Home

Unipro UGENE User Manual

1. tent C besten sione O 12 pe eae gm Rap 7 ME mas E77 TUIS Weight Matri E Unipro UGENE User Manual Version 1 11 3 In the search dialog you must specify a fle with PWM or You can do so by pressing the browse button 1 and selecting the fie Alo you use the secl interface to choose 3 JASPAR matrix by pressing the Sch JASPAR database Button Dj Alternative way to specify the position weight frequency mati ito create a specife one from an alignment o fle with several sequences with the huld new mutis taal After the profi the matris is leaded you can adjust the thresho value 3 The threshold seta the minimal entity scr for a paaa The ore the score i the more iia related the ard eger By changing the threshold you can filter lew searing euts Ifthe loaded matri ie position frequency matris you must also specify the algorithm to build the corresponding position weight matrix which wil represent the traction factor There are four grits available pr totae P Al you can ad a selected mati with the specified Minimal coe and the Algerithen to the matrices lat To lo it select the matrix and other options and presa the to queue button The plugin wil search wth al mater speci in the at You can use the Save at button to export the ist of matrices toa
2. MESA iem em Ee E f eem __ eet As you can see there s an index fer each sequence You can export the indexed sequence by selecting the Cerresponding index and the Export gt Save selection to 3 new fle context menu tem 17 Creating and Using Index Fi Unipro UGENE User Manual Version 1 11 3 You can at fiter the indexes ising the green arrow deis har ected De Suse Sl HE tte a mai Chapter 4 Basic Functions 5 Sequence View 5 1 Sequence View Components The Sequence View ia one of the major Object Von in UGENE aimed to visualize and edit DNA RNA or pola s quences along with tol properties annctations chromatogram 3D models statistical dita ec each UGENE analys the le content and automatically pens the most appropriate view activate the Sequence View opem any fle with at least one sequence For example you can use the SUGENE data 1 EMBL AF T1470 onis provided with UGENE After opening the in UGENE the Sequence View window appears ir the view opened you ean set a act of new buttons in the toolbar area The actions provided by these ar availible for al equences opened In the vien Io the picture below these buttona are pointed by he lal ection Below the tolto there la an area for a single ar
3. auc cmm e dnce IIT BE Cost rut te wore imde es nae Se Core 58 Y a tak has fished without err the notation is blue I n has during the task ection the red open a task report dick on the corresponding notification Set an example of a task report blow Basic Functions Unipro UGENE User Manual Version 1 11 3 Task report DigestSequenceTask Digest into fragments murine near ii rm 1 02 o da uoo e To emote notification from the Notations popup window click the notification cos baton Note that you can dik the dip button ofthe Notifications popup window ta show the window als top 4 3 Main Menu Overview Description A secl project lend operation Example create open ete a project open document access remote database to download a fle Tons Vac actions anced wh the active window Example export remove edit analyze a sequence using diferent plugins for the Se View edi ln change the consensus mode or the Agamane ir Settings Applicaton plugins and tol settings Tools Various tos independent af an acie window Tha men 8 by dicen plugins Example HMMER2 HMMER toos SITECON Designer Window of ative windows and basie manipulations witk the wis Example close winds window select net window Hag
4. ent ofthe alignment int Thi parameter he Pratt index check this bs to uae an inde le tnd of a suce reference sence Al SAM output always save the output lei the SAM format the option disabled for BWA Short reads each added short read a small DNA sequence fle At least one read should be added You can alto configure other parameters They are the same as in the original BWA jou can read dta description of the parameters on the EWA mansl page Sect one of the Following parameters that correspond te the option in the original BWA 0 reso edit distanca An integer value shouid be input Missing prob rn the faction of missing alignments given 2 uniform base errer rate A fost ale Max gap opens o maximum number of gap opens en leiten algorithm for constructing BWT indes It implementa three derer 1 designed for short reds up to 200p with low errar rate lt 36 It does gapped global vc rende supports paired end and one of the fastest shert read alent gorithms to date whe aso visting suboptimal 2 la designed far long reada with mare errors t performa eui Smith Waterman e to find high scoring local hits Algorithm implemented in EWT SW On queria BWA SU wer and lei accurate han the B agri but long renda i prin diy doe not wark for long geno
5. Bre uiu enn pm the Sequence details ve sing the Sequence overview m Showing and Hang Translations 5 7 Information about Sequence Content information about a sequence can be found on the ffi tab nthe Options Panel AN information contentual te shows tastes about the curently selected region on the selected sequence The tab cde information about Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 Sequence length Characters Dinucleotides occurrence sequences with the standard DNA and RNA alphabets E 25 E Be ae endo To copy the statistical infermation about a sequence select it on the Options anl and choose the copy item in the canes men or use the Cc r1 E short 37 Information about Sequence E Unipro UGENE User Manual Version 1 11 3 5 8 Manipulating Sequence Going To Position postion the glabal actiona toolbar tse the Go to position context menu or the Actions main menu Ale you can the shortcut Cert 5 8 2 Toggling Views Yl pol toate the Sequence overview Sequence oor view and the Sequence detalls ven vty sing the button inthe toolbar The sequence can be removed fom the view using the same menu Once you remove the last sequence in the viem the automaticaly closed
6. Dait ao Note The HMM build tal does automatically calibrate a profe Use the HM calibrate tool ta calibrate 11 13 2 Calibrating HMM Model HMM Calibrate The HMM calibrate too reads a HMM prof fle scores a large numberof synthesized random sequences with it fs an extreme value distribution EVD to the histogram f those cre and resaves he hr Fe including the EVD parameters To avoid modification of the orginal you can select a new location fer the calibrated profile e emman d Dees ithe aha terendam spree t D estin menn isset te TUR TE Unipro UGENE User Manual Version 1 11 3 11 13 3 Searching Sequence Using HMM Profile HMM Search The HAI search toal a HMM profe a and searches the sequence for significantly similar sequence The sequence mast be selected in the Project View or Here mast b a active Sequence View window opened selected sequence ts nucleic and the HMM profile built for amio alignment the sequences automatically trate and 6 translations to search in Ifa HMM prie is fer nucleic alignment the search is performed fer both strands direct and complement a E CAEN O rarasan e uu ED m Lr erent neh taske ante her pe n s search are stored as sequence annotations in the Genk format Warning Al HMM2
7. The following values ae available 0 both strands leet strand 1 complement strand Example 12 2 25 Fetching Sequence from Remote Database Task Name Fetches a sequence from a remote database Parameters database to rod from String Required in semicolon separated list of resource IDs in the database Sting Required Zavedi r directory to store sequence Fles loaded from the database String Optional Example 12 3 Creating Custom CLI Tasks The predefined tasks actualy the Warkdlow Designer schemas stored in the UDENE data cndline di Folie the instructions in the Workflow Designer Manual how ta create a schema and t run it fram the command ne You may find useful the following video tutorial devoted to the creating of a custam console command Creating custam console command MUSCLE alignment with various output Format T23 Creating Custom CLI Tasks E 13 APPENDICES 13 1 Appendix A Supported File Formats No the fies 19 1 1 Specific File Formats able trend and write Fles compressed with Unix Linux You don t have to unpack Tie tora ES Comment abl abi A chromatogram Fe format See Chromat ACE A e or string data about genomic Ses alte Alignment See Rett AW Binary compressed SAM format Ses
8. Greg aaa armes 81 sme vocato Nagevenmetdtewne a m ED aeos n Margot nary oot nahet 8 ce o Ert te Clipping for poor regions parameters Cipeing of a poor end region of a read is controlled by parameters Base quality fer clipping Ce the specihed value should be more than 5 and Clipping range 1 the specified value should he more than 5 Quality cence score of an overlap parameters Base quality cutoff for diferencas 9 an overlap contains a diference at bases of quality values land q2 then the score at the difference m min q1 62 b where the speci value The speci value mare than 15 The diesen ware of an overlap ia the aum o scares at each difirence Max gare sum at ferences 4 remove an aveo its fence score ia gester than the spec value The specified value should be more than 20 Sry cre of an overlap parameters The follwing parameters are used t the sary atre of an overlapping alignment Match arare factar a match at bases of quality values q1 and q i given a sore fof m minal q2 where m the specie value The specified value should be more Mismatch score factar n mismatch at bases of quality values ql and q2 i en a score of n uli q2 where wis the specife value The specified value shoul be les pn Gap penalty factor a ba
9. sels aF species that occur among the input trees more than specie facon f the Ue ee Fraction puemeer below The Sit the Majority Rule consensus extreme cues of the MI consensi being o fractions cf 1 and 05 respectively Majority Rale specifies that a set of species included in the consensus tree if i present in mare than half ofthe input trees Fraction becomes available when the Consensus type parameter isset to MI Species the action Save tree to Fle to save the tre built Pres the Build button to build a re with the parameters elected 7 4 2 MrBayes The Building Phylogenetic dialog fer the MrBsyes method has the following view Chapter 7 Alignment Editor Unipro UGENE User Manual Version 1 11 3 EE mS mm There are to step to phylogenetic anas using MrBayes 1 Set the evolutionary made 2 Run the Markov chain Monte Carlo MMC aralisys evolutionary model defined by the folloaing parameters Substitution model specifies the general structure of a DNA substitution modal Ts parameter is available or the mucleotide sequences It correspond to the setting of MrBajes You may sect eof the following haa GTR ate spain the docte aminoacid model This parameter available for inca sequences The fling model slate edebat Building Phylogenetic Tree
