Home

H-Designer

image

Contents

1. i i LkLanm7 7o0e Status Bar H Designer program environment overview Title Bar The Title Bar shows the name of the window and the directory where the current application is found For example C Program Files H Designer Project Files Project1 V6E If an application file has not been saved Untitled will be displayed in the Title Bar Menu Bar There are 13 menus in the Menu Bar they are File Edit View Screen Draw Object Library Application Tool Options LadderPlus Window and Help Tool Bar Users can easily create an H Designer project by clicking the icons on the Tool Bar This feature also helps new users to familiarize themselves with the software quickly and easily Beijer Electronics MA00822 13 Instructions 14 Window Workspace This is the area where the user designs a screen The objects or data created in this area will actually be displayed on the operator terminal screen In the following sections we will talk about the function application and usage of each of the commands and menus in much more detail 2 2 File Menu The main purpose of the File menu is to manage the files created by H Designer 2 2 1 New This command allows users to create a new application and specify its properties including Application Name Panel Terminal Controller PLC Printer Multilin gual Support Control Block Status Block and so on To create a new application sel
2. Select Language Watch Dog Timer Startup Language Language 1 The General tab of the Application Properties dialog box General Tab On the General tab you can set up the operator terminal and controller model startup language and screen and control block and status block Application Name The name of the application Panel Workstation Specifies the model of operator terminal Note the resolution size and color while selecting Programming Type Selects Macro or Standard Controller PLC Specifies the type of controller the operator terminal will commu nicate with Printer Specifies the type of printer the operator terminal will print to 138 Beijer Electronics MA00822 Instructions Multi lingual Support Check this option to support multi lingual use and specify the startup language Supports up to 5 different languages including Arabic Chinese Simplified Chinese Traditional Cyrillic English Greek Japanese Korean Thai Turkish and Western European Please see section Language 1 5 for setup The Multi lingual Support function allows that only one application file for a machine that can support up to 5 languages has to be maintained Control Block Specifies the controller address to control and size The minimum size is 2 words the maximum size is 32 words the maximum size is 6 for recipe The control block enables the controller to control actions in the operator terminal such as c
3. 9 12 GE Series 90 CCM Data format and range of the controller registers which H Designer can access Word Device and Bit Device word 6 bits Discrete Input Innnnn Discrete Output amp Qnnnnn Address must be 1 or multiple of 16 1 Discrete Input nnnnn 1 12288 1 or multiple of 16 1 Discrete Output nnnnn 1 12288 1 or multiple of 16 1 Cable Drawing PLC port RS 232C 25 pin male Operator terminal to RS232C port on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting RS232C COM1 or COM2 RS232C ea Transmission Speed 19200 bps Set the SW5 OFF if parameters are set Transmission Format Size 8 bit in H Designer i Set the SW5 ON if parameters are set in Parity NONE the operator terminal Stop bit 1 bit 246 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 13 GE Fanuc 90 SNP Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Discrete Inputs nnnnn 1 12288 1 or multiple of 16 1 Discrete Outputs nnnnn 1 12288 1 or multiple of 16 1 Discrete Temporaries nnn 1 256 1 or multiple of 16 1 Discrete Internals nnnnn 1 12288 1 or multiple of 16 1 SA Discrete nnn 1 128 1 or multiple of 16 1 SB Discrete nnn 1 128 1 or multiple of 16 1 SC Discr
4. COMMENT This is a non executable instruction and it is used to comment macros SYS gt There are a number of system services which can be used in the SYS com mand Please see below for full details 1 SET_TIMER gt Specify the internal timer Format SYS SET_TIMER N N Time number N is between 0 and 7 N 1 Current Timer Value N 2 Timer Limit N 3 Time up Flag N 4 Type of Operation as below O Timer will stop when it reaches the default setting the flag will be set to 1 1 Timer resets to 0 automatically when the flag is changed to 0 or 1 When the flag is 1 the timer resets to 0 automatically When the flag is 0 the timer resets to 0 automatically STOP_TIMER gt Stops the internal timer Format SYS STOP_TIMER N 2 STOP_COUNTER gt Stop the internal counter Format SYS STOP_COUNTER N 3 WAIT_TIMER gt Wait for the time up event in the internal timer Format SYS WAIT_TIMER N The macro instruction following this command will not be executed until the timer reaches the Timer Limit Remember that the corresponding timer must be activated by the SET_TIMER service before requesting this service 222 Beijer Electronics MA00822 Macros 4 INIT_COM gt Select and initialize a COM port Format SYS INIT_COM N The word n specifies the communication setting of the COM port The for mat of the setting is shown below Bit 1 Bit 0 gt DATA Bit S 10 7
5. Hi O Limit Lo 10000 Hi 10000 Variable target range limits The target value and range limits are read from the controller The target value is stored in a bit location which is next to the Read location The low limit is next to the target value The low limit is next to the high limit When the Read location is specified as W10 the target value is stored in W11 the low limit is stored in W12 the high limit is stored in W13 Display target indicator Check this option to display target indicator Target value Specifies the target value Target needle color Specifies the color of the needle Beijer Electronics MA00822 103 Instructions 104 Display range scale Specifies the color of the range scale to display Low Range Color and High Range Color Specifies the color to display on the scale when the value is less greater than low high range Low Limit and High Limit Specifies the low limit and high limit constants For properties not explained in this section please see the section Specifying Object Properties Example of designing a Round Panel Meter object A Round Panel Meter 1 Variable Specify 0 Local Internal Memory for Read and Signed Binary for Format Set Min to 30000 and Max to 30000 Needle Select 300 degrees for Sweep Angle Scale Set Number of Major Ticks to 7 and Number of Minor Ticks to 3 Check Display mark and set Min to 30 and Max to 30 WRK GO
6. 2 2 8 Exit Exit is used to close and exit H Designer If any changes have been made the following dialog box will appear on the screen asking the user to save the changes or exit H Designer Application has changed Do you want to save No Cancel The Exit dialog box Beijer Electronics MA00822 Instructions 18 2 3 Edit Menu The primary purposes of the Edit menu include the common editing functions for H Designer screen and objects If a user does not open an image all of the light colored items in the Edit menu are unavailable The user can click the icons on the tool bar to speed edit or quickly gain use of the elements on the list by right clicking with the mouse The following sections will explain the functions that are more specific to the H Designer software A view Screen Draw Gbjecil uk Copy Duplicate Delete Select All FindiReplace Address Align Make Same Size Nudge Layer Object Attributes The Edit menu and the Edit toolbar 2 3 1 Duplicate Number of Copies W Columns 2 a W Rows 2 Cancel Spacing in pixels Horizontal 2 Vertical 2 kw Address Increment f Direction Direction The Duplicate dialog box Number of Copies Columns Specifies number of columns to duplicate Rows Specifies the number of rows to duplicate Spacing Horizontal Specifies how many pixels to space duplicate ob jects horizontally Vert
7. Cancel Drawing a Line with arrows Connected Lines and Free Form Connected Lines are used to connect lines with the movement of the mouse cursor Click mouse button once and then move the cursor somewhere else on the screen to draw a straight line between the two points This will continue until you right click with the mouse Free Form is used to create lines and curves by holding down the left mouse button while moving the mouse cursor This will continue until you right click with the mouse Style Color Arrows and Profile can be specified in the Connected Lines and Free Form dialog boxes FA 1 Screen_1 Connected Lines ID CL00009 Line Style Arrows Begin style End style E gt he Begin size Pra End size gt Profile XD 10 W 120 Redraw YO 136 H 32 Cancel Drawing Connected Lines with arrows Beijer Electronics MA00822 Instructions Rectangle and Solid Rectangle Rectangle and Solid Rectangle are used to draw rectangular shapes Type Frame and Profile can be specified in the Rectangle and Solid Rectangle dia log boxes Fill is used for the Solid Rectangle FA 1 Screen_1 Rectangle Type Normal Clipped Frame Style gt Fill Pattern Style Foreground Color Background Color fed Profile x 21 We 89 Y 38 H 77 Redraw Cancel Rectangle with clipped corners Parallelogram and Solid Paralle
8. Dynamic Rectangle The Dynamic Rectangle object changes its position radius and color according to controller registers Dynamic Rectangle ID IDROOOOZ Vanable Read Di Format Unsigned Binary x Variable Position Variable Size Variable Color Anchor Point OF i Upper lett t Upper right Lower laft Cancel C Lower right Display Format Outline Outline Color iw Fill Pattern Style L_ mE Pattern Color Background Color Variable Position The position of the object is controlled by the controller Variable Size The length of the object is controlled by the controller Variable Color The color of the object is controlled by the controller Anchor Point Specifies the anchor point for the dynamic rectangle whose position is variable and size is fixed Display Format Specifies the format of the dynamic rectangle to display For properties not explained in this section please see the section Specifying Object Properties Example of using Dynamic Rectangle Suppose that the position size and color are variable and are controlled by the con troller The Read address is W420 The operator terminal reads five simultaneous pieces of data from the controller at most The read addresses here are W420 W421 W422 W423 and W424 The fol lowing is the table of controller addresses and graphic properties Re position Re position Re size Re size Re Col
9. Pattern Style Pattern Color ji s Background Color Profile E di Redraw r 2g H 15 Cancel The Polygon Attributes dialog box Static Text The Static Text object allows you to select text font color reading order alignment and frame edge Double click on the object to display the Static Text dialog box on the screen Text tab Enter text in the Text area 16 different types of fonts can be selected Static Text Ted Frame Edge ID ITODOO9 Text Font B16 Coo E Reading Order f Left to right Fight to left Bottom to top Horizontal Alignment Left f Center t Right Vertical Alignment Top f Center f Bottom Cancel The Text tab of the Static Text dialog box For properties not explained in this section please refer to the section Font Library Beijer Electronics MA00822 Instructions Frame Edge tab Click the Select button to specify the style of frame edge Static Text Select Color im Pattern Style B Pattern Color Background Color ES B The Frame Edge tab of the Static Text dialog box Bitmap The purpose of Bitmap is to provide graphics for selection Double click on the ob ject you can then select the bitmap from the drop down list in the Static Graphic dialog box Static Graphic ID Googi U Bitmap Mane iL Mone ARROWS GBF LAMP S GBFI MiscGif GBF NUMBERS GBF Black othe
10. The steps used to create a Drop Down List object are similar to those for a List ob ject Please see the Example of designing a List object tor the complete details Remem ber to adjust the length of a list accordingly so that you are able to display all items of the list A Drop Down List object The example below shows a Drop Down List object in the operator terminal Click the object to display the list The object will then drop down a list of items from which you can choose When you select an item from the list the operator terminal will write the value associated with the item to the controller register Therefore if the item Peach is selected then the value of the controller register will be 5 Notice that once a selection is made from the object the list will disappear The Drop Down List object and the display of the register value of the item Beijer Electronics MA00822 79 Instructions 2 7 8 Indicators There are two types of indicators the Multistate Indicator and the Range Indicator Multistate Indicator The Multistate Indicator is used to indicate which state exists with text and or graphics Therefore as the operator terminal reads the contact status or the register value from the controller it can automatically display the corresponding designed content on the operator terminal screen according to the indicator The number of states is as follows 1 Bit The maximum number of states is 2
11. Two way Moves the object in two way mode Duplication Select this option to move duplicate objects with marquee the number of copies can be specified as well For properties not explained in this section please see the section Specifying Object Properties State and Graphic Tab Please see section Specifying Object Properties tor complete details Beijer Electronics MA00822 Instructions Path Tab The Graphic State is Location dependent On the Path tab this feature enables you to specify the graphic states to be changed according to different locations For instance the point 0 displays the graphic state in state 0 the point 1 displays the graphic state in state 1 Animated Graphic kl x Attributes State Graphic Fath Faint 5 Bitmap 0 lamp005a a E O Jamp005a so Redraw Graphic S habe 0 ka Mame lampllSa The Graphic State is Auto Change On the Path tab the object changes its state along the specified path You can set the starting point and ending point of the path to be displayed on this tab Animated Graphic Attributes State Graphic Path Pe X Redraw i e Beijer Electronics MA00822 107 Instructions Example of creating horizontal vertical line as a path 1 Double click on the object to display the movement path H 5 Screen_5 2 Move the cursor to the point then click to draw the movement path The revised p
12. must be in the macro LABEL gt Format LABEL A1 Note that no two labels are allowed to have the same number in one macro but the same number in different macros is acceptable CALL Call Sub macro Format CALL A1 The CALL command can assign control to a sub macro Common uses of sub macros are to execute some specific functions to pass the parameter table and complex instruction sets Note that the specified sub macro must exist and return via the RET command when the end of the sub macro is reached Then the next macro will be executed The number of sub macros is from 001 to 512 and they can be named A sub macro can also be assigned to CALL another sub macro RET gt Return to macro The RET command only exists in sub macro although CALL exists in macro Each RET command must have a corresponding CALL com mand FOR NEXT gt Loop FOR is the start of a loop and NEXT is the end of a loop Note that the maximum number of FOR loops is 3 for example the FOR A1 NEXT FOR loop is formed by the set of FOR and NEXT commands and executes the macro instructions within the FOR loop A1 times Al can be a variable or a con stant When A1 is 0 the macro will skip the FOR loop and execute the line of code following the NEXT command When A1 is greater than 0 the macro will execute the loop continuously until the end of the FOR loop The value of Al can be changed within the FOR commands Note that if A1 is too great the
13. y Outline Color B Format Unsigned Binary vl Pattern Style 3 YWariable Central Point Pattern Colar En 7 YWariable Radius Baska Variable Color Color Cancel Variable Central Point The position of the central point is controlled by the con troller Variable Radius The length of the radius is controlled by the controller Variable Color The color of the object is controlled by the controller Display Format Specifies the format of the object to display For properties not explained in this section please see the section Specifying Object Properties Example of using Dynamic Circle Suppose that the dynamic circle s central point radius and color are controlled by the controller The Read address is W430 The operator terminal can read four pieces of data simultaneously at most and the read addresses here are W430 W431 W432 and W433 The following is the table for controller addresses and graphic properties Re central Re central Re central Re central Fix Central Re central Fix Central Point Point Point Point Point Point Point Re radius Re radius Re radius Re radius Re radius Fix Radius Fix Radius Fix Color Fix Color Re Coloring Fix Color Fix Color Fix Color Re Coloring Wn Radius Wn Radius Wn Radius Wn Radius Wn X Wn X Wn Color Wn 1 X Wn 1 X Wn 1 Color Wn 1 Y Wn 1 X Wn 2 Y Wn 2 Y Wn 2 Color Wn 3 Color 116 Beijer Electronics MA00822 Instructions
14. Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Data Size 16 bit variable nnnnn 0 65534 Word 16 bits 32 bit variable Dannnn nnnnn 0 65534 Double word 32 bits Up to 28 variables can be read at one time 16 bit variable Wnnnnn Only used in word objects Only used in Bit 0 Bit 15 of each variable If written Bit 16 Bit 31 will clear as 0 32 bit variable Dnnnnn Only used in double word objects Only used in Bit 0 Bit 31 of each variable Bit Data O Bit Data C Bit Data S Bit Data A Bit Data are read only If written the action will be invalid No error messages Cable Drawing HMI COM port PLC port RS232C i g pin male Operator terminal to RS232C port 9 pin male on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS232C COM1 or COM2 RS232C Transmission Speed 9600 19200 38400 bps Set the SW5 OFF if parameters Transmission Format are set in H Designer Set the SW5 ON if parameters Parity EVEN are set in the operator terminal Stop bit 2 bit Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 17 Idec Micro 3 Data format and range of the controller registers which H Designer can access
15. H Designer Reference Manual English Foreword H Designer Reference Manual Foreword This manual is a description of H Designer the configuration tool used tocreate ap plications for the operator terminals in the H series The manual assumes that the most recent versions of the system program firmware and configuration tool are used The operator terminal can be connected to many types of automation equipment such as PLCs servo and drives In this document the expression the controller is used as a general term for the connected equipment Beijer Electronics AB MA00822 2005 11 All examples in this manual are only intended to improve understanding of the functionality and handling of the equipment Beijer Electronics AB cannot assume any liability if these examples are used in real applications In view of the wide range of applications for this software users must acquire sufficient knowledge themselves in order to ensure that it is correctly used in their specific application Persons responsible for the application and the equipment must themselves ensure that each application is in compliance with all relevant requirements standards and legislation in respect to configuration and safety Beijer Electronics AB will accept no liability for any damage incurred during the installation or use of this equipment Beijer Electronics AB prohibits all modification changes or conversion of the equipment B
16. 10 SUM_XOR Calculate the sum of a block of words by the bit wise logical exclusive or operation and save the result in the specified address Format SYS SUM_XOR N The output data will be saved in N 3 This function is convenient for macro communication applications For example SYS SUM_XOR 50 here N 50 will calculate the sum of the 50 51 52 53 internal registers Execution of this command requires the internal values of 50 51 52 and 53 N 50 represents controller station number and the internal value of 50must be 0 if no controller station is required N 1 51 represents the starting address of the block N 2 52 represents the size of the WORDS block N 3 53 represents the initial value of the summand and the sum will be saved in this address automatically The command must be set before execution Most communication protocols regulate the initial value of the summand 00H or FFH so please refer to initial value assigned by the vendor 11 READ WORDS gt Read a number of words from controller word devices or internal memory and save the result in the specified address Format SYS READ WORDS N The data will be saved in 5 This command is powerful for use in commu nication with any controller registers and can be used for setting and monitoring controller data Take for example SYS READ_WORDS 80 here N 80 Execution of this command requires the internal values of 80 81 82
17. 57600 oo The Transmission Setup dialog box Beijer Electronics MA00822 155 Instructions If Ethernet is selected for PC Port you need to input the PC address or select from the drop down list Transmission Setup PE Port Ethemet IP Address 1920 fies j ra Select an on line Ps od Cancel Selecting Ethernet for PC Port 2 11 5 Default Screen Background Style Select Options Default Screen Background Style to specify the pattern pattern col or and background color for all screens The default setting will be displayed in all screens except for the special edit screen Fatter Pattern Color m Background Color E sample The Default Screen Background Style dialog box 2 11 6 Default Frame Styles Select Options Default Frame Styles to specify the different object types with their own shape frame Then those objects will be shown as specified on the screen Default Shape f rame Object ShapesFrame Indicator Push Button Numeric Display Numeric Entry Character Display Character Entry Message Display DD_Module_2a Bar Graph bwina l 7 Panel Meter Others Emi The Default Frame Styles dialog box 156 Beijer Electronics MA00822 Instructions 2 11 7 Default Text Styles Select Options Default Text Styles to specify character size col
18. Adding the Cross link device Mitsubishi Fs Seres Simatic 57 200 via PPI 1 t Remove Rename sal Ba Simatic 7 200 via PPI 1 to 1 Default Address E IP Address 192 168 189 239 Puls Type H TED Mono Macro Note that Connection 1 is linked to the controller by COM Port while Connection 2 is linked to the controller by Cross Link Ethernet If the operator terminal using Connection 1 is to access data from the controller linked to Connection 2 follow these steps Controller register address setup Example Specify the address of the controller register 2 C0 for Siemens S7 200 Note that controller register 2 C0 refers to Connection 2 on the Connection tab denotes the separation from the register address 3 There are three ways to set this up a Double click on the object Select the Attributes tab For Write under Vari able enter the location 2 Q0 0 b Enter the address of the controller register in the object attributes dialog box Beijer Electronics MA00822 201 Ethernet Communication In the example the address is 2 C0 Set Constant Button Attributes Shape Text Graphic ID JBTNOOOOT Security shape User Level I _ Saleen ro Operator Confirmation Waiting Time Sec Vearable Write 27 LO Si Hotification a Enabled By id Set Value i Word Double Word C Character String Format Unsigned Binary Value f c Click to dis
19. CYCLIC Macro The CYCLIC Macro is executed cyclically when the screen is displayed The operator terminal will execute the BACKGROUND Macro and CLOCK Macro periodically Beijer Electronics MA00822 211 Macros 212 8 2 3 ON OFF Macros There are two ON OFF Macro commands for push button objects On Off Button Attributes Shape State Text Graphic ID IETHOOOO2 Function Shape Set e Momentary Reset C Maintained Security Minimum Hold Time Sec f E Vanable Macro Wi tite oy i Use OM Macro Edit Head H W Use OFF Macro Edit Enabled By is ON OFF macros are available for the button object ON Macro The ON Macro is executed when the button is clicked and sets a bit to ON Common uses for the ON Macro are push button actions chain process con trol initial screen display and controller register and bit initialization OFF Macro The OFF Macro is executed when the button is clicked and released sets a bit to OFE The operator terminal will execute the OFF Macro commands once Common uses for the OFF Macro are push button actions sequence process control and displaying the close screen 8 2 4 Sub Macros The Sub Macro can be selected from the Object menu Sub Macro The Sub Macro is a sub command of Macro The Sub Macro is execut ed by the operator terminal with the CALL command Common uses for the Sub Macro are to edit and save some basic functions and macro arithmetic
20. Kept Area OK a Se e o Cancel Right 5g Bottom 2g The Trim dialog box Beijer Electronics MA00822 133 Instructions 2 8 2 Font Library The Font Library supports all Windows fonts and enables defining up to 16 types You can define your preferred fonts to create a more attractive interface Times New Roman Kids 6x32 2 e 4 User defined fonts Select Library Font Library to display the Font Library dialog box Font Library User Fonts Windows Arial 18 Font Nane Bia Times Mew Roman Size 40 Style Regular Sample Arial Import rom Export ta Modify oo vo I he Font Library dialog box Import from Click to import fonts into the font library Export to Click to export fonts to the font library Modify Click to modify the format of selected font User Font User Font Hame Arial _40 windows Font Font Style arial A eqular i Anal Black F Arial Marrom Tr BatangChe F Bodoni BdCn BT Effects Underline Strikeout Sample AaBbYvzz Modifying a font in the Font Library 134 Beijer Electronics MA00822 Instructions 2 8 3 Save as Shape The Save as Shape command allows the user to save basic objects such as Line Rect angle Circle Polygon Pie Arc Scale or multiple shapes as a file in the Library A shape must be selected before saving it as ashape Multiple shapes may be selected si multaneously Select Library Save as Sha
21. The formula is Y aX b Note that only the formats Signed Binary Unsigned Binary and 32 bit Floating point support this option Gain Y aX where X the value stored in controller and Y operator terminal displayed value Offset If the initial value is not zero then set the Offset Validation and Security Variable Input Limits Set the input limits as variable The minimum is stored in the bit following the write location the maximum is stored in the bit following the minimum input value For example if the write location is W10 then the minimum is stored in W11 the maximum is stored in W12 Min Set the minimum input value Values less than the minimum input value will be warned and rejected Max Set the maximum input value Values greater than the maximum will be warned and rejected For properties not explained in this section please see the sections Set Value Button and Specifying Object Properties Beijer Electronics MA00822 73 Instructions Example of designing a basic Numeric Entry button Perform the following steps to create a basic Numeric Entry button HHHHH A basic Numeric Entry button 1 Frame Select DE_Module_2 and Black for background color 2 Variable Specifiy the controller register W100 for Write to store the value The controller model is NULL Select Unsigned Binary for Format 3 Display Format Select White for character color Allow 5 Digits in a numb
22. The function of the Replace button is to replace the objects addresses one by one use Replace All to re place all of the objects address at one time Find Replace Address Find Replace Result Address to find wD Replace New address 2 Replace Bil The Replace tab Example 1 Find Screen Address Select Type Screen to find the screen address Find Replace Address ki x lt Find Replace Address to find b Find Type Range Options ie Screen f Curent screen i Match whole word only Macro f All screens Open attribute dialog m Find Screen address Range Current screen Only finds in the current open screen All screens Finds all the screens in the application program Option Match whole word only The findings match the entry address entirely If this op tion is not selected the initial findings match the entry address including partial and entire matches Open attribute dialog To display an objects attributes double click it in the list on the Result tab If this option is not selected the object attributes dialog box is unavailable 20 Beijer Electronics MA00822 Instructions Example 2 Find Macro Address Select Type Macro to find the macro address Find Replace Address utd Eq Find Replace Address to find T Find Type Options f Screen Curent macro i Match whole word only e Macro Current screen macros fir Sub macrog All
23. but the last displayed data is not included when the screen is changed Selecting Global displays the terminal data including the last one when the screen is changed Size Specifies the number of rows of terminal data Beijer Electronics MA00822 91 Instructions Example of designing a Terminal Data object 1 Click Application Workstation Setup to set ASCII Device as Controller PLC on the General tab of the Application Properties dialog box Application Properties General Connection Miscellaneous Logging Buffers Password Application Hame Dataterminal Panel4forkstation H TEO Color Standard r Programming Type Macro Controller PLE ASCII Device Multi lingual Support l Select Language Control Black Address ay jo Status Block Address a Default Data Format Unsigned Binary id Start up Screen Size 1 startup screen Extended Control Block PP Extended Status Block m Watch Dog Timer The General tab of the Application Properties dialog box urd x 2 Specify the port method used for the connection on the Connection tab New Application s Properties General Connection Connection 1 Address o Portfmethod used for the connection COM2 hi Multi link This HMI is a multi link master Device Type ASCII Device ASCII Device Default Address lo Data Bits ja Even T
24. details N 2 82 represents the low word of the device address N 3 83 represents the high word of the device address N 4 84 represents the auxiliary address if required else set to 0 N 5 85 represents the address of the internal memory to receive the data N 5 85 DATA 1 if the bit is ON DATA 0 if the bit is OFE 13 WRITE_WORDS gt Writes a block of data in internal memory to controller word devices or internal memory Format SYS WRITE_WORDS N The data will be saved in N 5 This command is powerful for the random modification of controller data and can be used to set and monitor controller data For example SYS WRITE_WORDS 90 here N 90 Execution of this command requires the internal values of 90 91 92 93 94 95 and 296 N 90 represents the controller station number and the internal value of 290 must be 0 if no controller station is required N 1 91 represents the device type For controller device types please see the chapter Communication between Operator Terminal and Controller for full details N 2 92 represents the low word of the device address N 3 93 represents the high word of the device address N 4 94 represents the auxiliary address if required else set to 0 N 5 95 represents the source address while the size of the continuous block of data is assigned by N 6 96 N 6 96 represents the number of words in the data block 14 WRITE_Bit Set a cont
25. m v gt O u x lt Xx ie a a CIC ua lt 5 S BE alela m a e pS ua D D C D o Relay Range m 0 4 nnnn 0 FF95 m 0 4 nnnn 0 FF95 nnn 0 7FF nnnn 0 3FFF nnnn 0 3FFF nnnnn 10000 13FFF nnn 0 255 nnn 0 255 nnn 0 511 nnn 0 511 nnn 0 511 nnn 0 511 nnn 0 511 nnn 0 511 nnn 0 511 Ext Input WXnnnn and Ext Output WYnnnn cannot access the Read Block func tion LC port RS232 CABLE 15 pin male 2 SD 3 RD 2 CTS 4 RTS 9 10 SG C 7 DSR 14 12 RXD 3 RXD TXD 2 TXD 4 RTX 5 CTX GND RTX CTX GND 7 Baud Rate is set by DIP SW of CPU Baud Rate is 19200 bps Operator terminal to RS232C port on controller 250 C port RS 232 CABLE 15 pin male 2 SD 3 RD 9 CTS 4 RTS 9 10 SG 7 DSR 14 12 8 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS232C COM1 or COM2 RS232C Transmission Speed 19200 bps Set the SW5 OFF if parameters are set Transmission Format Size 7 bit in H Designer i Set the SW5 ON if parameters are set in Parity EVEN the operator terminal Stop bit 1 bit Beijer Electronics MA00822 251 Communication between Operator Terminal and Controller 252 9 16 Hust CNC Controller
26. the byte nnnnn amp nnnnn 1 make DBWnnnnn Data Area DB10 VDnnnnn nnnnn 0 65532 VDnnnnn is a double Double word word address DBWnnnn amp DBWnnnn 1 make DBDnnnn Data Area Bit DBmm DBXnnnnn b mm 2 26 b 0 e g nnnnn 0 65535 b 0 7 DB22 DBX20 0 Double word Word Double word Q Q Data Area Bit Vnnnnn b nnnm 0 65535 b 0 7 b 0 e g V23 0 Data Area Bit DBXnnnnn b nnnnn 0 65535 b 0 7 b 0 e g DBX23 0 DB10 DBX23 0 DB10 DBX23 0 DB10 DB10 DBXnnnnn b is a bit address it is in b V23 0 DB10 DBX23 0 bit of nnnnn word with DB10 300 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Cable Drawings HMI COM port PLC port RS 232C 9 pin female HMI COM port Operator terminal and RS232C port on HMI 6ES7 972 0CA10 0XA0 Communication Format Before connection please set up the communication parameters and the DIP switch as follows Node adcress OD Set the SW5 OFF if parameters are Transmission Format set in H Designer Set the SW5 ON if parameters are Parity ODD set in the operator terminal Stop bit 1 bit Open Data Block DB block for S7 300 CPU nE Command Delay Set operator terminal Command Delay Beijer Electronics MA00822 301 Communication between Operator Terminal and Controller 9 47 Taian TPO1 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Input R
27. white YO eal Read Yo Bal Enabled By ea 2 For Connection 2 in the Write and Read boxes enter 2 Q0 0 for the bit address Note that 2 refers to Connection No 2 and denotes the separation from its register address Varlable Write ERLRLO Bi Read 2 000 si Enabled By El 3 For Connection 3 in the Write and Read boxes enter 3 1 for the bit address Note that 3 refers to Connection No 3 and denotes the separation from its register address Varlable white 3 1 E Read 3 1 ral Enabled By Bi 210 Beijer Electronics MA00822 Macros 8 Macros 8 1 Macro Function H Designer offers user a convenient and powerful macro application It enables the Operator terminal to execute a number of tasks Arithmetic Logic Flow Control Data Transfer Comparison Conversion and system service instructions for exam ple Using macros can also significantly reduce program size and optimize controller efficiency Macros not only allow the operator terminal to communicate with the controller but can also connect it to other devices Macros provide an efficient inte gration system as well as an economical hardware application structure 8 2 Macro Classifications Macros offer a number of functions for different situations and applications The rel evant macro window can be used to define an application according to needs The operator terminal will execute the macro commands in accordance with different mod
28. x Bkq Color LOG Vanable Read 100 SI Format Unsigned Binan Control Trigger Flag 1 Clear Flag 1 kai Display Format Number of Pointe 1 0 Number of Grids 0 m M Curve H Edit Curve 2 Edit T Curve 3 Edt M Curve 4 Edt Grid Color Cancel Trend Graph attributes in this example 5 Check Curve 1 and click Edit Set Minimum to 0 and Maximum to 100 Select Blue for Pen Color 6 Check Curve 2 and click Edit Set Minimum to 0 and Maximum to 100 Select Red for Pen Color Beijer Electronics MA00822 99 Instructions 2 7 14 XY Chart The XY Chart is used to read a series of values from the related controller register Then the operator terminal converts these values and presents them on an XY chart in the operator terminal Suppose that the register to read from is Wn with two curves in all The data will be read as follows Value in Wn m are the real sampling points Value in Wn 1 is the first point of the X axis on curve 1 Value in Wn 2 is the first point of the Y axis on curve 1 Value in Wn 3 is the first point of the X axis on curve 2 Value in Wn 4 is the first point of the Y axis on curve 2 Value in Wn 5 is the 2nd point of the X axis on curve 1 Value in Wn 6 is the 2nd point of the Y axis on curve 1 Value in Wn 7 is the 2nd point of the X axis on curve 2 Value in Wn 8 is the 2nd point of the Y axis on curve 2 and so on The operator termi
29. 5 Beijer Electronics MA00822 231 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication RS232C PLC 5 COM2 RS232 422 485 Format When using RS422 set DIP switch SW10 OFF When using RS485 set DIP switch SW10 ON Node Address Set PLC Station No in H Designer according to the controller setting Transmission 9600 19200 bps Set the SW5 OFF if parameters are set in Speed H Designer ARE e Set the SW5 ON if parameters are set in the operator terminal Format Parity NONE j Stop bit 1 bit 232 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 3 Allen Bradley SLC 503 504 Data format and range of the controller registers which H Designer can access Word Device Output file Input file Bit file Bfff nnn Timer file Tfff nnn T nnn Tfff nnn PRE T nnn PRE Tfff nnn ACC T nnn ACC Counter file Cfff nnn C nnn Cfff nnn PRE C nnn PRE Cfff nnn ACC C nnn ACC Control file Rfff nnn R nnn Rfff nnn LEN R nnn LEN Rfff nnn POS R nnn POS Integer file Nfff nnn N nnn Register Range fff 3 or 10 255 default file is 3 if fff omitted nnn 0 254 fff 4 or10 255 default file is 4 if fff omitted nnn 0 254 fff 5 or10 255 default file is 5 if fff omitted nnn 0 254 fff 6
30. 65532 Tnnnnn nnnnn 0 65534 Cnnnnn nnnnn 0 65534 Timer and Counter are read only Device Type Block Data Area Bit DB10 OxC3 i Data Area Bit DB10 DBXnnnn b Oxc4 0 7 Bi DB10 DBXnnnnn b is a bit address it is in b bit of nnnnn word with DB10 Data Area Bit DBmm DBXnnnn b mm 1 31 nnnnn 0 65535 b 0 7 Cable Drawing HMI COM port PLC port RS232C i 9 pin male Operator terminal to MPI port RS485 on controller 296 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Transmission Speed Set the SW5 OFF if parameters are Transmission Format set in H Designer Set the SW5 ON if parameters are Parity EVEN set in the operator terminal Stop bit 1 bit Notes 1 The cable is the same as for the Siemens Simatic S7 200 2 The operator terminal and PLC stations are between 0 and 15 The operator ter minal station no is lower than the PLC station 3 When using a macro the size of block move is limited to within 10 words 4 Due to the Token Ring protocol no error message is generated when removing the cable Beijer Electronics MA00822 297 Communication between Operator Terminal and Controller 9 45 Siemens Simatic S7 300 MPI Cable Data format and range of the controller registers which
31. 83 84 85 and 286 N 80 represents the controller station number and the internal value of 80 must be 0 if no controller station is required N 1 81 represents the device type setting For the device type of controller please see the chapter Communication between Operator Terminal and Controller for full details N 2 82 represents the low word of the device address N 3 83 represents the high word of the device address N 4 84 represents the auxiliary address if required else set to 0 N 5 85 represents the address of the internal memory to receive the data and the size of data is specified by N 6 86 N 6 86 represents the number of words to be read 224 Beijer Electronics MA00822 Macros 12 READ_Bit Read a controller bit device or internal bit and save the data in the specified address Format SYS READ_Bit N The data will be saved in 5 This command is powerful for use in commu nication with any controller bit state and can be used to set and monitor con troller data For example SYS READ_bit 80 here N 80 Execution of this command requires the internal values of 80 Q81 082 83 84 and 85 N 80 represents the controller station number and the internal value of 80 must be 0 if no controller station is required N 1 81 represents the device type For controller device types please see the chapter Communication between Operator Terminal and Controller for full
32. 9 pin male TXD 14 TXD 15 RXD 16 RXD 17 p gt 21 NDX RS232 PORT DALE SNe uhe eda 3 pin male Operator terminal to RS232C port on MIRLE nNDX 270 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication RS232C RS422 COM2 RS232C RS422 Format Station No Set PLC Station to 00 in H Designer Transmission 9600 bps Set the SW5 OFF if parame Speed ters are set in H Designer Transmission DX SBC20 8 bit NDX 8 bit set the SW5 ON if parame Format ters are set in the operator DX SBC20 ODD NDX NONE terminal DX SBC20 1 bit NDX 1 bit Beijer Electronics MA00822 271 Communication between Operator Terminal and Controller 9 30 Mitsubishi FX Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Auxiliary Relay nnnn 0 3071 must be 0 or multiple of 8 Special Auxiliary nnnn 8000 8255 must be 0 or multiple of 8 Relay Word Data Register nnn 0 1023 7999 D1000 FILE REGISTER Special Data Reg sadi nnnn 8000 8255 The operator terminal can read up to 32 words in one read command Auxiliary Relay 0 3071 Must be 0 or multiple of 8 Special Auxiliary Mnnnn 8000 8255 Must be 0 or multiple of 8
33. Address 220 Size 4 Total 3000 Check Time and Date Triggered By Time Time Interval 1 Check Non volatile Please see section Logging Buffer For the Historical Trend Graph object select the following properties Historical Trend Graph Ib IHTGODI3 Display Format Frame Number of Grids We Grid Color Color Space between two adjancent points Bka Color E pisel iM Curve 1 Edit Logging Butter 1 1 W Curve 2 Edit Format Unsigned Binary W CureH3 Edit Time D ate M Display Date W Curve 4 Edit ae Format Edt Display Time Color O DE Cancel The Historical Trend Graph properties 2 Frame Select Recessed_1 and Black for background color 3 Data Select Logging Buffer 1 and Unsigned Binary for Format 4 Display Format Specify 11 grids and Green for Grid Color 5 Check four curves to display Curve 1 displays the data record stored in the word 0 Curve 2 displays the data record stored in the word 1 etc Historic Trending Curve Eq Data Word No lo hd Minimum 0 Masimum 65535 ma ace Curve Fen Color Line Style Properties for Historical Trending Curve 1 Beijer Electronics MA00822 121 Instructions 6 Set Minimum to 0 and Maximum to 65535 Specify a different color for each curve H 70 Historical trend graph EO The result of the settings in the above example Displaying data
34. CPU will then execute other programs The CPU will execute the 30 command lines following the last executed command until the next cycle To use the macro communication function the user must define the related commu nication format for INICOM This command is only used once so it is usually en tered in INITIAL Macro 8 5 Internal Memory The operator terminal provides some internal registers that can be read from written to By using these internal registers users can make more efficient and convenient use of the macro function The internal registers can not only enhance macro with infi nite functions but can also store a great deal of arithmetic source data and results Note that this system provides the internal registers divided into RAM and ROM Details of the four types of internal memory follow vo Deve Tre se adress Am Ars W jaceno ost W OVoniyonewor o fow Row lo w osn p fw os wpa p k en os w ea w ts eevee tne adres a Ares I RcPWn b 064 losn pos Ro an 6 01 1 RCPNO 2 The n value of RCPWn is based on the size of the recipe and the maximum number The data register can be used as bit 3 The n value of CBn is based on the size of the control block The current size is 2 32 This data register can be used as bit 4 n Internal Register The size is 8191 WORDS n 0 8191 This data register can be used by bit Beijer Electronics MA00822 Communication betwee
35. Common Register Block CRB and a Common On Off Block COB for the operator terminals Select Limit data access to Multi link Common Blocks only Application Properties General Connection Miscellaneous Logging Buffers Password Device Type Connection 1 Mitsubishi Fes Seres Multi link Common Blocks Use Mo Type Address x wn ra mu m T Lots mI mu m IT 100 4 Register Address o Poart method used fo Cancel ha uilti link li This HMI iz a mul Master Port IANA AUN NIK m Limit data access x Common Blocks 4 TNT lll bpREeHEREEHEEEEEeEeEnEe The CRB is a block of registers and the COB is a block of On Off locations in the controller In every read cycle the master operator terminal reads the data from both the CRB and the COB Then the master sends the CRB and COB data to all the slaves The CRB and the COB allows a maximum of 128 words and 256 words respectively In multi link the CRB and the COB has to be specified with the same size and for mat for each of the operator terminals The slaves are not requested to read the data from the CRB or the COB directly The slaves read the data from the buffer contain ing the data sent by the master The CRB and the COB play important roles in terms of communication efficiency since they can reduce traffic in the multi link as well as in the link between the master and the controller For instance arranging control blo
