturally occurring bioluminescent protein derived from the jellyfish Aequorea victor
113. tocol allows you to generate expression clones more rapidly than the standard BP and LR protocols Fewer expression clones are obtained at least 10 20 of the total number of expression clones using the Rapid BP LR protocol If you wish to maximize the number of expression clones generated do not use this protocol Use the standard BP and LR as described in the Gateway Technology with Clonase II manual which is available from our web site www invitrogen com or by contacting Technical Service see page 65 Note For Multisite Gateway destination vectors follow the alternate protocol at page 56 This protocol is for experienced Gateway users If you are unfamiliar with the Gateway system refer to the Gateway Technology with Clonase II manual We recommend using the pcDNA 6 2 GW EmGFP miR neg Control Plasmid supplied with the BLOCK iT Pol II miR RNAi Expression Kits as a positive control for the Rapid BP LR protocol Dilute the supplied negative control plasmid 1 10 in sterile water to obtain a final concentration of 50 ng pl TM Do not use the pEXP7 tet supplied with the BP Clonase II Enzyme Mix or pENTR gus supplied with the LR Clonase II Enzyme Mix as a positive control for the rapid protocol You will need the following materials e Expression clone see page 29 TM e pDONR 221 vector or other suitable donor vector resuspend to 150 ng ul in sterile water e Appropriate destination ve
114. tory bench Allow the reaction to cool to room temperature for 5 10 minutes 4 Spin down the sample in a microcentrifuge for 5 seconds Mix gently 5 Dilute the ds oligo mixture 5 000 fold by performing serial 100 fold and 50 fold dilutions the first into DNase RNase free water and the second into 1X Oligo Annealing Buffer Final concentration is 10 nM Clone the ds oligo into 1 Set up the following ligation reaction pcDNA 6 2 GW miR or 5X Ligation Buffer 4 ul p B EWRERSET pcDNA 6 2 GW EmGEP miR 5 ng ul linearized 2 pl ds oligo 10 nM 1 5 000 dilution 4 ul DNase RNase Free water 9 ul T4 DNA Ligase 1 U ul 1 ul Total volume 20 ul 2 Mix reaction well and incubate for 5 minutes at room temperature 3 Place reaction on ice and proceed to transform E coli below Transform One Shot TOP10 1 Add 2 pl of the ligation reaction into a vial of One Shot TOP10 Chemically Competent E coli chemically competent E coli and mix gently 2 Incubate on ice for 5 to 30 minutes 3 Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tube to ice 4 Add 250 ul of room temperature S O C Medium 5 Incubate at 37 C for 1 hour with shaking 6 Spread 20 100 ul of bacterial culture on a pre warmed LB agar plate containing 50 ug ml spectinomycin and incubate overnight at 37 C Kit Contents and Storage Types of Kits Kit Components Shipping Storage vi This manual is supplied with the
115. uencing primer site C bases 1607 1626 TK polyadenylation signal bases 1645 1916 f1 origin bases 2028 2456 SV40 early promoter and origin bases 2483 2791 EM7 promoter bases 2846 2912 Blasticidin resistance gene bases 2913 3311 SV40 polyadenylation signal bases 3469 3599 pUC origin C bases 3737 4410 Spectinomycin resistance gene C bases 4480 5490 Spectinomycin promoter C bases 5491 5624 C Complementary strand Map and Features of pcDNA 6 2 GW miR neg control plasmid pcDNA 6 2 GW miR neg control plasmid The figure below shows the features of the pcDNA 6 2 GW miR neg control plasmid The vector contains an insert between bases 764 and 823 that can form a hairpin structure just as a regular pre miRNA but is predicted not to target any known vertebrate gene The insert has been cloned according to the instructions in this manual see page 14 Thus this plasmid serves as a suitable negative control for pre miRNA experiments with pcDNA 6 2 GW miR expression vectors The complete sequence of pcDNA 6 2 GW miR neg control plasmid is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 65 Note For an explanation of the features see page 63 BamH I _ Bgl Il Xho I Dra I Sal I 5 miR flanking miR neg 3 miR flanking region control region pcDNA 6 2 GW miR neg control plasmid Comments for pcDNA 6 2 G
116. ve miR 155 sequence see figure on page 18 19 miRNAs are sometimes expressed in clusters in long primary transcripts driven by RNA Pol II Lee et al 2004 Our vectors support chaining of miRNAs to express them in one primary transcript thus ensuring co cistronic expression of multiple miRNAs See page 38 for details BLOCK iT Pol Il miR RNAi Expression Vector Kits Description of the System Controls The BLOCK iT Pol II miR RNAi Expression Vector Kits facilitate the generation of an expression construct that permits high level expression of a pre miRNA in mammalian cells for RNAi analysis of a target gene The kit contains the following major components The pcDNA 6 2 GW miR or pcDNA 6 2 GW EmGFP miR linearized plasmids into which a ds oligo encoding the pre miRNA will be cloned to generate an expression clone that contains the elements required for expression of the miRNA in mammalian cells The pcCDNA 6 2 GW EmGFP miR vector is supplied linearized with 4 nucleotide 5 overhangs on each strand to facilitate directional cloning of the ds oligo insert The resulting expression clone containing the pre miRNA expression cassette see page 8 may be transfected into mammalian cells for transient or stable RNAi analysis or used to transfer the pre miRNA expression cassette into a suitable destination vector using Gateway Technology T4 DNA Ligase and an optimized ligation buffer to allow 5 minute room temperature li