10. tools werk anly with fles that contain a single HMM model LI Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 14 HMM3 The HMM plugin ook based on the Sean Eddy s HMMER2 package While working on thi plugin we vere guided by the folowing principles Make the HMMERS tole scesite to a wider user audience by providing graphical interface for all up utile for most of the platforms Be compatible with the original HMMERS package Create the high performance soliti using modern multi core processors The current version of UGENE provides user interface for three HMMS toole HMMS build HMMS search and Pheer each Inthe original program the corresponding command are and per To access these tools select the Tool HMMERS tal submenu f the program main menu son EP Meere We Highly recommend reading the original HMMER documentation to learn haw to uie lies provided by the 11 14 1 Building HMM Model HMM Build The bull tool is used to ula new prole from a multiple aliment You can ae any alignment supported by UCENE The output HMM pofle format is compatible with the package but it ot compatible with he HMMS build automatically calibrates the target model DX Ww Unipro UGENE User Manual Version 1 11 3 The HMM configuration dalag provides an easy way to set appropriat
11. 11 7 Repeat Finder The Repeat Finder plug provides a too to search for diaz nd invert repeats n a sequence Ala i to search for tandem repeat 11 7 1 Finding Repeats Usage example Oper a DNA sequence inthe Sequence View and select the Analyze contest ment item n a pa i The dialog will appear that alos specifying repeat parameters and the annotations table document ta save the ruts ine emn tea we et tty EXE Fines diripere E to sien O stum z gs arene dialogues status ine pays appoimate repeats number that wil be found with the curent settings The Advanced tab provides additional repeats finding options m Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 O e e sero have rre v 1 EI Pic ocium erudire di ser ta opt The found repeats are saved and displayed as annotations to the DNA sequence wx wed E ET TT 11 7 2 Finding Tandem Repeats To End tandem repeats select the Analyze Find tandems contest menu itm in the Sequence View window In the opened dialog you can specify the tandem search parameters the region to search in ad the result praetor TU Repeat Finder Unipro UGENE User Manual Version 1 11 3 Tend
12. Prove multiple sequence alignments MSA emat Ses Alignment Elita EWT A Bowie prebuit indes FE See niso Bo MEL oat or staring sequences and iir See ala Sequence View FASTA TR tis ties fnt Ore af the and impr sequence He See aha Sequence View FASTA fermat used 1o sore 3 sequence and conesponding quality sore Teas originally developed at the Wellcome Trust Sanger Institute See Seguen Genbank T ER am A reh format er staring Saunas and a sociated annotations See Seen E Unipro UGENE User Manual Version 1 11 3 oF E Tic Gene Finding Format GFF format aed to sre and annotation See Seen Dr A format to stre HMM profila See siso HIN HM MMDE E ASN I format ued by the Molecular Mode ing Database MMB 3D Structure Vien Tu sequence alignments e format ITT meg meger eile sequence alignments Fle at See Algomert A tee Forma Sen ale Bung Phyagenet Tie Ph Nes poi A mulie alignment and ehe res fie ferma See Editor Building Ph PDE The Protein Data Bank format alana te the 3D structure of the sequence Ses iD Structure Ven SORAWP tss sequence
13. Several constans calculation gira Using the Alignment Edi you ean Perform multiple sequence alignment ung integrated MUSCLE and Klin algorithms Edt an alignment delete copy paste symbola sequences and Buld phylogenetic trees Generate arid proie B ld Hidden Markov Model proles to use with HMM2 HMM3 oo Unipro UGENE User Manual Version 1 11 3 7 1 2 Alignment Editor Components Here ia the default layout of the editor The Aligoment Editor components Sequence area This the main component of the editar It displays aligned sequences The upper part of the Sequence area ia the ruler which shows the coordinates of the currently vise sequencen Consensus area This component i stunted above the Sequence are M shows the consensus sequence for the curent alignment calculated wang currently selected algorithm Sequence ist This component i located in the left part af the Sequence ors It shows names of the comesponding sequences in the Editor toolbar The toolbar contains sharteuts for important editar actions such as Und Redo Zooming and others Sequence oftsets These are the ofits for the frst and the lst vile base for each alignment row Note that the oft vale dos t include gapa For example lets assume that the coordinate ofthe frst visible base af the row is N but the row contains K aps before the potio N The starting fiet value wil be The same rule tue for the ending fet Yeu c
14. Unipro UGENE User Manual Version 1 11 3 tum eline The flowing parameters ae common for nucleotide and amino acid sequences Fate sets the madel for among ste rate variation Select one of the following equal no rate variation across sites rates acri sites The rate at a site drown gamma The gamma distribution has single parameter that describes how much rates proportion of the sites are invariable invgamma a proportion af the sites are invariable while the rat for the remaining sites dise rom gamma distribution Gamma the number of rate categories for the gamma distribution You can select the following parameters for the MCMC analy Chain length sets the number of cycle for the MCMC algorithm This should be big number as you want the chin to frat each stationarity and then remain thre for enough te ta ale lots of samples frequency species how often the Markov chain is sampled You can sample the chain every but this ret in vr large output fle Burn in length determines the number of samples that will be discarded when convergence diag are Heated chains number of chains will be in Metropolis coupling Set 1 to use usual MCMC anis chain temp the praeter heating the chains The higher the temperatur
15. se To show the labels again check an appropriate item in the submenu 9 4 2 Aligning Labels To align tree label press the Align Labels sticky button on the toolbar ar the Actions Align Labels item in the main meni Set the ampie of aligning labels below LI Chapter 9 Phylogenetic Tree Viewer Unipro UGENE User Manual Version 1 11 3 9 4 3 Changing Labels Formatting Ta change formatting of a tee labels select either the Formatting toolbar button or the Actions e Formatting ite thei es The Labels Formatting dialog wl appear Here you can select color font size and attributes bol ite et of the labels Note that when cade has been seed the abel formatting settings are applied ta the clade only 9 5 Zooming Tree To change the ize of a tree the Zoom In and Zoom Out toolbar button You can the Restore Zooming Button ta the deta alee Or e the corresponding items in the Actions maln menu See abo Zooming Clade 9 6 Working with Clade This paragraph deserts howto leta clade and modiy it s appearance 35 Zooming Tee Unipro UGENE User Manual Version 1 11 3 9 6 1 Selecting Clade Ta sect dade elk on oot node You can se that the corresponding branches are highlighted Ta select several clades at the same time hold the Shi t key and clik an the root nades of the clades 9 6 2 Collapsing Expanding Branches You c
16. sequences For ench sequence a aller toolbar with actiona Fr the sequence and the aes slate Sequence overview Shows the sequence in whale and provides handy navigation in the Sequence zoom view and the Sequence zoom view Provide exible tos for navigation in large annotated sequence regions Sequence details view A soclenertary component of the Sequence overview It ia used to show sequence content Without zooming Annotations editor Contains tah t manipulate annotations for a sequence Unipro UGENE User Manual Version 1 11 3 Sequence zoom view eta v ERENI Fe een drei rome t nte Annotations sator An example of the Sequence View with several sequences Vou can change the focus by ceking the corresponding sequence AN sequences that at ba focus have the sequence name and dead Th botoen ares of the Sequence View is the Annotations editor I contains a te e structure of al annotations valable for al sequent sm in the Sequence and ean used perform various actions a new annotation modify the esting one group sert ele Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 5 2 Global Actions 1 a td prodr pali et said pst tcu at htm na Mitac rap f tma Seene View Sn thi para de 5 3 Sequence Toolbar A brief description oft
17. 8 2 Browsing and Zooming Assembly 8 2 1 Opening Assembler Browser Window x 7 p span Exch as object correspond to an imported contig When you double cick on an as abject new Assembly Broses window with he data opened A windon the ia assembly abject in the at opened automatically after the import 8 2 2 Assembly Browser Window Tie opened window contains the list oF uel ever regions of the aeri Chapter Assembly Browser Unipro UGENE User Manual Version 1 11 3 boe xos o ar ETT ns etch crase one a te a vee Hor rz pa Rel Ral 15 imi 15 Note that for large assemblies i may take some time to calculate the overview and the wel covered regions To sce the reads either select region fom the at er zoom in fer erample by clicking the nk above the velicovensd regions or by rotating the mouse wheel You can aleo use the hotkeys Ties about hotkeys are shown under the list of well covered regions To lar about vale hotkeys reler to eil Holes 8 2 3 Assembly Browser Window Components An Asembly Browser window conste of Assembly Overview By default shows the whale assembly overview Can be rested provide an overview of an assembly pare Reference Area Shows the refines sence Consensus Area Shows the consent sequence Ruler Shows the coordinates