36. Control Size of Bit asray R znmnden mneozs4 rt fe Wod Control Reserved tie R nnn pos nnns0 254 i2 fe vora Word Floating point number Fsm rmneozs4 i4 6 mod The operator terminal does not support block read for the registers in TIMER COUNTER and CONTROL FILES It is necessary to open the files which the operator terminal will access in the Allen Bradley controller Data format and range of the controller ON OFF location which H Designer can access Dip Device T4 nnn acc bb Word Timer Accumulator nnn 0 254 bb 0 15 0xC6 10 15 Value Counter flag C5 nnn bb nnn 0 254 bb 0 15 Counter Preset C5 nnn pre bb nnn 0 254 bb 0 15 OxC8 0 15 Word Value Counter Accumula C5 nnn acc bb nnn 0 254 bb 0 15 OxC9 0 15 Word tor Value OxCB Control Size of Bit R6 nnn len bb nnn 0 254 bb 0 15 Array Control Reserved j R6 nnn pos bb nnn 0 254 bb 0 15 The operator terminal does not support block read for the registers in TIMER COUNTER and CONTROL FILES 228 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Cable Drawings 1761 CBL PM02 PLC port RS 232C Q pin male 17 61 CBL PMl2 9 pin male Operator terminal to RS232C connection on controller 1761 CBL PM02 Communication Format Before connection please set up the communication parameters and the DIP switch es as follows Controller Setting Operator Terminal Setting Communication RS232C COM2
37. EVEN set in the operator terminal Stop bit 1 bit Beijer Electronics MA00822 313 Communication between Operator Terminal and Controller 9 55 Yokogawa FA M3 Data format and range of the controller registers which H Designer can access Word Device and Bit Device nnnnn 201 65499 not continue Intern Relay _Innnnn_nnnn 1 16384 Word 16 bits 00001 Preset Counter _ CPnnnn_ nnnn t 3072 Word 16 its Data Register onnnn nnnn t 8192 Word 16 bits 0001 File Register _ Bnnnnn_ nnnnn 1 32768 Word 16 bits Bo0001 woo00 Special Register znan nnnts2 Word 16 its Common Register Rann The last two digits of the X and Y addresses must be multiples of 16 1 The I E L and M addresses must be multiples of 16 1 One communication can READ WRITE up to 60 words Intern Retay _ Innnan oann t 16384 Bit Special Relay nnnn 1 9984 Bit TUnnnn nnnn 1 3072 Bit Counter nnnn 1 3072 Bit The last two digits of the X Y and L addresses must be multiples of 16 1 The I E and M addresses must be multiples of 16 1 pr m I I mmm 1 a 314 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Cable Drawings HMI COM port PLC port RS232C 25 pin gt 6 pin male 1 SD 2 RD 5 GND front side view of the cable HMECOM port PLC TXD RXD 15 nE Operator terminal to RS485 port on controller Communication Format Before connection please
38. H Designer can access Word Device and Bit Device Device Type Data Size Register Type Register Range x Addres Double word panoge mm msa o Input mage bom mos fi Output image own a Mwan fannnne0 e854 I mmm jogi s Data Area DB10 DBWnnnnn nnnnn 0 65534 the byte nnnnn amp nnnnn 1 make DBWnnnnn Data Area DB10 DBDnnnnn_ nnnnn 0 65532 a double 7 word address DBWnnnn amp DBWnnnn 1 make DBDnnnn Data Area DBmmm mmm 2 205 DBWnnnnn nnnnn 0 65534 Data Area DBmmm mmm 2 205 DBDnnnnn_ nnnnn 0 65532 Device Type Block Relay Type Format Relay Range Aux Address R W Input Image nnnnn 0 65535 b 0 7 0xC0 0 poubiewora o _ _ _ _ o _ Pe Bi Na i Double word Output Image nnnnn 0 65535 b 0 7 Bit Mnnn b nnn 0 65535 b 0 7 0xC2 i Data Area Bit DB10 Vnnnnn b nnnnn 0 65535 b 0 7 OxC3 i Data Area Bit DB10 DBXnnnn b nnnnn 0 65535 b 0 7 it DB10 DBXnnnnn b is a bit address it is in b bit of nnnnn word with DB10 Data Area Bit DBmm DBXnnnn b mm 2 26 0 nnnnn 0 65535 b 0 7 298 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Cable Drawings HM LCOM port PLC port RS 232C HMI COM port PLC port RS232C 25 pin 9 pin CABLE 9 pin female HMI COM port HMI COM port PLC port RS 232C 25 pin o CABLE 9 pin female 9 pin a lt gt lt CABLE Q pin female PLC port R5485 9 pin male RXD TXD 14
39. Parallelogram and Solid Parallelogram Draws a solid parallelogram Draws a circle Circle Solid Circle Ellipse and Solid Ellipse Draws a solid circle a Draws an ellipse Draws a solid ellipse Draws a pie segment Draws a solid pie segment Draws a polygon Polygon and Solid Polygon Draws a solid polygon Static text display and Static Text design Beijer Electronics MA00822 Instructions Draws a frame edge Frame Edge Displays a shape Shape Double click on the object or right click and select Object Attributes The dialog box corresponding to the object will appear Rectangle Type f Normal C Clipped Comer EE Color P Pattern Style Foreground Color Background Color Profile 12 0 Wis 34 We 56 H 0 Redraw Cancel The Rectangle dialog box Dot Style Color and Profile can be specified in the Dot dialog box PA 1 anje E DIX ID D00001 Dot Style Color Profile x je Y 34 Redraw Cancel Drawing a Dot Beijer Electronics MA00822 45 Instructions Line Horizontal Line and Vertical Line Type Color Arrows and Profile can be specified in the Line Horizontal Line and Vertical Line dialog boxes Fa 1 Screen_1 ID L00002 Type Ge Line Style Color L gt Arrows Begin style J End style Ee Begin size End size gt ERI S XD 43 xi 126 Mu IN Vi IN Redraw
40. RS232 422 485 Format When using RS422 set DIP switch SW10 OFF When using RS485 set DIP switch SW10 ON Node Address Set PLC Station No in H Designer according to the controller setting Transmission 19200 bps Set the SW5 OFF if parameters are set in H Designer Tanio Set the SW5 ON if parameters are set in the operator terminal Format Parity NONE j Stop bit 1 bit Beijer Electronics MA00822 229 Communication between Operator Terminal and Controller 9 2 Allen Bradley PLC 5 Data format and range of the controller registers which H Designer can access Word Device Register Type Format Register Range Data Size R W Output file Omm nnn 0 277 Bit file Bfff nnn B nnn Timer file Tfff nnn T nnn Tfff nnn PRE T nnn PRE Tfff nnn ACC T nnn ACC Input file Counter file Cfff nnn C nnn Cfff nnn PRE C nnn PRE Cfff nnn ACC C nnn ACC Rfff nnn R nnn Rfff nnn LEN R nnn LEN Rfff nnn POS R nnn POS Integer file Nfff nnn N nnn Control file nnn 0 277 nnn 0 127 fff 3 or 9 999 default file is 3 if fff omitted nnn 0 999 fff 4 or 9 999 default file is 4 if fff omitted nnn 0 999 fff 5 or 9 999 default file is 5 if fff omitted nnn 0 999 fff 6 or 9 999 default file is 6 if fff omitted nnn 0 999 fff 7 or 9 999 default file is 7 if fff omitted nnn 0 999 The operator terminal can read up to 30 words in one read command The operator ter minal does not support bloc
41. Screw termmals RDA RXD RDB RXD SDA TXD SDB TXD SG PLC port RS422 CABLE 8 pin Screw termmals RDA RXD RDB RXD SDA TXD SDB TXD SG Operator terminal to Q Series C24 RS422 Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminai Setting Communica RS422 or RS232C COM2 RS232C tion Format RS422 RS485 Station No 00 CPU port Q Series C24 Set PLC Station to 00 in H Designer Transmission 19200 bps Set the SW5 OFF if Speed parameters are set in Format Set the SW5 ON if 278 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 33 Modbus Slave Data format and range of the controller registers which H Designer can access Word Device and Bit Device Relay Type Relay Range Cable Drawing HMI COM port PLC port RS2352C i 9 pin male Operator terminal to RS232C port 9 pin male on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS232C RS422 RS485 COM1 or COM2 RS232C RS422 RS485 Transmission Speed 9600 bps 9600 115200 Set the SW5 OFF if parameters are Transmission Format set in H Designer Set the SW5 ON if parameters are Parity NONE set in the operator termin
42. Stop Bit sl i Baud Rate 5600 Parity jo Defaul 0 s Command Delay me Timeout Time Sec Number of Retnes The Connection tab of the Application Properties dialog box 92 Beijer Electronics MA00822 Instructions Data Teminal attributes 3 Shape Select Outlined_2 and Black for color 4 Variable Select RX The controller is an ASCII Device 5 Display Select ASCII mode to display terminal data 6 Data Buffer Select Local The above mentioned steps will create a Data Terminal object that displays terminal data in ASCII mode Time Display The Time Display object is used to make the operator terminal read the time value of the internal real time clock RTC and to display the content directly on the op erator terminal screen Display Format HH MM SS Displays Hours Minutes Seconds HH MM Displays Hours Minutes Example of a Time Display object See section Example of the Time Date and Day of Week Display objects Date Display The Date Display obejct is used to make the operator terminal read the date value of the internal real time clock RTC and to display the content directly on the operator terminal screen Display Format MM DD YY The format is Month Date Year DD MM YY The format is Date Month Year DD MM YY The format is Date Month Year Example of a Date Display object See section Example of the Time Date and Day of Week Display objects Beije
43. To install to a different folder click Browse and select another folder Destination Folder C Program Filas H Designer b U 5 1135 InstallShield The destination hard drive and directory 10 Beijer Electronics MA00822 Installation 5 Click Next to select the type of setup Typical is recommended for most users Compact installs the program with basic options Custom allows users to indi vidually select the options to install and this is recommended for advanced users H Designer 6 0 8 03 Setup Type Select the Setup Type to install Click the type of Setup you prefer then click Nest i Typical Program will be installed with the most common options Recommended for most ugers Compact Program will be installed with minimum required options Custom fou may choose the options you want to install Recommended for advanced USETE InstallShield Back Cancel Selecting the type of setup 6 Click Next to begin the installation If the Typical option is selected the follow ing dialog box will appear on the screen H Designer 6 0 8 03 InstallShield Wizard Complete Setup has finished installing H Designer 6 0 8 0 on your computer H Designer installation 7 After installation the system will create the H Designer icon automatically 8 Once the installation is complete the H Designer software can be found in the specified directory To launch the H Designer program simply c
44. Word Device and Bit Device Register Type Input Relay Output Relay Internal Relay Shift Register Timer Preset Timer Current Counter Preset Counter Current Data Register Calender CLOCK Xo Yo on Tenn n n n n n X Y M T om pmo od mo po y i SS The operator terminal can read up to 50 words in one read command Timer Preset and Counter Preset are read only If the value of TP or CP exists in Data Register the value of Data Register will be read Relay Type Input Relay Output Relay Internal Relay Shift Register Counter Status Rn meoes pust be 0 or multiple of 8 The operator terminal can read up to 800 bits in one read command Cable Drawings HMI COM port RXD TXD 14 RXD TXD 15 SG RXDITXD 1 RXD TXD 6 SG 5 Operator terminal to PLC port R5485 8 pin male 1 DATA 2 DATA 8 5y PLC port R5485 9 pin male 1 DATA 2 DATA 7 SG 8 T front side view of the cable controller Program Loader RS485 port MICRO3 CPU PORT Beijer Electronics MA00822 253 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Operator Terminal Setting Setting Communication Format RS485 COM2 RS232C RS422 RS485 RS485 Set SW10 ON Station No No 0 31 255 Set PLC Station to 255 in H Designer Transmission a a
45. a pie segment or a solid pie segment is similar to drawing an arc The dif ference between a pie and an arc is that two lines are connected between the two sides of an arc and the center PA 1 Screen_1 Pie Arc Attributes v Fill Pattern Style Pattern Color Li 5 Background Color C Profile x j13 We 61 Recta Y 105 H 61 Cancel Arc Pie and Solid Pie The Arc Pie and Solid Pie dialog boxes are the same Pie Arc Attributes Border Style l Color E Iw Fill Pattern Style et T T Pattern Color Background Color Profile 13 Vis 61 TORR Y 0S H Cancel The Pie Arc Attributes dialog box Check Arc to draw an arc check Fill to draw a solid arc and specify the Pattern there check Arc and adjust the width and height under Profile to configure an arc from an ellipse Beijer Electronics MA00822 49 Instructions 50 Polygon and Solid Polygon Polygon is used to draw sides of a polygon by moving the mouse cursor and to con nect the lines between the starting point and the terminal point with the shortest dis tance Draw a polygon by dragging the mouse cursor then left clicking on the turning point and right clicking to form a polygon Border and Profile can be specified in the Polygon and Solid Polygon dialog boxes Fill is used for the Solid Polygon Polygon Attributes ID PF00008 Boarder Style Color Bi Iw Fill
46. and range of the controller registers which H Designer can access Word Device and Bit Device Pispa pom eoa Words o Tewe pan feos a o ooo Relay Type Relay Range Bonn nnn 0 1599 mustbe 0 or multiple of 16 tan po NE strn po PoV cron eo etn po Clear RAM EEPROM database Clr3 n and default setup HMI COM port RS232C 25 pi in male nip s Operator terminal to RS485 port on controller Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Controller Setting Operator Terminal Setting Format RS232C RS485 RS232C 2C RS485 Communication Format RS232C ee Use ee MIDA Use eee 20 20D driver Slave driver CU A A A Set the SW5 ON if parameters are set in the operator terminal mode topmode Running mode Beijer Electronics MA00822 289 Communication between Operator Terminal and Controller 290 9 40 Siemens Simatic S5 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Max 30 Max 30 nnn 0 65535 nnn defines the block If mmm is not set mmm defaults to 3 DB3 nnn mmm 0 255 mmm is the block number nnn 0 32767 nnn defines the block If mmm not set mmm defaults to 3 DW3 nnn The operator terminal can read up to
47. applications configured to monitor alarms 180 Beijer Electronics MA00822 Control and Status Block Bit 0 1 Password Level Status not available for applications configured to monitor alarms Once connected to the operator terminal the password level status bit 0 bit 3 rep resent the current user level Level 0 gt Bit 0 off Bit 1 off Level 1 gt Bit 0 on Bit 1 off Level 2 gt Bit 0 off Bit 1 on Level 3 gt Bit 0 on Bit 1 on Level 4 9 gt Bit 0 on Bit 1 on Bit O Alarm History Buffer Clear Status The operator terminal will turn ON this status bit when it detects the alarm history buffer clear flag being turned ON When the operator terminal finishes clearing the alarm history buffer it will turn OFF this status bit Bit 1 Alarm Frequency Buffer Clear Status The operator terminal will turn ON this status bit when it detects the alarm fre quency buffer clear flag being turned ON When the operator terminal finishes clear ing the alarm fre quency buffer it will turn OFF this status bit Bit 2 Form Feed Status The operator terminal will turn ON this status bit when it detects the form feed flag being turned ON When the operator terminal finishes sending the form feed char acter to a printer it will turn OFF this status bit Bit 3 Hardcopy Status The operator terminal will turn ON this status bit when it detects the hardcopy flag being turned ON When the operator t
48. ations Example Convert the boiler temperature in Procedure A into centigrade C If the temper ature is less than 100 C Procedure B will be entered if the temperature is 100 C or more Procedure C will be entered The following flow chart is made up of poly gons rectangles lines with arrows and static text FA 1 Screen_1 Procedure A Convers ion Temp gt 100 C Procedure B Procedure C Flow chart example Beijer Electronics MA00822 55 Instructions 2 7 Object Menu A screen object is an item placed on the screen to perform a particular function Each object has its unique user configurable properties and the object can be set to perform in exactly the method desired Objects are divided into four categories 1 Related to screen buttons and dynamic data e g Push Button Numeric Entry and List 2 Unrelated to screen buttons but related to dynamic data e g Numeric Display and Bar Graph 3 Related to dynamic controller data and operator terminal memory buffer zone Historical Display and Alarm Display 4 Related to application data contents are connected with the entire system If one of the contents is modified such as text display or controller data format the other objects with the same application will be changed simultaneously as Sub macro 1 Library Application Push Button Numeric Entry Related to screen button and dynamic data Character Entry 4
49. bit location Format There are BCD Signed Binary Unsigned Binary Hexadecimal 32 bit Floating point and Octal formats Range Edit button When clicking this button the displayed dialog box provides a display showing high low range Numeric Range Range Limits Display Format f None High Range Blinking f Constant Ekg Color Char Color High Limit 1 DO mi m Low Range Blinkin Low Limit 30 F a Ekg Color Char Color C Register mo m Editing Numeric Range None No high low limit Constant Enter the constant variable of high low limit Register Read high low limit from register If the read location is Wn the high limit is stored in Wn 1 and the low limit is stored in Wn 2 Display Format Specifies the format to display when the variable is equal or more less than high low limit For properties not explained in this section please see the sections Set Value Button and Specifying Object Properties Example of designing a Numeric Display object 1 Frame Select DD_Module_2 and White for background 2 Variable Specify controller register W100 to read from The controller model is NULL Beijer Electronics MA00822 85 Instructions 86 3 Display Format Select Blue for character color Numeric Display Ib INDOOOO Display Format Frame Select Color Character Color l Be C Left Cener Right Ekg Color DD Module 2 C Fill Leading Z
50. connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication Format RS422 CPU port or COM2 RS232C RS422 RS485 RS232C RS422 Set SW10 OFF statin o Nome Transmission Speed 9600 19200 bps Set the SW5 OFF if parameters are set Transmission Format Size 8 bit in H Designer Set the SW5 ON if parameters are set in Parity NONE the operator terminal Stop bit 1 bit Controller Password None or The password needs to be set in the controller 248 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 14 Hitachi EC Data format and range of the controller registers which H Designer can access Word Device and Bit Device The operator terminal can read up to 60 words in one read command Relay Type Relay Range Input Relay Xnnn nnn 0 15 20 35 40 55 60 75 X0 X20 X40 180 195 Output Relay nnn 200 215 220 235 240 255 Y200 Y220 380 395 Auxiliary Relay Mnnn nnn 400 655 700 955 960 991 M400 M420 Timer Counter Relay TCnn nn 0 95 TCO TC1 TC80 Cable Drawings PLC port RS232C 8 pin male RD SG gt 8 7 RS front side view of the cable Operator terminal to controller programming port Communication Format Before connection please set up the communication parameters and the DIP switch as follows statin o None Set the SW5 OFF if parameters are s
51. horizontal grids Curve 1 Curve 4 Provides four curves for editing When the Edit button is clicked the dialog box below will appear Trend curve Data me Miniman E Masimum 1 O0 once Curve Fen Color Pa Line Style H Editing Display Format of Trend Curves Minimum Specifies the value corresponding to the lowest point on the trend graph When the data is equal to or less than the Minimum the operator terminal places the dot at the bottom pixel of the drawing area of the trend graph Beijer Electronics MA00822 Instructions Maximum Specifies the value corresponding to the highest point on the trend graph When the register is equal to or greater than the Maximum the operator ter minal places the dot at the top pixel of the drawing area of the trend graph Pen Color Specifies the color of the trend curve Line Style Specifies the line style of the trend curve For properties not explained in this section please see the section Specifying Object Properties Example of designing a Trend Graph object TT TT TT TT TT G 1 2 345 6 7 8 9 1B A Irend Graph 1 Frame Select Outlined_2 and White for background color 2 Variable Specify 100 Local Internal Memory for Read and Unsigned Binary for Format 3 Control Select 1 for Trigger Flag and for Clear Flag 4 Display Format Specify 10 for Number of Points Trend Graph ID ITGOODOOZ Frame Select Color mo
52. into blocks The Read Blocks tab of the Screen Properties dialog box The function of the Read Block tab is to specify register block addresses on off block addresses size in words and refresh rate Register Block Address Specifies the register block address according to the control ler A screen can have a maximum of five specified register addresses On Off Block Address Specifies the on off block address A screen can have a max imum of five specified register addresses Size Specifies the size of block Refresh Rate Normal Reads data at normal speed for the controller Fast Reads data at twice the speed of Normal On Unchanged by Operator Enables users to change the value on the operator terminal but not change the value in the controller Perform block optimization Check this option to merge adjacent data into blocks Note that it is recommended that the data addresses of the controller are continuous to ensure good communication with the controller 40 Beijer Electronics MA00822 Instructions Auxiliary Keys Tab Screen Properties General Screen Background Style Read Blocks Audliary Keys Kep Function F1 Goto Screen Button F2 No function F3 Ho function F4 Ho function F5 Ho function FE Ho function Fr Ho function F8 Ho function F3 Ho function F10 Ho function Attribute OK Cancel The Auxiliary Keys tab of the Screen Properties dialog bo
53. is located in the controller it represents the A2 data in the operator terminal internal register in the controller If A2 is located in the controller it will represent the data read and copied from the operator terminal internal register A1 BMOV gt Format BMOV A1 A2 A3 Copies a block of data starting at A2 to the memory block starting at A1 A3 specifies the number of words to be copied The data format is word The BMOV command copies a block of length A3 starting at A2 to the A3 long block starting at Al The A2 data is unchanged A3 must be be tween 2 and 524 Format BMOV A1 A2 A3 FILL gt Format FILL A1 A2 A3 Fill a block of memory starting at Al with the value of A2 A3 specifies the number of words to be filled The data format is word The FILL command fills a block of A3 words starting at Al with the A2 data The A2 data is unchanged A3 must be between 2 and 524 CHR gt Format CHR A1 A2 Copies the character string A2 to Al The Al data is in ASCII format 8 3 4 Comparison Note Only internal memory can be used in these commands The internal memory includes amp RCPW CB RCPNO and e indirect internal memory IF gt Format IF Al A2 THEN GOTO LABEL A3 Goes to LABEL A3 if A1 is equal to A2 IF gt Format IF Al A2 THEN GOTO LABEL A3 Goes to LABEL A3 if Al is not equal to A2 IF gt Format IF Al gt A2 THEN GOTO LABEL A3 Goes to LABEL A3 if Al is g
54. level in the Bar Graph is increased On the Attributes tab of the Increment Button 1 Variable Write Specify controller register W200 to write in Read Specify W200 The controller model is NULL 2 Shape Select Raised 68 Beijer Electronics MA00822 Instructions 3 Function Select Increment Jog Step 5 and Limit 100 Jog Button BJE Attributes Shape Text Graphic ID IETHOOOO2 Function Shape i Increment C Decrement Select _Select Jog Step 5 Color Limit 1 on Variable Write amp f Word C Double words Format Unsigned Binay Read PO a Beene i Attribute settings for the Increment Button On the Text tab of the Increment Button 4 Enter the desired text for example Increment and select White for background color 188 166 79 To ou m1 29 29 B 5 Increment Clicking the Increment Button five times adds 25 to the controller constant W200 Beijer Electronics MA00822 69 Instructions Decrement Button The Decrement Button is used to make the operator terminal read a constant variable stored in a controller register Then a specified constant will be subtracted from the value before writing it back to the controller register Attributes Tab Function Decrement Select Decrement to create a Decrement Button one click is one sub traction Jog Step The Decrement Button is used to subtract a specified c
55. must be a multiple of 16 Word 16 bits X_Data Xnnn nnn 0 360 X0 X7 X10 X17 must be a Word 16 bits multiple of 20 Y_Data Ynnn nnn 0 360 YO Y7 Y10 Y17 must be a Word 16 bits multiple of 20 Nnnn 0 1264 must be a multiple of 16 Word 16 bits nnn 0 255 Word 16 bits 16 bits D_Register Dnnnn gt nnn 0 1279 Word 16 bits nnn 232 255 Double Word nnnn 0 1279 Multiple of 16 nnn 0 254 Multiple of 16 nnn 0 254 Multiple of 16 Note X_Data and Y_Data are Oct code such as X0 X7 X10 X17 X20 X27 or X30 X37 Connection The operator terminal can be connected to the controller RS232 port usinga DELTA 8 pin male connector PC gt DELTA DVP PLC Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting RS232C COM1 or COM2 RS232C Transmission Speed 9600 bps Set the SW5 OFF if parameters are set Transmission Format Size 7 bit in H Designer Set the SW5 ON if parameters are set in Parity EVEN the operator terminal Stop bit 2 bit Beijer Electronics MA00822 239 Communication between Operator Terminal and Controller 9 8 Ero TFS THS LFS Data format and range of the controller registers which H Designer can access Register Type Register Range Data Size Word Register mmm 0 255 nnn 0 529 Word 16 bits Relay Type Realy Range Realy mmm 0 255 nnn 1 342 Cable Drawin
56. or 10 255 default file is 6 if fff omitted nnn 0 254 fff 7 or 10 255 default file is 7 if fff omitted nnn 0 254 The operator terminal can read up to 30 words in one read command The operator ter minal does not support block read for the registers in TIMER COUNTER and CONTROL FILES It is necessary to open the files which the operator terminal will access in the Allen Bra dley controller Beijer Electronics MA00822 233 Communication between Operator Terminal and Controller Data format and range of the controller ON OFF location which H Designer can access Bit Device Bit file Bfff nnn bb fff 3 or 10 255 default file is 3 if fff omitted nnn 0 254 bb 0 15 Timer file Tfff nnn bb fff 4 or 10 255 Tfff nnn PRE bb default file is 4 if fff omitted Tfff nnn ACC bb nnn 0 254 bb 0 15 T nnn EN T nnn TT T nnn DN Counter file Cfff nnn bb fff 5 or 10 255 Cfff nnn PRE bb default file is 5 if fff omitted Cfff nnn ACC bb nnn 0 254 bb 0 15 Cfff nnn CU Cfff nnn CD Cfff nnn DN Cfff nnn OV Cfff nnn UN Control file Rfff nnn bb fff 6 or 10 255 Rfff nnn LEN bb default file is 6 if fff omitted Rfff nnn POS bb nnn 0 254 bb 0 15 Rfff nnn EN Rfff nnn DN Rfff nnn ER Rfff nnn UL Rfff nnn IN Rfff nnn FD Integer file Nfff nnn bb fff 7 or 10 255 default file is 7 if fff omitted nnn 0 254 bb 0 15 The operator terminal can read up to 480 bits in one read command The operator ter mina
57. os Eoo ST aa E o hrva TR e m jan o EE ER a x j i a i T a L Ea S e Sa E ste ste sko a a a En BSE ES J The Logging Buffers tab Source Address Specifies the starting address to read from e g W20 is starting ad dress of a block of controller registers from which the logging buffer reads from Size Specifies the size of a record to read from at one time e g Size 4 represents 4 words W20 W21 W22 W23 Total Specifies the total to store in e g 1500 represents that the operator terminal reads 4 words each time sampling 1500 times in total Time Date Check these boxes to record the Time Date while sampling Auto Stop Check this box to stop the sampling when it reaches the specified total 1500 If this option is not selected the first piece of data will be overwritten when the 150 1st piece of data records is recorded Triggered By Select Timer to trigger periods of fixed time or select controller to be triggered by the controller If PLC is selected for triggering it is triggered by the specified corresponding bit locations Wn 2 Wn 3 and Wn 4 Beijer Electronics MA00822 Instructions Time Interval Specify how often the logging buffer gets a record of data from the timer Unit seconds After completing the setup on the Logging Buffers tab you can create three types of Historical Display objects Historical Trend Graph The operator terminal ma
58. screen name Select this icon to sort by tag name Select this icon to sort by controller address in ascending order click the address to list the object Select this icon to sort by Macro in use objects Select this icon to sort by search pattern This feature is only available when searching controller addresses or tag names Set the desired pattern for search Select by PLC Addr or by Tag Name Exact match or Partial match Cross Reference Er OM A fe C Demo aps H T60c N_demo V6F Connection 1 BTNOO009 Decrement Button w31 W 39 217 Trends SetOfNoTagAssignment ia na BGO0007 Normal Bar w31 R 39 86 Trends w20 BTNO0008 Increment Button w31 W 41 62 Trends w30 w102 w101 w100 wi b2 bl Local Internal Memory FE a E I lt aa lw Sorting by Tag Name Cross Reference Ex parga E S C pemo aps H T60cN_demo V6 A s nome np Tegnome m um Screen Name HI w31 1 NE00039 Numeric Entry w101 W 66 224 Recipes H we 2 BG00012 Normal Bar w101 R 67 160 Recipes w102 3 NE00039 Numeric Entry w101 W 66 224 Recipes H 4 BG00012 Normal Bar w101 R 67 160 Recipes w100 wil RCP WS RCPW8 RCPW7 RCP W6 RCPWS5 RCPW4 RCPW3 RCPW2 RCPW11 RCPW10 RCPW1 rcpw0 rcnnn Sorting by Address clicking the address displays the object Beijer Electronics MA00822 151 Instructions When sea
59. screens macros Application macros All macros Find Macro address Range Current macro Finds the current macro Current screen macros Finds the current image screen macros Sub macros Finds all sub macros All screens macros Finds all image screen macros Application macros Finds three types of macros in the Application menu All macros Finds all macros Option Match whole word only The findings match the entry address entirely If this op tion is not selected the initial findings match the entry address including partial and entire matches Beijer Electronics MA00822 21 Instructions 2 3 3 Decompose Shape This function is primarily used to decompose the graphics created using Shape in the Draw command Each decomposed graphic can be modified and edited FA 1 Screen_1 Selecting Graph in Draw Shape to edit ra 1 Screen_1 Selecting Edit Decompose to modify each decomposed object 22 Beijer Electronics MA00822 Instructions 2 3 4 Align and Make Same Size These two functions are primarily used to align created objects or to make them the same size for example indicators moving signs message displays and lines The fol lowing are the steps used for these two commands 1 Select Shift and click on all objects which are to be aligned or made the same SIZe FA 1 Screen_1 2 Click on the master object the four corners of this master object should
60. set to 0120 decimal 304 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 49 Taian N2 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Data Size Function nnn 0 155 Word 16 bits Cable Drawings For connection to the RS232C port the TAIAN s FA RS 232 N2 cable must be used For connection to the RS485 port the TAIAN s FA RS 485 KN cable must be used connected as below HMI COM port TXD RXD 14 TXD RXD 15 Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication Format RS232C RS485 Station No RS232C 1 RS485 1 Transmission Speed RS232C 9600 bps Set the SW5 OFF if parameters are Transmission Format Size RS232C 7 bit set in H Designer Set the SW5 ON if parameters are Parity R5232C ODD set in the operator terminal Stop bit RS232C 1 bit Notes 1 Unsigned binary object must be used 2 Even though the F125 can be chosen it cannot be used Display 33333 3 FO F21 F42 F63 F84 F105 are quick read write start positions Block sizes are 21 21 21 214 21 23 4 33333 represents the Function is reserved 5 In the Function table Format and Function values marked cannot be changed 6 If editing a double word object its value is c
61. stored in logging buffer 1 Historical Data Table The operator terminal may have a fixed sampling period or the controller may ini tiate a data read from the specified registers and then store the data in the logging buffers in the operator terminal memory After a sampling period the data is then converted to numeric data tables and displayed in the operator terminal Historical Data Table Ib IHDTOOO19 Display Format Frame Humber of Data Fields l Select i Color C Field Attribute Ekg Color Outlined 2 a E Font exig Data Logging Butter 1 La Time D ate Display Date Display Time Format Colo BN Historical Data Table properties Display Format Number of Data Field Specify how many data fields to display up to 10 data fields 122 Beijer Electronics MA00822 Instructions Clicking the Field Attribute button displays the dialog box below Field Attribute Field Starting Word Data Data Display Leading Decimal Pt Int Frac Mo Position Wo Size Format Color ero Position Digits Digits foxfrl eo omar mi i nio Nisi Ad Ni ji sis S Sc nj a mi ir iko mijene e Ni mje e mije Sd Ni je is om Starting Position Specifies the position of a data field to display Be OE ESE Ee Se ME i m a Me Mel ME E WE E paf E i a Mee e o zl pia jE piz Mel es Rs Ea jE Ra il M 8 a 2 a E a Note If the st
62. the deviation 108 88 60 48 28 26 48 66 88 180 10 86 66 40 20 26 48 66 88 180 100 88 68 48 28 26 48 66 86 106 O a LoL I I I Z I VR A A Actual value 50 _ Actual value g Actual value 85 mi Deviation limit is set to 68 Deviation limit is set to 68 Deviation limit is set to 68 A Deviation Bar Graph shows the difference to the set standard value 1 Frame Select Recessed_1 and Yellow for background color 2 Variable Specify 5 Local Internal Memory for Read and Signed Binary for Format Set Min to 100 and Max to 100 Display Format Select horizontal direction for the Deviation Bar Graph The Standard Value is 20 on this deviation bar graph ami Specify that the Red color is to fill the graph when the difference between the register value and the standard value is beyond the limit 60 Deviation Bar Graph ID IDBGODODI Display Format Frame C Werlical Select Eg Horizontal Color a Pattern Rai x Vearable Read G5 ali Standard Value 20 F t Signed Binary id W Display Deviation Limit Min 100 blar 100 Limit EO Color E Variable Std Value Deviation Limit Cancel The attributes of the Deviation Bar Graph in this example Beijer Electronics MA00822 97 Instructions 98 2 7 13 Trend Graph The Trend Graph is used to read a series of values from the related controller register Then the operator terminal converts these values and p
63. the example The above steps will create a Multistate Button that displays First State in state 0 Second State in state 1 etc Set Value Button The function of the Set Value Button is to enable numeric entry When pressed the operator terminal displays a numeric keypad on the screen When pressing ENT the operator terminal will store the input value to the corresponding controller register Note that the corresponding controller value is not available in the Set Value Button Attributes Tab Variable Word The entered value is 16 bit data the maximum 65 535 Double Word The entered value is 32 bit data the maximum is 4 294 967 295 Format BCD Signed Binary Unsigned Binary and Hexadecimal can be select ed Notification Specify a register bit location to be notified the operator terminal will set the bit to ON Select Before Writing to make the operator terminal set the notification to ON when the numeric keypad appears and set the location to OFF when the numeric keypad disappears Select After Writing to make the operator terminal set the notification location to ON after writing the input value to the Write location Display Format Decimal Pt Position Specifies the number of digits after the integral part of the number The maximum is based on the specified format Intergral Digits The number of the integral part in a number Fractional Digits The number of decimal digits Display Asteri
64. the status block Select Application Workstation Setup in H Designer enter the controller address and its size for Control Block and Status Block on the General tab The control block size must be set to 6 words 2 Taking the coating equipment as an example the control block for the NULL controller WO W5 the size is 6 and the status block is W10 W15 Application Properties General Connection Miscellaneous Logging Buffers Password Control Block Application Mame Address wm test z 2 PanelWorkshation Size H TEO Color Network Status Block Programming Type Maso Address g Controller FLC Default Nul ka Data Format Unsigned Binary ka Printer Start up Screen None kai hai Use external keys Extended Control Block ma Extended Status Block Multi lingual Support ay Select Language Watch Dog Timer Setting up control block and status block For the properties not explained in this section please see the sections Control Block and Status Block The recipe register is defined as in section Recipe Operation Steps the starting address is W100 and the size is 5 Beijer Electronics MA00822 165 Recipes 166 The following are the words and their names in the controller The words related to read write recipes are highlighted with a light blue background Please see the chapter Control and Status Block for complete details ontroller Intern
65. their own object attributes Click on the object and then select Edit Object Attributes and the dialog box will then be displayed on the screen You can also double click directly on the objects For properties not explained in this section please refer to section Object Menu On Off Button Attributes Shape State Text Graphic ID BTNOOOOE Function Shape C Set Momentary i Reset Maintained Security Minimum Hold Time Sec 0 I Operator Confirmation Waiting Time Sec Af Yarable Macro Write SU Use OH Macro Edit Read a Use OFF Macro Edit Enabled By i Moving Sign Attributes State Tex ID IMSGOOO08 Speed Frame Humber of Characters Per Shift Time Between Shifts sec C Bt oo Value C LSB paneer Unsigned Binary The Moving Sign object attributes dialog box Beijer Electronics MA00822 25 Instructions 2 3 8 State Text Management The main uses of State Text Management include editing the text colors and type faces used the object created This function also provides users with easier operation enabling such functions as copy modify line feed and so on State amp Text Management I StataH Text Language 1 Y New Paste From 0 Automatic Heating Cut Replace By 1 Boiler Control a 2 Elevator Design pa Copy Copy To Text Fool Delete Modify a The State amp Text Management dial
66. then be shaded FA 1 Screen_1 mimi 3 Select the command Align or Make Same Size to make the other objects aligned with or made same size as the master object FA 1 Screen_1 OK Beijer Electronics MA00822 23 Instructions 24 2 3 5 Nudge and Layer Nudge Choose objects to slightly shift location and adjust towards the specified di rection Layer If there are more than two objects users can shift the objects layer positions up and down a BR BECO te BAe HM o u em FF et Bea ti The Layer Bring to Next command sends the rectangle to the top ie Vew Somi Drew Gipect trary Appiston Tool Cpteres Were feb oe SBCO i hBA lt S RR oo sam u The Layer Send to Previous sends the rectangle to the bottom 2 3 6 Group and Ungroup If there are more than two graphics or objects on the screen to be edited frame by using Shift left click all objects to be grouped and then select Group All of the framed objects will be moved to the appointed position as a single unit Select Edit Group to group the selected objects together Ungroup is used to ungroup the selected group of objects Beijer Electronics MA00822 Instructions 2 3 7 Object Attributes You can edit the content of the objects or modify the data location and formats asso ciated with the controller Note that different objects such as the push button indicator moving sign and mes sage display have
67. to dis play the value on the operator terminal screen When the button is clicked a numeric keypad will be displayed on the screen Enter a value and then press ENT on the key pad The operator terminal will then write the input value to the specified controller register Variable Write Specifies the controller register to write to Format BCD Signed Binary Unsigned Binary Hexadecimal 32 bit Floating point and Octal can be selected Notification Specifies a register bit location to be notified the operator terminal will set the bit to ON Before Writing The operator terminal sets the notification location to ON when the numeric keypad appears and sets the location to OFF when the numeric pad disappears After Writing The operator terminal sets the notification location to ON after writing the input value to the write location Display Format Fill Leading Zeroes Select this option to add leading zeros for example 5902 1 is displayed as 005902 1 Decimal Pt Position Specifies the number of digits after the integral part of the number There are 0 10 digits for selection Fractional Digits The number of decimal digits Fractional Digits Integral Digits or Decimal Pt Position lt the maximum number of digits Integral Digits The number of the integral part in a number Fractional Digits Integral Digits or Decimal Pt Position lt the maximum number of digits Scaling
68. two methods depends on one s needs and available equip ment The following table describes differences between thestwo methods RJ45 crossover cable RJ45 straight through cable HUB required 6 2 IP Address Setup To read or send data from a operator terminal over Ethernet correct IP addresses have to be set up The IP address can be set under Configure in the operator terminal system menu Date mm dd yyj 08 25 03 CTS handshaking Disabled Day of the week Battery check Enabled Time hh mm ss 34 screen saver time Min DO Printer Disabled PLO model code gt PLO communication port Workstation node address Baud rate Download Upload Copy port Data bits i RTC adjust Parity IP address Stop bits i Gateway address 100 101 102 254 Command delay x 10 ms sub network mask 255 255 255 O A table of operator terminal with support Lt Note If uploading downloading over Ethernet the first three segments of the PC IP address must be the same as the first three segments of the operator terminal IP address Example PC IP address 192 168 1 10 and operator terminal IP address 192 168 1 XXX The IP address of the operator terminal should not be shared with other units in the network Beijer Electronics MA00822 193 Ethernet Communication 194 6 3 Application Upload Download over Ethernet The Ethernet enabled operator terminals together with H Designer provide upload download over Ethernet for appli
69. used for the connection IP Address haz EJ e mE Ethemet Lrosg link r P5 Type H TED Mono Macro Multilink Cross link and connection to Simatic S7 200 via PPI 1 to 1 is selected 140 Beijer Electronics MA00822 Instructions IP Address Specifies the IP addresses of the other operator terminal The specified operator terminal connects with the controller through the other operator terminal HMI Type Specifies the model to connect with the controller other operator termi nals For the setup of Multi link and Cross link please see the chapter Ethernet Commu nication Note The transmission parameters for the operator terminal and the controller must be iden tical as they are linked together When the controller model is specified H Designer will set it up as the controller default but you must ensure that this setup is identical in the operator terminal For the setup of each controller please see the relevant controller manual or the chap ter Communication between Operator Terminal and Controller Miscellaneous Tab On the Miscellaneous tab recipe functions and write time and data to the controller can be set up Application Properties General Connection Miscellaneous Logging Buffers Password Touch Screen External Keys S Buzzer Acting Time 5er 0 m Address wi n fa Auto Repeat Delay Sec 08 Recipe size 3 Za Auto Repeat Hate Hz Number of recipes 3 m Ed
70. 0 999 Must be 0 or multiple of 8 Octal number 0 377 End with 0 Octal number 0 377 End with 0 0 255 Must be 0 or multiple of 8 Counter Flag 0 255 Must be 0 or multiple of 8 The operator terminal can read up to 512 bits in one read command PLC port RS 422 HMI COM port PLC port RS 422 25 pin male 25 pin male RDB RXD LL RDB RXD RDA RXD Be RDA RXD SDB TXD _ _ _ SDB TXD SDA TXD SG DSR DTR DSR DTR PL port R9422 8 pin male PLC port R9422 8 pin male TXD TXD 9 7 SG front side view of the cable Operator terminal to Program Loader port of controller FX2n FXOn CPU port 272 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS422 Transmission Speed 9600 bps Set the SW5 OFF if parameters are set Transmission Format Size 7 bit in H Designer Set the SW5 ON if parameters are set in Parity EVEN the operator terminal Stop bit 1 bit Beijer Electronics MA00822 273 Communication between Operator Terminal and Controller 9 31 Mitsubishi A Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Input Relay nnn hex number 0 7FF end with 0 O
71. 001 225 Double word 999 999 999 Integer IVARInnn VARInnn nnn 001 225 Double word 2 147 483 647 String VARSnn VARSnn nn 01 50 10 words 0 20 characters Motor Position Double word 2 147 483 647 Motor Velocity nTVEL Double word LS Timer InTTIM Double word 0 999999999 Nnn Run Nnn nn 1 50 10 words 0 20 characters Program If Parker 6K still executes it will cause a communication time out Parker 6K needs an internal program in order to accept commands with the initial code 1 otherwise communication errors may arise Binary Error Status Binary IVARBnnn VARBnnn bb nnn 001 125 bb 1 32 Error Status TERn bb TERn bb n 1 bb 1 32 Bit Cable Drawing HMI COM port PLC port RS232C 9 pin male Operator terminal to RS232 port on controller 286 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS232C COM1 or COM2 RS232C Transmission Speed 9600 bps Set the SW5 OFF if parameters Transmission Format Size 8 bit are set in H Designer Set the SW5 ON if parameters are Parity NONE set in the operator terminal Stop bit 1 bit Beijer Electronics MA00822 287 Communication between Operator Terminal and Controller 288 9 39 Side Mida 20 20D 1 Data format