117. will target your gene of interest and therefore needs to be antisense to the targeted messenger RNA 19 nucleotides derived from miR 155 to form a terminal loop with an engineered Msc I site to aid in sequence analysis Nucleotides 1 8 and 11 21 of the sense target sequence Note that nucleotides 9 and 10 are removed to form a short internal loop in the mature miRNA which results in more efficient knockdown 4 nucleotides derived from endogenous miR 155 This also constitutes the four nucleotide 5 overhang compatible with a 4 nucleotide overhang in the provided linearized pcDNA 6 2 GW x EmGFP miR to clone the double stranded oligo Upon transcription the mature miRNA sequence and its complement form a stem of the pre miRNA with a short internal loop separated by a larger terminal loop The folded pre miRNA structure of miR lacZ is shown below lacZ targeting sequence in bold UG UU UUGGCC CUGAAAUCGCUGAU GUGUAGUCGUU N LLEEEEEEL ELE JL I LLEEEL EE ge A GACUUUAGCGACUA CACAUCAGCAG AG UCAGUC Continued on next page 15 Designing the Single Stranded DNA Oligos continued Choosing the Target Sequence Generating the Top Oligo Sequence 16 When performing RNAi analysis on a particular gene your choice of target sequence can significantly affect the degree of gene knockdown observed We recommend following the guidelines below when choosing your target sequence These are general recommendations only exce
118. xample of ss Oligo Design Top strand oligo Bottom strand oligo Note ds oligo N WEN 7 X Y o E To generate the bottom oligo sequence perform the following steps 1 Remove 5 TGCT from top oligo sequence new sequence starts with C 2 Take the reverse complement of the sequence from step 1 3 Add CCTG to the 5 end of the sequence from step 2 e Werecommend using Invitrogen s RNAi Designer at www invitrogen com rnai which automatically applies the design rules and produces a high rate of knockdown success e tis not necessary to add 5 phosphates to your single stranded oligos during synthesis The phosphate groups necessary for ligation are present in the linearized pcDNA 6 2 GW x EmGFP miR The diagram below illustrates the required features of the top strand and bottom strand single stranded oligos as discussed in this section This particular example lists the sequences of top and bottom strand oligos encoding an miRNA targeting the lacZ gene These ss oligos were annealed to generate the miR lacZ positive ds control oligo supplied in the kit derived from antisense target sequence sense target sequence miR 155 Mature miRNA Sequence derived from miR 155 nucleotides 1 8 and 11 21 2 TGCTGAAATCGCTGATTTGTGTAGTCGTTTTGGCCACTGACTGACGACTACACATCAGCGATTT SH sequence for loop 5 overhang derived from miR 155 reverse complement of top strand oligo sequence minus 5 overhang r TT
119. ykanen A Haley B and Zamore P D 2001 ATP Requirements and Small Interfering RNA Structure in the RNA Interference Pathway Cell 107 309 321 Paddison P J Caudy A A Bernstein E Hannon G J and Conklin D S 2002 Short Hairpin RNAs shRNAs Induce Sequence Specific Silencing in Mammalian Cells Genes Dev 16 948 958 Paul C P Good P D Winer I and Engelke D R 2002 Effective Expression of Small Interfering RNA in Human Cells Nat Biotechnol 20 505 508 Continued on next page 71 References continued Rietveld L E Caldenhoven E and Stunnenberg H G 2002 In vivo Repression of an Erythroid Specific Gene by Distinct Corepressor Complexes EMBO J 21 1389 1397 Romano N and Macino G 1992 Quelling Transient Inactivation of Gene Expression in Neurospora crassa by Transformation with Homologous Sequences Mol Microbiol 6 3343 3353 Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Shimomura O Johnson F H and Saiga Y 1962 Extraction Purification and Properties of Aequorin a Bioluminescent Protein from the Luminous hHydromedusan Aequorea Journal of Cellular and Comparative Physiology 59 223 239 Smith C J Watson C F Bird C R Ray J Schuch W and Grierson D 1990 Expression of a Truncated Tomato Polygalacturonase Gene Inhi

BLOCK-iT™ Pol II miR RNAi Expression Vector Kits

Contents

Download Pdf Manuals

Related Search

Related Contents

BLOCK-iT&trade; Pol II miR RNAi Expression Vector Kits

Contents

Download Pdf Manuals

Related Search

Related Contents

BLOCK-iT™ Pol II miR RNAi Expression Vector Kits