18. eame pe E sten en randen Josefa ipit several quar names separated by comma then the frt found a talon into account and dur on the annotation E Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 5 104 Cr ing and Editing Qualifier To add a qualfr to an annotation dct it in one of the Sequence View suis and press the Insect he use the Add Quale contest mena or the Action main mena cee ee ee EXE gt mare cepa stl EI quie n v ES es dem llsreamuepm ac A en EY eoo E E m Mn B 310 Manipulating Annotations 7 Unipro UGENE User Manual Version 1 11 3 The dialog will appear Here you can specify the name and the value o the qualifier You can use the F2 hey to rename a qualiter To edit a qualifier select the qualifier and pres the F4 key or use the Edit qualifier context menu item T AC nes esam run EN EN am 5 10 5 Adding Column for Qualifier pose t add a column with the qur values to the Annotations eda add the colum iet the The ater are cour quali cante mena ten Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 5 10 6 Copying Qualifier Text se the Copy cule he ame text quale context mena to capy the qualifier value 5 10 7 Deleting
19. 3 Capturing Screenshot sea sequence toolbar Capture sereen button to save a screenshot of the sequence Available He formats are jpg png and ti Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 5 8 4 Zooming Sequence To zoom a sequence in the Sequence zoor view you can use one af the zoom button on the sequence toolbar There are standard Zoom In and Zoom Out buttons Additionally you can zoom to selected region using the Zoon to Selection To restore the dul view ofthe Sequence zoom view when the sequence not use the Zoom to Whole Sequence button 585 Cre can number of additional ules by Ruler Create sow ruler context menu ite setae n Ay r Ya T JA EM Iu 1 omm 5 8 6 Selecting Amino Translation The default value for the genetic code i read by UGENE from the sequence fle when it is available You can select he genet code for the sequence sing the Amino translation men button on the sequence toolbar Note All analysis routines ike HMMER OFR finding ete wil use this code by default Manipulating Sequence Unipro UGENE User Manual Version 1 11 3 Rn etti 16 pn nelle 2 Sarena tans dea 5 8 7 Showing and Hiding Translations Yeu ean turn on off the direct and complement amio translations visua
20. Later the list can be leaded from the fle using the Lead at button The rest options are standard sequence search options the strand and the sequence region where to search for snatches After specifying the neca options preas the Search button The found wil appear in the dialog table The corresponding dent scares are in the Score column E E dern Miti E The regions found by the weight mati algorithm can be saved as annotations to the DNA sequence in the Genbank format by pressing the Save as annotations buta After saving the with resulting annotations wi be automaticaly added to the curent project and the wil be added to The original sequence Note that in of selecting JASPAR or UNIPROBE matis the resulting annotations vill cantain the matrix properties Ez Chapter TI Plugins Unipro UGENE User Manual Version 1 11 3 umm Seva e Esra emote trots Pini BE pre Germ enirn 11 20 1 Searching JASPAR Dat Pres the Seach JASPAR database button in the Weight matrix search dialog The fling dialog wil appear mum Weight Matri zu Unipro UGENE User Manual Version 1 11 3 Here the matices are divided into categories and you can read detailed information af a matris which i represented by its properties It could help you to choose the matrix properly Note The matrices provided w
21. On the Lagging tab you can select type of lg formation ERROR INFO DETAILS TRACE for each Category Mat will be output 2o the Lag Vie You can select format for each log message by checking the Show date Show lg evel and Show log category a x E Sea E hee ran eee ZEEE MSS pe rer ener ol Chapter a Basic Functions Unipro UGENE User Manual Version 1 11 3 4 16 6 OpenCL IE you have a viden card that supports OpenCL you can use it to up some calculations in UGENE do it install he video card driver and check the corresponding check baw ef erated ere cc RESO ESTE mae po Now you can for example use OpenCL optimization for the Sith Waterman ago TIE UGENE Application Settings a Unipro UGENE User Manual Version 1 11 3 4 16 7 Workflow Designer se this tab to configure the Designer settings L1 parie pee Brome minn Jasa maraton Over f cem derem wh cemen re lone p rer f markt stera ee x Chapter a Basic Functions Unipro UGENE User Manual Version 1 11 3 4 16 8 Genome Aligner Use this tab to configure the Genome Aligner settings X36 UGENE Application Settings Unipro UGENE User Manual Version 1 11 3 4 16 9 CUDA IF you have NVIDIA video card that supports C
22. properties that you can configure Annotations Color crore te aroun p To change coler of all annotations of a certain type click on the colar bax in the annotations ps table and Slat the required color in the appeared Select Colo dig Annotations Visablity Yeu can show hide annotations of a eertain type by selecting the type in the annotations types table and check ong uncheclong the Shaw annotations of this type check box Show on Translation This option is available for nucleotide sequences It specifies to show the annotation on the corresponding amino sequence instead of the orginal nucleotide sequence in the Sequence Det Ve for example 310 Manipulating Annotations Unipro UGENE User Manual Version 1 11 3 Lx s i RET RV E OF You can enable disable this option by checking unchecking the Show tana Captions on Annotations tion check pole to show a value of a qualiier of an annotation of annotation type name in the Sequence doc Vies To enable this option for an annotation type check the Show vale af qualifier cheek box and oput ofthe required quer in the tex feld wey this check bon See the mage blo s pens as None 2 p 4 9 nicfotue 0 2 p ER me Show ake of usr em ly
23. By default closed To tal of the Options Panel chek on the corresponding icon at the right side oa Sequence View or Assembly Browser window dos tha tab eck again on tab lom Note that ct ley can be ted to open several tabs at the same tine In this ease the tala are shown on the Options Panel one after another More detailed information about diferent Options Pane tabe can be found in the falling chapters Options Panel in Sequence View Information abaut Search In Sequence Highlighting Annotations Options Pana in Browser Navigation iy Amembiy Browser Assembly Browser Settings Assembly Sette 4 14 Adding and Removing Plugins A plugin a dyramieally leaded modal that adds a new functionality to UGENE To manage plugins select the Settings Plugins main menu The Plugin Viewer window wil appear Options Panel Unipro UGENE User Manual Version 1 11 3 UTEM TER TE FEE dc E rcd 10 metire en D pressed a ow intrante omens Dedeipton ot pee pose Sign iz esee LE EP an ES Fee mal rne iia Tie window shows the at of available plugins Te add or remove plugina the Add plgin and the plagin trt available in the Pli Viewer contest did a When you select the Remove plugin item fer a plugin the pla status i c
24. Cag Belin the there is a rur to show coordinates in the sequence 55 1 Managing Zoom View Rows The Zoom View contains nat mare than 20 rows by default The rest vos are available by To change this behavior use the Manage Rows in Zoom View menu bution a sequence toolbar med E Sannan When the Shaw Al Rows hem is checked all availible annotations are alaya shown You can akio add ranas by selecting the 45 Ron and 1 Raw and remove ross by adecing tne and 1 Row Hema TO restore the dla number of ro select the Reset Rows Number pen m Zonning New Rer 35 Sequence Zoom View Ei Unipro UGENE User Manual Version 1 11 3 5 6 Sequence Details View The Sequence eta ew i a supplementary component of the Sequence overvis Iia to show sequence content without sing Every tne you double clc the sequence he Sequence oie area t select an annotation the omeponding sequence postion is made vtl fa the Sequence deta vic For DNA sequence the Sequence detalls veu automatically shows complement DNA stand and 6 anino translation lames Genetic codo calector Toggle e So Ce r e IG cat icon ACES coma The complement strand L thestlected amen x o eren B rcs cusa Su tabs p Dom 4
25. and phosphoenolpyruvate PEP stem oleate response traen factor aceti neamiic ac arate ii reponse War arate ii reponse Nar ite whlch ber ofthe ENT any of Formate and iie Ong a member ofthe GMP lai sre regulator Phob ia dual transcription regulator hat activates expen of the Pho regulon n to emitanmetal PI Member ofthe tao component regulatory stem pho pho Involved i adaptation ta lew Ma2 t environments and the contol acid gener Continued on ner page TIT SECON Unipro UGENE User Manual Version 1 11 3 11 2 continued from previous page Pur conr several genes m purine nucleotide ayaa and scum Regulater caule shes Regulator caule 8 Right org binding protein Right origi binding poti Sess ia dal transcriptional cator and participates im the removal of isc aude and protection solvents and Tai response regulator oe wanna cenar Tyrie repressor Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 12 Smith Waterman Search The Smith Waterman Search plagin als complete implementation of the So UCENE Te use the plugin open nucleotide er protein sequence in the Sequence View and select the A
26. fom the maia menu or the contest menu Working with Alignment Unipro UGENE User Manual Version 1 11 3 7 8 Advanced Functions This chapter la devoted to the advanced functions of the Alignment Edi You will lam how to build a grid prole export a etre of an alignment and build HMM profiles 7 3 1 Grid Profile Using te Alignment Editor you an rate polle of a multiple sequence alignment alignment grid prof shows positional amina acid or sucede counts highlighted according to the frequency osi in a row To cranta agi proie use the Statistics Generate grid proie m in he Actions malt or in tha contest To lean more about this feature ee to the DNA S 7 3 2 Exporting Image To export an alignment as image cich the Export as image btton on the eter tool aa arasen The save dislag will appear where you should set name location and format of the picture UGENE supports export to the PNG TIFF and JPEG image formats 7 3 3 Building HMM Profile editer has capable to build a Hidden Markov Madel profile batei on the multiple sequence alignment functionality based on the Sean dys HMMER package To buld a HMM profe select the Advanced Build HMMER profe or the Advanced 4 Build HMMERS profe item in the Actions main menu or in the coner Leam more about the HMM in the documentation pages of the HMM and the HMMS plugins E Chapter