72. 00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication Format Format RS232C RS422 RS485 COM1 or COM2 RS232C Station No nn ks Set PLC Station 01 in H Designer 01 247 mem setup 247 mem 01 247 mem setup Transmission Speed 19200 9600 bps Set the SW5 OFF if parameters are Transmission Format Size 8 bit set in H Designer Set the SW5 ON if parameters are Parity EVEN set in the operator terminal n bit 1 bit Beijer Electronics MA00822 281 Communication between Operator Terminal and Controller 282 9 35 Omron C Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Range Block Read IRnnn nnn 0 511 Word 16 bits TCnnn nnn 0 511 Word 16 bits DMnnnn nnnn 0 6655 Word 16 bits area femnbb _ rnne0 S11 bB 00 15 __ obs00 eg IZ nnn 0 511 Multiple of 16 e g TC16 Cable Drawings HMI COM port 25 pin CAELE 9 pin male RXD 3 TXD 2 GND 7 ra RTX 4 CTX 5 HMI COM port 9 pin RXD 2 TXD 3 mu G m r RTX 7 CTX 8 m PLC port RS422 9 pin male RXD RED TXD TZD or 7 na Yy f y PLC port RS232C HMI COM port PLC port RS232C 25 pin male PLC port RS 232C 25 pin ma
73. 2 Value The maximum number of states is 256 3 LSB The maximum number of states is 16 Variable Read Specifies the register bit location Bit Two states in all Users can input more than two states but only two states will be displayed in the operator terminal Value 256 states 0 255 in all value 0 represents state 0 value 1 represents state 1 value 2 represents state 2 and so on LSB 16 states in all the operator terminal takes the bit number of the smallest bit that is on as the state number Format Specifies the data format There are three options BCD Signed Binary and Unsigned Binary For properties not explained in this section please see the section Specifying Object Properties Example of designing a Multistate Indicator object Fa 4 Screen_4 E a bd VEE The Multistate Indicator object 80 Beijer Electronics MA00822 Instructions On the Attributes tab of the Multistate Indicator object 1 Shape Select Round_1 and Black for border color 2 Variable Specify controller register W60 to read from The controller model is NULL Select LSB for Format Multistate Indicator Atbutes Shape State Text Graphic ID IMIOOO10 Select Read jw 60 yy C Bt oo Value LSB Format lu The Multistate Indicator attributes in this example On the State tab of the Multistate Indicator object 3 Add new states There are 4 states in this object Mul
74. 2 word left by A3 bits and saves the result in Al word The left shift command puts 0 into bit 0 and the last bit will shift out If the displacement A3 is greater than 16 then 16 will be the most shiftable amount Alternatively shifts A2 double word left by A3 bits and saves the result in Al dou ble word The left shift command puts 0 into bit 0 and the last bit will shift out If the displacement A3 is greater than 32 then 32 will be the most shiftable amount Beijer Electronics MA00822 215 Macros SHR gt Format Al A2 gt gt A3 Shifts A2 word right by A3 bits and saves the result in Al word The right shift command puts 0 into bit 15 and the first bit will shift out If the displacement A3 is greater than 16 then 16 will be the most shift able amount Alternatively shifts A2 double word right by A3 bits and saves the result in Al double word The right shift command puts 0 into bit 31 and the first bit will shift out If the displacement A3 is greater than 32 then 32 will be the most shiftable amount 8 3 3 Data transfer Note Both the MOV and BMOV commands can be located in the controller memory or internal memory These include RCPW CB RCPNO and e indirect internal memory The data format for this command is word MOV gt Format Al word A2 word Al double word A2 double word The MOV command copies the value of A2 to Al and the value of A2 is unchanged If Al
75. 22 147 Instructions 148 2 9 7 Compile The Compile button is used to test the application to see if any errors happen before the application is executed After correcting the errors the application can be execut ed Select Application Compile Compile Status Status Completed Statistics Application Size Screen 1 Errors 0 Check Sum 1928eeH Memory Utilization Rate JE Data Size Fixed Fonts 32768 True Type Fonts 0 Graphic Data 296 Macro Ladder 2046 screen Data age Reconstruction E566 oe The Compile Status dialog box After clicking OK the Error Message dialog box will be displayed on the screen Error Message Ser H Set Button at 178 74 Ho write address specified To locate an erroneous object or macro statement double click its error message To let ADP open the dialog bos of an erroneous object automatically after locating that object check the following box i Open dialog box automatically The Error Message dialog box Double click the error message to display the incorrect object or macro on the screen Alternatively check Open dialog box automatically to automatically display the in correct object Beijer Electronics MA00822 Instructions 2 9 8 Download Application and Download Firmware and Application Download Application is used to download the update application and screen to the operator terminal Download Application Erasing flash memo
76. 232C RS422 RS485 00 31 a Transmission Speed 9600 bps Set the SW5 OFF if parameters are Parity EVEN set in the operator terminal Transmission Format Size 7 bit set in H Designer Set the SW5 ON if parameters are Stop bit 2 bit Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 37 Omron CV Data format and range of the controller registers which H Designer can access Word Device and Bit Device CIO Area ClOnnnnbb nnnn 0 2555 bb 00 15 bb must be 00 HMI COM port PLC port RS 232C 25 pin CABLE 9 pin male CTX 8 Operator terminal to RS232 port on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting RS232C COM1 or COM2 RS232C po Transmission Speed 9600 bps Set the SW5 OFF if parameters are Transmission Format Size 7 bit set In H Designer Set the SW5 ON if parameters are Parity EVEN set in the operator terminal Stop bit 2 bit Beijer Electronics MA00822 285 Communication between Operator Terminal and Controller 9 38 Parker 6K Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Data Range Output inToUT On n 0 8 Double word Binary IVARBnnn VARBnnn nnn 001 125 Double word i o l Numeric IVARnnn VARnnn nnn
77. 3 Buffer 12 Buffer 11 Buffer 10 Buffer 9 Beijer Electronics MA00822 za CB4 TB4 SB3 CB3 TB3 SB2 CB2 TB2 SB1 LBCR1 Aa a 2 no as a za LBCR2 ana 2 m ma an aa na LBCR3 Buffer 1 177 Control and Status Block 178 Trigger Bit 1 12 Sampling Control The operator terminal can not only sample the historical trend graph at a particular time interval it can also sample the historical trend graph under the control of the trigger bit in the controller When the trigger bit TB 1 TB 12 is set to ON OFF about 1 sec the operator terminal will execute its sampling function Remember to set to OFF before re triggering Clear Bit 1 12 Clear Control By triggering the trend graph clear bit CB 1 CB 12 ON OFF once about 1 sec the trend graph can be erased The flag needs to be set to OFF if it is to be trig gered again Size Bit 1 12 Multiple Sampling Control By triggering the size bit SB 1 SB 12 to ON the operator terminal can sample single or multiple data values When the trigger bit TB 1 TB 12 is set to ON OFF about 1 sec the operator terminal will execute its sampling function Logging Buffer In setting up the logging buffer the first step is to specify the Source Address which is used to specify the controller address to read the data from After setting up the source address the size bit is set to OFF and the trigger bit is changed
78. 30 words in one read command Flag Bits nnn 0 255 b 0 7 b 0 e g FB23 0 Peripheral 1 0 nnn 0 255 b 0 7 b 0 e g PB23 0 Cable Drawing HMI COM port PLC PG PORT 25 pin ss CABLE 15 pin Male RS 232 Port i PG PORT Current loop converter An RS 232 Current loop converter cable must be used Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS 232 Current loop converter COM1 or COM2 gt RS232 Transmission Speed 9600 bps PLC MODE CODE 0 90U 1 95U 2 100U 3 102U 4 103U 5 115U 6 135U 921 7 135U 922 8 135U 928 Transmission Format Size 8 bit Set the SW5 OFF if parame Parity EVEN ters are set in H Designer Set the SW5 ON if parame stop bit 1 bit ters are set in the operator PLC Mode Code Controller s Data Block terminal n 3 255 must OPEN Command Delay Operator terminal Com mand Delay Beijer Electronics MA00822 291 Communication between Operator Terminal and Controller 9 41 Siemens Simatic S5 3964R Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Range Data Size nnn nnn 0 255 data block set 3 Word 16 bits mmm 0 255 nnn 0 255 Word 16 bits PLC port R
79. 5 ON if parameters Parity EVEN are set in the operator terminal Stop bit 1 bit Mode Set the parameter of UD70 address 14 02 to 06 Beijer Electronics MA00822 311 Communication between Operator Terminal and Controller 312 9 54 Vigor M Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Input Relay Output Relay Auxiliary Relay Step Relay Special Relay Data Special Data Timer Register Counter Register Counter Register Relay Type Input Relay Output Relay Auxiliary Relay ST1 Status Special Relay Timer Relay Counter Relay Timer Coil Counter Coil Cable Drawings SK nnn ame O 8i9t Word BBS nnn mmm 9000 9255 Wod Te bts Word 32 is Operator terminal to RS232C port on controller with 4 pin male connector i gt T i ag g a 4 HA port RS422 Operator terminal to RS422 port on donirati Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS232C RS422 JL Station No RS232C 0 RS232C 0 RS422 1 RS422 1 Transmission Speed 19200 bps Set the SW5 OFF if parameters are Transmission Format Size 7 bit set in H Designer Set the SW5 ON if parameters are Parity
80. 7 200 PP e a ee e i dejta 293 9 43 Siemens Simatic 57 300 CP340 00aaaaaa kaaa aaa 295 9 44 Siemens Simatic S7 300 via MPI port aaaaavaa aaa ovaa 296 9 45 Siemens Simatic S7 300 MPI Cable aava nana anaan nakana 298 9 46 Siemens Simatic S7 300 HMI Cable aaa ana anaa na anaanaaaaannnannaa 300 OAT Pad POD o S E S E AAE 302 gas Tian ed 2 o jj o o e ene 303 o Ski ita 2 ee e e m m manam mre mv rea mr 305 950 Telemecinique TSX MI O zeko jojo i o oja 306 9 51 Toshiba M20 Ma Oes nET E SA 308 gS Tohbr CT eenen r eo a ner eee 309 9593 UnmidnveP UD 0 sie sl i i dd ija eee nce tao od do S daj 311 IDE MODNI sidro ia e rao SG trad dna 312 JD Oye Ae N I o a i ee ten 314 10 Appendix A H Designer Features and Operator Terminal Models 317 Beijer Electronics MA00822 Contents VI Beijer Electronics MA00822 Installation 1 Installation The basic H Designer system requirements are as follows PC CPU 80586 or higher Memory 64 MB RAM or more Hardware 60 MB or more available hard drive space Display VGA or SVGA Microsoft Windows with 256 colors or higher and a resolution of 800x600 or higher Since all the programs in the H Designer suite have been compressed one needs to uncompress and install the software before using it The H Designer software can be run under the following Windows operating sys tems Windows 95 Windows
81. 9600 bps Set the SW5 OFF if parameters are set Transmission Format Size 7 bit in H Designer Set the SW5 ON if parameters are set in Parity EVEN the operator terminal slat bit 1 bit Note If only one controller is used set the Station No as 255 In a network set the Station No to 0 31 254 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 18 Jetter Nano_B Data format and range of the controller registers which H Designer can access Word Device and Bit Device Rnnnnn nnnnn 0 32767 Double word 32 bits nnnnn 0 32767 Word 16 bits Relay Range Innbb nn 1 16 bb 01 08 1 or multiple of 16 1 Onnbb nn 1 16 bb 01 08 1 or multiple of 16 1 Fnnnn nnnn 0 2301 If nnn lt 256 must be 0 or multiple of 24 If nnn gt 255 and lt 2048 must be multiple of 24 16 If nnn gt 2047 must be multiple of 24 8 PLC port R5232C 15 pin male HMI COM port PLC port RS232C 9 pin male Operator terminal to RS232C port on controller 9 pin male Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting RS232C COM1 or COM2 RS232C fstationNo Nome Transmission Speed 9600 bps Set the SW5 OFF if parameters are set Transmission Format Size 8 bit in H Designer Set the SW5 ON if parameters are set in Parity EVEN the operator terminal Stop bit 1 bit Be
82. 98 Windows ME Windows 2000 Windows XP The software is available from the following website or your local distributor www beijerelectronics com Note also that not all features provided by H Designer are available for every operator terminal model For complete details of these H Designer features and the applicable models please refer to Appendix A H Designer Features and Operator Terminal Models Beijer Electronics MA00822 Installation 1 1 Installation Procedure 1 Start your computer in the Windows environment 2 Click Start and select Run When the Run dialog box appears on the screen select Browse to locate the installation program Setup exe Type the name of a program folder document or Internet resource and Windows will open it for you Running the H Designer installation program Setup exe in Windows 3 Click OK to start the installation H Designer 6 0 8 03 Welcome to the InstallShield Wizard for H Designer 6 0 6 03 The InstallShieldA Wizard will install H Designer 6 0 5 13 on your computer To continue click Hest H Designer is preparing to install 4 Follow the instructions and specify the hard drive and directory where H Designer is to be installed H Designer 6 0 8 03 Choose Destination Location Select folder where Setup will install files Setup will install H Designer 6 0 8 03 in the following folder To install to this folder click Next
83. 9999 m om An example of a System Message Beijer Electronics MA00822 145 Instructions Select Tool System Messages System Messages H Message 0 Password Table 1 Password Keypad 2 Numeric Keypad 3 Hexadecimal Keypad 4 Alphabetic Keypad 5 Set Time amp Date Cave az 6 Communication Error S i 7 Alarm 8 Are you sure 9 Numeric Entry 10 There is no input 11 Sign not allowed 12 Input out of limit 13 Invalid input 14 Character Entry 15 Set Constant 15 Set Value 17 Set On Off 18 Allowable Range 19 Invalid password Please enter again 20 Passwords must have eight digits Ti Meadifie Darmar LU The System Messages edit window Double click on the message block the message can be modified in its dialog box as shown below system Messages H Message English 1 Password Keypad 2 Numeric Keypad 3 Hexadecimal Keypad 4 Alphabetic Keypad 5 Set Time amp Date 6 Communi 7 Alarm Sime as eee Cancel 17 Set On Off 18 Allowable Range 19 Invalid password Please enter again 20 Passwords must have eight digits TI Madifu Dareum wg Editing System Message The Save as Default button is to save the system messages as a default file PSM 146 Beijer Electronics MA00822 Instructions 2 9 6 Macros Macros enable the ope
84. A LA SE 211 8 2 Macro ClassificatiON S icv csnecersicaceusenicedeadedeseadevos ade AE 211 OZU Application Macros lens o daske Sika ENEE 211 8 22 Screen MACOS acest EDS A e ob ka s ai 211 0 23 ONOFF Nfacros padom doo od o s ada 212 824A Sub eA OS ib dali adi haa aaa EE A kasa 212 8 3 Macro Commnand Soneraa E i A ks da OR N 213 Sal ARI O IMELIE oro Oo LL S GR Geen ote Gee ad eee eee 215 NO M o e a eS Pree ne e ee 215 83 3 Daratan CE aa ee ea aja o naa 216 BILA Compa onae a e a i dA 216 8 39 FlovwConoL ske anu o N 220 8 9 0 Data GORVEISIGH sno oi s A teased i i 221 OI DESCUIDO sai E ha teat buat S Bi KG 222 SLIKOM A noi scence aoe A Gi o E E sa 222 8 4 Wo MAR rm em m m moma rr va a 226 8 9 Vinee pineal Memory post ae vijak dn pastira 226 9 Communication between Operator Terminal and Controller 227 9 1 Allen Bradley Micrologic 1000 1500 4 40 205 Doe chateau 228 D2 Allen Bradley PLO get sa sia ds dadne 230 9 3 Allen Bradley 5567505204 erenn ar E a 233 9 4 Allen Bradley IQ Master Servo Controller eee ceeseeeeeeseeeeeeeee 236 9 5 ABB Coml Slave MGde es enski o atlasa lats ons 237 9 6 Computer as Master Slave V2 Null Modbus Master 238 9 7 Pea NAPE ecient E n NA SL LV LE A LE ee a 239 9 8 Pee oe ey EE Su ohne st pogotke 240 9 9 FOCOMlEB ha ja a a OD E E E sti 241 9 10 PSU 2 res one s NED ED O GB S OKA 243 9 11 Foi NB ses ese eases a S E i ik 244 9 12 GE Series OCC reared cdo eset eaten eda o
85. Application Tool Options LadderPlus Window Help DeuWs dalms HGO SeMKH o Hh Hts HE lge Afi u i Ih RES i 81 Recipes iT 42 Analog Objects t 4 Screen_1 1 10 Static Text 20 Graphics 50 Trends Trends Cascade is selected for screen display Fe ft Mew Goren Drew Object bsy Apion Tod Oyos inden ep D k FEA BECO eM BM IDF mt BAR du E kasom ms F E SA ESEE Ee oso ue ff obser UNSRESAM gt iLaOBJ7NOBCORB 1 SHareg m u ane G es bo gt do Trends S12 Son Do 205 Tile can be used when copying between screens and for an overview of screens Close All is used to close all open screens at once the screens will not be saved The application is not closed 158 Beijer Electronics MA00822 Instructions 2 13 Help Menu The Help menu offers complete details and instructions about Macros and Ladder Plus Selecting Help About displays the version number and copyright information of H Designer Beijer Electronics MA00822 159 Instructions 160 Beijer Electronics MA00822 Recipes 3 Recipes Recipes include blocks of similar systematic data Because of the similarities users can edit them as a group of recipes for convenient transmission In this way users can send data efficiently and accurately Note Recipes are not available for all operator terminal models please refer to Appendix A H Designer Features and Ope
86. BCD The operator terminal updates the time block every minute with the time data The format of time block is shown in the following Low byte of word 0 07 00 High byte of word 0 15 08 Low byte of word 1 07 00 High byte of word 1 15 08 Low byte of word 2 07 00 High byte of word 2 15 08 Day of week 1 Sunday 2 Monday 3 Tuesday 4 Wednesday 5 Thursday 6 Friday 7 Saturday The steps to set up the time block follow Select Application Workstation Setup in H Designer and you can set up the time block on the Miscellaneous tab The start ing address is W240 and the size is 3 words so the data will be saved in the W240 W241 and W242 16 bit registers The operator terminal updates the time block ev ery minute with the time data Application Properties General Connection Miscellaneous Logging Buffers Password W Read write recipes from to PLC Address w100 oy Recipe size 5 Number of recipes f Edit Field Definition kw Write time and date ta PLC Address W240 a Include second Touch Screen External Keys Buzzer Acting Time Sec 0 F Auto Repeat Delay Sec 08 i Auto Repeat Hate Hz 5 tv Start Up Delay Sec 0 Display Countdown J Synchronize time and date with PLE While opening a screen do not display the data until all of them have been read Seting up the Time Block Beijer Electronics MA00822 185 Control and
87. Bit S 11 8 Bit S Bit 2 gt STOP Bit S 0 1 Bit 1 2 Bit S Bit 4 Bit 3 gt PARITY gt 00 NONE 01 ODD 11 EVEN Bit 6 Bit 5 gt COM PORT gt 00 COMI 01 COM2 10 COM3 11 COM4 Bit 7 gt Not used Bit11 Bit 10 Bit 9 Bit 8 0001 115200 0010 57600 0011 38400 0110 19200 1100 9600 Others 4800 Bit 15 gt Computer Protocol Driver 0 Disable 1 Enable If this service is successful the word n 1 will be set to 1 otherwise it will be set to 0 Some models provide a Computer Protocol slave driver for the second COM port This function provides communication between PC another operator ter minal on the second COM port The operator terminal can communicate with the controller over the first COM port and the connection steps are the same as the normal steps The P PC can read from the internal registers 0 8191 the data in W0 W8191 corresponds to 0 8191 When using the Computer Protocol driver this function is unavailable to GET_CHAR GET_CHARS PUT_CHAR and PUT_CHARS 5 GET_CHAR gt Gets a character from the COM port Format SYS GETCHAR N The character will be saved in the low byte of the word n If there is no input the word n will be set to be 1 ffffH 6 GET_CHARS gt Gets a number of characters from the COM port Format SYS GETCHARS N The word n specifies the maximum number of characters to receive The actual number of characters received is saved in wo
88. CPU will over load and malfunction The FOR NEXT loop command can execute the program repeatedly Each FOR command must have one corresponding NEXT command One is allowed to have up 3 nested FOR loops such as FOR 1 FOR 2 FOR 3 NEXT NEXT NEXT END gt End the macro The END command represents the end of the macro The macro will not execute the next line of code after the END command but will start at the first line of code next time the program is run Note The END command represents the end of the macro and is invalid in sub macro Sub macro must use the RET command otherwise the program will cause errors 220 Beijer Electronics MA00822 Macros 8 3 6 Data Conversion Note Only internal memory can be used in these commands The internal memory includes RCPW CB RCPNO and e indirect internal memory BCD Convert BIN to BCD Format Al BCD A2 This command is used to convert A2 integer word or double word from a binary number to a BCD num ber and saves the result in Al Valid integer values of A2 are between 0 and 9999 word or 0 and 99999999 double word BIN Convert BCD to BIN Format Al BIN A2 This command is used to convert A2 from a BCD number word or double word to a binary number and saves the result in Al integer word or double word Valid BCD numbers are be tween 0 and 9999 word or 0 and 99999999 double word W2D Convert WORD to DOUBLE WOR
89. Cell Background Style Separator Style Style H Color i Pattern Color pana BackgroundColor C Stile H Color E Interlacing Apply to 7 ey Profile 4 98 width 73 gt Color gg g Yi 34 Height 9 Pedan mi The Table dialog box Use First Row as Row Header Specifies the pattern style and color of row header Use First Column as Column Header Specifies the pattern style and color of col umn header Border Specifies the style and color of border Profile Specifies the location and size of a table Cells General Specifies the number of rows columns and style Beijer Electronics MA00822 53 Instructions 54 Transparent Lets other object s be displayed under the table FA 1 Screen_1 Example Static text displayed under the table Interlacing Interlaces rows or columns Not available with transparent table FA 1 Screen_1 Interlacing Apply to Header Interlace applied to header Not available with transparent table FA 1 Screen_1 Interlacing applied to header Shape Shape provides graphics for selection Double click on the object then click Select to access the shape library in the Shape dialog box Beijer Electronics MA00822 Instructions Flow Chart Flow chart is one of the applications in Draw used for lines geometric graphs and frame edge editing You can illustrate an applied flow chart clearly to facilitate oper
90. D Format Al W2D A2 The W2D command is used to convert A2 from a WORD number integer to a DOU BLE WORD integer and saves the result in Al double word signed or unsigned Valid integer values of A2 are between 0 and 65535 word unsigned or 32768 and 32767 word signed This function can extend the size of a 16 bit signed integer word to a 32 bit integer double word B2W gt Convert BYTE to WORD Format Al B2W A2 A3 The byte array starting at A2 with the size A3 and the result is saved in the memory starting at Al word The high bytes of the word array are set to 0 W2B gt Convert WORD to BYTE Format Al W2B A2 A3 The word array starting at A2 with the size A3 The result is saved in memory starting at Al The conversion will discard the high bytes of the A2 word array SWAP gt Swap the Bytes Format SWAP A1 A2 The SWAP command is used to swap the low byte and high byte of each word of a memory block starting at Al A2 specifies the size of the memory block in words After execution the Al data will be changed MAX gt Maximum Format Al MAX A2 A3 Sets Al to the larger of A2 and A3 The data format can be word dword signed binary or unsigned binary MIN Minimum Format Al MAX A2 A3 Sets Al to the smaller one of A2 and A3 The data format can be word dword signed binary or unsigned binary A2H gt Convert 4 digit hex number in ASCII character form int
91. Hame z5 Therefore this object is not controlled by the controller and moves along a horizontal marquee at 60 pixels sec This object will move back and forth when it comes to the end point Beijer Electronics MA00822 111 Instructions Moving to the right along a horizontal marquee Moving to the left along a horizontal marquee Example of Animated Graphic object Not Controlled by controller Auto Change Connected Line On the Attributes tab of the Animated Graphic object 1 Check the Not Controlled by PLC option 2 The graphic state is Auto change and the Rate is 0 1 sec 3 The path is Connected lines 4 The movement rate is 60 pixels sec the direction is Two way Animated Graphic Attrbutes State Graphic Path ID AGOOOS Fath W Hot Controlled by PLE C Horizontal line C Horizontal marquee C Vertical line f Vertical marquee f Connected lines f Still Graphic State Movement Rate pisels sac 60 f Location dependent P C One way f Two way Rate Once per o sec E On the Graphic tab of the Animated Graphic object 5 Setup 8 graphics for auto change The example uses 8 wheels with different angles to create a rolling image when the graphic state is changed automatically Beijer Electronics MA00822 Instructions 6 Add more points to make the movement path smoother H 121 animated graphics Therefore this animated graphic object
92. Horizontal marquee Vertical line Vertical marquee Connected lines Stil Graphic State Movement Rate pixels sec 1 0 One way Co Two way f Auto change OK Cancel On the Path tab of the Animated Graphic object 5 This object is one state and the graphic is oil bmp ar Therefore this animated graphic is not controlled by the controller and moves along horizontal line at 10 pixels sec in one way mode the graphics are both oil bmp 110 Beijer Electronics MA00822 Instructions Example of Animated Graphic object Not Controlled by controller Two way Horizontal Marquee On the Attributes tab of the Animated Graphic object 1 Check the Not Controlled by PLC option 2 The graphic state is Location dependent 3 The path is Horizontal marquee 4 The movement rate is 60 pixels sec and the direction is Two way Animated Graphic i X Pitrbutes State Graphic Path ID IAGOOD4 Path kw Not Controlled by PLC t Horizontal line f Horizontal marquee C Vertical line C Vertical marquee C Connected lines C Gill Graphic State Movement Rate pivels sec 60 C One way f Two way Auta change Duplication On the Path tab of the Animated Graphic object 5 Since the graphic state is location dependent two states are set up Animated Graphic ied Atributes State Graphic Path 3 Bitmap Y Es Redraw ode M oe State lo 0
93. List Drop Down List Indicator Numeric Display Irrelative to screen button but related to dynamic data Character Display Cari Message Display Bar Graph Trend Graph Y Chart Panel Meter Pie Graph Dynamic Graphic ey Related to dynamic controller data and operator terminal Historical Display memory buffer zone Alarm Display Sub macto Zia Related to application The Object menu 2 1 Creating Objects You can select the object type from the Object menu for editing Some objects such as the Push Button have sub command lists las Library Application Tool Options Y Push Button k Set Numeric Entry Reset Character Entry 4 Maintained List Momentary Drop Down List Multistate i Set Value Indicator ae Set Constant Numeric Display ka eno Increment aracter Displa 5 i i Y Decrement essage Display Goto Screen Bar Graph j Previous Screen Trend Graph i Action mY Chart Panel Meter Pie Graph Dynamic Graphic Historical Display Alarm Display s Sub macro 24 The Push Button sub commands Beijer Electronics MA00822 Instructions Some of the objects are provided in the Basic Objects toolbar for editing Basic Objects on ofr Bg vow ma 2 g m pec Pod e rel s se dom The Basic Objects toolbar Select a desired object from the list for example Push Button Set Button and you will get a cursor that allows you to drag the object to the desir
94. Master Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Data Size Data Register nnnn 0 2047 Word 16 bits Relay Type Realy Range Bit Realy Bnnnn nnnn 0 1023 Cable Drawing HMI COM port RS232 25 pin female TXD RXD GND RTS CTS DSR CD 20 DTR KJ O O U A m WwW Operator terminal to RS232 port Note This figure is a PC simulation and the hook up method depends on the actual controller pin position Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting RS232C RS422 RS485 RS232C RS422 RS485 Transmission Speed 9600 bps Set the SW5 OFF if parameters Transmission Format are set in H Designer Set the SW5 ON if parameters are Parity NONE set in the operator terminal Stop bit 1 bit Note COMPUTER AS MASTER V2 does not only include the function of COMPUTER AS MASTER it also can inform the slaves when the data is changed e g value input The Null function includes macro and ladder but no communication with any controller 238 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 7 Delta DVP Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range nnnn 0 1008
95. N Round Panel Meter ID IPMOOOOZ Scale dela Color ii Select cope Number of major ticks 7 i i Cancel l l Number of minor ticks EN k 7 Bkg Color i Display axis FPMIJI C l Variable Head Er N Number of digits E hal Format Signed Binary Decimal point position eal Min 20000 Max 30000 Min 20 Max 30 i Display mark Font of oo f O76 Needle Target Range Color C a Sweep Angles deg 300 360 Edit The attributes of the Round Panel Meter in this example 6 Click Edit for Target Range and check Display range scale Set the Low range limit to 10000 and Blue color the High range limit to 10000 and Red color Rectangular Panel Meter The properties of the Rectangular Panel Meter are the same as for the Round Panel Meter please see section Round Panel Meter Beijer Electronics MA00822 Instructions 2 7 16 Pie Graph The Pie Graph is used to make the operator terminal read the register values in the controller Then it converts the values into a 360 degree pie graph and displays the graph on the operator terminal screen Display Format Starting angle Specifies the original angle of the pie graph Pie color Specifies the color used to fill the pie graph Bkg color Specifies the color of the unfilled part of the pie graph Style Specifies the pattern style used for filling the pie graph Border Check this option to display the pie grap
96. NEE REI eee RR PRVA I PR SR EM ene 100 Panel M StS snasao o aj ae 103 Pie Cea i i o i oi 105 Dynamic Graphics ei go i S S E 106 TIStOr Cal Dipli sasa d on jen E 118 jo ga bo coin mmm eure pe pr 126 RAJE o mene mr nm m re ek 131 Library MED aniona Gana Saso lo dei as iko 132 Biunap Libii y a aos nos o i bitove 132 Koni DIDA alo i od ee A ana sa e ka 134 JAVE a5 Sa Dereon dl Oe i a a eia 135 Shape Library Manase isipin ir sai aid od 135 OO E A E E E E a ja ie cles 136 Applicanom Meni oke aan E NEN 138 Workstation SetU a i i E R 138 Tap ea ess ga oe ed ec vedanta E o gli js es 142 Alaro Se er o a e e re 143 Sidone MENI Re renee o al ta 144 Dy SEC TEV SSAC as E eh episode doo 145 Moro og s ata ooo oj E E E loa 147 Compleanno ta 148 Download Application and Download Firmware and Application 149 BC PRO te CIO ides eis jadi e s i o sd a Ah 150 JE M o pr m o 150 Cross Ref eC Ao po O Gei ip 150 Off line and On line Simulation vasa ssasivesjai sivi edna 153 View Edit RECIDES okovi dila gih E sastao 154 Oplons Menu sosa a A A PG Rata 155 SOLIS Riko Cinta o aa lao tad li Cre Tee o 155 IB Soy hig Cog ts s ear ater nj ma O sk oja 155 Gad AIDU smem pam mm m nr mere tren Serer Te 155 TTANS MISSION S T i a as daskom inski roi 155 Detault Screen Backe round Style saga te adi 156 Derili ame a io BE o e E O o 156 We tawlt Wet Styles seas e ra sA lt sis neces 157 Nimeric keypad Seni zbasactiacsei Ko ine eaten ee EE 157 Editine OPON nanea i i cars peeve d
97. Number 6 bw Included in the compilation Screen Name Language 1 Screen 6 Only refresh the screen and enable its touch keps when it is the top most screen Always refresh the screen but only enable its touch keys when itis the top most screen Always refresh the screen and enable its touch keys Meed a base screen D Screen Demo Start 2 Demo Start 3 Demo Start 4 Static Text Static Text 12 Static Text 20 Graphics 21 Graphics Specifying a base screen Beijer Electronics MA00822 This screen is a sub screen D Heiaht JO m 3 Printed Area Upper left Position ml 0 TT 0 Lower night Position ee 1 Ya 0 cance 43 Instructions 44 2 6 Draw Menu To strengthen the effectiveness of the display of the created objects it is often helpful to draw a rectangle a line or a scale to label the object data This will help users to read and take note of the data The geometric shapes are static and are not influenced by dynamic controller data 2 6 1 Geometric Shapes The following geometric shapes are included Toolbar button Described in section Line Horizontal Line and Vertical Line Draws a horizontal line E Draws a vertical line m Connects lines with mouse Connected Lines and Free Form movement z Connected lines and curves with mouse movement ao Draws a rectangle Rectangle and Solid Rectangle Draws a solid rectangle E Draws a parallelogram
98. On the Attributes tab of the On Off Button 1 Shape Select Raised 2 Write Specify the controller register BO to write in Read Specify BO The controller model is NULL On the Text tab of the On Off Button 3 Enter text OFF for state 0 the font 16 x 16 the color White and the back ground color Black 4 Enter text ON for state 1 the font 24 x 24 the color Black and the background color White ON The button is white displaying ON in state 1 and black displaying OFF in state 0 Reset Button This button is contrary to the Set Button A Reset Button sets a bit location to OFF whenever pressed or released Attributes Tab Function Select Reset All other properties are the same as for the Set Button please see section Set Button Maintained Button The function of the Maintained Button is to change the button states by pressing Click to be ON and when released will still be ON until re clicked to be OFF Attributes Tab Function Select Maintained Macro There are Use ON Macro and Use OFF Macro options for the Maintained Button For properties not explained in this section please see chapter Macros All other properties are the same as for the Set Button please see section Set Button Momentary Button The function of the Momentary Button is to change the state by clicking and releas ing When the button is pressed the bit location is ON when it is released it is OFF Attributes Tab Functio
99. P IP Consequently the operator terminal can control or read data from the controllers LI mD m Connection to Ethernet enabled controllers Perform the following steps to set up the connection 1 Select Application Workstation Setup On the General tab select the type of controller or Modbus TCP IP Device from the Controller PLC list 2 On the Connection tab select Ethernet for Port method used for the connec tion Enter the address in the Default Address and IP Address boxes Application Properties General Connection Miscellaneous Logging Buffers Password Device Type Connection 1 Modbus TCP IP Device Rename t HMI HodEus TCP IP Device Default Address i Port method used for the connection IP Addresa Maz Mes m To o ka Command Delay me Multilink This HMI iz a multi link master W Use default port oa Cancel Selecting communication method and setting the IP address 3 Download the H Designer application file to the operator terminal and set up the link to connect 196 Beijer Electronics MA00822 Ethernet Communication 6 5 Multi Link One Master and Multiple Slaves The Multi Link over Ethernet function allows linking several operator terminals one master and multiple slaves This speeds up communication between the operator terminals DOL LTT Multi Link over Ethernet Perform the following steps to set up the communication Setting up
100. Parameters Perform the steps to set up the communication parameters Setting up the master The master is the operator terminal that communicates with the controller 1 Select Application Workstation Setup and check the This HMI is a multi link master box Application Properties General Connection Miscellaneous Logging Buffers Password Connection 1 HMI Address m Foart method used for the connection CoM Multi link WW This Hbl iz a multi link master Master Fort COM bal Limit data access to Multilink i Common Blocks only Setting up the multi link master Device Type DELTA DVP E5 55 ER EF Rename DELTA DVP ES 55 EP EH PLC Default Address 1 S600 Data Bits 7 Even Stop Bit s 2 Baud Aate Parity fi Default E Command Delay me Timeout Time Sec Number of Retries 2 Download the edited application to the master operator terminal 188 Beijer Electronics MA00822 Multi Link Normal Connection Port Setting up the slaves The slave operator terminals do not communicate with the controller 3 Select Application Workstation Setup On the Connection tab select COM1 port for the connection 4 Setting up the Default Address If the slave operator terminal dip switch 5 is set to OFE the operator terminal will read the communication parameters from H Designer The unique address 2 10 must be entere
101. Reference The Cross Reference tool helps you identify the screen name screen number con troller address tag address or macro in use quickly Cross Reference c i h ht E Graphics 22 Graphics 23 Digital Objects 30 Digital Objects 31 Analog Objects 40 Analog Objects 41 BTN00007 Reset Button 15 199 85 41 FALSE Analog Objects 42 1 2 3 4 Trends 50 5 BTNO0006 Set Button 15 159 85 41 FALSE 6 7 8 AL00011 Alarm Frequency Table 18 74 259 80 FALSE BTN00008 Reset Button 105 199 85 41 FALSE BTN00010 Set Button 105 159 85 41 FALSE Alarms 60 BTNO0017 Set Constant Button 193 158 83 82 FALSE Alarms 61 o T00011 Static Text 17 48 278 15 FALSE Multi language 70 Recipes 80 Recipes 81 Ladder Macro 90 Background 99 Security 2 100 Security 101 Security 3 102 Subscreen 110 T00004 Static Text 59 0 202 43 FALSE F E E E E E E E erm eee Oe Oe E E E E The Cross Reference window The icons can be used to sort according to screen name screen number controller address tag address or macro in use The right hand table will list its objects and properties The preview window below will display the selected object Click on a heading of a column in the table such as Serial No Name or PLC Addr to sort the properties in ascending or descending order 150 Beijer Electronics MA00822 Instructions Select this icon to sort by screen number Select this icon to sort by
102. S LS di iv MM e mrak m ma rm 32 ZV NING WCU CC NI o Sei ooo EEL O essences sae 32 eee Dea IVIAM ACE eaa A E A OE dos aa 32 25 Oe Screen 2 ee eRe A 36 2 5 4 Cut Copy Delete Current Screen and Paste Screen 000eeeeonacao 36 2 5 5 OPEN Macro CLOSE Macro and CYCLIC Macro 36 2r oreen PIOpErlE I gao ad od i e 37 2 6 Diiw Menene ea er m E me mm m ES 44 DOO MG comic thie Sila es a a E A Hoi 44 Df CVI COC IVI eT odi i A gat to ctone cele na aka 56 D L Creatine ODJE E sx acne send E Sei a 56 272 Specityinied Dject Properties sti teh esa i ah 57 Dee BOOST ae et ital carters ee enlace see eta haem ed eaenea aes 61 E NO EDO Ve dn e eo osa eta aos 73 e GM Erua s hn A A s a AS 76 a JM a je e ro mr e m mr a eva Te Zo SNOOP MO win Wet Stace eas bet sees aes dnik sidra dato s 2 ol oleic sat neue ast 79 DT RdC aaa TEE AE a 80 2 090 Numierne Splav oaio N N det OSA 85 DINO Character Displayer a tudes A EE dida 87 Beijer Electronics MA00822 Contents 2AM ZF 23 2 7 14 Pe S 2 7 16 Zep 2 716 bell 2 20 2 8 2 8 1 2 8 2 2 8 3 2 8 4 2 8 5 2 9 2 9 1 yay 2 23 2 9 4 2 9 5 2 9 6 De 2 9 8 29 2 10 2 10 1 2 10 2 2 10 3 2 11 2 11 1 pale es 2 11 3 2 11 4 2 11 5 2 11 6 ZAZ ZLS 2 419 ya 2 13 Recipes 3 1 3 2 3 3 3 4 Messies Displays Objects ae iii s osa civics ot di join nae 88 Bar Grap Mirenen n nv ra o ei arak 95 Trend GADI Ni a a e a S da A SNESE 98 PGA Gh oe
103. S232C 9 pin male Operator terminal to RS232 port on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting RS232C COM1 or COM2 RS232C nE Transmission Speed 9600 bps Set the SW5 OFF if parameters are Transmission Format Size 8 bit set In H Designer Set the SW5 ON if parameters are set Parity EVEN in the operator terminal Stop bit 1 bit 292 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 42 Siemens Simatic S7 200 PPI Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Input Image Input Image Output Image Output Image Internal Bits Internal Bits Timer Counter Special S Special S Special Bits Special Bits Special Bits Analog Input Word Analog Output Word Data Area Data Area Data Area m Ba on powiewa an mon powiewa mmn mos U RH swm mos wa o AQW SW SD cannot be used in CPU212 214 Relay Type Input Image Output Image Internal Bits Timer Bit Counter Bit Special Bit Data Area Bit Special M Cable Drawings HMI COM port RADITXD 14 RXD TXD 15 SG RXD TXD 1 RXD TXD 6 GND 5 nb obo oeeo ans feos bo oeg a0 PLC port R9485 9 pin male 3 DATA 8 DATA 5 SG 7 24V PLC port RS485 Q pin male 3 DATA 8 DATA 5 SG 7 24v O
104. Status Block 186 4 4 2 The Controller Writes to the Operator Terminal The operator terminal can read time and date from the internal real time clock of the controller Then the operator terminal can modify the corresponding data for the time date week read from the real time clock and display the content in the operator terminal The operator terminal updates the time block every minute with the time data 4 5 Read Cycle The operator terminal does the following steps to accomplish one read cycle and it will repeat these steps continuously The user needs to know this read cycle in order to configure an operator terminal to communicate with the controller efficiently Steps of the cycle 1 Reads control block of the controller 2 Reads specified register blocks for the current screen 3 Reads specified On Off blocks for the current screen 4 3 Reads specified alarm register regularly 3 10 sec Reads a number of controller locations which 1 are shown on the current screen and 2 do not appear in the current screen s register blocks or On Oft blocks and have not been read recently The number of controller locations to be read in this step is specified by the number of individual reads per read cycle of the current screen This read cycle is repeated continuously from Step 1 to Step 5 Beijer Electronics MA00822 Multi Link Normal Connection Port 5 Multi Link Normal Conn
105. a Format Unsigned Binary T Printer Start up Screen None kai T Use external keys Extended Control Block a Extended Status Block Multi lingual Support a Select Language Watch Dog Timer Setting up control and status block parameters Beijer Electronics MA00822 171 Control and Status Block 4 1 Control Block The Control Block is a block of continuos registers in the controller The most im g portant function in the operator terminal is the control block The control block enables the controller to control actions in the operator terminal through the controller program The minimum number of words used in the con trol block is 2 The maximum number of words used is 32 The size of the control block varies according to the functionality required if recipe functionality is used then the minimum length is 6 words The members of the Control Block are shown in the following table wm sereen Number Register SNR vwo DO Logging Buffer Control Register 3 RCPNO Number Register RNR VW10 Wn 6 and General User Area Register GUAR above User s application registers CBn VW14 cb7 n must not exceed 31 aie VW18 cb9 Say for example that the starting address is WO the starting address can be specified the members in the above table will shift according to the starting address Size 10 means that the operator terminal can read data from the W0 W9 10 words control ler re
106. aagee sigan tees 157 OW Tid Oye Vie gc cscs E si oi o a dasa 158 Felo MEDU i osa ad oj o i a NTE 159 pra mr m nr rav N A 161 je eo o ma me m mam umom mmm mmm mm 161 Recipe Operation S eps ida eia das sa dai i es ds 162 Recip Controlled by Controler 2 eo a aa ae easi 165 Recipe Controlled by Operator Terminal 000000 vanno 168 Beijer Electronics MA00822 Contents 4 Control and Status Block aaaaana vana aaa aan akan a nana nakana kaaa aaa kaaa aa aaa nana 171 4 1 Control Block i oi a i ai SA a ado 172 All Sercen NumberRESISLen o gad i o od dos 172 AMD Command Flag Ree iter orders epski ol sni 174 4 1 3 Logging Buffer Control Registers LBCRS 00 00 176 4 04 REPNO Number Register RN Riccctecacstaccsietaseiescetsivervieieriasiesetiee 179 Aa General User Area Ree se tacit tet e rarer rears en sere olja 179 4 1 6 Determine the Control Block Size aaeaaaaaa aaa aaa anna a aaa aanaaan aaa 179 4 2 Satis BIGEk sou mod edo a ad s ded da k 180 ADM SONUS TRC OIG CCK oni ee ci ob ot dd dA 180 ADD eneral Stanis REPTE sai a Ado A dia 180 4 2 3 Logging Buffer Status Registers LBSRS aavaaaaa vana va aaanaaao 182 ADA ROPNO Image Recisteric cs seissaccotseviriersicsveieiestabl A sis 182 4 3 Recipe Register Blocki gazde koki ode g ad N 183 4 3 1 Recipe Register Number Enhanced Operator Terminals 183 4 3 2 Addressing Recipe Data Enhanced Operator T