27. 80 tps af transcription actors venion of SITECON provides a tal for recognition of potential binding its bain site alignment proposed by user For the detailed method description see the sna SITECON ste Dota about used coneet dependen conformational and physicochemical properties are availabe in the POP ERTY TI SECON T5 Unipro UGENE User Manual Version 1 11 3 11 11 1 SITECON Searching Transcription Factors Binding Sites Ta search transcription factar binding sites in a DNA sequence select the Analyze Search TFBS with SITECON Jo the appeared search dialog you must select fle with TFBS profi The profiles supped with UGENE are placed inthe SUSENE darn sitecon edel folder Alter the proie i leaded the three iter populated with values read from profi You can use the filter to remove ow scaring regions from the result ON soarch wth modei ros Setups 2 erer DOSTAN Gear reailts Save as avetine rends fond The regions found by SITECON algorithm can saved as annotations to the DNA sequence inthe Genbank fosa Every SITECON profile supplied wth UGENE contains complete information about calibration settings provided to UGENE team by the author of SITECON The original TFBS alignments to calculate proles can be requested directly fram the author af SITECON i Chapter TI Plugins Unipro UGENE User
28. Annotations and Qualifiers Selected annotations groups and qualifiers can be deleted using the Delete key remove an annotation abject Fen the active view the object in the Annotations editor and press the Note that the ject wil not be removed from the poet but jst the active 5 Vico To add objet again just drag and drop it to the Sequence Vic 5 10 8 Importing Annotations from CSV pen to import annotations for sequence from an annotations table stored in the CSV format import from CSV right click an Project View ad select Import Import annotations CSV The following dialog bac wil appear s vite 1 Y 2 Basirme nae mous Be ade p you need to specify the fle to red annotations tabe required Fe orem Greiner ore seinem rosters m 310 Manipulating Annotations 7 Unipro UGENE User Manual Version 1 11 3 Ard the format of and the path to the to write the annotations table into regaled aT im Fleterat Geter Add result to project to Ink the annotations to the curently opened sequence EI Altre ttt To a separator to split the table chech the Column separator item and pec the separator symbols Abos can pres Guess ta try to detect the separator from the input fle meris 9 Gases Alternatively you can pes Edit and edit the srt which w
29. Arcs consists of the bases A G T It may contain the N character that Staya for an ambigous base Depending on the value of the Cigar parameter the read ean be shown partially or can be inserted Iraide the end ste belen By when read ia hovered over in the Raads Ara a hint appear disable this behaviour dick the folowing button the toolbar Or uncheck the Show popu hint check on the Assembly Browser Settings tab of the Options Pane hint shows the folowing information about the read Read nae Location Leth Ger n Read sequence The operations in the Cigar parameter are described as olan M Alignment match can be a sequence match or mismatch to the reference Shipped when the alged ta reference Le ia net shown in the Reade Area buts present in the read sequence E Chapter Assembly Browser Unipro UGENE User Manual Version 1 11 3 D Deletion from the reference Gaps are inserted to the read when the read aligned to the reference For ample N Skipped regen fom the reference Behaves as D but has fret biological meaning for mRNA gene alignment i represents a intron S Soft clipping led sequences are present in the read sequence Le behaves as I H dipping dipped sequences are nat present in the read sequence P Padog silent deletion fom padded reference Exact match to th
30. Basta the old program developed and distributed by the NCB fr running BLAST searches formata protein or source databases before these databases can be searched by Ard the oling tol of the new BLAST package blastn searches a nucleotide database using a ceti que blastp searches a protein database using a protein query blest searches a protein database using a translated cleotide query blastn compares a protein query against a translated nucleotide database the all sie reading ames thlasts translates the query nucleotide sequence in all sis posible Frames and compares t against the six rame rains of a nucleotide sequence database makeblastdb formats protein or nucleotide source databases before these databases can be searched by other BLAST toole BLAST home page To make BLAST or BLAST tools available from febLPAGE_TVPE BlastHeme tae seb nln alk 1 taal the required verion of BLAST or BLAST on your system 2 Set the paths to the executables you are going to we on the Extr toc tab of Application Sitene dalog Ar you ve finished this configuration you ean ares the tools fom the Tooli BLAST submenu of the maia Creating Database To format a BLAST database do the flowin you re using BLAST open Tools BLAST 4 FormstDB you re using BLAST open Tola BLAST BLAST make Tie Format database dialog a
31. Coeficient af varistion of substitution rate among sites becomes available the Gamma datributed across sites parameter checked Specs the coeficient of the detibuton o the ratet Transition transversion ratio expected ratio of transtions to transiens To enable bootstrapping check the Bootstrapping and Consensus Tees group check bex The following parameters pen Number of replicates number of replicate date sets Seed random number sed By default i is generated automaticaly You can manually change B value in arder to male ess of diferent rura of a tree buiding reproducible The should must be an integer greater than zero and les than 32767 and which is of the form A that i i leaves a remainder of 1 when divided by 4 Any tdid number ean ako be used but may eet random mbc sequence that repeats elf fier ess than he one bilion mbes aal tha ia not a problem Consensus species the method build he tree Select one of the folowing species that set of species must appear in all input trees to be itl in the strict Majority Rule extended specifies that any set of species that appears in more than 50 of the trees included The program then coders the other st of species in arder of the Fesency with which they have appeared ang to the consensus te any which are compatible with ean the te fully resolved the default setting MI includes the consensus tree
32. Manual Version 1 11 3 11 112 Types of SITECON Models Eukaryotic rj Description CCAAT enhancer binding proe alpha CCAAT enhancer binding protein Trendin Locomotor Output Kat TX Mye vgultor gene tht codes fra arat acto A muted veio af Mica found in many cancers TRE Cree response clement EFT Transcription factor 1 grates Wat Rumams encoded the gen ENIJDPidi factors biad ta DNA as homodimers or heterodimers in amociation with dimerization partner DPI EERE Early gran reponse protein T ERU le Factor ER Estrogen receptor bea s transcription fci abs to bind the sequence aes arly of transcription factos anced by their Ending beter 1 binding wate Trans acting Teel apc wana factor GATA High nobly group protein 1 HNF Hepatocyte nuclear factor 1 Hepatocyte factor 3 Hepateyte nuclear factor amp D Ttereron regulatory facta E belongs o a family oF proteins nti genie regulatory RET NE MeureFaronnin T NFE Transcription factor 45 Da subunit a sete tat in humana encoded by the NEE gene WESS component of the NFAT Nuclear far of activated Taal transcription NAE al Nace factor tapas ghe
33. Optional Default Blast result of the BLAST search Sting Optional Default blastn The following values are available m Hate m m ie expectation value threshold Number Optional Default 10 Example Chapter 12 UGENE Command Line Interface Unipro UGENE User Manual Version 111 3 122 10 Remote NCBI BLAST and CDD Requests Task Name remote request Performs remote requests to the NCBI Saves the results as annotations Parameters in semicolon separated let of input Blet A fle can be of any format containing sequences or String Required database to search in String Optional Default ne bas The following databases are available rebut for nucleotide sequences Prebbedi for amino acid sequences Pre ssp for amine acid sequences out output Genbank String Regie eval species the statistical significance tiveshold for repriog matches database uence Number Optional Default 1 Bits minimum number of Nts that wil be shown Number Optional Defaut 1 name name ofthe rent annotations V not set name wil be specified with the edd realtor the lat rent Sting Optional Default dd er shart optimizes search for shart sequences Boolean Optional Default b1ast output path to the with the NCBI BLAST output only for the and acs sor databases Boclcan Optio
34. Optional Default O Wa 1g specifies o use the Algorithm 2 weight In mast eat it is required but in some cates it can inereate the recognition quality Boolean Optional Default fale Example 12 2 25 Searching for TFBS with SITECON Task Name seco seth Searches far transcription factor binding sites TFBS with SITECON and saves the regions found as Parameters in semicolon separated list of input sequence to search TFBS in String Required insedel input SITECON profs W several prades fave been supplied searches with all prolis ane by and outputs mered aet of annotations for each input Sequence String cout output Genbank fle Sting Required annotat ion nase name of the annotated regions String Optional Default misc_feature min score mcognition quality threshold The vala must be between 80 and 100 Choosing l n threaheld wi lead recognition of teo many TFBS recogniaed with too kew trustworthiness Chang too high threshold may result in no TFBS recognised Number Optional Deut BS min err1 setting for fitting reas minimal value f Error type 1 Number Optional Deal 9 EI Chapter 12 UGENE Command Line Interface Unipro UGENE User Manual Version 1 11 3 masecea setting for flaring eu adum vale of Eror ype N Numher Optional Deal Son strand strands to searchin Number Optional Deft 0
35. Reference sequence DNA sequence to which short reads would be aligned to This parameter is Ind le name to sve the created indes to Tha parametar is required Colospace cole the input is read in ease colors are encoded as characters A C G T Ambas Careen Grange Tred E Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 17 BWA BWA ie a fatt lightweight tol that aligns relatively short read toa reference sequence Click this Ink to open BWA homepage BWA embedded as an sternal tal into UGENE Open Tools assembly submenu of the main mena BWA 4 Unipro UGENE User Manual Version 1 11 3 11 17 1 Aligning Short Reads with BWA When you select the Toole DNA Assembly Align short ead itm in the main menu the Align Short exe dialog appears Set value of the Align short rede method parameter to BWA The dialog lacks follows 10 10 po pro S 1 Gema art o B osea o ds m Gesneri e s ma x n ea ET p nena ms ED There ae lowing parameters Reference sequence DNA sequence to align short reads ta parameter ie required Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 Fest tame Hle in SAM format to
36. Replication help and check for updates The nena can be dynamically populated with actions added by plugina Check the Plugins documentation to kar tow each plugin ficis bal aed content Menu Overview 3 Unipro UGENE User Manual Version 1 11 3 4 4 Creating New Project t the dta eros dota auctions and Visualisation sedg Below is the deserintion on how to create a project manually Note that if you have no project crested when pening fle wth a sequence an alignment or any other data new anonymous project crested sitomatily To crest a project select the Fle prefect click the New project button on the main tala The dialog wil appen Create new project Pepe peste Crogan Fri BE Here you nee to specify the visual name for the project and the directory and fle to stere it After you ciek the Create button the Project View window is opened 4 5 Opening Document UGENE store infrmation about documents you are working with in Once a document been pened information about i saved in the curet poet 4 5 1 Opening for the First Time Toopena dalog sm ment that a nek yet presented nthe curent project ute ihr aa advanced Add existing document pen dialog o jant drag the document ta the UGENE windon GENE automaticaly detects the format o
37. Run butten Note that only 1 machine can be selected in Me curent verson of UGENE That s all Aker the task le finished you wil see the task report in the Task View Chapter 10 Distributed Computing Unipro UGENE User Manual Version 1 11 3 10 5 Running MUSCLE Align Task on Remote Machine Read the MUSCLE plug documentation belare reading this paragraph To nin the uMUSCLE align task remote machine you need t do the folowing Open ruts sequence alignment and chek the Align Align with MUSCLE item in the tet menu ot in the Actions main men I astiat srties usas You wil the Align with MUSCLE dialog required fields and click the Remote ron button cese eae atte Lifetime z o O camner 3531 The Remate machines monitor dialog will appear You ak ad remove or remote machines here Select a machine to run and cick the Run butten Note that oniy 1 machine tan be selected in the curent version of UGENE That s all After the task sited you wil aee the task report in the Tas View 105 Running MUSCLE Align Task on Remote Machine 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 1 Workflow Designer The liio Designer alls a molecular biologist to create and run complex computational workflow schemas even if he or she not mar with any programing language The workf
38. Shi E and Ctrl lega while eng on the annotations ether in the Sequence dias vov ar in the Sap 5 8 9 Copying Sequence The selected sequence region an annotation sequence or their amino translations can be coped to clipboard 1 By pressing the corresponding buttons in the global toolbar eons copy selected 2 Using the folowing shortcuts 1 caples direct sequence strand cape direct amino translation Cer1 shi E t rese complement sequence 1 copie reverse complement amino translation 3 Ung the Copy submenu of the contest menu aer 3 or omietradam kan eret see g M a a apy wren stretto rpm tree Manipulating Sequence a Unipro UGENE User Manual Version 1 11 3 5 8 10 Search in Sequence To search for a pattern in sequence go ta the Search in Sequence tab of the the Otans Pace in the Sequence Input the value you want to search in the text Feld and lick the button default misc_feature annotations are created fer regions tht exactly match the pattern To change these andar other stings ciek on the Show more options link Find below the description of the availble settings Search algorithm sn amon aee ems group species the algorithm tat should be used to search or a pattern The algorithm can be one of the Solowe there could be ins
39. Thare are the parameters Reference sequence DNA sequence to align short reads to parameter ie required esie tame lei SAM format to the result oF the alignment into parameter is required Prebult index check ts to an index fle instead of a source reference sequence The index is a oF O Bles with afin ebat Zielt Abw rev Lent and red bW The index created during the alignment Abo you can bod i moni Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 SAM output always save the output fle in the SAM format the option i disabled for Bowtie Short reads each added short read is small DNA sequence fle At lent one read should be added Note Short reads length for Bowtie cart be more than 1024 You can ako configure other parameters They are the same asin the original Bowtie you can read detailed description ofthe parameters tn the Bowie manual page Select one of the following modes The n alignment mode When thea mode is selected Bowtie determines which alignments are valid according to the flloving pel Alignments may have no than N mienst he here N i amber 03 in the frt L tases where Lisa number S or grater set with Send lrg on the high quality 88 end of the read Thesum of the Phved quay value a mimatehed positiona nat ja nthe may eed E set wth Mag error Where gules are unavailable eg If
40. The fragment will be saved an 11 9 3 Constructing Molecule To construe nawy molecule select the Tode Cloning Conatuct Mate itm in the maia Ia Sequence View window is active yeu can also select either the Actions Cloning Construct Molecule itemm in the main menu ar the Cloning gt Construct Molecule in the context men Tie Construct Molecule dialog appears Molecular Cloning silico s Unipro UGENE User Manual Version 1 11 3 ano ums QUSE EET Hoare Etpe Record p S ii Tem 7 ne WEEP EST cuss diaper medo Dm T 88 emen teen eere p ed rer Available Fragments All the fragments availble in the current project are shown in the Available fragments lat Vou can automatically crete a fragment from a DNA molecule from the curent UGENE project Click the From Project button t do v The Select Item dialog appears with the sequence abjecte available Select a sequence ard press the button that create a fragment in the appeared Crete Fragment dialog as described inthe Fragment paragraph The fragment Createt from the sequence appear in the lt of available agmen Fragments of the Now Molecule The step is to add required fragments to the new molecule contents add fragments select them nthe lat of available fragments and click the Add bution To add all the fragments ick
41. The window is moved along the sequence ya dep See Graph Settings Instructions how to modify these parametara Alara are alaya aligned to the range show in the Sequence zoom view It means that if you change the ible ange in the overview ether by Zooming rsrling the graph will abo updated The minimum and marina values of the vile range are shown at the ht lone and upper tones of the graph w Chapter 6 Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 To doe a graph uncheck its item in the popup 64 1 Description of Graphs Find below the detailed description of each graph Note that characters A C G and T in the formulas denote he numberof nucleotide in 3 windon DNA Flexibiity searches fr regions of high DNA helix flexibility in a DNA sequence The average Threshold in a window calculated by the following farms For mare detailed information see DNA Flevlbiity paragraph GC Content shows the percentage of nitrogenous bases either guanine or cytosine on a DNA molecule IE calculated by the flowing formula AG Content shows the percentage of nitrogenous bases ether adenine or guanine on a DNA molecule Ie calculated by the flowing fermua GC Frame Plot this raph is similar ta the GC content graph but shou the GC content of the second and third poison independently It i most eive i organisms with GC ich genomic
42. a nonnegative integer Number Optional Default O 122 15 Searching HMM Signals Using HMMER2 Task Name hon ach Searches each input sequence for thesenicaty similar sequence that matches to all specified prole HMM using the HUMMER tol Parameters seq semiclon spsrated lat of the input sequence es String Required semicolon separated at of the input HMM Fle String Require cut output wth annotations String Required name nate ofthe ret annotations Sting Optional Da 1 va evalue that can be used to elude low probability its from the result Number Optional Dei i SEX CL Predefined Tasks m Unipro UGENE User Manual Version 1 11 3 score bad fering which is an alternative to evalu filtering to exclude kow prabability fam the rel Number Optional Dau 1000000000 Exam 122 16 Aligning with Clustalw Task Name algo lunae Multiple sequence alignment wth ClustalW Warming ClustalW is used as an externa to and must be installed on your system path to the ChuatalW executable By default the path speed in the Application Settings sapped String Optional Default deu tmp e recy fer temporary String Optional in senkelo tpartd tof input String Required uk output Sting Required Format farmat of the output fle String Optional 12
43. arat by DRAW See ala Sequence Vie A e for a pasion mati See also iss hae I Tem for a poison weight mati See Weit Mat 7 T aw sequence Frat See Seven SAM Tum The Sequence Algrment Map SAM for gerer ament format for storing read aanments aga reference sequens See alse Alignment scr Teas Standard Cromatagiam Format See Chromatogram Viewer SITECON sus A Format ta stre TFBS pote 131 Appendix A Supported File Formats 25 Unipro UGENE User Manual Version 1 11 3 Sud Tas senes alignments f See Algorent Editor Seis Prat Aa annotated sequence in frat of the UniProt Swi Prot database See Sequence E Chapter 13 APPENDICES Unipro UGENE User Manual Version 1 11 3 13 1 2 UGENE Native File Formats Tila F eedenion Reed Wis Comment td Stere a dott of a sequence Scala UGENE E Y database Her stre information far database fle imported BAM or SAM and can be used fer converting his information ita a See aiso BAM SAM File Ghat Reads us us A mape sequence alignment We fermat FASTA See Alignment Eto UGENE Wark ant F format to sre UGENE flow Designer W