107. ad i dd weaned ene 246 9 13 GSE Amu FO eS Newsagents esd ew ao ee ia 247 9 14 Pe TAC iste Gas a mer m mm meme dnote ations 249 9 15 PA EE ed eerste esas decease i o Gah bond ez arak 250 9 16 Hust CNG Controller s ds ea eo A A S EA 252 9 17 Idec Micro gt AAA 253 Ore Jere Nano Bit sein daj du pd et bs je jedan 255 els Jere IDE ICE e ia odo e S oteo e ida ora hasta 256 9 20 Kle kner Moeller RS set e s a E i ion 257 9 21 Koyo OAV 11 52515230 20 otad gasi odaja kai 258 922 Koyo Direct DU KoyoSU Seri6s 11435 esens dresa 260 IV Beijer Electronics MA00822 Contents 92 LOGON GMO ii E een eee ko 262 9 24 TG O0 Ty ODI a KOS s Ao S 263 9 29 IRO OS Za nr nm nero e een 265 DO ECG RIOUS saan mr remenom 266 9 27 LG Master K10S K305 605 1005 0000aaaaava nana aaa anka aaa nana 267 TA ME Dal Ca A A AS S A A 268 ODD NA Vel MD Grm one pa a des totianeetenyaatelanen eaxa 270 930 Mitsubishi FX Cte tec e td E 272 SoL WCE CCD ob ina Wee ne nea o o tb sd bi ke 274 932 Niua OH o nj sos o o nl AEE 21 9 35 WMiodbus oliveros aie ee es eke 279 9 34 Modicon PC984 or Modbus ASCII or TSX Quantum 280 193 OTON C a E E T 282 936 0 08 0 0 Sol aa i ee SD Te 284 De Om One OV aa e O ROG E o a S 285 JS PRE OEI dabi gj a gl Sado ode 286 9 39 Side vidi 2020D ae i o rana od daka o ts 268 QAO Siemens Simatic OJ Aaa s s i boda 290 QA Siemens Simatic SI 5904 BR zao anata daje s SK 292 O42 Stemens Simatic s
108. al Stop bit 1 bit 7 EVEN NONE 2 Beijer Electronics MA00822 279 Communication between Operator Terminal and Controller 9 34 Modicon PC984 or Modbus ASCII or TSX Quantum Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Data Size Input Registers nnnnn 30001 39999 slave Word Modicon PC 984 Modbus ASCII 30001 31024 master _ Output Registers nnnnn 40001 49999 slave Word Modicon PC 984 Modbus ASCII 40001 41024 master Input Registers TSX Quantum nnnm nnnnn 300001 365535 Output Registers TSX Quantum nnnm nnnnn 400001 465535 The operator terminal can read up to 125 words in one read command Relay Type Relay Range Discrete Outputs Nnnnn nnnnn 1 4999 slave Modicon PC 984 Modbus ASCII 1 1024 master Discrete Inputs Nnnnn nnnnn 10001 19999 slave Modicon PC 984 Modbus ASCII 10001 11024 master Discrete Outputs TSX Quantum nnnnn 000001 065535 Discrete Inputs TSX Quantum nnnnn 100001 165535 The operator terminal can read up to 2000 bits in one read command Modbus ASCII master V2 as Modbus ASCII master In functional way it will inform the connected controller automatically when the operator terminal data is changed Cable Drawings HMI COM port PLC port R5232C HMI COM port Operator terminal series to controller RS232C CPU port 280 Beijer Electronics MA
109. al the Recipe Read Flag located in CFR bit 6 must be set to ON Using the coating equipment as an example the address of CFR is W1 The Recipe Flag is located in CFR bit 6 26 64 Set Constant Button Attributes Shape Tex Graphic ID BTNODOB Security shape User Level I _ Sete E Operator Confirmation Waiting Time Sec Vearable Write w di Notification a Enabled By i External kep Set Value Word Double Word Character String Format Unsigned Binary Value E4 Setting up Recipe Read Flag ON Once the above object design steps are completed the user can execute the actions in the operator terminal conveniently 170 Beijer Electronics MA00822 Control and Status Block 4 Control and Status Block This chapter describes the general information that you need for programming the controller to communicate with the operator terminal Detailed information about connecting specific controllers to the operator terminal is presented To set up the Control Block Address Size and Status Block Address select Application Workstation Setup Application Properties General Connection Miscellaneous Logging Buffers Password Control Block Application Mame Address mm test z 2 Size Panel workstation SE H TEO Color Network Status Block Programming Type Macro Address a Controler PLE Default Null ka Dat
110. al Data Bloc Word Bit Member Pwo OTT zy says SR Control LBCR 1 Block LBCR 2 woop saps SR status W12 Block LBCR 2 W14 LBCR 3 Recipe Register CER bit 4 is the Recipe Write Flag bit 5 is the RCPNO Change Flag bit 6 is the Recipe Read Flag GSR bit 4 is the Recipe Write Status bit 5 is the RCPNO Change Status bit 6 is the Recipe Read Status 3 Set up RNR to read recipe N W5 in the controller is assigned to read recipe N from the operator terminal For example Ist recipe N 1 4 Then set RCPNO Change Flag to ON for about 1 second The operator termi nal s internal RCPNO and Current Recipe will be changed to read recipe N Remember to set the RCPNO Change Flag to OFF before re triggering Status Block When the value of RCPNO is changed the value of RIR W15 will also be changed The current recipe N can be checked on the controller Moreover if the RCPNO Change Flag is set to ON the GSR bit W11 bit 5 will also be set to ON The status bit will turn OFF automatically after RCPNO is changed For details on addressing recipe data please see the chapter Addressing Recipe Data Enhanced Operator Terminals Beijer Electronics MA00822 Recipes Operator Terminal Data Register Recipe Data Recipe 1 RCPW10 RCPW 11 Recipe 2 RCPW14 RCPW20 RCPW21 Recipe 4 5 Finally set the Recipe Write Flag to ON The operator terminal will then write the Cur
111. al Models for complete details Select Application Slide out Menu Click New to display the following dialog slide out Menu Properties Name Henu Iker Description Icon Font e 6 Color IH Text ae Background Color Alignment Left Center Copy Feplace Clear Right OF Cancel WHEW Setup of the Slide out Menu Name Enter the name for the slide out menu 144 Beijer Electronics MA00822 Instructions Function Select a function from the Pop down list Mone Set Button Reset Button Momentary Button Maintained Button Multistate Button Set Constant Button Set Value Button Increment Button nI Decrement Button Background Color jn Goto Screen Button AE sage pa Previous Screen But Alignment f Let Center Action Button aes i Right Selecting a function for a button on the Slide out Menu Cut Copy Replace Clear Use the buttons to cut copy replace and clear the but ton s content Description Enter the name for the button in the Text block View Click the View button to view the created slide out menu 2 9 5 System Message The System Message is used to edit messages for the operator terminal system When the Operator Confirmation option is selected executing the object will display its system message For example the system message Are you sure can be displayed after the numeric entry Numeric Keupad 59 Bo
112. al can read up to 32 words in one read command intemal Relay __ Rrnb__ ano0 6 boo beg TOO Cable Drawings HMI COM port PLC port R5422 RDA RXD RDB RXD SDA TXD SDB TAD J SG PLC port R5422 RDA RXD RDB RXD SDA TXD SDB TXD SG Operator terminal to RS422 Computer Link port on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication Format RS422 COM2 RS232C RS422 RS485 Programmer computer Computer link can be used RS422 Set SW10 OFF link RS485 Set SW10 ON Transmission Speed 9600 bps Set the SW5 OFF if parameters Set the SW5 ON if parameters Parity EVEN ODD NONE are set in the operator terminal Stop bit 1 bit 308 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 52 Toshiba T1 T2 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Pata Register Pomno m0 Wor Tam mos Cable Drawings HMI COM port Special Device nnn 0 255 b 0 f b 0 e g S230 HMI COM port 8 7 6 4 RS front side view of the cable Operator terminal COM port to TI CPU serial port Beijer Electronics MA00822 309 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication p
113. alog box Please refer to section Screen Properties for complete details di Cut Screen Copy Screen Paste Screen Delete Screen View Recycle Bin Opens and displays the selected screen while the Screen Manager window will be minimized at the bottom A screen can also be opened by double click ing on it Used to edit the selected screens A pop up menu to select editing operations can also be displayed by by right clicking on the screen Use the Ctrl key while left clicking to select several screens for editing at once Also described in image below Lists all of the deleted screens marked with red Right click on the screen list and then select Restore from the list Also described in image below ul Click the te again to return to the previous Screen Manager window Select Language Specifies the language displayed in the screen Also described in image below Beijer Electronics MA00822 33 Instructions FA Screen Manager Compilation Optimization Y SREBRENE Adding a new screen from the Screen Manager FA Screen Manager Analog objects No 41 naa Bate oe an sess ioe Name Analog Objects i Size 320 X 240 ax T Compilation Yes Optimization Yes u u um im u B 4 IF FH PPP PPR eeae Selecting two screens for editing at once Right clicking opens the edit pop up menu 34 Beijer Electronics MA00822 Instru
114. alphabetic keypad will be displayed on the screen En ter character s and then press ENT on the keypad The operator terminal will then write the input entry in ASCII to the specified controller register The object is not available on all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models for complete details Variable Number of Characters Specifies the number of characters the maximum is 28 2 words in ASCII 1 word in a controller register For properties not explained in this section please see the sections Set Value Button and Specifying Object Properties Example of designing a Character Entry button Perform the following steps to create a basic Character Entry button A Character Entry button 1 Variable Specifiy the controller register W210 for Write to store the value The controller model is NULL Select 4 for Number of Characters 2 Security Set the Waiting Time Sec to 20 seconds Character Entry ID ICEOOOOS Display Format Frame Font Ean X Select Color Character Color cs 3 Bka Color C Left Center C Right DE_Module_2 LL Variable Security Write M210 User Level js Read 1 i Operator Confirmation Humber of Characters 4 waiting Time Sec 2c Hotification oy Before Writing After Writing Enabled By i eaa Character Entry properties in this example The steps above will create a Charac
115. alue Select Word for numeric entry Value Specifiy the constant value 400 for the 4 mm Glass button On the Text tab of the Set Constant Button 3 Enter the text 4 mm Glass and select Green for background color The above steps will create a 4 mm Glass button When clickced the operator ter minal will store the constant value 400 to the register W10 Follow the same steps to create other glass buttons using the corresponding constant values Beijer Electronics MA00822 67 Instructions Increment Button The Increment Button is used to make the operator terminal read a constant variable stored in a controller register Then a specified constant will be added to the value before writing it back to the controller register Attributes Tab Function Increment Select Increment to create an Increment Button one click increases a specified constant Jog Step The Increment Button is used to add a specified constant by clicking Limit Specifies the maximum value written to the register when using the Incre ment Button For properties not explained in this section please see the section Specifying Object Properties Example of designing an Increment Button When clicking the Increment Button the increased value stored in the controller register will be displayed in the bar graph The Bar Graph is an object used to display the dynamic data FA 3 Screen_3 When the Increment Button is clicked the
116. ar Good Afternoon Good Evening Color Background Color Adding texts for the 3 states in this example 90 Beijer Electronics MA00822 Instructions The above mentioned steps will create a Moving Sign object H 1 startup screen A Moving Sign object used together with a Multistate button The Multistate button is designed to write the command to the controller when clicked Then the Moving Sign object will display the corresponding content ac cording the current state For example if the state is Morning the Moving Sign object will display Good Morning Good Morning Good Morning The text here is displayed revolving mov ing through characters from right to the left Data Terminal The Data Terminal object is used to simulate an ASCII terminal The operator ter minal can be connected with another specified communication port and the speci fied communication parameters to the data terminal displayed using ASCII HEX mode Remember to set the ASCII Device to communicate and specify the communication port The object is not available on all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models tor complete details Variable Read Specifies a bit location to read from The ASCII Device provides RX RXSTS TX and TXSTS contacts Display Mode Displays the terminal data in ASCII HEX mode Data Buffer Type Selecting Local displays the current terminal data
117. arameters and the DIP switch as follows Format Controller Setting Communication Format RS232C COM1 or COM2 RS232C Operator Terminal Setting Transmission Speed 9600 bps Set the SW5 OFF if parameters are Station No Set PLC Station to 00 in H Designer Transmission Format Size 8 bit set in H Designer Set the SW5 ON if parameters are Parity ODD set in the operator terminal Stop bit 1 bit 310 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 53 Unidriver UD70 Data format and range of the controller registers which H Designer can access Word Device and Bit Device word 32 it W 400 W 598 Word 32 bits word 32 bi word 32 bi word 32 it 01 20 pd 20 01 20 50 W 920 W1018 Word 32 bits 91 01 91 10 W1020 W1029 Word 16 bits Relay Type Relay Range 18 31 18 50 BO B19 mnm 19 31 19 50 B20 B39 UD70 port RS485 9 pin male TXD RXD 15 5G 7 Operator terminal to RS232C port on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS485 RS485 Station No Set the parameter of Set PLC Station to 11 in UD70 address 14 01 to 11 H Designer Transmission Speed 9600 bps Set the SW5 OFF if parameters Transmission Format Size 7 bit are set in H Designer Set the SW
118. arting position is O for Field No 1 the time will be displayed in Field No 1 the date will be displayed in Field No 2 and the first data field will be displayed in Field No 3 If there is no time date displayed the first data field will be displayed in Field No 1 Word No 0 31 characters can be specified Data Size 1 represents one word 2 represents double word Data Format Select BCD Signed Binary Unsigned Binary or Hexadecimal Display Color Specifies the character color of a data field Leading Zeros Checking this box to displays leading zeros Decimal Pt Position Specifies the number of digits following the decimal point Int Digits Specifies how many digits to the left of the decimal point Frac Digits Specifies how many digits to the right of the decimal point For properties not explained in this section please see the sections Historical Trend Graph and Specifying Object Properties Beijer Electronics MA00822 123 Instructions Example of designing a Historical Data Table 70 Historical trend graph A Historical Data Table Suppose that there is historical data stored in logging buffer 1 Select the following properties for the Historical Data Table object 1 Frame Select Outlined _2 and Black for border color 2 Data Select Logging Buffer 1 to read data from 3 Time Date Check both boxes 4 Display Format Select 4 data fields Click Field Attribute Field Attribute F
119. ater simply select Applica tion Workstation Setup Description of the Devices block on the Connection tab Device Type 1 Connection 1 Mitsubishi Fs Seres 2 Connection 2 Simatic 57 200 via PPI 1 te 3 Connection 3 Modbus TCP IP Device Ww Add Click to add a new connection device controller m Click to delete a connection device The first connection Connection 1 cannot be deleted E Rename Click to change Device Name or Device Type For Connection 1 only the Device Name can be changed The Device Type can be changed on the General tab No column Numbered according to the order in which devices are added and cannot be changed Beijer Electronics MA00822 209 Multi Channel Communication 7 3 Read Write Address Setup Since there is more than one type of controller a read write address for each control ler has to be assigned The symbol denotes the separation of the connection number from the register address Note This function is not available for all operator terminal models please refer to Appendix A H Designer Features and Operator Terminal Models for details The connection in section 7 2 Connection Setup is used in this example Simatic S7 200 via PPI 1 to 1 Perform the following steps 1 For Connection 1 in the Write and Read boxes enter 1 Y0 for the bit address and 1 D100 for the register address 1 is for No column 1 and can be omitted so enter YO Variable
120. ath is marked with a red line H 5 Screen_5 3 Click elsewhere on the screen to display the object s graphics H 5 Screen_5 imba D 108 Beijer Electronics MA00822 Instructions Example of creating connected lines as a path 1 Double click on the object to display the movement path 2 Click on the points of the connected lines icon is to draw the movement path The revised path is marked with a red line FA 1 Screen_1 3 Move the cursor to any one of the points and right click to select Add Path Point or Delete Path Point from the drop down list FA 1 Screen_1 Copy Paste Duplicate Delete Bring to Next Send to Previous Bring to Top Send to Bottom Focal Mark Style Object Attributes Screen Attributes Beijer Electronics MA00822 109 Instructions 4 In the same fashion the way to edit a new path is to click the added path point to drag a movement path which is marked with red lines H 1 Screen_1 Example of Animated Graphic object Not Controlled by controller One way Horizontal Line On the Attributes tab of the Animated Graphic object 1 Check the Not Controlled by PLC option 2 The graphic state is Location dependent 3 The path is Horizontal line 4 The movement rate is 10 pixels sec and the direction is One way kove Graphic Attributes State Graphic Path ID lAGOO003 Path li Mot Controlled by PLC Horizontal line
121. atures and Operator Terminal Models 318 Beijer Electronics MA00822
122. be printed for the planning management or storage Note The Print option is not available for all operator terminal models please refer to Appendix A H Designer Features and Operator Terminal Models for complete details Select File Print and the Print Options dialog box appears on the screen Print Options Frint Screen Image Workstation Setup Screen Overview Screen Image Cancel Copies Range C All Curent Screen C Screens Ko en The Print Options dialog box There are three options available Workstation Setup Screen Overview and Screen Image Workstation Setup prints the operator terminal data such as the controller type configuration setup and the logging buffer details Application Name Page 1 11 01 2005 14 58 Workstation Type PLC Type Printer Type None Default Startup Screen None Default Data Format Unsigned Binary Control Block address WO Size 2 Status Block Address W10 Logging Buffers Record Stamp Auto Triggered Time Source Address Size Total Time Date Stop By Interval 1 w3o0 2 200 No No No Timer 2 2 0 O No No No PLC 3 o No No No PLC 0 4 o o No No No PLC 0 5 o o No No No PLC 0 6 o o No No No PLC 0 7 O o No No No PLC 0 8 O O No No No PLC 0 9 o O No No No PLC 0 10 0 o No No No PLC 0 11 0 O No No No PLC 0 12 0 o No No No PLC 0 An example of the Workstation Setup print option Beijer Electronics MA00822 15 Instructions 16 Screen Overview prints a s
123. bjects Analog Objects Analog Objects Trends Alarms 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 320 X 240 ma SS BS RS RS SKS SYS BS RS ES BS KS ES ES KS KS ES A RRRA RRR RRRA eaasa List sorted in numerical order after clicking No in the table header 35 Beijer Electronics MA00822 Instructions 36 The Screen Manager can also help you manage and edit the screens quickly and eas ily If the data in these columns is to be modified you can click the Screen Properties button on the toolbar and modify the screen properties in the displayed dialog box Alternatively right click for the Screen Properties selection The Compilation column is used to choose to check compilation or not This can also be configured in the Screen Properties dialog box on the General tab The Optimization column is used to choose to perform block optimization during compilation This can also be configured in the Screen Properties dialog box on the Read Blocks tab Please refer to section Screen Properties for complete details 2 5 3 Close Screen Closes the current screen 2 5 4 Cut Copy Delete Current Screen and Paste Screen Cuts copies or deletes the current screen A cut or copied screen can be pasted onto other screens 2 5 5 OPEN Macro CLOSE Macro and CYCLIC Macro Th
124. box to set its register bit Using the coating equipment as an example the address of CFR is W1 The RCPNO Change Flag is located in CFR bit 5 The constant is set to 32 2 32 so the RCPNO Change Flag will be set to ON Set Constant Button Attributes Shape Text Graphic ID IETHODOBA Security Snape User Level E Buka Operator Confirmation Color Variable Write a ai Notification Sy Enabled By i Set Value f Word Double Word Character String Format Unsigned Binary Value 32 Setting RCPNO Change Flag to ON 3 Finally design an object which can set the CFR bit 4 Recipe Write Flag to ON and write the Current Recipe to the controller Using the coating equipment as an example the address of CFR is W1 The Recipe Write Flag is located in CFR bit 4 so enter the value 16 24 16 The Recipe Write Flag located in W1 bit 4 will then be set to ON Beijer Electronics MA00822 169 Recipes Set Constant Button Attributes Shape Text Graphic ID ETNODOB Security shape User Level I _ eit Operator Confirmation Waiting Time Sec Vanable Write a ali Notification oy Enabled By iy External kep Set value i Word Double Word C Character String Format Unsigned Binary Value IE Setting up Recipe Write Flag ON 4 If the user wants to read a recipe from the controller to the operator termin
125. c keypad will be displayed on the screen After numeric entry the input value cannot be displayed directly on the Set Value Button Instead you can create a Numeric Display object to display the input value When the value is changed B10 is set FA 1 Screen_1 Press to set a value between 4 7HHH The Set Value Button and Numeric Display object 66 Beijer Electronics MA00822 Instructions Set Constant Button The Set Constant Button is used to make the operator terminal write a constant to the corresponding controller register The numeric keypad will not be displayed on the screen since the constant has been set in the controller Attributes Tab Value Specifies the constant value For properties not explained in this section please see the section Specifying Object Properties Example of designing a Set Constant Button Here we use a glass list as an example When one of the Set Constant Buttons is pressed the operator terminal will write the specified constant value to the corre sponding controller register In this example 4 mm Glass represents the constant val ue 400 5 mm Glass represents the constant value 500 etc Glass thickness FA 2 Screen_2 eee ead ae eie ad The Set Constant Buttons glass list example On the Attributes tab of the Set Constant Button 1 Variable Write Specify controller register W10 Notification Specify B10 The controller model is NULL 2 Set V
126. cation firmware recipes and source code Uploading downloading over Ethernet Preform the following steps to upload download an H Designer application over Ethernet 1 Set the IP address gateway address etc in the Configuration Table Please see the section ZP Address Setup for details 2 In H Designer select Options Transmission Setup and select Ethernet from the PC Port list Transmission Setup Download Upload PL Part Baud Rate Selecting PC Port 3 Enter the address under IP Address or select from the drop down list Transmission Setup Download Upload PC Port Ethernet La IP Address 192 168 1 elect an on line PS ma Setting the IP address Beijer Electronics MA00822 Ethernet Communication 4 Select Application Download Application or Download Firmware and Appli cation to download the application Follow the same steps to Upload Application Upload Recipes Download Recipes or Reconstruct Source over Ethernet For Upload Application the steps above must be changed to select File Upload Application If the link is not set up properly H Designer will display an error message 3 Communication error Communication error message Beijer Electronics MA00822 195 Ethernet Communication 6 4 Communication with Ethernet enabled controllers H Designer supports operator terminals communicating with Ethernet enabled con trollers using Modbus TC
127. cks for the operator terminal in the CRB and the COB is one of the most effective ways to improve performance Arranging the vari ables common to some of the operator terminals in the CRB or the COB will also improve performance Doing so will result in a high refresh rate for the variables held in the CRB and the COB since the variables are refreshed every read cycle In addition to the CRB and the COB remember to make use of the register blocks and on off blocks for screens since these too lessen the burden of the operator termi nal by reducing the number of read commands It is recommended to specify the CRB and the COB with continuous locations when designing screens Beijer Electronics MA00822 Multi Link Normal Connection Port 5 3 Important Notes When using multi link please note the following points 1 The RS485 connection method is suggested for the multi link The RS232 con nection method is suggested for a single slave operator terminal H series 25 pin H series 25 pin Male Male TXD RXD 14 _ 14 TXD RXD TXD RXD 15 ______ 15 TXD RXD GND T 7 GND 2 Each slave must have its own unique address 3 The operator terminals on the same multi link must have the same CRB and COB 4 The master operator terminal should only start after all the slaves have displayed their first screens To delay the start up of the master select the Miscellaneous tab in the App
128. commands Beijer Electronics MA00822 Macros 8 3 Macro Commands The following chart details the macro commands and their formats For the set up procedure please see the next section odi e SUB AT ADD AZ A3 2 a 2 4 Dwisigned At SUB A2 A3 2 24 2 4 pws At MUL A2 A3 2 4 2 4 Dwisigned ov A DV 2 13 2 4 2 4 Dwisigned MOD M MOD A2 A 2 2a 2 4 DwiSigned A1 A2 A3 2 4 A wo AND msasa a Ba 24 OW XOR A1 A2 A3 2 04 24 pw ma DE III DV NE a EJ a a ET O o o oo or e rani m e pov wova ER oa a ies Fu pumao p paba F CHR CHR at az DLANA A A Fe mencono aa a ovisne o E ememoras fa a fa owned eo iFaracoroas ajaa a ovin rman aja a pwsi _ IF AND 0 IF A1 AND A2 0 THEN GOTO A32 4 2 4 4 w o pooo Emono mao ARO THEN GOTO pa A w oo on fanono po e ee o en oreo h p po oo Po IF THEN IF condition THEN DO 2 4 2 4 Condition ENDIF IF condition THEN DO 4 12 4 Condition ELSE DO ENDIF IF condition THEN DO 2 4 Condition IF THEN ELSE ELSE DO IF THEN ELSE ENDIF IF condition 1 THEN DO 2 4 Condition ELIF condition 2 THEN DO ELIF condition 3 THEN DO ENDIF Condition includes A1 A2 A1 A2 A1 gt A2 A1 gt A2 A1 lt A2 A1 lt A2 A1 amp A2 0 A1 amp A2 0 A1 ON and A1 OFF A1 and A2 are only for internal memory and constant The usable range of memory will be identified according to the commands The numb
129. creen image with the controller location of each object Application Name Page 1 11 01 2005 14 56 H series operator terminals Screen Attribute Screen Number 1 Name Screen 1 Width 320 Height 240 Printed Area 0 0J 1 0 On off Block Address Size Register Block Address size 1 0 o 2 0 0 3 0 o a 0 0 o 0 Number of individual reads per read cycle 1 CYCLIC Macro An example of the Screen Overview print option Screen Image prints a screen image without the controller locations Application Name i Fage 1 11 01 2005 14 54 Screen Number 1 Name sereen 1 Width 320 Helght 240 An example of the Screen Image print option Other options Copies Specifies the number of copies to print Range Only available for the Screen Overview and Screen Image options 2 2 5 Upload Application and Download Application From Upload Application is used to upload an application from a operator terminal to a PC and save the file as AFG Download Application From is used to download a program from a PC to a operator terminal The file format is AFG 2 2 6 Upload Recipes and Download Recipes Upload Recipes is used to upload recipes from the operator terminal to a PC The file will be saved as RCP Download Recipes is used to download recipes from a PC to a operator terminal The file format used is RCP Note These functions are not available for all operator terminal models please refer to A
130. ctions FA Screen Manager b mawi he x e lear Static text 2 320 X 240 11 Static Text 2 Draw own objects 24 25 81 No 24 Name Graphics Size 320 X 240 Compilation Yes Optimization Yes Restoring a deleted screen FA Screen Manager gt BEE Le aexeti e am v Language 1 gjajajsjajsjajaji Analog objects Bararaph Demo Start 3 Demo Start 4 Static Text Static Text Static Text Graphics Graphics No 41 Name Analog Objects Graphics Size 320 X 240 z Compilation Yes Digital Objects Optimization Yes Digital Object Analog Objects NEEEEEEEEEEEEKEKK S Analog Objects Ii Ki Switching between Language 1 and Language 2 Screen Table In the Screen Manager click the Detail View button The detailed data will be listed in the table in five columns No Name Size Compilation and Optimization When you click the header the data will be listed in increased or decreased order fol lowing numerical order dimensional order and so on FA Screen Manager gt NEE BAaXR UF N Screen_1 320 X 240 Ala rms Demo Start 320 X 240 666 Alarn 1 661 Alarn Z ggz Reset Alarn 1 No 60 Name Alarms Size 320 X 240 Compilation Yes Optimization Yes Active alarms gt z all Alarns Demo Start 2 Demo Start 3 Demo Start 4 Static Text Static Text Static Text Graphics Graphics Graphics Graphics Digital Objects Digital Objects Analog O
131. d IF THEN structure The simplest IF statement evaluates a condition and performs a specified action if the condition is true If the condition is not true the entire statement is ignored For ex ample IF 100 50 THEN DO CALL 50 ENDIF If 100 equals 50 sub macro 50 is called If 100 contains anything else the entire statement is ignored IF THEN ELSE structure An IF statement can also specify one or more statements to be executed if the condi tion is false This option is indicated with the keyword ELSE as shown below IF condition THEN DO statements to be executed if condition is true ELSE DO Beijer Electronics MA00822 217 Macros statements to be executed if condition is false ENDIF In the example below if 100 equals 50 the sub macro 50 is called If 100 is not equal to 50 sub macro 1 is called following the else statement IF 100 50 THEN DO CALL 50 ELSE DO CALL 1 ENDIF Nested IF THEN ELSE structure You can create nested IF statements in which one IF statement is embedded in an other IF first condition THEN DO IF second condition THEN DO statements to be executed if second condition is true ELSE DO statements to be executed if second condition is false ENDIF ELSE DO IF third condition THEN DO statements to be executed if third condition is true ELSE DO statements to be executed if third condition is false ENDIF ENDIF In the following example if the value
132. d in Default Address Application Properties General Connection Miscellaneous Logging Buffers Password Device Type 1 Connection 1 DELTA DVP ES S5 ER EF Rename t iii HMI DELTA OVP ES 55 EP EH PLC Address lo Default Address 1 Port method used for the connection COM Multilink slave La MA uilti lirk Command Delay ms jo Timeout Time Sec Default Number of Retries 0 Application Fila of Multi link Master m Limit data access to Multilink Common Blocks only Setting up slave operator terminal parameters Remember to compile and download applications each time after making any changes to the address If the slave operator terminal dip switch 5 is set to ON the operator terminal will read the parameters from the hardware The user must enter the address 1 15 in HMI Node Address 5 Download the edited application to the slave operator terminals Please note that the address number of the master operator terminal will not affect communication with the slave operator terminals Moreover it is not necessary to set up the baud rate or data type for the slave operator terminals The purpose of setting up the slave operator terminals is to make sure the connection port for the master operator terminal is correctly set Beijer Electronics MA00822 189 Multi Link Normal Connection Port 190 5 2 Communication Efficiency H Designer allows you to specify a
133. device This change has to be made on the General tab HMI Address Sets up the operator terminal Once the multi link is made the address can be repeated and the range is 0 255 Port method used for the connection Specifies the port and method to connect with the controller or other operator terminal models including COM1 COM2 Ethernet Cross link COM1 Multi link slave COM2 Multi link slave and Ethernet Multi link slave Multi link This HMI is a multi link master Check this option to specify the operator as a master Master Port Specifies the port which connects master with slaves COM1 COM2 or Ethernet Common Register Block Specifies the starting location for the Common Register Block CRB which master and slaves use CRB Size Specifies the size of Common Register Block Common On Off Block Specifies the starting location for the Common On Off Block COB COB Size Specifies the size of th Common On Off Block Operator terminals arranged into a multi link one master multi slave network is not available for all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models for complete details Application Properties General Connection Miscellaneous Logging Buffers Password Device Type Connection 1 Null Connection 2 Simatic 57 200 via PPI 1 te Remove Rename a Hal Simatic 57 200 via PPI 1 to 1 Default Address 2 Foart method
134. display at startup The user can select the language directly from the View menu if the screen language is to be switched later 2 4 3 Zoom In Normal and Zoom Out Zoom In To enlarge the image size by a set percentage of 150 175 200 or 250 Normal To adjust the image size to the actual size of the screen Zoom Out To decrease the image size by a set percentage of 75 50 or 25 2 4 4 Toolbars There are eight different toolbars in the View menu The user can decide to display the toolbars for quick operation or not The toolbars are shown as below D amp lgs ta NEEGO ga oN OF The Standard toolbar S S ot of i ON OFF BB vow tot GL oh Foe z m Pg o mE ie The Edit toolbar the Draw toolbar and the Basic Objects toolbar Arial_12 Push Buttons Aq The Text toolbar Monitor C Demo apstlampi A A HH The Bitmap toolbar the Monitor toolbar and the Ladder toolbar Beijer Electronics MA00822 31 Instructions 2 5 Screen Menu The main purposes of the Screen menu are to name number edit and manage screens The following sections will explain these commands in detail 2 5 1 New Screen Select New Screen to create a new screen In the Name field enter the name for the new screen In the Number field enter the screen number Create New Screen bed The Create New Screen dialog box 2 5 2 Screen Manager The function of the Screen Manager command is t
135. e H TEO Mono Macro HA uilti lirk The connections in operator terminal 2 6 Download the H Designer application file to operator terminal 1 and operator terminal 2 Connect the link to the controllers and network Beijer Electronics MA00822 203 Ethernet Communication 204 Beijer Electronics MA00822 Multi Channel Communication 7 Multi Channel Communication Since there are many different vendors and models of all kinds of equipment on the market users often have a difficult time with data collection and integration The op erator terminal model with 2 COM Ports and an Ethernet connection can be used to connect controllers or other equipment such as temperature controllers servers inverters etc from different vendors in order to integrate and collect data using an operator terminal or PC Note This feature is not available for all operator terminal models please refer to Appendix A H Designer Features and Operator Terminal Models for details 7 1 Connection COM1 COM2 or the Ethernet Port can be used to link the Multi Channel connec tion The link can be set up via RS232 RS422 or RS485 with the connection method based on needs and available equipment For Ethernet RJ45 has to be used to set up the link The controller must also be Ethernet enabled For connection method and setup please see the chapter Communication between Operator Terminal and Controller Multi Channel Connect
136. e border color Pattern color Background color Patter The Shape Properties dialog box View All States Displays all states of the selected shape State Displays individual states of the selected shape Name Specifies the name of the selected shape Purpose The function of the selected shape Push Button or General Original Size Displays the width and height of the original shape Minimum Size Specifies the minimum width and height of the selected shape Keep Original Aspect Ratio Selecting this option keeps the size of the shape in its original ratio Display Sets the state of the selected graphic Always or At State User Changeable Allows changing shape properties including frame border col or background color pattern color and pattern g p Profile Specifies the position of the component object and displays the specified view here 2 8 5 Text Pool The function of the Text Pool is mainly to provide common management and edit ing of the texts used in the application 136 Beijer Electronics MA00822 Instructions Select Library Text Pool zow limit or The Text Pool dialog box Perform the following steps to edit texts in the Text Pool 1 Enter the desired texts in the Text Pool dialog box to save in 2 Click on the object to edit an object which has texts as in Text Pool then select Edit State and Text Management State amp Tex
137. e function For the applied operator terminal models please see Appendix A H Designer Features and Operator Terminal Models for complete details 4 3 1 Recipe Register Number Enhanced Operator Terminals H Designer provides internal recipe register number for use in the operator terminal application using the formats shown below Format Description Recipe Register Number 1 N RCPNO is an internal register of the operator terminal that specifies the current recipe number No gt 1 RCPWnnnnn Recipe Register nnnnn is current recipe where nnnnn is a decimal number and n gt 0 RCPWnnnnn b Recipe Register Bit nnnnn is decimal number n gt 0 b is a hexadecimal number b 0 F RCPNO is an internal register of the operator terminal used to display the specified recipe on the screen The operator terminal changes the RCPNO number to display its corresponding recipe data There are two methods to change the RCPNO number One way is for the user to change the RCPNO number directly through the numeric entry object The other way is for the controller to change the RCPNO constant To change the RCPNO constant the user must write the specified number N to RCPNO number register Dn 5 then set the RCPNO change flag Dn 1 bit 5 as ON about 1 sec The operator terminal will change the RCPNO constant to N and display the recipe data RCPW0 RCP Wm corresponding to the Nth recipe Beijer Electronics MA00822 183 Control and Sta
138. e trigger command was received LBSR1 Buffer 4 Buffer 3 Buffer 2 Buffer 1 LBSR2 Buffer 8 Buffer 7 Buffer 6 Buffer 5 LBSR3 Buffer 12 Buffer 11 Buffer 10 Buffer 9 The operator terminal will turn ON one of the trigger status bits when it finishes col lecting one data record for the logging buffer The operator terminal will turn OFF the same status bit as it detects the corresponding trigger flag being turned OFE One can use the trigger status bits as handshake signals to switch the trigger flag 4 2 4 RCPNO Image Register The operator terminal sets the RCPNO Image Register RIR to the new value of the RCPNO as this internal register is changed by the user or a controller Consequently the controller is able to identify the current value of the RCPNO The operator ter minal reports the value of the RCPNO to the controller by writing the value to the RCPNO Image Register The RCPNO Image Register is word 5 of the status block and one can keep track of the current recipe with this register Beijer Electronics MA00822 Control and Status Block 4 3 Recipe Register Block The recipe block is located in the controller register To make the operator terminal read write the recipe data from to the controller a recipe block needs to be defined for the application Please see the chapter Recipes for complete details The maximum recipe memory block is 524 288 16 bit word for the operator ter minal with recip
139. ect Design steps 1 Design an object for the user to enter as recipe N and write recipe N to control ler RNR In H Designer select Object Numeric Entry and enter the address of RNR in the Write box Using the coating equipment as an example the address of RNR is W5 so the controller recipe N will write to W5 It is also possible to enter RCPNO directly into a Numeric Entry object This can only be changed locally in the operator terminal Numeric Entry ID INEOOOES Frame Select i e Bka Color DE_Module_2 al Variable White RCPNO Su f Word Double Words Format Unsigned Binary Read han Sy Motitication di C Before Writing 9 Alter Writing Enabled By id 168 Display Format Validation and Security pa la l Wariable input limits Character Color y C Left amp Center Right User Level E Fill Leading Zeroes RT oD tor Confirmati Decimal Pt Position o E ai et ani Scaling SE Integral Digits 2 Fractional Digits o ha Cancel Settting up the address to write recipe N to controller RCPNO Beijer Electronics MA00822 Recipes 2 Design an object that can confirm the designated recipe and write the com mands to controller CFR bit 5 RCPNO Change Flag set the flag to ON In H Designer select Object Push Button Set Constant First enter the address of CFR in the Write box Then enter the constant value in the Value
140. ect File New The New Application s Properties dialog box appears on the screen New Application s Properties BJE General Connection Control Block Application Mame Address m Demo 2 PanelWorkshation Size H TE0 Color Plus aA cae ee WI ee Programming Type Macro Addr Controller PLE Default Null La Data Format Unsigned Binary La Printer Start up Screen HFP DeskJet Color Printer Extended Control Block Extended Status Block W Multi lingual Support z Number of languages 2 Select Language Startup Language Language 1 Y cancel The New Applications Properties dialog box The following are the basic properties a user needs to set up for a new application In the Application Name box enter the application name In the Panel Terminal list select a operator terminal model In the Controller PLC list select the type of controller which the operator termi nal will communicate with Please see the sections Application Menu and Connection Tab for more details Beijer Electronics MA00822 Instructions 2 2 2 Open and Close Open opens an existing application Close closes the application 2 2 3 Save and Save as Selecting Save saves an existing application replacing the previous copy with the new Copy Selecting Save As saves a new or existing application with a new name 2 2 4 Print An application file can
141. ected objects Pattern Specifies the pattern of all selected objects which can be set Pattern Color Specifies the pattern color of all selected objects which can be set Beijer Electronics MA00822 Instructions Text Font Specifies the text font for different objects The user can specify the text font for different types of objects When using the Selection button the Font Selection dialog box will be displayed Font Selection fe Buttonslndicator Message display Static text jr Numeric Character Date Time display a LEE s Arial8 Te dj Stated M m Ea Specifies the text font for objects Color Specifies the text color for all selected objects Alignment Specifies the text alignment type for all selected objects Underlined Specifies whether the text of all selected objects is to be underlined Contents Specifies the text contents for all selected objects Remember to click the Apply button to apply changes Beijer Electronics MA00822 29 Instructions 2 4 View Menu The main functions of the View menu include the managing functions of whole screen whole screen with I O labels five language selections zoom in out and eight kinds of toolbars 2 4 1 Whole Screen and Whole Screen With I O Labels Whole Screen Full screen view showing all edited objects The user can return to the previous view by clicking on the screen Whole Screen With I O Labels To view the whole scree
142. ection Port The Multi Link function provides an economical and convenient way to link several operator terminals and communicate with a single controller connection port One operator terminal is master and the others are slaves The master is the only operator terminal that is physically connected to a controller and this operator terminal is re sponsible for data exchange between the controller and the slaves Each of the slave operator terminals must be assigned a unique address so that the master operator ter minal is able to identify which slave to send the data to The following illustration shows the setup for four operator terminals with one con troller Note that the RS485 cable must be used for the connection between the mas ter and the slaves and each of the slaves must be assigned a unique address Controller RS232 422 485 Multidrop RS485 TXD RXD A Multi Link network The cable and the connection between the master and the controller is the same as for the normal 1 to 1 application The RS485 cable must be used for the connection between the master and the slaves Additionally each of the slaves must be assigned a unique address All the controller models in H Designer support this function Multi link can also be connected through Ethernet Please see the chapter Ethernet Communication for complete details Beijer Electronics MA00822 187 Multi Link Normal Connection Port 5 1 Communication
143. ed By Gil Cancel The Attributes tab of the On Off Button dialog box Beijer Electronics MA00822 57 Instructions 58 Shape Select Specifies shape from library Color Specifies the color of the selected shape Variable Write Writes to the specified controller register Read Reads the value from the specified controller register If the location is not specified the operator terminal reads from the Write location Enabled By Specifies the controller register to the ON button This is not available in OFF state labeled ca ca S Ei Specified State OFF Specified State ON TITI EO TITI CO This feature is only available on objects with input text numeric or specific states Shape Tab The shape style of a selected object is defined on the Shape tab On Off Button Attributes Shape State Tet Graphic State 0 gt State Pattern Style Pattern Color Profile TE TT a Background Color L_ II Lett 227 aticlt a Top FE Blink The Shape tab of the On Off Button dialog box Shape Select Selects shape from library Color Specifies the color of the shape Profile Specifies the location width and height of the object State Pattern Style Specifies the pattern style for the object Pattern Color Specifies the color of the pattern for the object Background Color Specifies the background color of the object Blink Specifies whether the object bli
144. ed size by clicking the left mouse button and then clicking again when finished Once created the object can be resized by dragging one of the object s handlebars If the objects handlebars are not visible clicking anywhere on the object will display the handlebars To move the object click at the center of the object and then drag it 2 2 Specifying Object Properties There are three ways to specify the properties of an object 1 You can select Object Attributes from the Edit menu 2 You can double click on the object 3 You can right click on the object and then select Object Attributes from the pop up menu Each of the above methods will bring up the dialog box for the properties specified In the H Designer software each object has a corresponding dialog box For exam ple there is the On Off Button dialog box in the Set Button object there is the Nu meric Entry dialog box in the Numeric Entry object The following five tabs are available for most objects certain specific properties will be explained later Attributes Tab Major properties are specified on the Attributes tab Each object has attributes that define its use On Off Button Attributes Shape State Text Graphic ID IBTNOOODI Function Shape Set C Momentary Reset C Maintained Select Security Minimum Hold Time Sec f Operator Confirmation Color Vanable Macro Write uy Use ON Macro Read 1 imi Enabl
145. eft Center Right Underlined C Toe C No Contents Cancel Opening the Common Attributes dialog box The user can edit the common attributes of selected objects such as location dimen sion apperance and text Beijer Electronics MA00822 27 Instructions 28 Language Specifies language to be used for the selected objects Apply to State Specifies the state of the selected objects The user can edit different states in this list Location Dimension Specifies the width and height of the objects Click the Apply button to modify Outlook Specifies the apperance of selected objects Shape ID Specifies the shape of different objects When clicking the Select button a dialog box with a selection of shapes will appear on the screen select Shape Library Wiew State jo Cancel Selection of shape of the object When the selection has been made a dialog box with a selection of functions for the selected shape will appear on the screen as Shape Frame Selection ki Eg Object Type Push button Indicator Data ent Data display Message display FrameEdge i Static test Panel meterlrectanale C Panel meterlraund General frame f Shape objects Selection of function of the object The user can then select the next object to create Outline Color Specifies the outline color of all selected objects Background Color Specifies the background color of the sel
146. egister Word 16 bits Output Register Word 16 bits Constant Register nnn 1 512 Word 16 bits 16 bits Relay Type Relay Range Input Relay nnn 1 384 Must be multiple of 16 1 Output Relay nn 1 384 Must be multiple of 16 1 Auxiliary Relay nn 1 1024 Must be multiple of 16 1 Cable Drawings HMI COM port pnone jack converter HMI COM port pnone jack converter j RS 232 9 pin RS 232 Operator terminal to RS232 port on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting RS232C COM1 or COM2 RS232C Station No Transmission Speed 9600 bps Set the SW5 OFF if parameters are Transmission Format Size 8 bit set in H Designer Set the SW5 ON if parameters are Parity ODD set in the operator terminal Stop bit 1 bit 302 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 48 Taian TPO2 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Data Size Input nnn 1 369 must be 1 or multiple of 16 1 Word Output Register nnn 1 369 must be 1 or multiple of 16 1 Word Auxiliary Register nnnn 1 1024 Word Auxiliary Register Dnnnn nnnn 1 1024 Word System Register nnn 1 128 Word Auxiliary Relay nnnn 1 2048 must be 1 or multiple of 16 1 Word Register Consta
147. eijer Electronics MA00822 Contents Contents E ERALA a ech cee e av e tte dee 9 1 1 Installariom Procedure sne i AEE A E EAN 10 2 Tasto ons aane T AS N ew ae eg ea A 13 Deck H Designer Programming Environment na 13 22 Pile Neni a o ha rd ea GA dobe 14 De Me Den ude ni i la o My a E ed o pete no 14 222 Operana Close oganj e E E 15 DDD WAVE BNC SAV e ds e as o a NJ GG A sk 15 22 UG ce eee gs a jd e m sb oi te 15 2 2 5 Upload Application and Download Application From 00000 16 2 2 6 Upload Recipes and Download Recipes 0000aaaaaaaa vanka 16 22 IREGONSTTUCE SOUT CO eserse esrara eee Gods diva onda 17 Del SI soa tetas a ase ace neces eon heca clara T A 17 2 3 Gite he tile d5 tako ot nic on ded dean etomidate Gene eases 18 2o Duplo e nata an kas S Ana 18 20 2 Fad Replace Address ali sadn ani o a a s a 19 20 Decompose Shape bash een en me a eee re ere dasa 22 DOA len and Make Sanie SIZE sees a a os east e etn Seca tae 23 2 3 9 Nudee and Layer jegu lani seas e ea oo 24 296 Group and UNSTOUDA anka sAd aos a nj a i 24 23 7 Obec AUTIDINE I li ii e elo sl EG 23 2 3180 Stave Te Management dij roje A Shoo diet 26 2 4 VOW NONU eee ee mee ee ine re ne EA td jb ROE OE 30 2 4 1 Whole Screen and Whole Screen With I O Labels ee 30 ZA MPA ALS aha di i eeu eee E EES 30 2 4 3 Zoom In Normal and Zoom Out cccccccecccecccccceccecceccceccueceascues 31 2AA GWLOBIDdNS e bid oto a il ed g oo 31 2 3 SY
148. en it finishes the clearing task requested by the corresponding clear flag controlled by the controller The operator terminal will turn OFF the same status bit when it detects the corre sponding clear flag being turned OFE One can use clear status bits as handshake sig nals to switch the clear flags Bit 12 15 Trigger Status Flag 1 4 The operator terminal will turn ON one of the trigger status bits when it finishes the task triggered by the corresponding trigger flag The operator terminal will turn OFF the same status bit as it detects the corresponding trigger flag being turned OFE One can use trigger status bits as handshake signals to switch the trigger flags 4 2 3 Logging Buffer Status Registers LBSRs LBSR1 saves the status of logging buffer 1 4 LBSR2 saves the status of logging buffer 5 8 LBSR3 saves the status of logging buffer 9 12 The status bit s position for each of the logging buffers is shown in the table below Bte fs fa ps om om ofo fp ee Bt VW4 AB4 FB4 CB4 TB4 FB3 AB3 CB3 TB3 AB2 FB2 CB2 TB2 AB1 FB1 CB1 TB1 LBSR1 Bit VW6 x LE LE a az LE m na LBSR2 Bit 15 fia h3 j2 fat fo b je VW8 AB12 FB12 CB12 TB12 AB11 FB11 CB11 TB11 a a JE m LBSR3 AB Almost Full Bit indicates that the buffer is 90 or more full FB Full Bit indicates that the buffer is full CB Clear Status Bit indicates the clear command was received TB Trigger Status Bit indicates th
149. er Validation and Security Set the minimum input value to 0 and the maximum input value to 60000 Numeric Entry ID INEODOOZ Frame Select m Bka Color DE_Module_2 a Vearable We Tike wi OD oy f Word Double Words Format Unsigned Binary Read a Notification ol C Before Writing After Writing Enabled By id Display Format Font Ee be Character Color x C Left amp Center Right Fill Leading Zeroes Decimal Pt Position 0 Scaling Integral Digits 5 Fractional Digits o Cancel Numeric Entry properties in this example Validation and Security Wariable input limits Mlin lo Mas 60000 User Level E Operator Confirmation ya The steps above will create a Numeric Entry button When the button is clicked a numeric keypad will be displayed on the screen After entering a value the operator terminal will show the input value on the button It is also possible to create a Numeric Display object to display the value stored in the controller Therefore for this basic numeric entry button if one enters 10 on the operator terminal then both the Numeric Entry button and the Numeric Display object will show 10 HHHHH HHHHH A basic Numeric Entry button and a Numeric Display object 74 Beijer Electronics MA00822 Instructions Example of designing a Numeric Entry button with scaling featu
150. er Electronics MA00822 95 Instructions 96 5 Check Ranges and select Blue for Low range and Red for High range Bar Graph ID IEGOOOD4 Display Format Frame f Upward Downward Select C Rightward C Leftward Color E Color BAE X Ekg Color Pattern mai i Recessed LI Yarable mo Read 5 D Format Signed Binary w Ranges Low range High range Min 32768 pena 32767 co Cy bw Variable targetsrange limits Heim EO Cancel The attributes of the Bar Graph object in this example When the register value is equal to or less than the low limit the graph will be filled with blue color when the register value is equal or greater than the high limit the graph will be filled with red color 166 166 166 Value 20008 05 Value 15500 85 Value 2000 85 Target RG Target 6 6 za Target 6 B6 High limit 15606 07 High limit 15606 07 High limit 15000 Q07 50 50 50 Low Limit 15000 pg Low Limit 15000 pg Low Limit 15000 pg 100 100 100 Bar Graphs indicating different limits using Numeric Entry objects The Numeric Entry objects are used to set the high low limits There is a Scale to the left of the bar graphs The Low Limit here is 15000 and the High Limit is 15000 using the following configuration Variable lt 15000 fills graph with blue Variable between 15000 and 15000 fills graph with black Variable gt 15000 fills graph with red Deviation Bar Grap
151. erminal finishes printing the current screen it will turn OFF this status bit Bit 4 Recipe Write Status The operator terminal will turn ON this status bit when it finishes sending a recipe from the operator terminal s RAM block to the controller The operator terminal will turn OFF this status bit when it detects the recipe write flag being turned OFE This bit can be used as a handshake signal to switch the recipe write flag Note This function is only supported by operator terminals with a recipe function Bit 5 RCPNO Change Status The operator terminal will turn ON this status bit when it detects the RCPNO change flag being turned ON When the operator terminal finishes changing the RCPNO it will turn OFF this status bit Bit 6 Recipe Read Status The operator terminal will turn ON this status bit when it finishes reading a recipe from the controller The operator terminal will turn OFF this status bit when it de tects the recipe read flag being turned OFE One can use this bit as a handshake signal to switch the recipe read flag Note This function is only supported by operator terminals with a recipe function Bit 7 Battery Status The operator terminal will turn ON the battery status bit if it detects a low battery before running an application Beijer Electronics MA00822 181 Control and Status Block 182 Bit 8 11 Clear Status Flag 1 4 The operator terminal will turn ON one of the clear status bits wh
152. erminal reads D200 D350 and stores the data in battery backup RAM To request logging buffer 11 to clear the data records change D4 s clear bit from 0 to l Beijer Electronics MA00822 Control and Status Block 4 1 4 RCPNO Number Register RNR RCPNO is an internal register of the operator terminal that specifies the current rec ipe number To change the RCPNO the controller first sets the RNR to the recipe number and then sets the RCPNO write flag or recipe read flag To change RCPNO by the controller the controller has to set RNR to the recipe number and set the RCPNO change flag which is the CFR 5 bit If the RNR is zero or greater than the maximum recipe number the operator terminal will ignore the request To request the operator terminal to change RCPNO the controller must reset the RCPNO change flag or use the RCPNO change status flag which is the GSR 5 bit Be sure to set this flag long enough for the operator terminal to detect it 4 1 5 General User Area Register For high speed display the operator terminal only reads data from the internal regis ter cannot write to it when editing in H Designer The maximum size is 32 the size depends on the length of the control block The format is shown in the follow ing table Description n represents the word data of the nth register where n is a decimal num ber n gt 0 but smaller than the specified size n b represents the bit data corres
153. erminals 184 4 4 Time Block zoo ea ba erento ab tast eal etch sla t as lotrel 185 4 4 1 The Operator Terminal Writes to the Controller eee 185 4 4 2 The Controller Writes to the Operator Terminal 0ce00aa 186 4 5 Read G a hha tana om o a i i a eae A E A 186 5 Multi Link Normal Connection Port c ccccccccccccesccccceccacceescascuecens 187 5 1 Communication ParaMeters ccccccsceccsceccececcecescecescscescecescesesceses 188 5 2 Communication BM Cen Cy rcs dira ea wit vince dno 190 5 3 Wimp Or tant NOteSi s A N 191 6 Ethernet Communication ccccccccccccccacccacccucccccacccsccuccauccusceuscuuscuecens 193 6 1 CONCOS 193 6 2 IPAddress Sep aia dt ar aaa 193 6 3 Application Upload Download over Ethernet aaa 194 6 4 Communication with Ethernet enabled controllers a 196 6 5 Multi Link One Master and Multiple Slaves vceeavcceaaca 197 6 6 Cross Link over Ethernet Data Sharing eceeeseeeeeceeeeseeeeeeees 200 7 Multi Channel Commu nication 0 ccccccccccceccccccccccucccuccacccueceuscanscuscens 205 7 1 Connec oia ei o A ERTIES GATORS UT Ree naki 205 Fd Conneccion SOUP ara ase iden ion dna peskanj ska dol 206 Ro Read Wy rite Address S bil pics aii iel ai a kaj aba 210 Beijer Electronics MA00822 Contents a aM E E EEA RESE PEET a me e See o D o A AM COE A res 211 8 1 IV IAG LO UCL ION as a ej tee sea ol i S
154. eroes Font Variable Decimal Ft Position u hd Read w100 yy f Word C Double Words Sealing Format Unsigned Binary Range Integral Digits 4 Edit Fractional Digits 0 Cancel Numeric Display properties in this example 4 Range Click the Edit button and select Constant Specify 100 for High Limit and 30 for Low Limit Select Red for character color for High Range and Light Blue for character color for Low Range PI I ce Numeric Entry buttons are used to influence Numeric Display objects In this example a Numeric Entry button is used to input a value in the controller register The variable will display different text colors on the screen according to its range If the variable is less than or equal to 30 it shows Light Blue text if the vari able is greater than or equal to 100 it shows Red text if the variable is between 30 and 100 it shows the original setting Blue text Beijer Electronics MA00822 Instructions 2 7 10 Character Display The Character Display object is used to provide an alphanumeric display for an ASCII variable in the controller register Note that it does not support click button functionality Variable Number of Characters Specifies the number of characters to display It can have up to 28 characters limited by the width of the object For properties not explained in this section please see the section Specifying Objec
155. ers in the table represent 0 Controller Device word 1 Controller Device bit 2 Internal Memory word 3 Internal Memory bit 4 Constant 5 ASCII Character Beijer Electronics MA00822 213 Macros 214 Controlle Operation Format A1 A2 A3 Data Format Data coro Gotolabetat e E we heen VA CO O A E CAL kat Rak PPF RT Rum FP FO FPP POR rm Ba PPF Neat mtr F FPP NO U pe A NN E Ta h SCS me primes kp pe le BD S amp L AM BCD A2 A2 A1 BIN A2 A WD uz 2 e ni iF at BZW 2 A3 2e pa Fo SE CO CTI RNA NR mo aim g iP PP a a Wa 2 ea ea owsa o e sma o o Con _ MA A1 H 2A A2 e H2A A2 s a O emen Pp TO CE IO e S o e SYS GGTOP_COUNTERN f A swamme S E mn ni O TA mn ac A mn eO AP mn o VN AP m o VN e AP I TO E OO PD erasmo A wewn A mwee SYS SUM_ADD N C T I E E o semon The usable range of memory will be identified according to the commands The numbers in the table represent 0 Controller Device word 1 Controller Device bit 2 Internal Memory word 3 Internal Memory bit 4 Constant 5 ASCII Character Beijer Electronics MA00822 Macros 8 3 1 Arithmetic Note Only internal memory can be used in these commands The internal memory includes RCPW CB RCPNO and e indirect internal memory The data format is word double word signed binary and unsigned b
156. ertical Min and Vertical Max Specifies the minimum and maximum values for the Y axis Horizontal Min and Vertical Max Specifies the minimum and maximum values for the X axis Color Specifies the color for the point line Point Size Specifies the size of the point to display For properties not explained in this section please see the section Specifying Object Properties Example of designing an XY Chart object A 2 Screen_2 An XY Chart Beijer Electronics MA00822 101 Instructions 1 Frame Select Outlined_2 and White for background color 2 Variable Specify 100 Local Internal Memory for Read and Unsigned Binary for Format 3 Control Select 1 for Trigger Flag and Clear Flag 4 Display Select Line 5 Maximum Number of Points 5 ID krong Display Frame Type C Points Area over axis Select Galen Line Area over y axis Be Maximal Number of Points 5 Bka Color CJ Grids Number of H Lines 10 anable Humber of Lines 1 T oo Bu u Color 7 Format Unsigned Binan_ W lata Set 1 Control i DataSet 2 Trigger Flag i m Data Set 3 Clear Flag a l Data Set 4 XY Chart attributes in this example 6 Check Data Set 1 and click Edit Set Vertical Min and Horizontal Min to 0 and Vertical Max and Horizontal Max to 100 Select Blue for Point Line Color 7 Check Data Set 2 and click Edit Set Vertical Min and Hor
157. es Macros can be categorized into Application Macros Screen Macros ON OFF Macros and Sub Macros 8 2 1 Application Macros There are three types of macro commands in the Application menu 1 INITIAL Macro The INITIAL Macro is used for data initialization and communication parameter declarations This command is executed only once when an application is started and the start up screen does not appear until this command is executed There is one INITIAL Macro in an application 2 BACKGROUND Macro When the operator terminal runs the application these macros will be executed cyclically The maximum size of macro commands are 30 rows The macro commands will execute whatever the current screen Common uses for the BACKGROUND Macro are communication control and controller sample data conversion 3 CLOCK Macro When the operator terminal runs this application these macros will be executed every 500 ms Common uses for the CLOCK Macro are display control controller bit monitor timer control and data timer conversion 8 2 2 Screen Macros There are three types of macro commands in the Screen menu 1 OPEN Macro The OPEN Macro is executed when the screen is commanded to be opened Common uses for the OPEN Macro are screen initialization display control internal register or bit initialization 2 CLOSE Macro The CLOSE Macro is executed when the screen is commanded to be closed The CLOSE Macro will execute its command once 3
158. ese three macros enable the operator terminal to execute data initialization display control and internal register or contact initialization Once these commands are se lected the operator terminal will display the edit screen i OPEN Macro of S 40 The OPEN Macro edit screen OPEN Macro is executed when the screen open command is issued A screen is not displayed until the OPEN Macro is completely executed There is one OPEN Macro per screen CLOSE Macro is executed when the screen close command is issued A screen is not closed until the CLOSE Macro is completely executed There is one CLOSE Macro per screen The CYCLIC Macro is executed cyclically when the screen is displayed The operator terminal stops executing the macro when it encounters an End command or reaches the end of the macro Please refer to chapter Macros for complete details Beijer Electronics MA00822 Instructions 2 5 6 Screen Properties The function of the Screen Properties command is to display the properties of the current screen including General Screen Background Style and Read Block tabs General Tab Screen Properties General Screen Background Style Read Blocks Screen Number EM W Included in the compilation Screen Name This screen is a sub screen Language 1 Analog Objects Language z hs Language 3 PO m KU UY EU e Only refresh the screen and enable its touch fa keys when itis the top most sc
159. et Transmission Format Size 7 bit in H Designer Set the SW5 ON if parameters are set in Parity EVEN the operator terminal Stop bit 1 bit Note When using exclusive protocol you must set the controller peripheral mode selector to COM2 Beijer Electronics MA00822 249 Communication between Operator Terminal and Controller 9 15 Hitachi H EH1 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Format WXnnnn WYnnnn WRnnnn WRnnnn WMnnn WLnnn WLnnnn TCnnn Register Type Int Output Int Output Int Output CPU Link CPU Link T C CV Register Range nnnn 0 4FF9 nnnn 0 4FF9 nnnn 0 C3FF nnnn F0000 F1FF nnn 0 3FF nnn 0 3FF nnnn 1000 13FF nnn 0 511 Data Size Word 16 bits Word 16 bits Word 16 bits Word 16 bits Word 16 bits Word 16 bits Word 16 bits Word 16 bits m lt lt lt w pa Hitachi H EH1 Series must use procedure 1 protocol to communicate Hitachi EH2 Series must use procedure 2 protocol to communicate Ext Input WXnnnn and Ext Output WYnnnn registers cannot access the Read Block function Relay Type Format Xmnnnn Ymnnnn Int Output Int Output Mnnnn Lnnnn Lnnnnn TDnnn SSnnn CUnnn CTUnnn CTDnnn CTnnn CLnnn DIFnnn DFNnnn On delay timer bit Single shot timer bit U D counter up coil U D counter down coil U D counter contact Rising edge TI 4 Cc aI a m
160. ete nnn 1 128 1 or multiple of 16 1 9 Discrete nnn 1 128 1 or multiple of 16 1 Genius Global Data nnnn 1 7680 1 or multiple of 16 1 Registers nnnnn 2 16384 Analog Inputs nnnn 1 8192 The operator terminal can read up to 50 words in one read command Relay Type Relay Range Discrete Inputs nnnnn 1 12288 1 or multiple of 16 1 Discrete Outputs nnnnn 1 12288 1 or multiple of 16 1 Discrete Temporaries nnn 1 256 1 or multiple of 16 1 Discrete Internals nnnnn 1 12288 1 or multiple of 16 1 SA Discrete nnn 1 128 1 or multiple of 16 1 SB Discrete nnn 1 128 1 or multiple of 16 1 SC Discrete nnn 1 128 1 or multiple of 16 1 S Discrete nnn 1 128 1 or multiple of 16 1 Counter Flag nnnn 1 7680 1 or multiple of 16 1 The operator terminal can read up to 800 bits in one read command Cable Drawings HML COM port C port RS232C HMI COM port PLC port R5232C 9 pin male HML COM port PLC port RS 422 25 pin i CABLE 15 pin male pi 15 pin male 11 RDB RXD RDB RXD 10 RDA RXD RDA RXD 13 SDB TXD men SDB TXD 1 lt 12 SDA TXD SDA TXD 21 7 SG SG B 8 CTS CTX3 CTS CTX 2 J 14 RTS RTX RTS RTX RTX 24 15 CTS CTX HERA ie i X 13 J 6 RTS RTX RTS RTX SV cty J y Operator terminal to RS422 port on controller 9030 CPU Beijer Electronics MA00822 247 Communication between Operator Terminal and Controller Communication Format Before
161. from 0 to 1 Then the logging buffer will read a data value from the control ler To force the logging buffer to read multiple data values from the controller the size of the source address to read from must be set Then set the size bit to ON and change the trigger bit from 0 to 1 Note that the size cannot exceed 1 022 words Change the clear bit from 0 to 1 to clear the logging buffer To force logging buffer recording the controller must reset the trigger and clear bits Sufficient time must be provided for operator terminal detection Example FX2 controller Assumptions 1 Control block starts from DO with a size 6 2 Source address of logging buffer 11 is D200 3 The record size of logging buffer 11 is 3 words To request logging buffer 11 to read only one data record from the controller first write the data to be read in D200 D202 Set D4 s size bit 10 to OFF and change its trigger bit 8 from 0 to 1 The operator terminal reads D200 D202 into logging buffer 11 after it detects the trigger bit 8 of LBCR3 has changed from 0 to 1 To request logging buffer 11 to read 50 data records from the controller set D200 to 150 50 x 3 Write the data to be read in D201 D350 Set D4 s size bit 10 to ON and change its trigger bit 8 from 0 to 1 The operator terminal first reads D200 D202 to get the actual size of the data to be read after it detects the trigger bit 8 of LBCR3 has changed from 0 to 1 Then the operator t
162. g HMI COM port TXD RXD 14 TXD RXD 15 Operator terminal to RS485 port on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication Format RS485 RS485 Station No Set the SW5 OFF if parameters are set Transmission Speed 9600 bps in H Designer Set the SW5 ON if parameters are set in Transmission Format Size 8 bit the operator terminal Parity EVEN Stop bit 1 bit 240 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 9 Facon FB Data format and range of the controller registers which H Designer can access Word Register Range Data Size Device and Bit Device Register Type Input Relay Output Relay Internal Relay Special Relay Step Relay Timer Present Value Counter Present Value Data Register 32 bit Counter Present Value Data Register The operator terminal can read up to 32 words in one read command Relay Type Input Relay Output Relay Internal Relay Special Relay Step Relay Timer Flag Counter Flag Cable Drawings Word Word Word Word Word Word Word Ronnnn onneo ss34 or Word ronan nnaneo ess34 mor Relay Range HMI COM port PLC port RS232C HMI COM port PLC port RS 232C 15 pin male Operator terminal to RS232C on FB MC controller Beijer Electronics MA00822 241 Communicat
163. gisters and store data in the CBO CB9 internal control block The functions of the words Wn through Wn m word n m in the control block will be discussed in the following sections 4 1 1 Screen Number Register A controller can request a operator terminal to display a specific screen by setting its Screen Number Register SNR to the number of that screen SNR Wn enables the controller to control the operator terminal screen or print the screen For example a controller can request a operator terminal to display a specific screen by setting its SNR to the number of that screen The operator terminal cannot reset the SNR Wn to 0 automatically However the operator terminal does reset the SNR Wn to zero before changing a screen If the screen specified by the SNR does not exist the operator terminal does nothing but resetting the SNR Wn 0 The value in the SNR can be BCD or binary 172 Beijer Electronics MA00822 Control and Status Block Example Mio e mour Ka Ha A PLC can control the switch of screen 00l The value of the SNR data register Wn and the functions bit 0 bit 05 are as fol lows The register bit 0 9 is used to control the screen change and the other bits bit 10 15 are not related In other words it is not necessary to control the backlight or lan guage when changing the screen Likewise it is not necessary to assign the screen number when setting up the backlight or select
164. gt 3 DATA RXD TXD 15 8 DATA SG 5 SG 7 24V PLC port RS485 Q pin male RXD TXD 1 3 DATA RXD TXD 6 8 DATA GND 5 5 SG 7 24 V Example of connections between operator terminal and S7 300 400 CPU MPI port Communication Format Before connection please set up the communication parameters and the DIP switch as follows Set the SW5 OFF if parameters are Transmission Format Size 8 bit set in H Designer Set the SW5 ON if parameters are set Parity ODD in the operator terminal Stop bit 1 bit Command Delay le eed Set operator terminal Command Delay Beijer Electronics MA00822 299 Communication between Operator Terminal and Controller 9 46 Siemens Simatic S7 300 HMI Cable Data format and range of the controller registers which H Designer can access Word Device and Bit Device Word Word Word Word Word Word Word Word DBmmm DBWnnnn mmm 2 205 nnnn 0 65534 DBWnnnn is a word nnnn 0 65534 address the byte nnnn amp nnnn 1 make DBWnnnn DBmmm DBDnnnn mmm 2 205 nnnnn 0 65532 DBDnnnn is a double nnnn 0 65532 word address DBWnnnn amp DBWnnnn 1 make DBDnnnn Data Area DB10 DBWnnnnn nnnnn 0 65534 DBWnnnnn is a word address the byte nnnnn amp nnnnn 1 make DBWnnnnn Data Area DB10 DBDnnnnn nnnnn 0 65532 DBDnnnnn is a double word address DBWnnnn amp DBWnnnn 1 make DBDnnnn Data Area DB10 VWnnnnn nnnnn 0 65534 VWnnnnn is a word address
165. h The Deviation Bar Graph is used to make the operator terminal read the values of the controller register and to compare them with the normal value Then the opera tor terminal converts the difference and presents it on a Deviation Bar Graph in the operator terminal Variable Variable Std Value Deviation Limit Select this option if the standard value and de viation limit are read from the controller If Read address is W10 Standard Value will be stored in W11 Deviation Limit will be stored in W12 Display Format Vertical Horizontal Selects the direction of the bar graph Standard Value Specifies the constant standard value The standard value will be a date line on the bar graph Beijer Electronics MA00822 Instructions Display Deviation Limit Select this option to fill the bar graph with selected color when the difference of the register value and the standard value is beyond the limit Limit Specifies the constant limit Difference Value Variable Standard Value Color Specifies the color to fill the graph with when the difference of the register value and the standard value is beyond the limit For properties not explained in this section please see the sections Normal Bar Graph and Specifying Object Properties Example of designing a Deviation Bar Graph Target value is 28 Target value is 28 Target value is 26 The bar shous the deviation The bar shous the deviation The bar shows
166. h with a border Color Specifies the border color of the pie graph For properties not explained in this section please see the sections Bar Graph and Specifying Object Properties Example of designing a Pie Graph object Fie Graph 18 Numeric Entry The Pie Graph object 1 Variable Specify W60 for Read and BCD for Format 2 Set 0 for Min and 100 for Max 3 Display Format Set Starting Angle to 0 4 Select Pie color Bkg color Style and Border color Pie Graph ID IPGOOODI Vanable Format BCD Min f0 Cancel TIEN Display Format Starting angle E Fie color Ekg color ag 7 Style En 5 Border Attributes for the Pie Graph object in this example A Pie Graph object is drawn from X axis starting angle 0 When the input value is 20 the area of the pie is one fifth of a circle 20 100 Beijer Electronics MA00822 105 Instructions 106 2 7 17 Dynamic Graphics There are five types of dynamic graphics Animated Graphic GIF Graphic State Graphic Dynamic Circle and Dynamic Rectangle Animated Graphic The Animated Graphic object enables you to control a graphic including its posi tion and moving path on the operator terminal screen whether via controller or not For instance the controller can control the graphic movement along the X axis Y axis or displaying different graphics Attributes Tab Not Controlled by PLC Check this option and the gra
167. hange screen print send recipes etc Please see the chapter Control and Status Block for complete details Status Block Specifies the starting address for the Status Block the fixed size is 10 words The Status Block provides communication between the operator terminal and the controller The operator terminal will write a continuous block of data Please see the chapter Control and Status Block tor complete details Data Format Specifies the data format to be read Start up Screen Specifies the screen to display when the operator terminal starts up Connection Tab On the Connection Tab you can add or delete devices for connection and set up the parameters such as address connection method and IP address Application Properties General Connection Miscellaneous Logging Buffers Password Device Type Connection 1 Rename Address oO Multi link This Hbl is a multi link master Cancel The Connection tab of the Application Properties dialog box Multi link is selected Add Click to add new devices to connect with including Muti link and select con troller type to connect with For the steps or methods related to setup please see the chapter Multi Link Normal Connection Port Remove Removes the connected device The No 1 device cannot be removed Beijer Electronics MA00822 139 Instructions Rename Modifies the device name and type but the device type cannot be modified for the No 1
168. hanges a relay s state the operator terminal must read 1 byte 8 relays After changing the corresponding bit the operator terminal will write the byte to the controller These actions will take more than one controller scan PLC ladder cannot control other bits relay of the byte before the operator terminal has completed the Change the Relay action otherwise these bits relay will return to their initial values In other words the controllers control action will be resumed For example if the operator terminal wants to change B3 s state it will read BO B7 After the corresponding bit B3 is changed the operator terminal will write the entire byte to the controller The PLC ladder command will be cancelled after the operator terminal writes the changes Cable Drawings HMI COM port PL C port RS 232C HMI COM port PLC port RS 232C CABLE 25 pin male SD 2 3 7 4 5 6 8 Operator terminal to RS232C port on controller SA21 Note KOYO SA21 series EO2 DM and T1305 02DM have the same wiring 258 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Saono Nome Set the SW5 OFF if parameters are set Transmission Format in H Designer i l Set the SW5 ON if parameters are set in Parity ODD the operator terminal Stop bit 1 bit Beijer Electronic
169. he data to be read Consequently users can use the LBCRs to clear logging buffers or to request logging buffers to sample the data from the con trollers Beijer Electronics MA00822 Control and Status Block There are twelve logging buffers here and operator terminals can be set to sample the data automatically at fixed periods or to sample or clear the historical trend graph controlled by the controllers Application Properties General Connection Miscellaneous Logging Buffers Password Record Auto Triggered Time Mon Field Use LEH Source Address Size Total Stop Bu Interval volatile Def a oe o TE db bo TFT jima zi NZ SL E MR TE Ts PRE el XA See Pi os Pe el Es ii RE as Es ae KAT eee PO is eel A See EO TS Pel A ee Fe pol A aS Es ee A Ses A Fs Peel AX es PE TS Peel A See Fe Peel xl Vee Ee ee Elze ki E tz Hm 1 Setting up logging buffers Note that LBCRI controls logging buffer 1 through 4 LBCR2 controls logging ii i i i D i i i a i Edit Edit e 14 daa buffer 5 through 8 LBCR3 controls logging buffer 9 through 12 The positions of the trigger bit clear bit and size bit for each logging buffer are shown in the following table Bit 4 m opa fm fo poooz eb 6 BOR VW4 Bit VW6 Bit VW8 SB Size Bit CB Clear Bit TB Trigger Bit Buffer 4 Buffer 3 Buffer 2 LBCR2 Buffer 8 Buffer 7 Buffer 6 Buffer 5 LBCR
170. ical Specifies how many pixels to space duplicate ob jects vertically S Tt oF ot Duplicate Allows a user to make multiple copies of an object and simultaneously increase the corresponding addresses incrementally Beijer Electronics MA00822 Instructions Address Increment X Direction The address of the same dynamic objects in creases from left to right Y Direction The address of the same dynamic objects increases from top to bottom PA Screen 1 owore owore Duplicate 2 3 2 Find Replace Address The main function is to find or edit addresses in a created project and to replace the found addresses Find Replace Address Find Replace Address to find Find Type Range Aan M Options i Screen f Current screen kw Match whole word only C Macro C All screens Open attribute dialog The Find Replace Address dialog box Enter the address in the blank space or select from the drop down list directly e g W100 then click the Find button to search The Result tab displays a detailed list according to the designated range and address Find Replace Address Find Replace Result Address Object ID Screen Mo Operation Humeric Entry ME 0003S 80 wi Normal Bar BGO001 1 a Numeric Entry ME 00038 a Normal Bar BG O001 1 nl The Result tab Beijer Electronics MA00822 19 Instructions Use the Replace button to replace the address with a new one
171. idly as the original on the screen There are 8 color 16 color and 256 color options The higher the color selected the higher the contrast of the figure displayed Import from Imports bitmaps from a selected library GBF or GIF graphics Export to Exports bitmaps to a selected library GBF Import Imports the graphic into the bitmap library from a computer The import able graphic formats include Bitmap Image BMP Jpeg Image Files JPG AutoCad Files DWG or DXF and GIF Files GIF Export Exports the graphic stored in the bitmap library to a computer Rename Modifies the name of the graphic Copy Copies the selected bitmap to the clipboard Paste Imports a bitmap from the clipboard When clicked a dialog box will appear and ask for the name of the imported graphic Beijer Electronics MA00822 Instructions Delete Deletes the selected bitmap Flip and Rotate Allows changing a bitmap s orientation When clicked a dialog box with flip or rotate degree options is displayed Flip and Rotate Flip horizontally Flip vertically Cancel Rotate 90 degree Rotate 180 degree Rotate 270 degree The Flip and Rotate dialog box Inverse Color Inverts the selected bitmap s colors Stretch Adjusts the width and height of the bitmap Stretch W Keep Aspect Ratio Size Width E0 roy Height 30 The Stretch dialog box Trim Allows cutting unused area around a bitmap
172. ield Starting Word Data Data Display Leading Decimal Pt Int Frac Mo Position No Size Format Color ero Position Digits Digits Jeo ica ol eee a cs 7 rar jr r raa 2 r fara lr r fala Ir e Cancel ed id id d id d id dl el ud 124 Beijer Electronics MA00822 Instructions 5 Make settings according to above 11703705 11 63 65 11703705 11703705 11703705 11703705 The result of the settings in the above example Displaying data stored in logging buffer 1 Historical Event Table The operator terminal may set a fixed sampling period or the controller may initiate a data read from the specified registers or the related bits in LSB Thereafter the data is converted into pre defined message text s and then displayed line by line in the operator terminal Historical Event Table Attributes State Tet ID JHETOOO20 ETOOO20 Frame Select Calor Al Ekg Color mi Data Lagging Butter fi Type e Value LSB Format BCD TimeDate Display I Date Format Color I Time a m The Historical Event Table Data Logging Buffer Specifies the number of the logging buffer where the historical data is stored numbered 1 to 12 Type Select Value 256 states in all 0 255 where 0 represents state 0 1 represents state 1 etc or LSB 16 states in all the operator terminal takes the bit number of the lowest bit that is ON as the state number Fo
173. ijer Electronics MA00822 255 Communication between Operator Terminal and Controller 9 19 Jetter Delta Data format and range of the controller registers which H Designer can access Word Device and Bit Device User Register nnnn Double word 32 bits 0 20479 21000 24999 31000 34999 41000 44999 50200 59999 61440 64999 User Register WRnnnnn nnnn Word 16 bits 0 20479 21000 24999 31000 34999 41000 44999 50200 59999 61440 64999 Cable Drawings HMI COM port PLC port RS232C 15 pin male HMI COM port PLC port RS232C 25 pin 9 pin male Operator terminal to RS232C port on controller 9 pin male Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting RS232C COM1 or COM2 RS232C saronno Nore Transmission Speed 9600 bps Set the SW5 OFF if parameters are set Transmission Format Size 8 bit in H Designer Set the SW5 ON if parameters are set in Parity EVEN the operator terminal Stop bit 1 bit 256 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 20 Klockner Moeller PS Data format and range of the controller registers which H Designer can access Word Device and Bit Device The operator terminal can read up to 32 words in one read command Relay Type Relay Range Bit Marker0 nnnnn 0 32766 b 0 7 b 0 e g M10 0 The operator terminal ca
174. inary Format Al A2 A3 Description Adds A2 and A3 and saves the result in Al ADD gt Format Al A2 A3 Adds A2 and A3 and saves the result in Al SUB gt Format Al A2 A3 Subtracts A3 from A2 and saves the result in Al MUL gt Format Al A2xA3 DIV gt Format Al A2 A3 A1 is the quotient and A3 cannot be zero MOD gt Format Al A2 A3 A1 is the remainder and A3 cannot be zero 8 3 2 Logical Note Only internal memory can be used in these commands The internal memory includes RCPW CB RCPNO and e indirect internal memory The data format is word double word etc no signed binary floating point number arithmetic Truth tables for OR to the left and AND to the right logical operations OR gt Format Al A2 A3 Performs the bit wise OR operation on A2 word and A3 word and saves the result in Al word or on A2 double word and A3 double word and saves the result in A1 double word AND gt Format Al A2 amp A3 Performs the bit wise AND operation on A2 word and A3 word and saves the result in Al word or on A2 double word and A3 double word and saves the result in Al double word XOR Format Al A2 A3 Performs the bit wise exclusive OR operation on A2 word and A3 word and saves the result in Al word or on A2 double word and A3 double word and saves the result in Al double word SHL gt Format Al A2 lt lt A3 Shifts A
175. ing a language Beijer Electronics MA00822 173 Control and Status Block 4 1 2 Command Flag Register The functions of the bits in the CFR are summarized in the following table 00 15 0 The bits of the CFR Wn 1 are described in more detail below Bit O Alarm History Buffer Clear Flag This controller bit is used to clear the data in the alarm history buffer If bit 1 is set to clear the data in the alarm history buffer the operator terminal will clear its data when bit 0 is set to 1 The controller requires that the bit be reset if the operator terminal is re assigned to clear the data and it needs enough time for operator terminal detection The hand shake function can be used to reset the bit as well For more about the handshake function please see the section General Status Register Bit 1 Alarm Frequency Buffer Clear Flag This controller bit is used to clear the Alarm Frequency Buffer If bit 1 represents to clear the data of alarm frequency buffer the operator terminal will clear its data when bit 0 sets to bit 1 The controller requires that the bit be reset if the operator terminal is re assigned to clear the data and it needs enough time for operator terminal detection The hand shake function can be used to reset the bit as well For more about the handshake function please see the section General Status Register Bit 2 Print Change Paper Flag This controller bit is
176. ion Beijer Electronics MA00822 205 Multi Channel Communication 206 7 2 Connection Setup The Multi Channel connection setup includes the controller type and its parameters Follow the steps below to set up the connection 1 In H Designer select File New The Applications Properties dialog box is dis played On the General tab select the type of the first controller from the Con troller PLC list for example Mitsubishi FX Series New Application s Properties 7 x General Connection Control Block Application Mame IS po Panel forkstation Size H TEO Color Network Status Block Programming Type Maco Address oy Controller PLE Default Mitsubishi Fs Series Data Format Unsigned Binary La Printer Start up Screen None hai Use external keys Extended Control Black ma Extended Status Block W Multi lingual Support sd Number of languages SRE Select Language Watch Dog Timer Startup Language Language 1 amp Selecting the type of the first controller Beijer Electronics MA00822 Multi Channel Communication 2 On the Connection tab select the method of connection for the first controller from the Port method used for the connection list Enter the addresses in the HMI Address box and controllers Default Address box and make the appropri ate selections for Baud Rate Data Bits Parity and Stop Bits New Application s P
177. ion between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Transmission Speed Set the SW5 OFF if parameters are set Transmission Format in H Designer Set the SW5 ON if parameters are set in Parity EVEN the operator terminal Stop bit 1 bit Note Facon FB Series RS232 RS485 for RS232 w o RTS control 3 PIN cable or RS485 Facon FB Series RS232 RTS for RS232 with RTS control 5 PIN cable RTS CTS with connect not for RS485 242 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 10 Festo FPC Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register fm mmnozss vodop word 6 bits Cable Drawing HMECOM pod PLC TIL 10 RS232 CABLE 103 dt 2 DY 35 L gen Operator terminal to controller TTL to RS232C cable The operator terminal needs to use a FESTO TTL to RS232C cable connection a 6 pin telephone connector with a controller port and a 9 pin male with 9 pin female Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting RS232C COM1 or COM2 RS232C fstationNo ome Transmission Speed 9600 bps Set the SW5 OFF if parameters are set Transmission Format S