44. cheek to mal he ew molecule output On the Output tab of the dialog you can select the to save the new molecule to The molecule opened y default as soon ax it is crested this behavior uncheck the pen wiew for sev check on the sume tab To save the molecule fle to the hard dink immediately after it in created check the Save immediately check bo Otherwise t would be stored in memory unt you save or remove it EI Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 10 Secondary Structure Prediction The Secondary Structure Prediction provides a stt ol grita fr tha protein secondary structure alpha hells beta sheet prediction om a raw sequence Currently available algorithms GORIV Jean Garnier ei Francos Git and Barry Robson GOR Method for Predicting Protein Sec order Structure rom Amine Acid Sequence in Methods in Enzymology vol 206 540 553 09 Improved version of the GOR method J Garnier D Osgutherpe and B Robson J Mal Bial vol 120 p 97 1978 4 Bryson K MeCufin LJ Marden RL Ward JJ Sodhi 15 amp Jones DT 2005 Protein structure prediction servera st University College London Nucl Acida Res 33 Web Server iue W36 38 Jones 1990 Protein secondary structure prediction based positien apecifie scoring matrices J Mal Bial 292 195202 You can access these analysis capabilite
45. fired Sting Required 41 ift to tue accepts oly the specified annotations iet to falie accepts I annotations exept the ones clea Optional complemen complements the annotate reins f the corresponding annotation is located on complement and Boolean Optional extend Les extends the resting regjons to the let for the specified number of base umber Optional extend sight extends the resulting regions tothe right or the specified number of base Nurber Optional 1 inserts a gap ofthe specified length between the merged annotations trana translates the annotated regions Boolean Optional Example 1224 Finding ORFs Task Name Searches for Open Reading Frames ORFs in nucleotide sequences and saves the regions found Parameters in of ipit Sting Reed cout output fle with the annotations String Regie ame name of the annotated reins String Optional Default ORE 1 ignores ORFs shorter than the specified length String Optional Default 100 equi re otep ccdon ignares boundary ORFs that last beyond the search region Le have no codon within the rane Optienal Default fal equi re inse codan lls ORFs starting with any codon ather than terminator Boclean Optional Default tie a11ow a1ternat ive codans alias
46. from metagenome stade uncultured sequences om anonymous environmen al sample Fer help in constructing Entrez queres see the Entree Hela document Fits Rie for lon corplesity and repeat elements of the human s Maia for lookup table only this option masks aniy fr purposes o constructing the oun table ined by BLAST so that no hita are found based upon low complerity sequence or repeats repeat ftris checad Mask loger letters with this option selected you can et and paste a FASTA sequence in upper cae characters and denote areas ou woul like Altered with louer ease Filer by fiters results by accession by definition of annotations ar by id Select ent by selects res by EValo or by core When the blastp search l selected in the general options the view of the Advanced options tab a the allowing pn n pp you can se there no Mate scores option but there are Matrix and Service option Mari matis which sns a score fer aligning any posite prof esis Sere ot service which nada to be plain pl oF phi key element in evaluating the quality of a pair wise sequence alignment ithe substitution Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 The Advanced options tab is nat available when the cd search is selected TIE Remote BLAST T6 Unipro UGENE User Manual Version 1 11 3
47. he read are rom a FASTA the quality defaults 40 The alignment mode a v mode ry have va more than V mismatches ubere V may bea O through 3 Quality values are ignored The v mode a mutually exclave with the on mode The felling parameters are avaiable Mag err maqer maximum permitted total of quality vale at al mismatched rad postions throughout the entire alignment no just in the ated The dell a 10 default Bowe rounds tay values to the 10 and saturates at 30 Nate that the rounding Can be daabled wth No Mag rounding Seed Length sedi the numberof bases on the high quality end of the ead to which the cn alien The lowest permitted sting ls 5 and the default 28 Maumum of backtracks mass the maximum number of default 125 without S00 with Best backtrack ie the introduction of speculative substitution nt the alignment Descriptors memory wage chunkmbs the number af megabytes af memory a given thread is gent sore path descriptors in the fg Default 64 Ths parameter avaiable the Bet checked Send red ponds random number generato Threads lunch the specified number of parallel search threads Threads vill run on separate procesos cores and synchronize when parsing reads and outputting alignments The following fags are available Colapace clor the input is read in colorspace colors are encoded as characte
48. in the contest menu Every sequence om the current multiple sequence view can be to build a dott Note If you need to compare a sequence with itself you ean activate the mena from a single Sequence View 6 5 10 Comparing Several Dotplots Dotpots rate fr the same view are show at the same Ifthe and vertical sequences of several doles are the same correspondingly it ia posite t lock al and navigating operations for these dotglots Pres the Multiple view synchronization lok button on ele iw Chapter 6 Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 NC JERE ea 31 deity 08 i D167 ga eras 15 et 0 7 Alignment Editor 7 1 Overview This chapter gives n overview af the Alignment Editor capasents and explains basic concepts of on lament 7 1 1 Alignment Editor Features The Alignment Editor a panel tal for vation and editing DNA RNA er protein mulipl sequence alignments The editor supports diferent multiple sequence alignment MSA formats sch a ClustalW MSF and Stackholm The ful tof formats supported in UGENE here Tie editer proves interactive vas representation which inches Navigation through an alignment Optional coloring schemes for example Chustal ave esc zoning fer large alignments Export publication eady images of alignment
49. in the task report se report E J Task report DigestSequenceTask Digest into fragments murine b en a 25 un Fem a weis Gu anto Fron ER 0229 Teg 0698 47230 renta rs rota G2 iste Feminen GaN Tec in Refer to learn mare task reports 11 9 2 Creating Fragment To creste a DNA fragment from a sequence region activate the Sequence View window and select either the Atianas Cling s Crete Frapent em ia the main rens or the Cloning gt Create Fragment lr in the Tie Creste DNA Fragment dialog appears Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 j Va rain has ben sdectd you ean choose to create the fragment ror this reglon there you can either to create the fragment from the whale sequence or choose the Custom em and the custom reglan To add a 5 overhang to the direct strand check the Left Overhang chick box and input the required nucleotides To add overhang to the reverse strand in addition ta the described steps sles the Reverse complemen iem i the same pup bax te add a 3 overhang check the fede Right verhang check input the required overhang and tiect ets the direct or the erre complent strand On the Output tab of the dialog you can optionally modify the annotations output settings Finally gress the OK button to create the fragment
50. me te Cera ene st I femme E m mum e Here you shouid specify the Fe with first sequence Alko you should either check the Compare sequence against tef option eet he File with teca sequence Optionally you can select ta Join al sequences fund in the Gle for the Girst ando for the second W you to join the sequences you can select the Gap size The gap of the specie ze wil be inserted between the joined sequences After you press the button the dialog to configure the depot parameters wil appear p ms d mc e m peyan The lining parameters are sable X ane sequence the sequence for the X dtl ai Y axis sequence the sequence fr the V dotplot aris here are several sequences in the specified the ist ar the second and you haven t secte to Join the sequences inthe previous dla then you ean select a sequence Ia these fields If you have selected Join all sequences found in the fle then you can t elect separate sequence from the the oed Sequence can be selected instead Search dat repeats check this option to search for direct repeats in the specie sequences You selec the with which the repeats wil be displayed in the picture The default baton its the default dr Search inverted repeats check this to search fer inverted repeats in the specie sequences LI Chapter Sequence View Ex
51. name fer the group You can use the character i tha fld 8 a group rame separator to create subgroup The Location contains annotation coordinates The coordinates must be provided in the Genbank or EMBL Sie formats yo want to annotate complement sequence stand surround the coordinates wth the comple re ward or preas the last button ia the Location tow dot atomic 310 Manipulating Annotations Unipro UGENE User Manual Version 1 11 3 Note that by default the Location contain the coordinates af the selected sequence region Once the Crete button pressed the annotation crested and highlighted both in the Sequence o pus metum 0 pense o d 5 10 2 Editing Annotation IE he document not loched it is posible to edit an annotation or an annotation group using the P2 key The rendo peng the hey fran annotation The of pressing the key fer an annotation group 5 10 3 Highlighting Annotations configure settings of annotation types got the Annotation Highighting tab in the Options Pone By default the tab shows annotatione types of the opened Sequence View Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 Proven 8 T GE TE Ge pr E VF yeu want to see all annotation types dick the Show al annotation types ink Find below information about annotations types