178. is not controlled by the controller and moves at 60 pixels sec back and forth along the curve The graphic state is set to auto change to show a rolling effect Moving along the curve with auto change in two way GIF Graphic The GIG Graphic displays GIF graphics controlled by the controller or not Graphic Selects the graphic to display from the drop down list The graphic will ap pear in the View window Profile Modifies the location and size of objects For properties not explained in this section please see the section Specifying Object Properties Example of designing a GIF Graphic object 1 Select a GIF graphic form the Graphic drop down list specify the controller register from which to read if the option Controlled by PLC is checked and modify its profile GIF Graphic ID IGIFODODI Graphic Mone Variable ARROWS GBF lb Cont Selecting a GIF graphic Beijer Electronics MA00822 113 Instructions 114 FA 1 Screen_1 The GIF graphic appears on the object State Graphic The State Graphic constantly displays one of several bitmaps depending on the state of the controller register Attributes States Auto Change Check this option to change the graphic automatically Change Rate Hz Specifies the rate of change For properties not explained in this section please see the section Specifying Object Properties Example of creating a State Graphic object H 120 ani
179. is set 160 the operator terminal will monitor 160 bits 10 words and this corresponds to W130 W131 W132 W139 When bit W130 turns on the operator terminal will sample and record an alarm message Number of Alarms Specifies the number of alarms Scan Time Specifies the sampling time for monitoring the controller data 1 10 sec onds Number of Records in Alarm History Specifies the maximum number of events stored in the alarm buffer For example 100 means that when the 101st alarm event occurs the first alarm message will be overwritten Table Message Enter the text to the alarm message The format can be modified in its dialog box Up to 512 alarm messages can be set ACK Acknowledge the message which has been received to conceal the alarm Screen Specifies the screen to display when the alarm occurs Beijer Electronics MA00822 143 Instructions 2 9 4 Slide out Menu The function of the Slide out Menu is to operate the functional keys such as the Set Button Reset Button and Momentary Button in a convenient way in the operator terminal The number of functional keys depends on the selected operator terminal model When the Menu button is clicked the operator terminal will display the slide out menu with its specified functional keys The Slide out Menu The object is not available on all operator terminal models please see Appendix A H Designer Features and Operator Termin
180. it Field Definition Start Up Delay Seo 0 Display Countdown Write time and date ta PLC Synchronize time and date with PLC While opening a screen do not display the data until all of them have been read OK Cancel The Miscellaneous tab of the Application Properties dialog box For setup of recipes please see chapter Recipes and section Recipe Register Block The recipe function is not available for all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models for complete details Write time and date to PLC Select this option to enable the operator terminal to write time and date to the real time clock in the controller Please see section Time Block for details Touch Screen External Keys Specifies the format of buffer Start up Delay Sec Specifies the length of time before the screen start up Beijer Electronics MA00822 141 Instructions 142 Logging Buffers Tab Logging Buffers are used to collect data from the battery backup RAM It is a con tinuous data block and there are 12 buffers available The object is not available on all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models for complete details When creating a Historical Display object the logging buffer s area and size has to be set up first Please see section Historical Display for information Password Tab When you want t
181. ith f Pattern t Bitmap Pattern SRR m Filing method Background Color ha Example The Screen Background Style tab of the Screen Properties dialog box Filled With When selecting Pattern the options Pattern Pattern Color and Background Color will be available for selection 38 Beijer Electronics MA00822 Instructions When selecting Bitmap a bitmap can be selected from the drop down list There are two filling methods available Stretch Displays the bitmap entirely on the entire screen When this option is se lected the bitmap can be enlarged to match the designed screen Tile Displays the duplicate bitmaps lined up on the designed screen Each bitmap keeps its original size Screen Properties General Screen Background Style Read Blocks Filled ith f Pattern Bitmap Pattern book wa Pattern Color Filling method f Stretch Background Color Example Selecting the Tile option Beijer Electronics MA00822 39 Instructions Read Blocks Tab screen Properties General Screen Background Style Read Blocks Register Block Address Size in Wword Refresh Rate Normal PIII Normal On Off Block Address Size in Word Refresh Rate HJ i Normal Normal afo Normal s nl Noma fpo Normal KEKE oo ho oo oo E W Perform block optimization in compilation to merge adjancent data
182. its f Constant Limits Select Range Y Color IN C Minimum 2500 Variable Read w30 py w Word C Double words Format Unsigned Binary The Attributes tab of the Range Indicator in this example On the State tab of the Range Indicator object 4 Add new states There are 3 states in this object On the Text tab of the Multistate Indicator object 5 Enter the texts for the states Range Indicator kl pd kite Shape Sate Tet rapti Editing Option wrap Lines Text Movable Sf Text Bitmap om Font EIB hi 1 Average Underlined Color Background Color zi g Blink Entering texts for the different states The above mentioned steps will create a Range Indicator object In this example a Numeric Entry button is used to input value in the controller register and a Range Indicator object is used to calculate the result and display its corresponding state as sociated with the specified range 43500 a SUCCESS The Range Indicator object displays the corresponding state If you enter the input value 3500 the corresponding range is Range 0 Therefore the Range Indicator object will show Success 84 Beijer Electronics MA00822 Instructions 2 7 9 Numeric Display The Numeric Display object is used to display the register value stored in controller This object does not support click button functionality Variable Read Specifies a register
183. ize 8 bit in H Designer Set the SW5 0N if parameters are set in Parity NONE the operator terminal Stop bit 1 bit Beijer Electronics MA00822 243 Communication between Operator Terminal and Controller 244 9 11 Fuji NB Data format and range of the controller registers which H Designer can access Word Device and Bit Device Relay Type Timer output Counter output Dnnnn nnnn hex number 8000 80FF Relay Range nnn hex number 0 1FF nn hex number 0 FF End with 0 End with 0 Cable Drawings HMI COM port PLC port RS 422 8 pin RJ45 Male 4 RDB RXD 3 RDA RXD 6 Snos Ai 5 SDA TXD 17 SG 28 5V PLC port R5422 8 pin RJ45 Male 4 RDB RXD 3 RDA RXD 6 SDB TXD 5 SDA TXD 1 7 SG 2 8 5Y front side view of the cable Operator terminal to RS422 on NB NS NJ CPU port Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Saono Nome Set the SW5 OFF if parameters are set Transmission Format Size 8 bit in H Designer l l Set the SW5 ON if parameters are set in Parity ODD the operator terminal Stop bit 1 bit Controller Password None or 0000 9999 The password needs to be set in the controller Beijer Electronics MA00822 245 Communication between Operator Terminal and Controller
184. izontal Min to 0 and Vertical Max and Horizontal Max to 100 Select Red for Point Line Color 102 Beijer Electronics MA00822 Instructions 2 7 15 Panel Meters There are two types of panel meters Round and Rectangular Round Panel Meter The Round Panel Meter is used to make the operator terminal read the value from the controller register and to reflect the value on the Round Panel Meter object on the screen Needle Color Specifies the needle s color Sweep Angles deg 300 or 360 degrees can be selected Scale Color Specifies the color used to display the scale Number of major ticks Specifies the number of major ticks on the scale If the num ber is less than 2 no ticks are displayed Number of minor ticks Specifies the number of minor ticks on the scale Display axis Check this option to display an arc as the axis of the scale Display mark Check this option to display marks on the scale Font 8 x 8 or 8 x 16 can be selected Number of digits Specifies the number of digits including precision and scale Decimal point position Specifies the position of the mark s digit If the number is 0 no decimal point is displayed Min and Max Specifies the minimum and maximum number of marks Target Range Click the Edit button to display the dialog box below Target Range of Panel Meter Wariable targetsrange limits Display target indicator W Display range scale Color Lo
185. k read for the registers in TIMER COUNTER and CONTROL FILES It is necessary to open the files which the operator terminal will access in the Allen Bra dley controller 230 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Data format and range of the controller ON OFF location which H Designer can access Bit Device Bit file Bfff nnn bb fff 3 or 9 999 default file is 3 if fff omitted nnn 0 999 bb 0 15 Timer file Tfff nnn bb fff 4 or 9 999 Tfff nnn PRE bb default file is 4 if fff omitted Tfff nnn ACC bb nnn 0 999 bb 0 15 T nnn EN Tinnn TT T nnn DN Counter file Cfff nnn bb fff 5 or 9 999 Cfff nnn PRE bb default file is 5 if fff omitted Cfff nnn ACC bb nnn 0 999 bb 0 15 Cfff nnn CC Cfff nnn CD Cfff nnn DN Cfff nnn OV Cfff nnn UN Cfff nnn UA Control file Rfff nnn bb fff 6 or 9 999 Rfff nnn LEN bb default file is 6 if fff omitted Rfff nnn POS bb nnn 0 999 bb 0 15 Rfff nnn EN Rfff nnn EU Rfff nnn DN Rfff nnn EM Rfff nnn ER Rfff nnn UL Rfff nnn IN Rfff nnn FD Integer file Nfff nnn bb fff 7 or 9 999 default file is 7 if fff omitted nnn 0 999 bb 0 15 The operator terminal can read up to 480 bits in one read command The operator ter minal does not support block read for the bits in TIMER COUNTER and CONTROL FILES Cable Drawings PL C port RS 232C PLC port RS 232C 25 pin male TXD 3 GND RTX 7 CTX 8 Operator terminal to RS232C on PLC
186. l Double Word BCD Bin UBin Editing Recipe 1 The function of the recipe editor is the same as a common edit tool it includes open save print view the recipe file and window arrangement Beijer Electronics MA00822 Instructions 2 11 Options Menu The Options menu provides options for editing and transmission 2 11 1 Snap to Grid If you select Snap to Grid on the edit screen the edited objects will align to the near by grid see section Display Grid This command is convenient for aligning objects 2 11 2 Display Grid When selecting this option the edit screen will display a grid to allow easy alignment 1 Recipes Seles Recipes A screen with a visible grid 2 11 3 Grid Attributes Select this option to specify the grid size The bigger the grid size is the longer the distance between points will be 2 11 4 Transmission Setup Select Options Transmission Setup to specify the download upload port and baud rate between the PC and the operator terminal The PC port options are Ethernet COM1 COM16 and USB A baud rate of 115200 is recommended Note These settings are not the same as the ones set on the Connection tab in Application Workstation Setup The former is the setting between the PC and the operator terminal the latter is the setting between the operator terminal and the controller Transmission Setup Download Upload PL Port CoM x Baud Rate
187. l does not support block read for the bits in TIMER COUNTER and CONTROL FILES Cable Drawings HMI COM port PLC port RS232C 9 pin male HMI COM port Operator terminal to RS232C on SLC 503 504 234 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication RS232C SLC 503 504 COM2 RS232 422 485 Format When using RS422 set DIP switch SW10 OFF When using RS485 set DIP switch SW10 ON Node Address Set PLC Station No in H Designer according to the controller setting Transmission 9600 19200 bps Set the SW5 OFF if parameters are set in Speed H Designer Trancmicsion Set the SW5 ON if parameters are set in the l operator terminal Format Parity NONE i Stop bit 1 bit Beijer Electronics MA00822 235 Communication between Operator Terminal and Controller 236 9 4 Allen Bradley IQ Master Servo Controller Data format and range of the controller registers which H Designer can access Word Device and Bit Device Relay Type Relay Range Cable Drawings HMI COM port PLC port RS232C 9 pin male HMI COM port PLC port RS 232C 9 pin male Operator terminal to RS232 port 9 pin male on controller Communication Format Before connection please set up the communication parameter
188. ld Definition Start Up Delay See 0 Display Countdown Write time and date ta PLE Synchronize time and date with PLC While opening a screen do not display the data until all of them have been read Setting Recipe size 5 and Number of recipes 4 in this example According to the setup above the starting address of the controller recipe register is W100 and its size is 5 words The starting address of the current recipe in the oper ator terminal is RCP WO and its size is 5 words The starting address of the operator terminal RAM is RCPW5 and its size is 5x4 words If the recipe write flag is ON the operator terminal will write the current recipe from RCPW0 RCPW4 in the operator terminal to W100 W104 in the controller If the recipe read flag is ON the operator terminal will write the recipe from controller W100 W104 to RCPW0 RCPW4 in the operator terminal If the user wants the operator terminal to read write the recipe data from to the controller RNR Wn 5 must be defined For instructions about operator terminal recipe registers please see section Recipe Register Block 162 Beijer Electronics MA00822 Recipes 2 The application can be edited and saved as a VGF file In the example a Numeric Entry object is used to display the coating equipment data in the oper ator terminal RCPW5 RCPW9 represent top recipe data RCPW10 RCPW14 represent button recipe data RCPW15 RCPW19 represent left side
189. le 6 9 2 Operator terminal to RS422 HOST LINK on C200H LK202 an 2 vio RDB RXD RDA RXD SDB TXD SDA TXD Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting RS232C RS422 COM2 RS232C RS422 RS485 RS485 00 00 31 Set PLC Station to 00 in H Designer Transmission Speed Set the SW5 OFF if parameters are Ude Mika nana Zi DE ai parameters are s ie set in the operator terminal Operatonmode Motorno Potoci mpl lv Note For CQM1 and CPU21 set the DM6648 0000 Beijer Electronics MA00822 283 Communication between Operator Terminal and Controller 284 9 36 Omron CS1 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Raven CO Area im ononeO 6iad wora ebi Relay Type Relay Range IR Area CO Area _ Rrnnnbb _ pnnn 0 6148 bb 00 15 pb mustbe00 Counter Area fem m0207 Po Cable Drawing HMI COM port PLC port RS232C i g pin male Operator terminal to RS232 port 9 pin male on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting RS232C RS422 RS485 COM1 or COM2 RS
190. ler program the operator terminal applica tion can be presented to the customer On line Simulation H Designer offers user On line Simulation for connection between the PC and the controller communication ports If there is only one RS232C serial port in the PC the user needs to add an adapter for transferring the signal from RS232C to RS422 or RS485 in order to connect with the RS422 or RS485 port in the controller Note that the communication time between H Designer and controller is 60 minutes If you need to connect again please close the H Designer and restart it Beijer Electronics MA00822 153 Instructions 154 2 10 3 View Edit Recipes Select Tool View Edit Recipes to display the recipe editor window Recipe Editor The Recipe Editor window Note that the recipe must upload the file from the operator terminal to a PC and save the file The data size and total number of of recipes cannot be modified The object is not available on all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models tor complete details For setup procedures please see section Application Menu and chapter Recipes Select File Open to open the selected recipe file Note that the recipe file is stated as RCP Open the recipe files then select Recipe Open Recipe Open Recipe Enter the recipe number for the recipe The recipe is displayed on the screen for you to edit W Recipe F
191. lication Properties dialog box Then set the time for the Start Up Delay Application Properties General Connection Miscellaneous Logging Buffers Password Touch Screen External Kens Read siwrite recipes from to PLC Bla eni aja TIME enii o pen Auto Repeat Delay Sec UG ane Auto Repeat Rate Hz 5 r Start Up Delay Sec 3 nr i Display Countdown Write time and date ta PLE Synchronize time and date with PLC While opening a screen do not display the data until all of them have been read Setting up delay of start up Beijer Electronics MA00822 191 Multi Link Normal Connection Port 192 Beijer Electronics MA00822 Ethernet Communication 6 Ethernet Communication The following chapter will introduce communication setup application upload download and Ethernet communication with Ethernet enabled controllers and op erator terminals There are two methods for Ethernet enabled operator terminals to communicate with multi operator terminal controllers over Ethernet multi link and cross link Note Ethernet communication is not available for all operator terminal models please refer to Appendix A H Designer Features and Operator Terminal Models for details 6 1 Connection There are two methods to set up the link using a RJ45 straight through cable or us ing a RJ45 crossover cable The RJ45 crossover cable requires a HUB for connection The choice between these
192. lick the H Designer icon Beijer Electronics MA00822 11 Installation Beijer Electronics MA00822 Instructions 2 Instructions Microsoft Windows is undeniably the predominant PC operating environment these days H Designer is designed to make full use of the Windows environment using a What You See is What You Get Approach Users can immediately see the objects they create on a PC screen with their specified attributes such as font size color object location picture scale frame and so on What the user sees on the PC screen will be the same as what is displayed on a operator terminal Furthermore H Designer utilizes the principles of object oriented design to imple ment drag and drop editing Users can use a mouse to conveniently drag objects to another location or change their shape and size as they wish 2 1 H Designer Programming Environment The figure below illustrates the main menu bars and tool boxes in the H Designer program environment Title Bar Menu Bar Toolbars Toolboxes Ti H Designer untitled Fie Edit View Screen Draw Object Library Aipicaton Tool Options LadderPi Window Help Os 44 MEHEGO See Mo RY OF es seo SM wl eo eagle FA 1 Screen_1 A bd ME Basic Objects A or dd v a ga ogee Bed O D o ot oF of pol Gl eh My me Me ot OGODBAAATNOID 6B MASE sy Static Text at 47 35 W 26 H 38 153 1 Screen Zoom 200
193. llows the Read The High Limit is stored in the bit location that follows the Target Variable The Low Limit is stored in the bit location that follows the High Limit Register X X 1 X 2 X 3 Target Variable High Limit Example W10 W11 W12 W13 Display Format Upward Downward Rightward and Leftward Selects the direction of the bar graph Color Specifies the color of the bar graph Pattern Specifies the pattern style to display Target Sets the target to display Value Specifies the constant target value Color Specifies the color of target line Ranges Select this option to fill the graph with a different color when the register value is beyond a normal range Low Range Specifies the color to fill the graph with if the register value is equal to or less than the low range limit Limit Specifies a constant for the low range limit High Range Specifies the color to fill the graph with if the register value is greater than or equal to the high range limit Limit Specify a constant for the high range limit For properties not explained in this section please see the section Specifying Object Properties Example of designing a Bar Graph object 1 Frame Select Recessed_1 and White for background color 2 Variable Specify 5 Local Internal Memory for Read and Unsigned Binary for format 3 Set Min to 32 768 and Max to 32 767 4 Check the option Variable target range limits Beij
194. logram Parallelogram and Solid Parallelogram are used to draw a parallelograms by holding down the left mouse button to draw a side This side will continue until you left click with the mouse Then you drag this side to configure a rectangle until you right click with the mouse Border and Profile can be specified in the Parallelogram and Solid Parallelogram di alog boxes Fill is used for the Solid Parallelogram FA 1 Screen_1 Pattern Style Pattern Color mu Background Color ma j Profile xfi w 95 Redraw Y 21 Ha 110 Pan Cancel Drawing a Parallelogram Beijer Electronics MA00822 47 Instructions Circle Solid Circle Ellipse and Solid Ellipse Circle Solid Circle Ellipse and Solid Ellipse are used to draw circles and ellipses Border and Profile can be specified in the Circle and Ellipse dialog boxes Fill is used for the Solid Circle and Solid Ellipse FA 1 Screen_1 Pattern Style Pattern Color Background Color Profile ok oo IH Redraw Ye 17 He for po Cancel The Circle dialog box Arc Pie and Solid Pie Arc is used to draw a circle by holding down the left mouse button Continue until you have configured the desired size then right click Left click for a radius display You can drag the radius to configure a desired arc until left clicking again Fa 1 Screen_1 Drawing an Arc 48 Beijer Electronics MA00822 Instructions Drawing
195. lue of RCPNO RCPNO is an internal operator terminal register used to control the recipe data This is only sup ported by operator terminals with a recipe function Set the RNR Wn 5 to write the recipe set the bit to ON RCPNO can be modi fied The controller requires that the bit be reset if the operator terminal is re assigned to modify RCPNO and it needs enough time for operator terminal detection Bit 6 Recipe Read Flag from controller to operator terminal This controller bit is used to read the recipe data from the controller to the operator terminal and save it in the RAM block Set the RNR Dn 5 to the recipe number to be updated Then set the bit to ON and the operator terminal will update the corresponding recipe The controller requires that the bit be reset if the operator terminal is re assigned to update and it needs enough time for operator terminal detection H21 HOUP HAHA H HOUP Ku H5 H11 HOHA H H H3 4 W noup KO H1 J PLC N21 reads the data from PLC to the 4th recipe Wil bit 6 is Recipe Read status bit Beijer Electronics MA00822 175 Control and Status Block 176 Bit 7 Buzzer Flag This controller bit is used to control the operator terminal s buzzer Set the bit to ON about 1 sec to start the buzzer The controller requires that the bit be reset if the operator terminal is re assigned to start the buzzer Bit 8 11 Clear Flag 1 4 This controlle
196. mated graphics animated graphics A State Graphic object On the Attributes tab of the State Graphic object 1 Variable Specify 300 Local Internal Memory for Read and Value to be dis played 2 Select Unsigned Binary for Format Beijer Electronics MA00822 Instructions 3 Check the Auto Change option Change Rate Hz is 0 5 State Graphic Attributes State Graphic ID 560014 Vearable Read 300 p Bt f Yalue LSB Format Unsigned Fina States i Auto Change Change Hate Hz OE m On the State and Graphic tabs of the State Graphic object 4 There are 14 states in all Add states on the State tab and select specific graphic to display on the Graphic tab State Graphic Attributes State Graphic 5 Bitmap g ili go2 q035 g4 q05 g Bitmap Transparent Transparent Color Black Part Color White Part Color Arrangement W Keep Original Size Therefore the object changes its state repeatedly every 0 5 sec and is controlled by the controller A pumping effect will be generated on the operator terminal screen State 0 State 1 State 2 The object shows auto change ex state 0 2 Beijer Electronics MA00822 115 Instructions Dynamic Circles The Dynamic Circles object changes its position radius and color according to con troller registers Dynamic Circle Ib IDCOOODI Display Format Variable Bice Read
197. me Check the boxes to display the date and time and click the Format button to specify formats Alarm Number Check this box to display the alarm number Color Specifies the color of the message 126 Beijer Electronics MA00822 Instructions Text Tab Alarm History Table Attributes Text Color Background Color m Cancel On this tab Font Color and Background Color for alarm messages can be selected Example of designing an Alarm History Table 100 Generate alarms EDR Alarm Setup 1 Select Application Alarm Setup 2 Specify 230 for Address of Alarm Block to and 16 as Number of Alarms 3 Set the scan time to 1 second for sampling the controller data and maximum number of records to 100 Beijer Electronics MA00822 127 Instructions 4 Enter texts in the message block select to acknowledge the alarm and which screen to display Alarm Setup Address of Alarm Block 2230 OY Scan Time second fi Number of Alarms fi 6 Number of Records in Alarm History Buffer 100 Language 1 M r AK Seen_is Emergency Stop Side carriage down delay Cooling water flow low Gas flow low SD pump overload TRIP Yes None ves noe DOL motor overload TRIP None System parameter set error epe Oven temp too high Wash tank overload om amp wo hm wolrol ny m Transmiss gear lubricate oil over 3000 hours PLS change 10 Sta
198. meters are set Transmission Format in H Designer Set the SW5 ON if parameters are set in Parity NONE the operator terminal Stop bit 1 bit Beijer Electronics MA00822 265 Communication between Operator Terminal and Controller 9 26 LG K300S5 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Data Register Word 16 bits Input Output Relay ewm foso Oooo Cable Drawing RS232 PORT S pin male Operator terminal to RS232C port on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication Format RS232C ss Transmission Speed 9600 bps Set the SW5 OFF if parameters are Transmission Format Size 8 bit set In H Designer Set the SW5 ON if parameters are Parity NONE set in the operator terminal Stop bit 1 bit 266 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 27 LG Master K10S K30S 60S 100S Data format and range of the controller registers which H Designer can access Word Device and Bit Device Data Register Word 16 bits Relay Type Relay Range Input Output Relay Pnb _ n 0 5 b O F fomwstbeo Cable Drawing HMI COM port PLC port R5232C i 9 pin male Operator terminal to RS232C port on controller 9 pin male Communication Format Befo
199. n Click to set the contact as OFF release Reset Button or re click still to set OFF Maintained Button Click to set the contact as ON Maintained Button released still on re click to set OFF Momentary Button Click to set the contact as ON Momentary Button release be OFF Multistate Button Click to change a register to the Multistate Button next previous state of a referenced register SO gt S1 gt S2 gt S3 gt S4 gt 90 a straightfor ward cycle or SO gt S4 gt S3 gt S2 gt S1 gt SO a reverse cycle Set Value Button Click to a numeric keypad display Set Value Button Click ENTER button to write a numeric entry to corre sponding controller register Ls Set Constant Button Click to write a constant to a reg Set Constant Button ister Increment Decrement Button Click to write the value ncrement Button obtained by adding subtracting a constant to from the Decrement Button corresponding register value corresponding controller register Goto Screen Button Click to change the current screen Goto Screen Button to the specified screen Previous Screen Button Click to change the current Previous Screen screen to the previous screen Button ER Action Button Performs a built in action Action Button Beijer Electronics MA00822 61 Instructions 62 Set Button en pressed the operator terminal sets the controllers corresponding bit location Wh d th tort I se
200. n Select Momentary Macro There are Use ON Macro and Use OFF Macro options for the Momentary Button For properties not explained in this section please see chapter Macros To create two states as an ON button simultaneously please see section Set Button Beijer Electronics MA00822 63 Instructions Multistate Button When the button is pressed the operator terminal will write the command to a cor responding controller bit location or register The option Change to Next State is used to change states in a straightforward cycle SO gt SI gt S2 gt S3 gt S4 gt S0 the option Change to Previous State is used to change states in a reverse cycle SO gt S4 gt S3 lt I gt S2 gt SI gt 50 Click to change a register to the next previous state of a referenced register Attributes Tab Variable Write Writes the specified command to a corresponding controller bit location and register Bit Only two states enables you to enter multistated text but only two states can be displayed on the operator terminal Value 256 0 255 states in all 0 represents state 0 1 represents state 1 etc LSB 16 states in all represented by bit The operator terminal takes the bit num ber of the lowest bit that is on as the state number Format Only available when Value has been selected There are BCD Signed Bina ry and Unsigned Binary options Read Specifies a register bit l
201. n Operator Terminal and Controller 9 Communication between Operator Terminal and Controller Note The Register and Range of Relay Numbers in this document refer to the setup range available in H Designer In practice please make sure not to exceed the maximum range defined by the controller CPU in use Otherwise communication errors will occur This chapter provides current information on the settings of the supported control lers at the time of writing As controller vendors continue to release new models con troller data capacity data range and drivers are also often updated Please visit www beijerelectronics com for the latest information For correct communication between the controller and operator terminal the Com munication Format Station Baud Rate and Data Format settings must be consis tent Before connection please setup the operator terminal and controller communication parameter and DIP switch settings Beijer Electronics MA00822 227 Communication between Operator Terminal and Controller 9 1 Allen Bradley Micrologic 1000 1500 The controller data settings and ranges which H Designer can access Word Device CIN an os h ET Word Word Word Timer accumulator Value Tnnn ace nnns0254 fa Wor ounterfiag einnn rmos 7 f5 o vor Counter Preset Value _ CSinnn pre_ onns0 254_ 8_ 5 wora Counter accumulator Value CSinn ace onne0 254 9 s Wor Cole foom mmneozs4 fio fe od
202. n allows users to link several operator terminals and controllers and share data between them Cross Link over Ethernet function The following steps are performed to set up the connection Setup in the first operator terminal 1 Select Application Workstation Setup On the General tab select the operator terminal model from the Panel Workstation list and the controller type from the Controller PLC list New Application s Properties General Connection Control Block Application Name NIN lt Panel forkstation Size H TEO Color Network Status Block Programming Type Maca Address oy Controller PLE Default Mitsubishi Fs Series ka Data Format Unsigned Binary ka Printer Start up Screen None hai Use external keys Extended Control Black a Extended Status Block Multi lingual Support oy Select Language Watch Dog Timer Selecting operator terminal model and controller model 200 Beijer Electronics MA00822 Ethernet Communication 2 On the Connection tab click Add to add Connection 2 for the Cross link Select Ethernet Cross link from the Port method used for the connection list Enter the Default Address IP Address and HMI Type for the desired device New Application s Properties General Connection Device Type Connection 1 Connection 2 HMI Port method used for the connection Ethemet Cross link ki MA uilti lirak
203. n read up to 512 bits in one read command Cable Drawings HMI COM port PLC port RS 232C HMI COM port PLC port RS 232C 9 pin female 9 pin CA 9 pin female Operator terminal to RS232C programming port on controller CPU ZB4 303 KB1 Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting RS232C COM1 or COM2 RS232C Station No O PS4 201 Set PLC Station to 0 1 in H Designer 1 PS316 Transmission Format Size 8 bit in H Designer Set the SW5 ON if parameters are set in Parity NONE the operator terminal Stop bit 1 bit Transmission Speed 9600 bps Set the SW5 OFF if parameters are set Beijer Electronics MA00822 257 Communication between Operator Terminal and Controller 9 21 Koyo SA TI 325 330 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range TMR CTR nnn nnn octal number 600 677 Register Values mmm Accumulator mmm octal number 400 576 Even Bytes mmm must be a multiple of 2 Input Output Bits Bann _ anneoctal number 057 with Input Output Bits Bann _ anneoctal number 700 767 end wth 0 Internal Relay Bits Bn nmnzoctat number 160377 endwino Shift Register Bits Bnnn nmnzoctat number 400577 end with 0 TaR CTR Bits Bnn nmnzoctat number 6004677 endwih 0 When operator terminal c
204. n with dynamic objects with write read addresses displayed on the top left side The user can return to the previ ous view by clicking on the screen Digital objects Push Buttons bl b bl bl On Reset On On Off Displaying Whole Screen With I O Labels 2 4 2 Language 1 5 There are five languages available to the user Please follow the steps below to set up multiple languages 1 Select Application Workstation Setup The Application Properties dialog box will appear on the screen Application Properties General Connection Miscellaneous Logging Buffers Password Control Block Application Mame Address wid Panel ork station 5 ee H T60 Color Plus Status Black Programming Type Maco Address gy Controller FLC Default Null ka Data Format Unsigned Binary x Printer Start up Screen None ka Use external keys Extended Control Block m Extended Status Block I Multi lingual Support sd Number of languages z Select Lanquag Watch Dog Timer Startup Language La The Application Properties dialog box 30 Beijer Electronics MA00822 Instructions 2 On the General tab check the Multi lingual Support box to begin setup Number of Languages Specify the number of languages required for the project A maximum of 5 languages can be selected Select Language Specifies the languages to use Startup Language Specifies the language to
205. nal reads all controller registers from Wn to Wn 2m For example if the value in Wn is m 15 sampling points the operator terminal will read data from 61 2 x 2 x 15 1 controller registers Control To control the trend graph by controller Trigger Flag The trigger flag number of the trend graph is bits 12 15 in CFR The operator terminal reads data from controller and displays the XY chart when the trig ger flag turns on Clear Flag The clear flag number of the trend graph is bits 8 11 in CFR The op erator terminal clears the trend graph when the clear flag turns on Display Points Line Area over X axis and Area over Y axis See the illustration below PL a ku mi om mom mi im VES AVE fo Nar a ma m iy a i ni a i a u Line Points maa E Area over X axis Area over Y axis Maximum Number of Points Specifies the maximum number of points to display on the XY chart 100 Beijer Electronics MA00822 Instructions Grids Number of H Lines Specifies the number of horizontal lines Number of V Lines Specifies the number of vertical lines Color Specifies the color of the lines Data Set 1 Data Set 2 When the Edit button is clicked the dialog box below will appear Data Range And Drawing Style Eq Data Range Vertical Min E Horizontal Min 0 Vertical Max 100 Horizontal Wax 1 00 FointLine Color EA i Foint Size 5 Line Styl F3 V
206. nd Controller 9 23 LG Glofa GM6 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Input Image IWn m b n 0 1 m 0 7 b 0 3 Word 16 bits Internal memory Word 16 bits Internal memory nnnn 0 65534 Double word 32 bits The operator terminal can read up to 60 words 30 double words in one read write command and only supports CPU modules Cable Drawing HMI COM port PLC port R5232C 25 pi 9 pin male Operator terminal to RS232C port on controller 9 pin male Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS232C RS422 RS485 COM1 or COM2 RS232C RS422 RS485 Transmission Speed 19200 9600 38400 bps Set the SW5 OFF if parameters are Transmission Format set In H Designer Set the SW5 ON if parameters are Parity NONE set in the operator terminal Stop bit 1 bit 262 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 24 LG K10 60H 200H Data format and range of the controller registers which H Designer can access Word Device and Bit Device Poo pos e o ooo O Auxiliary Relay Input Output Relay Data Register Dnnnn nnnn 0 1023 Word The operator terminal can read up to 60 words in one read command Input Output Relay Pano nn 063 Bohex numbe
207. nks Beijer Electronics MA00822 Instructions State Tab The states of the object are defined on the State tab Multistate Button Attributes Shape State Text Graphic S Text Bitmap Lowest Speed Medium High Highest Delete The State tab of the Multistate Button dialog box New Adds a new state to the object Cut Cuts the specified state to the clipboard Copy Copies the specified state of the object and keep the original state Paste Pastes the state from the clipboard Replace Replaces the current specified state from the clipboard Delete Deletes the current specified state Text Tab Font and apperarance of the text in the object is specified on the Text tab Multistate Button Attributes Shape State Text Graphic S Text itma E Lowest Speed Font 76 Zi Medium Underlined High Color m gt Highest Background Color z Blink The Text tab of the Multistate Button dialog box Beijer Electronics MA00822 59 Instructions 60 Editing Option Wrap Lines If the length of the text is longer than the width of the button it will be executed in wrapped lines Text Movable If the length of the text is longer than the width of the button it will not be executed in wrapped lines Click the text on the selected object to make the text surrounded with the handlebars for dragging Appearance Font Specifies the size of the font Unde
208. nnection 2 Simatic 57 200 via PFI 1 t Remove Rename Hal Simatic 57 200 via PPI 1 to 1 Address 0 Default Address 2 Port method used for the connection Baud Rate S600 Data Bite E COM hi Even Stop Bifa 1 ovi Parity Multilink Command Delay ms o l Timeout Time Sec Default Number of Retries E Setup up of the connection with the second controller 5 If the communication port is already being used the following error message will be displayed 63 COM2 is used by more than one link OK Error message when the port is already being used 6 To add an Ethernet enabled controller click Add again to add a third controller for example ModBus TCP IP Device Add Connection Adding a third Ethernet enabled controller 208 Beijer Electronics MA00822 Multi Channel Communication 7 Enter the addresses in the Default Address and IP Address boxes New Application s Properties General Connection Device Type Connection 1 Mitsubishi Fs Seres Connection 2 Simatic 57 200 vla PPI 1 t Remove a Connection 3 Modbus TCP IP Device Rename lt E HMI Modbus TCPIP Device Default Address 1 Port method used for the connection odes A me m z Ehem KB Command Delay me 0 bel ulti link W Use default port a Setup of the connection with the third Ethernet enabled controller Click OK to finish the setup To change the setup l
209. nt Ea B r Color Background Color I Blink Adding one text for each state on the Text tab of the List object 78 Beijer Electronics MA00822 Instructions The steps above will create a List object When an item from the List object is select ed the operator terminal will write the value associated with the item to the specified controller register In this example if the item Peach is selected the value of the con troller register will be 5 pple Banana Orange Lemon The List object and the display of the controller register value of the item 2 7 7 Drop Down List Each of the items in the Drop Down List object corresponds to a value of a controller register Therefore for a Drop Down List object the value associated with the dis played item is the current value of the controller register Click the object to display the list A list of items to choose from is dropped down You can also change the value of a controller register by making a selection from the Drop Down List object Once a selection is made from the object the list will dis appear The object is not available on all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models tor complete details The properties of the Drop Down List object are similar to those of the List object please see the sections Listand Specifying Object Properties Example of designing a Drop Down List object
210. nt Register nnn 1 912 Word Cable Drawings HMI C OM port PLC port RS422 25 pin we eee ne nen eee CABLE 9 pin male TAD 190 LL 2 RAD TXD 15 es 7 RD RADA T RXD 17 3 TXD 5 GND 4 PG COM Operator terminal series to RS422 port on TPO2 HMI COM port PLC port R 5485 25 pin see eee eee oes CABLE TXD RXD 14 TXD RXD 15 SG 7 Operator terminal to RS485 port on TP02 Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication Format RS422 RS485 LL Station No PLC Station 01 Transmission Speed 19200 bps Set the SW5 OFF if parameters are Transmission Format Size 7 bit set In H Designer Set the SW5 ON if parameters are Parity EVEN set in the operator terminal Stop bit 2 bit Note The above Controller Setting is the H Designer default please refer to the controller manual Beijer Electronics MA00822 303 Communication between Operator Terminal and Controller To set up WS041 WS042 WS044 WS045 WS041 SET RS422 baud rate data bit parity stop bit WS042 SET RS422 station number WS044 SET RS485 baud rate data bit parity stop bit WS045 SET RS485 station number If IPO2 controller RS422 port station no 01 WS042 set to 01 decimal trans mission speed 19200 bps and transmission format 7 bits Even 2 bits WS041
211. o Screen Button but remember to check the Close Previous option for Function Beijer Electronics MA00822 71 Instructions Action Button The Action button is used to perform a built in function The following actions are available Set Lowest User Level Changes to the lowest user level level 9 Print Screen Prints the specified region HARDCOPY of current screen Select Language 1 5 Displays the screen in the specified language 5 languages available for selection All features are not available on all operator terminal models please refer to Appendix A H Designer Features and Operator Terminal Models For properties not explained in this section please see the section Specifying Object Properties Example of designing an Action Button In this example the Action Button will be used to change the contrast of the display On the Attributes tab of the Action Button 1 Action Select Contrast Up from the drop down list On the Graphic tab of the Action Button 2 Bitmap Select Symbol ContrastUp Action Button Attributes Shape Text Graphic S Text Bitmap Bitmap Transparent Transparent Color Black Fart Color White Part Color Arrangement W Keep Original Size Selecting a symbol for the Action Button 72 Beijer Electronics MA00822 Instructions 2 7 4 Numeric Entry The Numeric Entry is used to write an input value to a controller register and
212. o a binary num ber Format Al A2H A2 The character of the fourth digit is in word A2 and the characters of the other digits are in the words following A2 in sequence The result will be saved in Al For example suppose A2 is 200 and the data in 210 9538H After the conversion the result will be saved in Al 210 and will be 200 0039H 201 0033H 202 0035H and 203 0038H The data format is word only H2A gt Convert a 16 bit binary number into a 4 digit hex number in ASCII char acter form Format Al A2H A2 The number to be converted is in A2 The char acter of the fourth digit will be saved in Al and the characters of the other digits will be saved in the words following A1 in sequence For example suppose A2 is 100 and the data in 100 1234H After the conversion the result will be saved in Al Q2110 and will be 110 0031H 111 0032H 112 0033H and 113 0034H The data format is word only Beijer Electronics MA00822 221 Macros 8 3 7 Bit Setting Note Both internal memory and controller bit can be used in these commands including nnn b and RCPWnnn b SETB gt Set bit to ON Format SETB Al CLRB Set bit to OFE Format CLRB A1 INVB Inverse bit state Format INVB Al 8 3 8 Others There are three special commands to use TIMETICK gt Get the current system time tick CPU internal clock time For mat Al TIMETICK The system time tick is increased by 1 in every 100 ms
213. o copy the screen or upload the application to H Designer the op erator terminal will ask for the password Application Properties General Connection Miscellanecus Logging Buffers Password Developers Password Developer s User Level jo The Password tab of the Application Properties dialog box 2 9 2 Tag Table The Tag Table enables you to provide a name for the controller address and specify the refresh rate Select Application Tag Table 3 Tag Table fo Local Internal Mo Name fff 1 Connectinr Normal Normal Normal Normal Normal Normal Normal Normal Normal 1ITITITI TI Normal The Tag Table window Beijer Electronics MA00822 Instructions 2 9 3 Alarm Setup To use the Historical Display object you must set up its address and parameters first Then the operator terminal will display the corresponding messages after reading the controller value Up to 512 messages can be specified Select Application Alarm Setup Alarm Setup Address of Alarm Block TEL dij Scan Time second 3 v Number of Alarms 1 60 Number of Records in Alarm History Buffer 1 0 Cancel Femme mA EA AAA pre o POT L fel Hee e o 1 2 ES 4 _5 8 7 e o9 mu The Alarm Setup dialog box Address of Alarm Block To use a bit LSB as a corresponding alarm address If W130 is the starting position and the number of the alarm
214. o display all of the application files in detail view or thumbnail view in order to make it easy for a user to search modify edit and so on Select Screen Screen Manager or click E The entire Screen Manager will be dis played in the middle of the window or minimized on the left side ra SCT Meni LI _ OK e HSE Rx Bl mam ima Cs gt Coma Analog objects o fs e HH 1 fH ALAH EE H BR m ri ou slejejejejejejajajejejejejejejejejejsjsjajai a SEBEODOOODOOOOEEOEEEEOEGOEGOG The Screen Manager In the Screen Manager window click the number or name to display the selected screen If you want to open the image just double click on the image 32 Beijer Electronics MA00822 Instructions Screen Manager Icons Screen Manager icons provide functions to manage screens and screen properties as well as functions to increase ease of use of the Screen Manager as explained below Undock The size of the Screen Manager window will be decreased and the Screen Manager will be docked at the left side of the screen The Screen Manager window is restored to full screen size Closes the Screen Manager Detail View Displays screen data in different ways either as Thumbnail View detailed list data or as thumbnails ll Adds a screen with No and Name A new screen appears in the Screen Manager list Also described in image below Screen Properties Opens the Screen Properties di
215. ocation to read from if the location is not specified then the operator terminal reads from the Write location Function Change to Next State Changes the Write location to its next state in a forward cycle SO gt S1 gt S2 S3 gt S4 gt SO Change to Previous State Changes the Write location to its previous state in a re verse cycle SO gt S4 gt S3 lt I gt S2 gt S1 SO Note that the number of states can be edited on the State tab For properties not explained in this section please see the section Specifying Object Properties Example of designing a Multistate Button On the Attributes tab of the Multistate Button 1 Write Specify controller register W50 to write in Read Specify W50 The controller model is NULL 2 Format Value 3 Function Change to Previous State 4 Shape Select Outlined _1 and the color Black On the State tab of the Multistate Button 5 Add 8 States 64 Beijer Electronics MA00822 Instructions On the Text tab of the Multistate Button 6 Enter the corresponding texts Multistate Button Attributes Shape State Text Graphic Language Editing Option Wrap Lines C Text Movable 5 Text First State Font Esp Second State Third State Underlined Forth State Color cam 2 Fifth State Sixth State Background Seventh State Color i Texts for the 8 different states of the Multistate Button in
216. of 100 is 50 sub macro 50 is called If the value of 100 is 100 sub macro 100 is called If 100 is not equal to either of those values the sub macro 1 is called IF 100 50 THEN DO CALL 50 ELSE DO IF 100 100 THEN DO CALL 100 ELSE DO CALL 1 ENDIF ENDIF 218 Beijer Electronics MA00822 Macros ELIF structure The ELIF statement is provided to create IF structures in which the ELIF branch of one IF statement leads to another option IF first condition THEN DO statements to be executed if condition is true ELIF second condition THEN DO statements to be executed if condition is false ELIF third condition THEN DO statements to be executed if third condition is false ENDIF In the following example if 100 equals 50 sub macro 50 is called If 100 is not equal to 50 the program continues to the ELIF statement to test if 100 is equal to 100 If 100 equals 100 sub macro 100 is called If 100 is not equal to 100 the program moves to the next ELIF and so on IF 100 50 THEN DO CALL 50 ELIF 100 100 THEN DO CALL 100 ELIF 100 150 THEN DO CALL 150 ENDIF You cannot define a label inside an IF statement Beijer Electronics MA00822 219 Macros 8 3 5 Flow Control Note Only internal memory can be used in these commands GOTO gt Format GOTO LABEL A1 Goes to LABEL A1 unconditionally The GOTO command will cause a branch to the specified label Label A1 LABEL A1
217. of the word located at byte nnnn of data block mmm HMI COM port 9 pin eb OO mno Operator terminal to RS232C port on CP340 Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication Format RS232 CP340 COM2 RS232C RS422 RS485 RS422 CP340 RS422 Set SW10 OFF RS485 CP340 RS485 Set SW10 ON Transmission Speed 9600 19200 bps Se Eby P Designer NE Set the SW5 ON if parameters are Transmission Format set in the operator terminal Parity EVEN Stop bit 1 bit Function Block FB40 FB2 FB3 DB2 DB3 for CP Beijer Electronics MA00822 295 Communication between Operator Terminal and Controller 9 44 Siemens Simatic 57 300 via MPI port Data format and range of the controller registers which H Designer can access Word Device and Bit Device Device Type Data Size Register Type Format Register Range x Addres Input Image IWnnnnn nnnnn 0 65534 Input Image nnnnn 0 65532 1 Double word Output mage own annnn 0 65534 f mos Bis jm mosa da Data Area 6610 Von DB10 DBWnnnnn nnnnn 0 65534 the byte nnnnn amp nnnnn 1 make DBWnnnnn Double word Double word Data Area DB10 DBDnnnnn_ nnnnn 0 65532 a double word address DBWnnnn amp DBWnnnn 1 make DBDnnnn Data Area DBmmm mmm 1 255 DBWnnnnn nnnnn 0 65534 O Q Data Area DBmmm mmm 1 255 DBDnnnnn nnnnn 0
218. og box Focal Mark Style There are five focal mark styles to choose from None Still Lines Circulating Lines Circulating Dots and Swaying Dots This function is not limited by any application images or files It modifies the H Designer editing environment Cut Copy Duplicate Delete Bring to Next Send to Previous Bring to Top Send to Bottom Focal Mark Style gt None Still Lines Circulating Lines Circulating Dots Object Attributes v Swaying Dots Screen Attributes The Focal Mark Style list 26 Beijer Electronics MA00822 Instructions ra 1 Screen_1 Objects with different focal marks Common Attributes This function makes it easier to edit objects with common attributes simultaneously The user can modify attributes of all objects which are on the screen at one time First select the objects to be edited at one time The Common Attributes dialog box will be displayed on the screen when you double click one of the objects E 80 Recipes x Recibes Common Attributes 721 Language Language 1 Apply to state Recipe table L LIL OO Location Dimension oO HH ogo HH ogo HE ian Apply m oo Oe Height Ha Apply u i HH HH Outlook 5 5 a Shape ID Select crt oOo HH Outline color Bka color Pattern ze Value in controller LE LL m Pattern color Alignment L
219. omposed of nearby two values Dont use 7 Please adjust the value of the operator terminal Command Delay block read displays 0020 error message 8 Object integer decimal digit must correspond with reality unsigned binary object refer to the user manual Beijer Electronics MA00822 305 Communication between Operator Terminal and Controller 306 9 50 Telemecanique TSX Micro Data format and range of the controller registers which H Designer can access Word Device and Bit Device The operator terminal can read up to 60 words in one read command Controller denotation MWnnnn Bit of Internal Word nnnn 0 9999 bb 0 15 bb 00 e g W0 0 Notes 1 The writing unit for a single point bit is 16 bits 2 When operator terminal changes a relay s state the operator terminal must read 1 word 16 bits After changing the corresponding bit the operator terminal will write the word to the controller These actions will take more than one con troller scan The controller ladder cannot control other bits word before the operator terminal has completed the Change the Relay action otherwise these bits word will return to their initial values In other words the controller s con trol action will be resumed For example When the operator terminal changes W1234 7 the operator termi nal must read the word from W1234 0 toW1234 15 After changing bit 7 the operator terminal will write the word to the c
220. onstant by click ing Limit Specifies the minimum value written to the register when using the Decre ment Button For properties not explained in this section please see the section Specifying Object Properties Example of designing a Decrement Button When clicking the Decrement Button the subtracted constant value stored in the controller register will be displayed in the bar graph The Bar Graph is an object used to display the dynamic data E Fa 3 Screen_3 B Increment Decrement When the Decrement Button is clicked the level in the Bar Graph is decreased The steps used to create a Decrement Button are the same as in section Example of designing an Increment Button but remember to change Limit to 0 106 iga 75 75 5a 5a 25 25 a Pati a oe X Clicking the Decrement Button five times subtracts 25 from the controller constant Beijer Electronics MA00822 Instructions Goto Screen Button The Goto Screen Button is used to change the current screen to another screen Attributes Tab Function Open Go To Check this option to create a Goto Screen Button You can select which screen to open from the drop down list Enabled By Only change the screen when the controller register is ON Execution On Press Executes the command changes the screen when button is pressed On Release Executes the command changes the screen when button is released Appended Function
221. ontroller If the operator terminal does not write to the controller the controller ladder has changed W1234 0 W1234 6 or W1234 8 W1234 15 The operator terminal s write action will cause the controller control action to resume Cable Drawings HMI COM port PLC port RS 232C HMI COM port PLC port RS485 8 pin male RXDITXD 14 RXDITXD 15 SG PLC port RS485 8 pin male RXD TXD 1 1 DATA RXD TXD 6 2 DATA SG 5 7 SG 8 SV 8 7 front side view of the cable Example Operator terminal COM port to TER RS485 port Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication Format RSRS232C RS485 COM2 RS232C RS422 RS485 RS485 Set SW10 ON Station No 0 8 Master Set operator terminal station to 1 8 SLAVE in H Designer Transmission Speed 9600 19200 bps Set the SW5 OFF if parameters are Transmission Format Size 8 bit set in H Designer Set the SW5 ON if parameters are Parity ODD set in the operator terminal Stop bit 1 bit Beijer Electronics MA00822 307 Communication between Operator Terminal and Controller 9 51 Toshiba M20 M40 Data format and range of the controller registers which H Designer can access Word Device and Bit Device The operator termin
222. or designated specific position Screen Properties General Screen Background Style Read Blocks Ausiliary Keys Screen Number 40 W Included in the compilation Screen Name Language 1 Analog Objects S Language 2 PO Language 3 PO Only refresh the screen and enable its touch keps when it is the top most screen A Always refresh the screen but only enable its touch keys when it is the top most screen Always refresh the screen and enable its touch keys Need a base screen B Backaound o Modifying attributes of a sub screen i This screen is a sub screen width 0 Height 0 f Shown on the display center C Shown at E TE Printed Area Upper left Position Zia Lower naht Position ko ud 5 After clicking Enter the screen will be minimized to the specified size Beijer Electronics MA00822 Instructions Base Screen A base screen is a screen which may be used as a template for many different screens Once you have edited a base screen all of the same base screens in the application will be changed at the same time The following are the steps required to create a base screen 1 Create a base screen first named for example Screen 5 2 Create a new screen Screen 6 Then check the Need a base screen box and specify the base screen Screen 5 in the Screen Properties dialog box Screen Properties General Screen Background Style Read Blocks Screen
223. or and background color for each type of object The objects will be displayed with their settings on the screen Default Text Styles Object Char Size Static Text m Kaj NE Indicator Push Button Numeric Display Cancel Numeric Entry Character Display Character Entry Message Display Historical Data T able e6 l Historical E vent Table E l Ad alt el ota a tole el The Default Text Styles dialog box 2 11 8 Numeric Keypad Setup Select Options Numeric Keypad Setup to set up the numeric keypad on the screen displayed for example when clicking the Numeric Entry object Numeric Keypad Setup Ed Keypad Size Legend Style Symbols ka Initial Position Left The Numeric Keypad Setup dialog box Keypad Size Small or Large can be selected Legend Style Symbols or Chinese Characters can be selected Initial Position Left or Right can be selected 2 11 9 Editing Options Select Options Editing Options to set up the edit environment here Editing Options W Show object contents while dragging l Cancel Trigger object attribute dialog open when drawing done The Editing Options dialog box Beijer Electronics MA00822 157 Instructions 2 12 Window Menu The Cascade Tile and Close All options available in the Window menu and all open screens are listed i H Designer C Demo aps H T60c N_demo V6F File Edit View Screen Draw Object Library
224. oring Fix Color W420 Width W420 Width W420 Width W421 Height W421 Height W421 Height W421 Height W422 X W423 Y W424 Color Fix Position Re size Re Coloring W422 Color Fix Color Fix position Re position Fix Position Re size Fix Size Fix Size Fix Size Re Coloring Re Coloring Fix Color Fix Color W420 Width W420 X W421 Y W422 Color W420 X W421 Y W420 Color 117 Beijer Electronics MA00822 Instructions 118 2 7 18 Historical Display The Historical Display drop down list includes the following Historical Trend Graph Historical Data Table and Historical Event Table The Historical Display data is stored in logging buffers so you should assign its area and size first The logging buffer is used to store the sampling data in the operator terminal battery backup RAM The object is not available on all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models for complete details Logging Buffer Select the Logging Buffers tab from Application Workstation Setup Application Properties General Connection Miscellaneous Logging Buffers Password Record Auto Triggered Time Mon Field Use LEH Source Address Size Total Stop Bu Interval volatile Def 1 lao a fso Timer f2 A Edt ka ee pi e p E E Tr fi e KITE IM UT u STO NONE 0 UTO ae en ko dii mi ro ec ae NOTE I TEN a Ta ki aj os E E e e m jag KOD OT NE TT hen TR e pru
225. pe You can select the library to save in from the drop down list and name the shape in the Shape Name block Save As Shape Library C Program Files H Designer iyv6 0 8 0345 hap Browse Shape Mame Cancel The Save as Shape dialog box 2 8 4 Shape Library Manager The Shape Library Manager is used to manage shapes in the Shape Library Shape Library Manager Library New Oper Dave Save As Shapes View Properties The Shape Library Manager dialog box New Creates a new shape library Open Opens an existing shape library Save Saves the active shape library to a file Save As Allows selection of which file to save to Close Closes the Shape Library Manager If changes have not been saved a dialog box will be displayed asking if you want to save Copy Copies the selected shape to the clipboard Paste Imports the shape from the clipboard Cut Exports the selected shape to the clipboard Delete Deletes the selected shape Beijer Electronics MA00822 135 Instructions Properties Displays the properties of the selected shape Shape Propertities Setting View AllStates State fi Name HTSO10 Lancel Purpose Original Size Push Button width 154 General Height 56 Dimensional Constraints I Minimal Size w IE H IE Keep Original Aspect Ratio Component View Display Always At State a User Changeable I Fram
226. perator terminal to programming port on controller RS485 mode Beijer Electronics MA00822 293 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Set the SW5 OFF if parameters are set in H Designer Set the SW5 ON if parameters are Parity EVEN set in the operator terminal Stop bit 1 bit Command Delay ee Operator terminal Command Delay Note The communication mode of the Simatic 7 200 network is a Token Ring structure and can exist in several majors When on line the PC can download from upload to the controller Transmission Format Size 8 bit 294 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 43 Siemens Simatic 57 300 CP340 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range DBmmm DBWnnnn mmm 1 255 DBmmm DBWnnnn is the address of a Word nnnn 0 8190 word located at byte nnnn and the byte following nnnn of data block 3 DBmmm DBDnnnn mmm 1 255 DBmmm DBDnnnn is the address of a Double word nnnn 0 8188 double word located at byte nnnn and the three bytes following nnnn of data block mmm The operator terminal can read up to 32 words in one read command DBmmm DBXnnnn b mmm 1 255 DBmmm DBXnnnn b is the address of nnnn 0 8191 bit b
227. ph is not controlled by the controller Graphic State PLC controlled Displays the graphic states controlled by the controller Location dependent Displays the different states according to the location Auto change Changes the graphic state automatically Rate Once per Specifies the rate at which to change the graphic state Path PLC controlled Controls the object s movement path via the controller Horizontal line Moves the object along a horizontal line Horizontal marquee Moves the object along a horizontal line with marquee Check Duplication to move duplicated graphics along a horizontal line Vertical Line Moves the object along a vertical line Vertical marquee Moves the object along a vertical line with marquee Check Duplication to move duplicated objects along a vertical line Connected Lines Moves the object along the route of connected lines Path Double click the left key on the object to display the movement path Path Point Right click on the object to select Add Path Point or Delete Path Point from the drop down list for the connected lines setup Please see section Example of creating horizontal vertical line as a path for complete details Note that a curve path can be configured with various path points Still Changes the state without movement Movement Rate pixels sec Specifies the rate of movement One way Moves the object in one way mode
228. play the Address Constant Input dialog box Select 2 Connection 2 from the Connection list Enter the address in the Device Type and Addr Value boxes In the example the address is CO Address Constant Input Connection 2 Connection 2 Device Type Ic a Type Addr value ji f PLC Device Word f PLE Device Bit Internal Memory word i nternal Memory Bit f Constant Constant Type Unsigned integer Signed integer Her number Floating point number PLC Station Number W Default ons Click OK and 2 C0 will appear in the object attribute dialog box 4 Download the edited application to the first operator terminal 202 Beijer Electronics MA00822 Ethernet Communication Setup in the second operator terminal 5 The setup steps are the same as for the first operator terminal with the difference that the controller device in Connection 1 of the second operator terminal is the controller device in Connection 2 of the first operator terminal Note that the Addr Value of the controller device Connection 2 must be changed Application Properties General Connection Miscellaneous Logging Buffers Password Device Type Connection 1 Simatic 57 200 via PPI 1 te Connection 2 Mitsubishi Fs Seres Remove Rename HMI Mitsubishi FX Seres Default Address 0 Port method used for the connection IP Address haz hes hes ma Ethernet Cross link La Pus Typ
229. ponding to the nth word register where b is in hexadecimal nth b 0 f For example if the address of the control block is DO the Numeric Display object can be selected to display the recipe number register by configuring it to display CB5 instead of displaying D5 The internal buffer of the control block is read only This means for example that you can configure a Numeric Display object to show the value of CB2 but you can not configure the object to allow the operator to change the value of CB2 Say for example that the you want to achieve the effect of the RNR numeric display object using H Designer You can specify that D5 be read from writeable or that CB5 be read from non writeable 4 1 6 Determine the Control Block Size As every application needs a Screen Number Register SNR and a Control Flag Register CFR you can refer to the following rules to determine the size of the con trol block 1 If the operator terminal reads writes a recipe from to a controller the minimum SIZE 1S SIX 2 If Item 1 is not true and the operator terminal uses LBCR3 to control logging buffer 9 12 the minimum size is five 3 If either Item 1 or Item 2 is not true and the operator terminal uses LBCR2 to control logging buffer 5 8 the minimum size is four 4 If none of Item 1 through Item 3 is true and the operator terminal uses LBCR1 to control logging buffer 1 4 the minimum size is three 5 If none of the abo
230. port RS 422 15 pin male 15 pin male RDB RXD 10 RDB RXD 3 RDA RXD gt RDA RXD SDB TXD x mani SDB TXD SDA TXD x 2 SDA TXD 7 SG SG 2 CTS CTX CTS CTX RTS RTX RTS RTX 5 CTS CTX CTS CTZI RTS RTX RTS RTX SV 8 SV Operator terminal to RS422 programming port FP3 CPU port Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication RS422 or RS232C COM2 RS232C RS422 RS485 Format Station No 02 27 Set PLC Station to 01 in H Designer FP CPU PORT 238 CPU PORT 238 FP1 Set computer link Transmission 19200 9600 bps Set the SW5 OFF if parameters are Speed FP10SH CPU Set 115 2K bps set in H Designer Trancmicsion Set the SW5 ON if parameters are i set in the operator terminal Format Parity ODD j Stop bit 1 bit Beijer Electronics MA00822 269 Communication between Operator Terminal and Controller 9 29 Mirle DX Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Relay Type Relay Range Cable Drawings CABLE lt lt ccceees 9 pin male TXD 14 TXD 15 RXD 16 RXD 17 u lt lt lt SBC 20 port RS422 CABLE sco seeesce
231. ppendix A H Designer Features and Operator Terminal Models for complete details Beijer Electronics MA00822 Instructions 2 2 Reconstruct Source This function allows users to directly reconstruct the source file of an application by uploading the application file from an operator terminal to a PC Reconstruct Source is used to reconstruct an uploaded application file from AAG to V6E The application will be displayed on a PC and the source file V6F can be saved for the future editing and application In H Designer an application downloaded to an operator terminal is rebuildable Reconstruct Source enables a user to directly reconstruct a source file of an uploaded application on an operator terminal from AAG to V6E Note This function is not available for all operator terminal models please refer to Appendix A H Designer Features and Operator Terminal Models for complete details Steps to reconstruct a source file from AA6 to V6F Assuming that an application has been uploaded on the operator terminal 1 On the operator terminal select Upload Application In H Designer select File Upload Application The operator terminal will upload the application to the PC and the file will be saved as AFG 2 Next select File Reconstruct Source and open the application file C64 or AAG The application should appear on the PC and the user can save the source file as V6F for future use
232. r GBF lw Keep Original Size g 70 w 108 Redraw Ym Hp a The Static Graphic dialog box Beijer Electronics MA00822 Instructions Frame Edge Frame Edge enables you to choose style pattern style background and color Frame Edge ID FRMOOOTI Style Select i Color B Pattern Style maiii I Pattern Color Protile 25 We T 38 H The Frame Edge dialog box Clicking Select displays flow chart styles for selection MS Select Frame Style it GeneralFrame Push Button Frame Selection of Frame Style 52 Beijer Electronics MA00822 Instructions Scale Scale provides scales directed left right up and down as well as color number of ticks and display marks for scales ID ISCLOOD12 Attributes m Type Y Color iM Display Axis Cancel Number of Major Ticks 5 Humber of Minor Ticks lo W Display Marks Fort gs5 CO G16 Number of Digits E Decimal Pt Position Ic T bdin 0 Har 100 Marks in Reverse Order The Scale dialog box Table Table is used to create tables ID ITELOO013 Cells General Header Number of Rows kw Use First Row as Row Header Humber of Columns Style Transparent Cancel Pattern Color Separator Background Color Style m Color E Use First Column as Column Header Separate Rows Evenly Style Separate Columns Everly Pattern Color Background Color
233. r Electronics MA00822 93 Instructions Day of Week Display The Day of Week Display object is used to make the operator terminal read the day of week value from the internal real time clock RTC and to display the content di rectly on the operator terminal screen The object is not available on all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models for complete details The operator terminal will display the date of week automatically Day of week Display Attributes Text 5 Text Color Background Color The Text tab of the Day of Week Display object Example of the Time Date and Day of Week Display objects WED 11702705 19 17 62 The Time Display Date Display and Day of Week Display objects 94 Beijer Electronics MA00822 Instructions 2 7 12 Bar Graph There are two types of Bar Graphs Normal and Deviation Normal Bar Graph The Normal Bar Graph is used to make the operator terminal read the value of the controller register to convert its data into a bar graph and then to display the bar graph in the operator terminal Variable Min Specifies the minimum value the bar graph can display Max Specifies the maximum value the bar graph can display Variable target range limits Select this option if the target value and the range limits are read from the controller The Target Variable is stored in the bit location that fo
234. r OF End with sO Cable Drawings HMI COM port PLC port RS 232C 9 pin male HMI COM port PLC port RS 232C 9 pin male Operator terminal to RS232C port on controller K200H CPU Beijer Electronics MA00822 263 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS232C COM1 COM2 RS232C Transmission Speed 9600 bps Set the SW5 OFF if parameters are set Transmission Format Size 8 bit in H Designer Set the SW5 ON if parameters are set in Parity NONE the operator terminal Stop bit 1 bit 264 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 25 LG K2005 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Data Register Word 16 bits Input Output Relay Ponb nn0 15 beot fomstbeo Timer counter w w Cable Drawing HMI COM port PLC port R5232C i 9 pin male Operator terminal to RS232C port on controller 9 pin male Communication Format Before connection please set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting RS232C COM1 or COM2 RS232C fstationNo ome Transmission Speed 38400 bps Set the SW5 OFF if para
235. r bit is used to clear curves in the operator terminal There are four clear flags and the user can set the corresponding signal to clear the desired curve Set the bit to ON OFF once to clear the values of a trend graph or X Y chart The controller requires that the bit be reset if the operator terminal is re assigned to modify RCPNO and it needs enough time for operator terminal detection Bit 12 15 Trigger Flag 1 4 This controller bit is used to sample the trend graph data There are four trigger flags in all Once the controller bit is set to ON OFE the operator terminal will read the contin uous data and covert it into a continuous curve which is displayed as a trend graph or X Y chart objects The controller requires that the bit be reset if the operator terminal is re assigned to sample the data and it needs enough time for operator terminal detection 4 1 3 Logging Buffer Control Registers LBCRs The other type of trend graph in the operator terminal is called the Historical Trend Graph The operator terminal reads the data from the corresponding logging buffer according to the specific signal The logging buffer is used to save the sample data in battery backup RAM Remember to specify the logging buffer to read from and its SIZE In LBCRs Trigger Bits are used to request logging buffers to sample the data from controllers Clear Bits are used to clear logging buffers and Size Bits are used to de termine the size of t
236. rator Terminal Models for complete details 3 1 Example The following coating equipment is used to spray paint on different parts The paint colors are limited to white red blue dark and mixed color 1 spray 0 no spray Recipes can be used to present and save data to simplify matters 1 0 3 0 0 2 0 0 1 0 1 1 This recipe data has five variables White Red Blue Black and Time The following recipes are to be created Recipe 1 paints the top in white for 3 minutes Recipe 2 paints the bottom in red for 2 minutes Recipe 3 paints the left side in purple red blue for 1 minute Recipe 4 paints the right side in black for 1 minute A variable represents a word the recipe size is 5 and the number of recipes is 4 Beijer Electronics MA00822 161 Recipes 3 2 Recipe Operation Steps This section will illustrate the operation and application of recipes We will continue to use the coating equipment from section 3 2 as an example 1 First a Recipe Register has to be defined Select Application Workstation Setup and enter the PLC address Recipe size and Number of recipes on the Miscella neous tab Application Properties General Connection Miscellaneous Logging Butfers Password Touch Screen External Keps kw Read write recipes from to PLC SU ino TRE Se 0 20 Address m WE Auto Repeat Delay Sec 1 0 i Recipe size 5 2 W 2 Auto Repeat Rate Hz Number of recipes 4 Edit Fie
237. rator terminal to execute a number of tasks including flow con trol data transfer conversion counter system service instructions etc Using macros can not only help you communicate to the controller but also connect to other de vices This feature provides an efficient integration system as well as an economical structure for hardware application In addition using macros can also significantly reduce program size and optimize controller efficiency Please see the chapter Macros for complete details There are three macro options in the Application menu INITIAL Macro BACK GROUND Macro and CLOCK Macro INITIAL Macro When the operator terminal runs the application for the first time this means the first time the application is executed after power off this macro is executed once The purpose of INITIAL Macro is data initialization communication parameters declaration etc BACKGROUND Macro When the operator terminal runs the application the command will be executed cy clically A maximum 30 lines of macro commands can be executed at once Whatever the screen is the macro commands will be executed The purposes of the BACK GROUND Macro include communication control data conversion etc CLOCK Macro When the operator terminal runs the application the entire macro will be executed once every 500 ms The purpose of the CLOCK Macro is screen control bit setting command control data transfer etc Beijer Electronics MA008
238. rching controller addresses or tag names the seach pattern can be specified If the search pattern is W and Partial match is selected the cross reference will dis play objects with the controller addresses W W0 W1 W20 W60 Object Search ud Ed Kep f by PLC Addr C by Tag Name Search Pattern E Options Exact match fe Partial match Cancel Specifying the search pattern 152 Beijer Electronics MA00822 Instructions 2 10 2 Off line and On line Simulation H Designer supports two types of simulation Off line Simulation and On line Simulation They both offer simulation of the operator terminal in the PC Note The application must compile before simulation Off line simulation is available with all controllers which H Designer offers but on line simulation is only available on some controllers Off line Simulation Off line Simulation can be used to present results on a PC with the same operation mode as between the operator terminal and the controller Analog objects H T60 in off line simulation Off line simulation is without communication with the controller and provides the following benefits 1 Before purchasing you can simulate operation and recognize the operator termi nal functions sufficiently 2 Before downloading you can simulate on the PC to test the application includ ing screen change button functions and display etc 3 Before the completion of the control
239. rd n 1 The characters received will be saved in the low bytes of the words n 2 n 3 n 4 and so on 7 PUT_CHAR gt Sends a character in the low byte of the word n to the COM port Format SYS PUTCHAR N If this service is successful the word n 1 will be set to 1 otherwise it will be set to another value 8 PUT_CHARS gt Sends the characters in the low bytes of the words starting from n 2 to the COM port Format SYS PUTCHARS N The word n specifies the number of characters to be sent and the actual num ber of characters sent is saved in the word n 1 Beijer Electronics MA00822 223 Macros 9 SUM_ADD gt Calculates the sum of a block of words by normal arithmetic addition Format SYS SUM_ADD N The output data is saved in N 3 This feature offers a more convenient application for macros For example the command SYS SUM_ADD 30 here N 30 will calculate the sum of the 30 31 32 33 internal registers N 30 represents the pointer parameter and the internal value of 30 must be 0 N 1 31 represents the starting address of the block N 2 32 represents the size of the WORDS block N 3 33 represents the initial value of the summand and the sum will be saved in this address automatically The command must be set before execution Most communication protocols regulate the initial value of the summand 00H or FFH so please refer to initial value assigned by the vendor
240. re Perform the following steps to create a Numeric Entry button with the Scaling fea ture 1 Display Format Check Scaling Select Gain 0 5 and Offset 2 All other properties are the same as in the previous example Numeric Display Ib IMDOOOO4 Display Format Frame Font gep I Color Character Colo Left Center Right Ekg Color DO Module 2 C Fill Leading Zeroes Vanable Read w100 ST kw Scaling Gain 05 f Word C Double Words a Offset E Format Unsigned Binary ha Integral Digits 5 E dit Fractional Digits 0 r Cancel Numeric Entry properties in this example Range After entering a value the operator terminal will show the input value on the button It is also possible to create a Numeric Display object to display the value stored in the controller Therefore for this example with a numeric entry button if one enters 10 on the operator terminal then the Numeric Entry button will show 10 and the Numeric Display object will show 16 1 16 A Numeric Entry button with Scaling feature and a Numeric Display button Y aX b X is the value stored in the controller Y is the input value on an operator terminal where a 0 5 and b 2 here Beijer Electronics MA00822 75 Instructions 76 2 7 9 Character Entry The function of the Character Entry is used to provide users with alphabetic input and display When the button is clicked an
241. re 16 states If more than 2 bits are to be ON the controller register will store the value of the lower bit Format This is only available when the Value option is selected There are three se lections BCD Signed Binary and Unsigned Binary Read Reads the value from the specified controller register If the location is not specified then the operator terminal reads from the Write location For properties not explained in this section please see the section Specifying Object Properties Example of designing a List object Perform the following steps to create a List object Apple a Banana Orange Lemon Grape H A List object Beijer Electronics MA00822 77 Instructions On the Attributes tab of the List object 1 Shape Select Outlined_2 and White for background color 2 Variable Specifiy the controller register W10 for Write to store the value The controller model is NULL Select Value for Type of State and BCD for Format 2X Attributes State Tet ID LSTOOOO6 SS AE TOTO O Variable Read only Write a 0 Sy Type of State ff Value LSB Format a C wod Double Words Read l Enabled By i List properties in this example On the State tab of the List object 3 Add new states There are 8 states in this object On the Text tab of the List object 4 Enter the text and set up the format of the display Attributes State Tet Language 1 bi Fo
242. re connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS232C COM1 or COM2 RS232C Transmission Speed 9600 bps Set the SW5 OFF if parameters are set Transmission Format Size 8 bit in H Designer _ Set the SW5 ON if parameters are set in Parity NONE the operator terminal Stop bit 1 bit Beijer Electronics MA00822 267 Communication between Operator Terminal and Controller 268 9 28 Matsushita FP Data format and range of the controller registers which H Designer can access Word Device and Bit Device Device Type Block Read Register Type Register Range Aux Addres R W Special Internal Relay External Input Relay External Output Relay Timer Counter PV 127 nnnn 9000 9255 LDnnn fnnn 0 127 8447 The operator terminal can read up to 27 words in one read command The register setting range of FP10SH is nnnnn 0 32764 Rnnnb fmn 0 97 875 b 0 f b 0 e g R1230 nnn 900 910 b 0 f b 0 e g R9100 i ee 639 b 0 b 0 e g L110 f External Input Relay ee 255 b 0 b 0 e g X00 f b 0 External Output Relay Ynnnb f nnn 0 254 2047 Must be 0 or multiple of 16 nnn 0 254 2047 Must be 0 or multiple of 16 The operator terminal can read up to 432 bits in one read command The relay setting range of FP10SH is nnnn 0 2047 PLC port RS232C 9 pin male PLC
243. reater than A2 IF gt Format IF Al gt A2 THEN GOTO LABEL A3 Goes to LABEL A3 if A1 is greater than or equal to A2 IF lt Format IF Al lt A2 THEN GOTO LABEL A3 Goes to LABEL A3 if Al is less than A2 IF lt Format IF Al lt A2 THEN GOTO LABEL A3 Goes to LABEL A3 if A1 is less than or equal to A2 216 Beijer Electronics MA00822 Macros IF AND 0 Format IF A1 amp A2 0 THEN GOTO LABEL A3 Goes to LABEL A3 if the result of an AND operation on Al and A2 is 0 IF AND 0 Format IF A1 amp A2 0 THEN GOTO LABEL A3 Goes to LABEL A3 if the result of an AND operation on Al and A2 is not 0 IF ON gt Format IF Al ON THEN GOTO LABEL A2 If bit Al is ON 1 goes to LABEL A2 IF OFF gt Format IF Al OFF THEN GOTO LABEL A2 If bit Al is OFF 0 goes to LABEL A2 Example Command IF DO ELIF DO ELSE DO ENDIF Description Use an IF statement when you want your macro to choose between two or more options An IF statement consists of the keyword IF a condition to be eval uated the keyword THEN the keyword DO and the keyword ENDIF as shown below IF condition THEN DO statements to be executed if condition is true ENDIF The condition can be one of the following Al A2 Al A2 Al gt A2 Al gt A2 Al lt A2 Al lt A2 Al amp A2 0 Al amp A2 0 Al ON Al OFF The following IF statement structures are provide
244. recipe data RCPW20 RCPW 24 represent right side recipe data Coating equipment 1 Screen_1 Bese ere Reg Bee eee ee ee Liste ama aad anne ane The Coating Equipment screen 3 Download the H Designer file to the operator terminal First select Download Application in the operator terminal then select Application Download Firm ware and Application in H Designer 4 Then upload the recipe from the operator terminal to H Designer Select Upload Recipes in the operator terminal and then select File Upload Recipes in H Designer The recipe will be uploaded to H Designer and saved as RCP 5 Once the above steps have been completed the recipe file can be opened to edit Select Tool View Edit to display the H Designer Recipe Editor dialog box Recipe Editor lame Recipe View Window Help Cha Print Setup Exit Alt F4 The Recipe Editor dialog box Beijer Electronics MA00822 163 Recipes 164 6 Select File Open and select the desired recipe file e g painting RCP Note The RCP recipe files must be uploaded and saved in the operator terminal first the recipe size and number of recipes cannot be modified 7 To edit the recipe select Recipe Open and enter the recipe number to open The coating equipment examples are recipe numbers 1 4 Open Recipe Recipe Mumber il Specifying recipe number 8 The dialog box appears on the screen The data can be edited in the dialog bo
245. reen The Alarm History Table using 16 On Off Buttons to send alarm messages Note that the Alarm State A represents Activate Alarm State C represents Clear Beijer Electronics MA00822 129 Instructions Active Alarm List The operator terminal displays only the active alarms according to its reference bit in controller ON and sorts the data according to the order of the state number All the attributes are the same as for the Alarm History Table object please see the section Alarm History Table Example of designing an Active Alarm List The steps used to create an Active Alarm List are the same as for an Alarm History Table object You must complete the alarm setup first and then specify its properties Please see section Example of designing an Alarm History Table 23 42 666 Emergency Stop 23 42 BBB Wash tank ouver loa T E foe 3 42 12 Shift conveyer mo e The Active Alarm List displays only the active alarms and in numerical order Alarm Frequency Table The operator terminal summarizes the number of occurrences of each alarm which are to be monitored and displayed on the screen All the attributes are the same as for the Alarm History Table object please see the section Alarm History Table Example of designing an Alarm Frequency Table The steps used to create an Alarm Frequency Table are the same as for an Alarm His tory Table object You must complete the alarm setup first and then specif
246. reen Always refresh the screen but only enable its Printed Ares touch keys when itis the top most screen Upper left Position Always refresh the screen and enable its io o s touch keys 1 10 Y1 U Lower naht Position W Need a baze screen na 313 y2 299 99 Background Slide out Meru Analog kad The General tab of the Screen Properties dialog box Screen Number Specifies the number of the current screen Included in the compilation Use this option to compile the selected screen or not This feature provides convenient screen editing but is unnecessary for draft screens Screen Name Enters the name for a current screen Screen Update and Key Function Specifies the types of screen updates Need a base screen Check this option for a base screen A base screen can be the background for various screens This screen is a sub screen Check this option to display the selected screen as a sub screen You can designate the width height location and buttons of a sub screen in this block Maximum width 180 height 160 For further information please refer to section Sub screen Printed Area Specifies the area to print Note that this feature is available only on models with PRINTER PORT Slide out Menu Specifies the slide out menu of the screen Beijer Electronics MA00822 37 Instructions Screen Background Style Tab Screen Properties General Screen Background Style Read Blocks Filled
247. rent Recipe to the controller The recipe data will be saved in the desig nated Recipe Register Block Remember to set the Recipe Write Flag to OFF before re triggering In this example set W1 bit 4 to ON for about 1 second The operator terminal will then write the Current Recipe to controller W100 W104 Status Block When the operator terminal has written a recipe the GSR bit W11 bit 4 will be set to ON automatically Likewise if the Recipe Write Flag is set to OFF the GSR bit will also be set to OFE Once the steps above have been completed the controller can read one cycle of a recipe from the operator terminal Remember to reset the flag to OFF each time in order to trigger the flag Follow the steps above to set the RNR RCPNO Change Flag and Recipe Read Flag values and to read a recipe from the controller to the operator terminal Beijer Electronics MA00822 167 Recipes 3 4 Recipe Controlled by Operator Terminal Using objects on the operator terminal display makes it convinient to control read and write actions on recipe data performed in the controller Please see the chapter Control and Status Block This section uses coating equipment as an example of controlling recipe data in the controller The following is an illustration of the coating equipment setup on the op erator terminal E Coating equipment N Top An illustration of a coating equipment screen in the operator terminal Obj