52. separated list of input shart reads String Require bet Boule String Required ior output fle Sing Required format format of the output fle Sting Optional maqerr mavimum permitted total of quality values at all mismatched read positions throughout emire aliment no just in the sel The delauit 70 Bowtie rounds qual values t the 0 and saturates 30 rounding be disabled with comarca lumber Optional nomaqround prevents rounding of quay alas se naqe rr description Optional maximum numberof backtrack permitted when aligning read inn 2 ir 3 mode defaut 125 without 80 with heze A backtrack ls the introduction of speculative substrtuten nt the alignment Without thra mit the dal parameters wil sometimes require that tries 100 or 10s of backtrack to align a read especialy d the read has many kew quality bases and or hat no valid alignment slowing bowtie domm significantly However this mit may use some valid alignments to be mised Higher imis yield greater sensitivity but require longer vin mes Number Optional n mami number of mismatches permitted in the Le the frst L base pairs of the read tere with Number Optional nazw peces nat to align against the erar reference stand Bocean Optional nare specifies not align against the revrsecomplament reftrenee strand Boolean Opt
53. sequence T it abaa n all mikrobia sequences GC Deviation G C G C shows the diference between the G content of the forward strand and the reve stand GC Deviation calculated by the following formula Deviation shows the diference between the A content of the foward strand and the revese stand AT Deviation by the falli formula Karlin Signature Dierence dinuclestide absolute relative abundance difference between the whale se uence and 3 siding window Let The Karin Signature erence fer a window calcat by the following rr Entropy in calculated from a table of overlapping DNA triplet The of pes macte the fame eft Informational Enon calculated by the folowing Formula DNA Graphs Package Unipro UGENE User Manual Version 1 11 3 64 2 Graph Settings To change settings of graph select the Graph settings in the graph context menu The Graph Settings dalog The following parameters are avaliable Widow the number of bases window Steps per window the number of tes in window The Step s calculate as Window Steps per poni Default color the default color of Ine of graph or Ines of graphs for GC Frame Po Ceding of the Krein and maximuma vales checkbox enables th flowing settings Mies the iium fa Maium micum value
54. strands to sarc in Plumber Optional Dead O Tie tolaning values solle 0 both stan 1 et rand 2 complement sand Examples E Chapter 12 UGENE Command Line Interface Unipro UGENE User Manual Version 1 11 3 122 22 Building PWM Task Name pum build Bulk a pation weight matrix from a male sequence aligiment Parameters semiealn separated list of input MSA fles String Required cut output Fe Sting Required type of the matric Boolean Optional Default falie The following values are available ue nul type e type matrices are mere dealed while marosuck ie one we mare unl for small input data sets 2195 ili to build the matr Stsing Optional Default Berg and von Hippel The following values are available Beng and ven Hippel enG Example 12 2 23 Searching for TFBS with Weight Matrices Task Name pum search Searches for etr binding sites TFBS with position weight matrices PWM and saves the regions found as annotatione Parameters somiclon separated lst of input sequence lest search TFBS in String Required matrix semicolon separated Unt f the input PWM Required output Genbank fle name of the annotate regions Sting Optional Default mise etur pin acore minimum percentage score detect TFBS Number Optional Defau
55. the Add button Changing Fragments Order in the New Molecule change the order of agents in the new molecule select a fragment inthe new molecule content at and dk either the Up or the Bowe button to move the Fragment nthe coresponing diecon w Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 Removing Fragment from the New Molecule To remove a fragment from the new molecule select it in the new molecule contents list and dick the Remove baton To remove all the Fragments click the Cear AI button Editing Fragment Overhangs To edit a agents overhangs select the fragment in the new molecule contents ist and click the Edit button The Edit Molecule Fragment dialog appears Here you can select the type of each DNA end and even input a custom overhang The changes you ve rade are la the Preview area af the dialog Te the changes and cse the dialog click the OK button Reverse Complement a Fragment reverse complement a fragment chech the Inverted check bos f r the fragment in the new mle contents E other Constuction Options To sve the fragments ofthe new molecule as annotations check the Annotate in new molecule check p Molecular Cloning in ico Unipro UGENE User Manual Version 1 11 3 To make all DNA ends blunt check the Fre hunt and omit sll overhangs check box All overhangs would be ct in case Che the Male cular
56. the dialog you can tune the width oF the tee re layout to rectangular you can ture the height af the ee also Ard you can select the tree view Phyogram 9 2 Adjusting Branch Settings To adjust ranch setings select ther Branch Settings toolbar button or the Actions Branch Settings lem in the main menu The Branch Settings dialog wil appese Here you can select the esor and the ine width of the tree branches Note that when a clade has been selected the branch settings are applied to the clade only 9 3 Selecting Tree Layout You can select one of the follwing tree layon Rectangular Te do it pres the Layout toolbar button and check the required iem in the appeared menu Or you can check the item in the Actions Laut submenu of the main See the example of the Circular layout 32 adjusting Branch Settings Unipro UGENE User Manual Version 1 11 3 9 4 Modifying Labels Appearance From this paragraph you can lear how to show hide taxon and distance labels align them and change their formatting color t 94 1 Showing Hiding Labels When you open ate all the als are shown by default To hide the tavon sequence name labels select either the Show Labels toolbar button or the Actins Show Labels m in the main menu and uncheck the Show Names item in the submenu appeared To hide the distance labels uncheck the Show Distances ite the
57. these server to specie functions storage computation le UGENE provides for users capability to launch their computational tasks en the cloud UGENE computational service i hated on the Arion EC servers and maintained by the UGENE team Currently this serie unis In testing mode and it la free to ty Note To ensure that sensitive data are not intercepted and read all data are transmitted ver a secure Although the available cloud computing functionally is based on the Amazon EC2 Unigro company is capable of sting and maintaining UGENE distributed computation service in any private oca or caste Environment Please contact us for more detail th mite 10 2 3 Cloud Remote Machine Bere launching distributed wks make sure that the pubic EC2 remote machine enabled in the remote machines meriter The publie EC machine settings are already provided withthe default UGENE bundle so you don t have to specify them Once you ve opened the Remote machines monitor the sesion with the remote cloud service will be initialized ard pins tak il be performed LI Chapter 10 Distributed Compuling Unipro UGENE User Manual Version 1 11 3 Check the chus machine stat inthe Remate machines mont I the selon hasbeen inthe uccelli the green tick is highlighted inthe Ping column thee green tik check the Log View fr details abaut the occured problem 10 2 4 Launching Workflow Open the Work Designer us
58. time you can restore the default view by pes the Restore Default View button on the toolbar You can also overview the whale structure by splaning t automatically Select the Spl ether in the 30 Sic Viewer contest menu rf the Display menu the toolbar i do To stop the spinning uncheck the Spin tem 6 2 4 Selecting Sequence Region When you ar noes es the corresponding region on the 3D ture are bong shaded To configure jon selected open the Settings ilg press the Settings item in the 3D Structure Display menu on the toolbar to do it press the Set selection cle button and silt a calor In the dialog appeared Chapter 6 Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 To adjust the shading drag the Unselected regions shading slider in the Settings dialog 6 2 5 Selecting Models to Display When a molecular structure contains multiple models eg NMR ensembles of model the Modal tem appears in the 3D Structure Vewe conten menu and in the Display menu on the EZ SO Structure Viewer Unipro UGENE User Manual Version 1 11 3 6 28 Exporting 3D Structure Image To export 3D structure image select the Expert Image item in the 3D Structure Viewer contest mena or in the Dipl menu on he loa The Export Image dialog vill appear pum Here you ean romae for the ie name select the width and height of the im
59. to search for restriction sites batuten the ed and the beginning of the sequence check the Cireular molecule option Example Let s coder The sequence CTGC CAC Ar restriction enzyme with recognition sequence CACCTGC has been checked In this case if the Circular molecule option has been checked the restriction site wil be found IF it hasn t been decks tne restriction sita won t be fund in thia postion Restriction Analysis s Unipro UGENE User Manual Version 1 11 3 11 8 6 Results When at least one enzyme has been acted and the OK Button has been pressed ia the dialog the aut annotating becomes enabled la the Annotations dior the Restriction Sitet can be found the The diet and complement cut site pshion are as tangles on a annatation in the Sequence detail Sena EXE SACOT Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 9 Molecular Cloning in silico chapter decies a set of tools in UGENE to perform molecular cloning experiments in silk This lows you to digest a molecule into fragmenta creste a fragment rom a sequence eg and iie fragmenta iato a sew lac 11 9 1 Digesting into Fragments Open a DNA molecule you want to cut into fragments Digestion into fragmenta performed using restriction enzymes So before continuing make sure that the esti ion analy has been performed Refer chapter Analyses for details Se