248. resents them in a trend graph in the operator terminal Suppose that the register is Wn to be read from with three curves in total The data will be read as follows format Value in Wn m is the real sampling points Value in Wn 1 is the first point of Y direction on the curve 1 Value in Wn 2 is the first point of Y direction on the curve 2 Value in Wn 3 is the first point of Y direction on the curve 3 Value in Wn 4 is the 2nd point of Y direction on the curve 1 Value in Wn 5 is the 2nd point of Y direction on the curve 2 Value in Wn 6 is the 2nd point of Y direction on the curve 3 and so on The operator terminal reads all controller registers from Wn to Wn 3m For example if the value in Wn is m 25 sampling points the operator terminal will read data from 76 3 x 25 1 controller registers Control To control the trend graph via the controller Trigger Flag The trigger flag number of the trend graph is 12 15 bits in CFR The operator terminal reads data from the controller and displays the trend graph when the trigger flag turns on Clear Flag The clear flag number of the trend graph is bits 8 11 in CFR The op erator terminal clears the trend graph when the clear flag turns on Display Format Number of Points Specifies the maximum number to display on the Y direction Number of Grids Specifies the number of evenly spaced horizontal grids to be dis played Grid Color Specifies the color of the
249. rlined Specifies whether the text is to be underlined Color Specifies the text color Background Color Specifies the background text color Blink Specifies whether the text blinks Aligns the text to the left center to the right Graphic Tab Bitmap style color etc for each state is defined on the Graphic tab Multistate Button Attributes Shape State Tet Graphic 5 Text Bitmap Bitmap Lowest number01 Low number02 numberl4 ki Medium number03 Transparent Highest number05 Transparent Color Black Part Color White Part Color Arrangement W Keep Original Size The Graphic tab of the Multistate Button dialog box Bitmap Specifies the bitmap to display Transparent Specifies whether the bitmap is transparent Transparent Color Specifies the color of the bitmap when transparent Black Part Color Replaces the black part color only available for monochrome diplays White Part Color Replaces the white part color only available for monochrome dis plays Arrangement Arranges the moveable bitmap to a previous location Keep Original Size Keeps the bitmap s original size Beijer Electronics MA00822 Instructions 2 7 3 Buttons There are 13 buttons in the sub command list for the Push Button menu Icon i Funetion Described in section Described in section section Mj Button Click to set the contact as ON release or Set Button re click still to set ON ae Reset Butto
250. rmat Only available when Value is selected and the formats are BCD Unsigned Binary or Signed Binary For properties not explained in this section please see the sections Historical Trend Graph and Specifying Object Properties Beijer Electronics MA00822 125 Instructions 2 7 19 Alarm Display There are four types of Alarm Display Alarm History Active Alarm List Alarm Fre quency Table and Alarm Marquee To use the Alarm Display objects you must set up the address of the alarm block and its parameters The operator terminal reads the value stored in the controller and dis plays its corresponding messages Up to 512 messages can be set Please see section Alarm Setup for information about setting up alarms The objects are not available on all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models for complete details After completing alarm setup the four types of Alarm Display objects can be used Alarm History Table The operator terminal reads the reference bits in the controller in fixed periods and then activates the corresponding alarm messages Thereafter this the operator termi nal can show the alarm history as an Alarm History Table Attributes Tab Alarm History Table Attributes Text ID JALODOZI O Frame Outlined 2 Status Display Date Format I Time Format Alarm Mumber Color Cancel Status Display Dateand Ti
251. ro 9 Sub macro 70 Sub macra 11 Sub macrao 12 Sub macra 13 Sub macro 14 Sub macra 15 Sub macro 16 Sub macra 17 Sub macro 15 Sub macra 19 Sub macro 20 Sub macra 21 Sub macro 22 Lancel The Sub Macro edit window Beijer Electronics MA00822 131 Instructions 132 2 8 Library Menu There are five options in the Library menu Bitmap Library Font Library Save as Shape Shape Library Manager and Text Pool The main function is to edit import and export bitmaps shapes fonts or text pools 2 8 1 Bitmap Library The Bitmap Library is used mainly to import export and edit bitmaps Select Library Bitmap Library to open the dialog box below Bitmap Library Graphics SIA pg amowg arrow arrows arrows CAW IN DOW S Argyle bmp Chinab asket China ountain Color wheel Flower Flower Basket fruit apple green_bl off 60 4 x30 H 24 bit colors 1808 bytes Compilation landscape Color Ditherina 256 color Preview ows6600 x Preview PwzSumbol Bottom PwsSumbol Clear Import From Import Copy FlipAotate Stretch Trim Export Ta Export Paste Inverse Color Rename Delete The Bitmap Library dialog box Graphics Lists all the graphics available for selection View Displays the selected graphic Compilation Color Dithering Processes the graphic 16 bit 24 bit or JPEG to display the image as viv
252. roller bit device or internal bit to the state of an internal word Format SYS WRITE_Bit N The source address is Q 5 This command is powerful for the random modifi cation of controller data and can be used to set and monitor controller data For example SYS WRITE_Bit 90 here N 90 Execution of this command requires the internal values of 90 91 92 93 94 and 95 N 90 represents the controller station number and the internal value of 90 must be 0 if no controller station is required N 1 91 represents the device type For controller device types please see the chapter Communication between Operator Terminal and Controller for full details N 2 92 represents the low word of the device address Beijer Electronics MA00822 225 Macros 226 N 3 93 represents the high word of the device address N 4 94 represents the auxiliary address if required else set to 0 N 5 95 represents the address of the internal memory to receive the data N 5 95 DATA 1 if the bit is ON DATA 0 if the bit is OFF 8 4 Cautions The last line of code must be the RET command otherwise an error will occur when you compile Except in sub macro the END command marks the end of the macro The CPU will execute other programs after the execution of INITIAL Macro CLOCK Macro ON OFF Macro OPEN Macro and CLOSE Macro For BACKGROUND Macro CYCLIC Macro and sub macro the CPU executes the 30 command lines once The
253. roperties General Connection Device Type Add Connection 1 al HI Address oO Port method used for the connection Multi link This Hbl is a multi link master Mitsubishi Fs Seres Perov Rename Mitsubishi Fs Seres Default Address 0 Baud Rate 3600 Data Bits 7 Parity Even Stop Bits EJ jo Default f Command Delay m Timeout Time Sec Number of Retries Setup of the connection with the first controller Note If SW5 ON on the operator terminal the parameters of the first linked controller must be set up according to the Configuration Table in the operator terminal s System Menu If SW5 OFF the parameters of the first linked controller must be set up according to the Connection tab in Application Workstation Setup in H Designer The switches are described in the Installation and Operation Manual for the operator terminal 3 To add a second controller click Add on the Connection tab and select for example Simatic S7 200 via PPI 1 to 1 Add Connection Adding a second linked controller Beijer Electronics MA00822 207 Multi Channel Communication 4 Enter the addresses in the HMI Address box and controller s Default Address box and make the appropriate selections for Baud Rate Data Bits Parity and Stop Bits New Application s Properties General Connection Device Type Add Connection 1 Mitsubishi Fs Seres Co
254. rt Timeout Time Sec Number of Retries mi Limit data access to Multrlink Common Blocks only Setting up the multi link master Mitsubishi Fs Seres Default Address 0 Data Bits 7 None Stop Bits 1 fi Default o zl 3 Download the edited application to the master operator terminal Setting up the slaves The slave operator terminals do not communicate with the controller 4 Select Application Workstation Setup On the Connection tab select Ethernet Multi link slave port for the connection Beijer Electronics MA00822 Ethernet Communication 5 Set up Master IP Address Common Register Block Common On Off Block CRB Size and COB Size Application Properties General Connection Miscellaneous Logging Buffers Password Device Type Connection 1 Mitsubishi Fs Senes Mitsubishi Fs Seres Default Address 0 Port method used for the connection Ethernet Multi link lave r Flulti link Command Delay me 0 i Timeout Time 5ec Default od Number of Retries f Teeri Application File of Multi link Master am m Limit data access to Multi link Common Blocks only Setting up connection method master IP address etc 6 Download the edited application to the slave operator terminals Beijer Electronics MA00822 199 Ethernet Communication 6 6 Cross Link over Ethernet Data Sharing The Cross Link over Ethernet functio
255. rt control RELAY failed 11 Water pump motor overload 12 Shift conveyer motor failed 13 Auto mode was not action 14 Alarm 14 45 Alarm 15 The Alarm Setup dialog box Setting up properties for the Alarm History Table 5 Frame Select Recessed_1 and Blue for frame color 6 Status Display Check Time and Alarm Number and select Yellow for color Alarm History Table Attributes Text ID 4LO019 Frame Select m Status Display I Date Format W Time Format W Alarm Number Color mall The Attributes tab of the Alarm History Table 128 Beijer Electronics MA00822 Instructions 7 Note that the properties for Message ACK and Screen set in the Alarm Setup dialog box will be shown on the Text tab Select Red for message color and Black for background color Alarm History Table Attributes Ted Emergency Stop Side carriage dow Cooling water flo Gas flow low SD pump overloa Ye DOL motor overlo System paramete Oven temp too h Wash tank overlo Transmiss gear lu None None None None None Back 4 None 2 ackgroun Wi a Color 102 A Hone a None gt The Text tab of the Alarm History Table The operator terminal will read the reference bits in the controller at fixed periods then convert the data into its corresponding messages in sequence and display them on the sc
256. ry Downloading application Download Firmware and Application is used to download the firmware and appli cation to the operator terminal This option has to be selected the first time you download the application Download Firmware and Applicaton Downloading Cancel Downloading firmware and application If the connected operator terminal is not the same as the model specified in the project a message box will appear on the screen Note Remember to execute Compile before downloading Beijer Electronics MA00822 149 Instructions 2 9 9 File Protection File Protection is used to protect the application you must enter the password to open the application file Select Application File Protection File Protection Need a password to open the application file Password Caution If you loge or forget the password it cannot be recovered Remember that passwords are case sensitrve Setting a password for file protection Note This password is used to protect the application file from being modified by unauthorized users and is totally different from the password set on the Password Tab That password provides security against copying and uploading 2 10 Tool Menu The Tool menu is used to manage and simulate the application and to edit recipes There are four options in the Tool menu Cross Reference Off line Simulation On line Simulation and View Edit Recipe 2 10 1 Cross
257. s Change to the Lowest User Level Sets the current user level as the lowest level User Level 9 Acknowledge Alarm Acknowledges the current active alarm when the button is clicked Notify Notifies the specified bit location after clicking the button Security User Level There are 9 user levels the order is 1 gt 2 gt 8 gt 9 For properties not explained in this section please see the section Specifying Object Properties Example of designing a Goto Screen Button In this example clicking the Goto Screen Button will open Screen_3 assuming that the Screen_3 has been created in the project On the Attributes tab of the Goto Screen Button 1 Shape Select Raised 2 Function Select Screen_3 from the drop down list 3 Execution Select On Press On the Text tab of the Goto Screen Button 4 Enter the desired text for example Go to Screen 3 Previous Screen Button The Previuos Screen Button is used to return to the previous screen in the operator terminal Attributes Tab Function Close Previous Check this option to create a Previous Screen Button You can select which screen to open from the drop down list For properties not explained in this section please see the sections Goto Screen Button and Specifying Object Properties Example of designing a Previous Screen Button The steps used to create a Previous Screen Button are the same as in section Example of designing a Got
258. s MA00822 259 Communication between Operator Terminal and Controller 260 9 22 Koyo Direct DL Koyo SU Series TI435 Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Timer Accumulated Counter Accumulated V Memory Link Relays Input Status Output Status Control Relays Stage Timer Status Counter Status Spec Relay 1 Spec Relay 2 Relay Type Input Status Output Status Control Relays Stage Timer Status Counter Status Spec Relay 1 Spec Relay 2 Linker Relays Word word word Word End with 0 End with 0 End with 0 End with 0 nnn octal number 0 177 End with 0 nnn octal number 0 177 End with 0 nnn octal number 0 137 End with 0 nnn octal number 320 617 End with 0 nnn octal number 0 777 End with 0 Cable Drawings 255 a LI 3 BEI Operator terminal to RS232C port on controller CPU240 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows stating ft Set the SW5 OFF if parameters are Transmission Format Size 8 bit set in H Designer Set the SW5 ON if parameters are Parity ODD set in the operator terminal Stop bit 1 bit Comm Protocol Mode HEX TISOFT AUX26 ns Beijer Electronics MA00822 261 Communication between Operator Terminal a
259. s and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS232C COM1 or COM2 RS232 Transmission Speed 9600 bps Set the SW5 OFF if parameters are set Transmission Format Size 8 bit in H Designer Set the SW5 ON if parameters are set in Parity NONE the operator terminal Stop bit 1 bit Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 5 ABB Comli Slave Mode Data format and range of the controller registers which H Designer can access Word Device and Bit Device Register Type Register Range Word IO nnnnn 0 37760 must be a multiple of 8 Word 16 bits nnnn 0 3071 Word 16 bits Relay Type Realy Range Bit IO nnnnn 0 37777 8 bits Cable Drawing HMI COM port 25 pin Operator terminal to RS232 port on controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows Format Controller Setting Operator Terminal Setting Communication Format RS232C RS232C Station No 01 controller sets 2 197 bo F Transmission Speed 9600 bps Set the SW5 OFF if parameters Transmission Format are set in H Designer Set the SW5 ON if parameters Parity ODD are set in the operator terminal Stop bit 1 bit Beijer Electronics MA00822 237 Communication between Operator Terminal and Controller 9 6 Computer as Master Slave V2 Null Modbus
260. set up the communication parameters and the DIP switch as follows Controller Setting Operator Terminal Setting Communication Format RS232C RS485 ri Station No RS232C 1 RS232C 1 based on CPU slot 1 4 RS485 1 RS485 1 Transmission Format Size 8 bit set in H Designer Set the SW5 ON if parameters are Parity EVEN set in the operator terminal Transmission Speed RS232C 9600 bps Set the SW5 OFF if parameters are Stop bit 1 bit Note Operator terminal station no must match YOKOGAWA controller CPU slot no If CPU plugs in the first slot the operator terminal station no must be set to 1 Beijer Electronics MA00822 315 Communication between Operator Terminal and Controller 316 Beijer Electronics MA00822 Appendix A H Designer Features and Operator Terminal Models 10 Appendix A H Designer Features and Operator Terminal Models The following table summarizes the H Designer features and operator terminal mod els H H T60b H T60c aaa e feet Hef es le Numeric Display Numeric Display Ni Yes Yes Yes Yes Time Date and Day of Week Im Yes Yes im La Display Historical Display a Historical Display No Yes Yes Yes Yes Yes fAlarmDisplay no ves ves Yes ves ves ves ves ae Ladders Yes Yes Yes Yes Yes Yes Yes ma akni One master Slaves ul Rane Communicator No Yes es es re Beijer Electronics MA00822 317 Appendix A H Designer Fe
261. sk Instead of Number Displays an asterisk instead of input value for security reasons Beijer Electronics MA00822 65 Instructions Validation and Security Input Min Sets the minimum input value A number less than the minimum in put value will be warned and rejected Input Max Sets the maximum input value A number greater than the maximum will be warned and rejected User Level There are 9 user levels the order is 1 gt 2 gt 8 gt 9 Operation Confirmation Check this box to display a dialog box on the screen asking for User Confirmation during a waiting time of 5 60 seconds For properties not explained in this section please see the section Specifying Object Properties Example of designing a Set Value Button On the Attributes tab of the Set Value Button 1 Shape Select RaisedBase 2 Write Specify controller register W100 to write in Numeric Entry Word Notification Specify B10 and After Writing The controller model is NULL 3 Display Format Check Display Asterisks Instead of Number 4 Validation and Security Select 0 fot Input Min and 2000 for Input Max Check Operator Confirmation to require a confirmation after numeric entry On the Text tab of the Set Value Button 5 Enter the desired text for example Press to set a value between 0 2000 and select White for background color The steps above will create a Set Value Button When the button is pressed the numeri
262. sters which H Designer can access Word Device and Bit Device Register Type Register Range Link Relay en p hex number 0 1FFF end with 0 Word Counter Coil n 0 1023 must be 0 and multiple of 16 F r Data Register Internal Relay M Y n n i Special Register n 0 2047 Special Relay n 0 2047 must be 0 or multiple of 16 Retentive Timer Current i n 0 2047 Word File Register Step Relay S all Y ua Foo n 0 2047 must be 0 or multiple of 16 Latch Relay L n 0 8191 must be 0 or multiple of 16 S Sn Xn n n n n Retentive Timer Contact n 0 2047 must be 0 or multiple of 16 Special Link Register n hex number 0 7FF Word n 0 2047 must be 0 or multiple of 16 Timer Coil Timer Current Value Timer Contact TSn TSn n 0 2047 must be 0 or multiple of 16 s G D Link Register i Relay Type Relay Range Link Relay Bn hex number 0 1FFFF ee al Internal Relay 0 8191 om Input Relay n n n n SN Edge Relay n 0 2047 must be 0 or multiple of 16 Zn ZR Counter Contact u Y ua Beijer Electronics MA00822 277 Communication between Operator Terminal and Controller Relay Type Relay Range Edge Relay 0 2047 Input Relayr n hex number 0 1FFF Output Relay n hex number 0 1FFF Cable Drawings HMI COM port PLC port RS232C 25 pin CABLE 6 pin HMI COM port PLC port R5232C 25 pin CABLE 9 pin PLC port R5422 CABLE 8 pin
263. t Properties Example of designing a Character Display object The following steps are used to create a Character Display object this function can be applied in the factory for product management Bar code reader ASCII result A Character Display object 1 Frame Select Outlined_2 Blue for border color and White for background 2 Variable Specify controller register W20 to read from The controller model is NULL Specify 10 for Number of Characters 3 Display Format Select Dark Blue for character color Beijer Electronics MA00822 87 Instructions 2 7 11 Message Display Objects There are six types of Message Display objects Prestored Message Moving Sign Data Terminal Time Display Data Display and Day of Week Display Note Message Display objects contain only text Indicator Buttons can have both text and graphic however Prestored Message Display The Prestored Message Display object is used to make the operator terminal read the contact state ON OFF or the register value from the controller and automatically display designed content on the operator terminal screen according to the state value Please see the section Multistate Indicator for complete details Example of designing a Prestored Message Display object On the Attributes tab of the Message Display object 1 Frame Select Recessed_1 and Dark Blue for border color 2 Variable Specify W20 to read from Message Display Attrib
264. t Management Statek Text Language 1 W 2 Paste From l Replace By Copy Copy To Test Fool a OF Cancel The State Text Management dialog box 3 Select Replace By to edit You can select the desired text which was edited in Text Pool to display Low limit al High limit zi The following List object displays the text which was edited in Text Pool Beijer Electronics MA00822 137 Instructions 2 9 Application Menu The Application menu is used for general management of the operator terminal and the software You can set up configuration parameters for the operator terminal such as controller type operator terminal type logging buffers and alarm setup In addi tion Compile and Download are also available in this menu 2 9 1 Workstation Setup Workstation Setup is used to set up the parameters of the operator terminal Select Application Workstation Setup to display the following dialog box Application Properties General Connection Miscellaneous Logging Buffers Password Control Block Application Mame W m Panel forkstationr Size H TEO Color Network Status Block Programming Type Macro Address a Controller PLC Default Nul T Data Format Unsigned Binary Printer Start up Screen None Li kad Use external keys Extended Control Block a Extended Status Block W HMult lingual Support ay Number of languages 3
265. t PLC port RS 232C CABLE 9 pin male m A Oy OO MM PLC port RS422 CABLE 8 pin Screw termmals RDA RXD RDB RXD SDA TXD SDB TXD aa SG PLC port RS422 CABLE 8 pin Screw termmals RDA RXD RDB RXD SDA TXD SDB TXD SG PLC port RS 422 25 pin male RDB RXD RDA RXD SDB TXD SDA TXD SG CTX RTX CTX RTX Operator terminal to AnA and AnA AnS AnU CPU port RS422 Beijer Electronics MA00822 275 Communication between Operator Terminal and Controller Communication Format Before connection please set up the communication parameters and the DIP switch as follows station No 00 CPU port Set PLC Station to 00 in H Designer 00 AISJ71C24 S3 Set operator terminal station to 255 i S Transmission Format set in the operator terminal C m NE Checkin ives edno alowed For AISJ71C24 or AJ71c24 set the operator terminal station no to 255 and PLC sta tion no to 0 and connect with controller CPU port To communicate via COM2 please set the DIP switch off and the communication parameters to 9600 8 ODD 1 00 31 AJ71UC24 Transmission Speed 9600 19200 bps Set the SW5 OFF if parameters are CPU port 9600 bps set in H Designer Set the SW5 ON if parameters are 276 Beijer Electronics MA00822 Communication between Operator Terminal and Controller 9 32 Mitsubishi QnA Data format and range of the controller regi
266. t to left When the operator terminal reads the value from a bit location ON OFF or regis ter in the controller the Moving Sign object will display its contents or message ac cording to the corresponding state on the screen Speed Number of Characters Per Shift Specifies the number of characters per shift Time Between Shifts sec Specifies the time between shifts in seconds For properties not explained in this section please see the section Specifying Object Properties Beijer Electronics MA00822 89 Instructions Example of designing a Moving Sign object On the Attributes tab of the Moving Sign object 1 Frame Select DD_Module_3 2 Variable Specify W80for Read The controller model is NULL Select Value and Unsigned Binary format 3 Speed Select 1 for Number of Characters Per Shift and 0 5 seconds for Time Between Shifts Moving Sign Attributes State Tex D IMSGOOOI2 speed mt Number of Characters Per Shift f Select Time Between Shifts sec HE 05 Variable Read hwan z Bk amp Value LSB Saree Unsigned Binary Setting attributes for the Moving Sign object in this example On the State tab of the Moving Sign object 4 3 states are used in this example On the Text tab of the Moving Sign object 5 Enter the desired text and specify the text format for the states Moving Sign Attributes State Tet S Text Good Morning Font F
267. ter Entry button When the button is clicked an alphabetic keypad will be displayed on the screen Note The Alt key on the keypad is used for Shift functionality Beijer Electronics MA00822 Instructions After entering the characters press ENT on the keypad A dialog box asking for user confirmation appears on the screen ABCD cope Pn nije Are you sure nmi Using the Character Entry button with user confirmation 2 7 6 List Each item in the List object corresponds to a designated register value in the control ler The first item represents the register value as 0 The second item represents the register value as 1 and so on When the user chooses one of the items in the list the operator terminal will store the corresponding value in the controller register The corresponding item will be highlighted in the List object Furthermore you can change the value of a controller register by making a selection from the List object The object is not available on all operator terminal models please see Appendix A H Designer Features and Operator Terminal Models for complete details Variable Read Only For display purposes Users are not able to make a selection from the list Write Writes the value to the specified controller register Type of State Value There are 256 states 0 255 The value of 0 represents state 0 the value of l represents state 1 and so on LSB There a
268. the master The master is the operator terminal that communicates with the controller 1 Select Application Workstation Setup On the General tab select the operator terminal model from the Panel Workstation list and the type of controller from the Controller PLC list Application Properties General Connection Miscellaneous Logging Buffers Password Control Block Application Mame Address po Demo E Fanelw ork station Size H TEO Color Network Status Block Programming Type Ladder Address a Controller PLC Default Mitsubishi Fs Series Data Format Unsigned Binary ka Printer Start up Screen None kai kai Use external keys Extended Control Block a Extended Status Block Multi lingual Support a Select Language Selecting operator terminal model and controller model Beijer Electronics MA00822 197 Ethernet Communication 198 2 On the Connection tab check the This HMI is a multi link master box and select Ethernet from the Master Port list Next check Limit data access to Multi link Common Blocks only Application Properties General Connection Miscellaneous Logging Buffers Password Device Type Connection 1 Mitsubishi FX Seres Address oO Port method used for the connection COM MA uilti lirak Baud Rate 3600 Parity kw This Hbl is a multi link master Ethernet Command Delay me Master Po
269. tistate Indicator Adding states for the Multistate Indicator On the Graphic tab of the Multistate Indicator object 4 Select bitmaps for the different states This example does not display text but graphics These graphics are available in the SYMBOLS GBF library Beijer Electronics MA00822 81 Instructions On the Text tab of the Multistate Indicator object 5 Select White for background color The above mentioned steps will create a Multistate Indicator object In this example Numeric Entry buttons are created for the numeric entry written in the controller register The Multistate Indicator objects will display the corresponding states ac cording to the register value Fa 4 Screen_4 The Multistate Indicator object displays the corresponding graphic Therefore for this example of the object if one enters 1 in the operator terminal the Multistate Indicator object will show state 0 if one enters 4 the object will show state 2 if one enters 8 the object will show state 3 The Format selected in this example is LSB please refer to the following table Numeric Entry Multistate 1 O bit is ON the others are OFF 1 bit is ON the others are OFF OJ a A Na a o 82 Beijer Electronics MA00822 Instructions Range Indicator A Range Indicator displays one of several indicator labels depending on the register value The operator terminal reads register values from the controller and a
270. torical Trend Graph ID HTGO0013 Display Format Kia Humber of Grids WW Grid Color Lo x Color Cl Space between two adjancent points Ekg Color 8 va pixels m Data W Curve 1 Edi Logging Butter 1 W Curve 2 Edt Format Unsigned Binary x bw Curve 3 Edit Timer Date l Display Date W CureH4 Edit AG Format Edt Display Time Color as OF Cancel Word No Specifies the number of the words to display on the historic trend curve Minimum and Maximum Specifies the value corresponding to the lowest and high est point on the historical trend curve Pen Color Specifies the color used to draw the trend curve Line Style Specifies the line style of the trend curve Example of designing a Historical Trend Graph Historical Trend Graph Ib IHTGODI3 Display Format Kike Number of Grids 5 PE Grid Color E 1 Color j Space between two adjancent points Ekg Color E pixels Cg Data W Curve 1 Logging Butter 1 i i Curve 2 It Format Unsigned Binary x kw Curve 3 Edit Time D ate Edi Display Date W Curve 4 Edit oa Format Edt i Display Time Color ae DE Cancel The Historical Trend Graph 120 Beijer Electronics MA00822 Instructions 1 First assign logging buffer size and area for Logging Buffer 1 on the Logging Buffers tab in Application Workstation Setup Source
271. ts th troll g to ON A Set Button will be ON whether pressed or released Attributes Tab Function Select Set On Off Button Attributes Shape State Text Graphic ID IETNOOOOG Shape Select Color VWarlable tribe ss Read g Function Set i Reset C Momentary C Maintained Security Minimum Hold Time Sec 0 Operator Confirmation RES Macro Use ON Macro T PS We Enabled By ay Selecting the Set function for the Set Button Security Minimum Hold Time Sec Specify how long to activate the button 0 10 sec onds Operator Confirmation If any changes have been made this dialog box will ap pear on the screen to ask the user to confirm the desired operation A waiting timed of 5 60 seconds can be selected Macro Check the Use ON Macro for a Set Button Click the Edit button to display the ON Macro dialog box ON Macro of S 31 The ON Macro edit window For properties not explained in this section please see chapter Macros Use ON Macro When the Set Button is selected the operator terminal will run the program createdas ON macro This feature is for data control screen display controller register bits initialized and so on For properties not explained in this section please see the section Specifying Object Properties Beijer Electronics MA00822 Instructions Example of designing a Set Button
272. tus Block 184 4 3 2 Addressing Recipe Data Enhanced Operator Terminals Suppose that the number of recipe N 20 a recipe size m 100 words To edit an address one needs to set up the current recipe N RCPNO The operator terminal will display the corresponding recipe data 1 Enter the recipe number N in RCPNO or change RCPNO using the controller The operator terminal will display the corresponding recipe data For example if RCONO N 5 RCPW0 RCPW99 displays the data correspond ing to the fifth recipe if RCPNO N 7 RCPW0 RCPW99 displays the data corresponding to the seventh recipe 2 Another way to edit the corresponding recipe register data is to use the absolute address Suppose that an address is greater than RCP W100 the corresponding recipe address will display the Nth recipe data RCPW100 RCPW199 represents the first recipe data RCPW200 RCPW299 represents the second recipe data RCPW2000 RCPW2099 represents the twentieth recipe data Addresses greater than RCPW2099 are invalid So RCP234 represents the second recipe data 35 words and RPCW 34 in RCPNO 2 Beijer Electronics MA00822 Control and Status Block 4 4 Time Block 4 4 1 The Operator Terminal Writes to the Controller To make the operator terminal write the current time and date to the controller the Time Block has to be defined for the application The time block is a block of three words in the controller and its format is
273. used to control form feed on the printer connected to the oper ator terminal Set the bit ON and the printer will change paper The controller requires that the bit be reset if the operator terminal is re assigned to form feed and it needs enough time for operator terminal detection 174 Beijer Electronics MA00822 Control and Status Block Bit 3 Hard Copy Flag This controller bit is used to control the hard copy function for the printer connected to the operator terminal Set the bit to ON and the printer will print the current screen The controller requires that the bit be reset if the operator terminal is re assigned to print a hard copy and it needs enough time for operator terminal detection Bit 4 Recipe Write Flag from operator terminal to controller This bit is used to write the recipe from RAM to the controller This is only support ed by operator terminals with a recipe function Set the RNR Wn 5 to write the recipe set the bit to ON and the recipe will be written to the controller The controller requires that the bit be reset if the operator terminal is re assigned to write another recipe and it needs enough time for operator terminal detection N26 HOUF H6616 H1 HOUF Ku H5 H11 HBB1B H 188 H30 c TO KO Hi j PLC N20 writes the data from terminal 4th recipe to PLC 11 bit 4 is Recipe Frite status bit Bit 5 RCPNO Change Flag This controller bit is used to change the content va
274. utes State Text ID IMSGOOO45 Frame Select Color Variable Read wed gd C Bit amp Value LSB PE Unsigned Binary Setting attributes for the Message Display object in this example On the State tab of the Message Display object 3 Add 8 new states 88 Beijer Electronics MA00822 Instructions On the Text tab of the Message Display object 4 Enter the desired text and specify the text format Message Display Attributes State Ted 5 Text Strawberry Font Esp Blueberry Apple Banana Color y Starfruit Back d ome ackgraun ey Color a Blink Adding texts for the 8 states in this example The above mentioned steps will create a Prestored Message Display object When the Multistate button under the Prestored Message Display object is clicked once the operator terminal writes the command to the controller for state change When the state is changed the Prestored Message Display will display the corresponding state Apple Blueberry Strauberry Prestored Message Display objects used together with Multistate buttons For instance when the state is Blueberry the Prestored Message Display object will display the corresponding content Blueberry When the state is Starfruit the Pre stored Message Display object will display the corresponding content Starfruit Moving Sign The Moving Sign object is used to display content one by one from righ
275. utomati cally calculates the difference according to the boundary value of current states Then the contents of current status are displayed on the operator terminal screen according to the calculated results Read value from controller gt Calculated result gt Display the corresponding states Ranges Variable Limits Specifies the minimum value of the ranges to be read from registers following the read location If the Read address is Wn the minimum value of Range 0 is stored in Wn 1 the minimum of Range 1 is stored in Wn 2 and so on Constant Limits The minimum of the ranges is constant Range The number of ranges 15 ranges at most Minimum The minimum of ranges Note Number of ranges number of states 1 For properties not explained in this section please see the section Specifying Object Properties Example of designing a Range Indicator object FA 4 Screen_4 SUCCESS Average Value is Value is between less than 2900 2999 2 088 The Range Indicator object On the Attributes tab of the Range Indicator object 1 Shape Select Raised_2 2 Variable Specify controller register W90 to read from The controller model is NULL Beijer Electronics MA00822 83 Instructions 3 Ranges Select Constant Limits and minimum 3000 of Range 0 minimum 2500 of Range 1 Range Indicator Attributes Shape State Text Graphic ID IRIOOOZA Ranges Shape f Variable Lim
276. utput Relay nnn hex number 0 7FF end with 0 nnn hex number 0 7FFF end with 0 Internal Relay nnnn 0 8191 must be 0 or multiple of 16 Special Relay nnnn 9000 9255 9000 must be multiple of 16 nnnn 0 2047 must be 0 or multiple of 16 Flag nnnn 0 2047 must be 0 or multiple of 16 Data Register Dnnnn nnnn 0 8191 Special Register Dnnnn nnnn 9000 9255 File Register Rnnnn nnnn 0 8191 Link Register nnn hex number 0 FFF Peripheral Input nnn 0 7FF must be 0 or multiple of 16 The operator terminal can read up to 64 words in one read command Input Relay End with 0 Link Relay Bnnn nnn hex number 0 FFF End with 0 Internal Relay Must be 0 or multiple of 16 i 9000 9255 The last 3 digits must be multiple of 16 Latch Relay Must be 0 or multiple of 16 Flag Must be 0 or multiple of 16 Timer Set Must be 0 or multiple of 16 Timer Coil Must be 0 or multiple of 16 Must be 0 or multiple of 16 i Must be 0 or multiple of 16 i 0 7ff Must be 0 or multiple of 16 The operator terminal can read up to 512 bits in one read command Q a 5 x 2 3 a or 2 mo og 70 a SIE D S lt o ZI D S lt Must be 0 or multiple of 16 Must be 0 or multiple of 16 Peripheral Input Relay 274 Beijer Electronics MA00822 Communication between Operator Terminal and Controller Cable Drawings HMI COM port PLC port RS 232C po PLC port RS232C 25 pin CABLE 9 pin male i 25 pin male samo nnd HMI COM por
277. ve is true the minimum size is two 6 The size of the control block is the minimum size plus the size of the user area Beijer Electronics MA00822 179 Control and Status Block 4 2 Status Block The Status Block is a block of contiguous registers in your controller that display sta tus information from the operator terminal For example you can get the cur rent screen number from the first word of the Status Block The members of Status Block are shown in the following table Screen Status Register SNR D10 General Status Register GSR Logging Buffer Status Register 1 LBSR1 D12 Logging Buffer Status Register 2 LBSR2 Logging Buffer Status Register 3 LBSR3 D14 RCPNO Image Register RIR a2 For example if the status block is W10 and the size is 6 words the operator terminal will write the status data of the current screen to W10 W15 4 2 1 Screen Status Register When a screen is changed in the operator terminal the controller sets its Screen Sta tus Register SSR to the number of the new screen Consequently the controller can identify the current screen by reading the SSR The value of the SSR can be in BCD or binary format 4 2 2 General Status Register The components of the General Status Register GSR are shown in the following table bit 0 bit 15 Bit 0 Password Level Status not available for applications configured to monitor alarms Password Level Status not available for
278. x The main function of the Auxiliary Keys is to create the attributes of external but tons The buttons defined on the Auxiliary Keys tab are only available for the current screen If the F1 key is defined in screen 5 as Goto Screen 1 this function is only available on screen 5 Click the Function key to display the function assignment dialog box Function Assignment Eq Function Reset Button Momentary Button Maintained Button Multistate Button Set Constant Button Set Value Button Increment Button Decrement Button Gota Screen Button Previous Screen Button Acton Button Cancel The Function Assignment dialog box Note This function is not available for all operator terminal models please refer to Appendix A H Designer Features and Operator Terminal Models for complete details Beijer Electronics MA00822 41 Instructions 42 Sub screen A sub screen is a screen that is smaller than the normal screen The operator terminal displays a sub screen in the center of the screen without destroying the existing dis play and adds a raised frame to it automati cally The following are the steps required to create a sub screen 1 Create a new screen enter the screen name and number 2 Open the Screen Properties dialog box and check the This screen is a sub screen box Enter the width and height of the sub screen 4 Specify the position of the sub screen display shown on the display center
279. x Note that the count for editable data is contained in data size After editing select File Save to save the data For example Recipe 1 is 1 0 0 0 3 Recipe 2 is 0 1 0 0 2 etc ME Recipe 1 Double Word eje sojnja oso Z Editing the recipe data 9 Select Download Recipes in the operator terminal and then select File Down load Recipes to download the recipe file Finally select Run in the operator terminal The operator terminal will display the recipe filled with the same data as displayed on the screen in H Designer The coating equipment example includes painting methods and time Coating Equipment Top 1 Bottom 0 Left 0 Right 0 The recipe data in the operator terminal Beijer Electronics MA00822 Recipes 3 3 Recipe Controlled by Controller Once the recipe is completed the controller can be assigned to control the recipe through the communication link between the controller and the operator terminal The controller can read write the recipe from to the operator terminal This section will introduce the controller setup and corresponding execution related to the oper ator terminal For an introduction to communication between the controller and the operator terminal please see the chapter Control and Status Block for complete de tails The main steps to read a recipe from the controller to the operator terminal 1 Set up two continuous blocks one is the control block the other is
280. y have a fixed sampling period or the controller may initi ate that data be read from the specified registers and then store the data in the logging buffers in the operator terminal memory After a sampling period the data is then converted to continuous curve s and displayed on the operator terminal Historical Trend Graph Ib HTGO0 3 Display Format ake Number of Grids 5 pec Grid Color A Color L li Space between two adjancent points Ekg Color E a nisel s Recessed 1 J m LDL Data W Curve 1 Logging Butter 1 i Curve 2 It Format Unsigned Binary x W Curve 3 Edit Time D ate Edi i Display Date kw Curve 4 Edit oan Format Edt i Display Time Color O DE Cancel Data Logging Buffer Specifies the number of the logging buffer where the historical data is stored numbered 1 to 12 Format BCD Signed Binary or Unsigned Binary Time Date Display Date and Display Time Checking the boxes displays date and time click Format button to setup Color Specifies the color of characters to be displayed Display Format Number of Grids Specifies how many evenly spaced horizontal lines shall be dis played Grid Color Specifies the color of the horizontal grids Beijer Electronics MA00822 119 Instructions Curve 1 4 There are four curves to be selected Click the Edit button to display the following dialog box His
281. y its prop erties Please see section Example of designing an Alarm History Table Emergency Stop Side carriage dow Cooling water flo Gas flow low SD pump over load DOL motor overloa system parameter Oven temp too hi Wash tank over loc The Alarm Frequency Table displays the number of occurrences of each alarm 130 Beijer Electronics MA00822 Instructions Alarm Marquee The operator terminal displays alarm messages from active alarms as a moving sign All the attributes are the same as for the Alarm History Table object please see the section Alarm History Table Example of designing an Alarm Marquee The steps used to create an Alarm Marquee are the same as for an Alarm History Table object You must complete the alarm setup first and then specify its properties Please see section Example of designing an Alarm History Table rgencu Stop C Tia AB The Alarm Marquee displays the active alarm message as a moving sign on the screen 2 7 20 Sub Macro A Sub Macro is the macro s sub application The main function is to call commands directly Some common functions or operation commands which are used frequently can be edited and saved as sub macros for call commands There are 512 options for a Sub Macro please see the chapter Macros for complete details Open 5ub Macro Sub macra 2 Sub macro 3 Sub macra 4 Sub macro 5 Sub macro 6 Sub macro 7 Sub macro 8 Sub mac

Download Pdf Manuals

image

Related Search

H Designer h designer bag h design group designer dresses at nordstrom h designs h design hamptons h design group llc h design hydraulic engineering group pty ltd h design pte ltd h design springfield mo h design hydraulic engineering group h design salon minneapolis h design hydraulic engineering h design group springfield mo

Related Contents

Manual do usuário  Samsung ML-2010 Manual de utilizare  "Gas Insulated Switchgear (GIS) Visión tecnológica hacia  Roland S-1608 User's Manual  小型転倒ます雨量計:WJ-30  USER MANUAL  PDF-AURA PERSIST-AURA PERSIST  Buffalo AirStation WZR-HP-G300NH2  PDF (BOE-A-1986-26651 - 2 págs.  M18i UM - Cryogenic Control Systems, Inc.  

Copyright © All rights reserved.
Failed to retrieve file