60. 1 11 3 7 2 Working with Alignment chapter explains how to werk elfen wih the Alignment Editor You wil leam haw to madly an alignment remove gas aan sequences copy and paste regions add neu sequence and extract aa new alignments 7 2 1 Undo Redo Framework The editar trachs all modifications of the aligned sequence When a medication happens the current state of the multiple sequence agents object a being recorded Nou can apply any previous state and redo the madiicationa using the corresponding buttons on the toolbar 722 Selecting Subalignment While in the Sequence arta if you hold the left mouse button and move the cir will activate the selection mode By the cur you can adjust the of the selection Releasing the mouse button wl in eting the selection mode The selection mode available in the Sequence and the Consensus area too The difference between these areas and the Sequence that here you cam add to selection the whole ro or columns respective To cancel the selection press the Eo hy 723 Editing Alignment Select the Edit submenu in the Alison dto contest menu The actions avaliable from thia mena are described bolo Working win Alignment Unipro UGENE User Manual Version 1 11 3 Selected as MSA posible to extract subalgnment and save itas new multiple sequence alignm
61. 1 3 11 14 3 Searching Sequence Against Sequence Database Phmmer Search The Phnmer search to searches query sequence matches in sequence database much as BLASTP or FASTA veld de The Phar search works Nhe the HMMS search does you provide a query sequence hated of au The dat opened ry proie HMM tabase sequence must be selected inthe Project View or there must b an active Sequence View window Select the query sequence in the Phmmer search dialog exec grt soosse Askalon Erata aban Ofer orm emer arene aene 26 e umm ae g ED Yew ea options in et options of the Pier search by choosing the needed dalag tab Here you can se the evalue utr xom en Arun Lede tai ru ft Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 The results se stored as sequence annotations in the Genbank fle format EET Pe mT re rere mermere BI Sara mm Simard Sa ira aisi FEE poros ara prj Sard ses sro E veep famen Mr pon Indesit he Vae po mara Sin umm Warning The P per sich warka oniy wth single sequence databases Unipro UGENE User Manual Version 1 11 3 11 15 uMUSCLE GENE contains graphica
62. 2 17 Aligning with Kalign Task Name algo lali Multiple sequence alignment with Kalen Parameters in aelealanataratet of input String Required eut output Fle in the ClustalW format Sting Required 122 18 Aligning with MAFFT Name alg malt Multiple sequence alignment with MAFFT Warning is wed as an external too and must be installed on your system E Chapter 12 UGENE Command Line Interface Unipro UGENE User Manual Version 1 11 3 tosipath path to the MAFFT executable By default the path specified in the Application sapped Sine Optional Default deat tmp directory for temporary String Optional in senielor tpartd lt of input String Reged uk output Fe Sting Required format format of the output fle String Required penalty for opening a Number Optional ep penalty for extending a gap Number Optional maxi erate maximum number of cyl of iterative refinement Number Optional Example 122 19 Aligning with MUSCLE Name alen Multiple sequence alignment with MUSCLE Parameters in semiolp separatd list o input An input can be of any format containing sequences Sting Required output ClustalW fie Sting Requires 122 20 Building Task Name a position frequency matrix from a multiple sequence ament Pa
63. 7 Alignment Editor Unipro UGENE User Manual Version 1 11 3 7 4 Building Phylogenetic Tree To build tee from an alignment ether gress the Build button on the tola select the Tre Build Tree Aem in the agent contest menu t the Tree Tee em in the main s Too methods for building phylogenetic trees are supported 1 The PHYLIP Neighbour method The PHYLIP package implementation of the method is used der the hood 2 The MrBayes external teol Check Mayes Web Site for more detail 7 4 1 PHYLIP Neighbour Joining The Building Phylogenetic dialog for the PHYLIP Neighbour Joining method has the following view pam peu zore met pm m mtn pes 55 Ex inire Ea server usur c Ce The felling parameters are availible Distance matrix model model ta compute a distane matrix The following values are available fer a nucleotide multiple sequence alignment m Building Phylogenetic Tee Unipro UGENE User Manual Version 1 11 3 The folowing models are avaiable fer a protein alignment Jones Toor Thorton Henikoff Tiller PMB s Dao PAM Ken distributed rates acres sites species to take into account unequal rates of change a dierent sites Iti assumed thatthe dation of the rates the Gamma
64. AM SAM fle So there Is import the whole if you re going to werk with some contigs Note that in the future there sre plans to support the other approach as wel namely when a BAM SAM fle opened dist The Assembly Browser has been tested on diferent BAM SAM from the 1000 Genomes Project and other Read the documentation below ta learn more about the Assembly Browser Features 8 1 Import BAWSAM File start working with an assembly importit ta the UGENE database Fle do this the assembly Fle The Source URL feld in the dog species the to import The Info button nearby can be used ta obtain tional information about the Unipro UGENE User Manual Version 1 11 3 Thare is iat af cones below the Source URL Check the contigs that you want ta import to the database You can e the Select Deselect and ert Slaton buttona ta manage the selection The Destination URL Feld specifes the output database Fle IF you check the Import unmapped reads then all unmapped reads in the assembly i read with the unmapped Mag or without CIGAR are imported Nete however that they are not vizrakzed in the current version To start the import lich the Import button in the dialog You can see the progress of the import in the Tash Vies Ta epar a UGENE database into the SAM format select the Actions Export assembly to SAM emat iem in he maia menu
65. Algorithm implemented in EWT SW On rt quedes BWA SU dover and lena accurate than the A algorithm but on long reas i is better Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 3 div not wark for long genomes Colospace the input is read in colorspace colors are encoded as characters A C G T ambue Coreen TIT BWA m Unipro UGENE User Manual Version 1 11 3 11 18 UGENE Genome Aligner The UGENE Genome Alper fast short read It aligns DNA sentences of various lengths to the reference genome wth configurable mamach rate available the Tools DNA stem submenu of the main mena EHE cm Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 18 1 Aligning Short Reads with UGENE Genome Aligner When you select the Tool DNA Assembly Align short ead lem in the main menu the Align Shot exe dialog appears Set the Align short reads method parameter to UGENE Genome Alger The dialog looks pe p p rp The lining parameters are available Reference sequence DNA sequence to align shor reads to parameter ie required est fle name Fle in database format er SAM format f the box SAM output check to write the result of the alignment into Ths parameter ts required rebuilt index check this ta use an index instead af a referenc
66. ENE User Manual Version 1 11 3 11 3 DNA Flexibility To serch for regions of high DNA hel bli in DNA sequence open the sequence in the Sequence View ard select the Analyze Find high DNA fell regions em in the contest Noe that only standard DNA alphabet i supported Le the sequence shuld consist of characters A C G and The losing dialog appears HIDA Peeve ein The calculation made for overlapping windows along a given sequence If there are tuo or more consecutive dows wth an average Het threshold each window rater than the specied Threshold parameter Sich areas marked by an notation Tie average threshold window ls calculated by the flowing formula The following esl angles are use during the elation Dinucleotide Angle Dinucleotide Ange AA A CA EH AC 18 cc T2 AG 88 AT 125 GA 32 TA E 38 Ez EI 09 78 A nitus vale wen N characters i present na dle NC GN NG NN 72 ANNA TNNT 16 DNA Flexibility Unipro UGENE User Manual Version 1 11 3 11 3 1 Configuring Dialog Settings Inthe dialog you can setup the corresponding parameters Window sie the of banes in a window The window sise should be greater than 2 The valus 100 bp Window the number of hase to shift a window The Window stp should be postive integ
67. IUGENE able to read a document aee the Su le Todo it use the Dun Fl Formats chapter you can export the document lo you ean export the document objects of unlock documents 4 9 Using Objects and Object Views The document vay contains ane or more objects An object ta structured biological data that can be viale by diferent Object View A single Object View can visualize ane or several objects of diferent typet For example a single view can show a Sequence annotations for the sequence 3D model or the part of the sequence or ta chromatogram The type of an object indicated by the in the square brackets and the ican near the object Below is the Ist of object types supported by the current version of UGENE Object types Locked Documenta Unipro UGENE User Manual Symbol eon Description df AO mode Tel 9 tations or DNA sequence epo Ted d esent 1I Chromatogr d WE Ez with indes information ar ato her ual ge Tel dd Att sequence signent E protein or raw sequence A plain Te 377 You can elit names of patior objecta sch as sequence objects by selecting therm in the Project View and thon 2 To be able todo an the document contin th aret object must be unlocked Tose the list of all available views for given object select the obje
68. M search MUSCLE align The collectes information DOESN T include any personal data Path for temporary fles the path where vill be stored temporary les Default settings this option resets the default settings 4 16 2 Resources pec Dd TIE UGENE Application Settings Unipro UGENE User Manual Version 1 11 3 On the Resources tab you ean set resources that can be aed by the application Optimi or CPU count Tas memory hit and Thread lit 4 16 3 Network Ir Eee eadem ram On the Network settings tab of the dialog you can specify Pray server parameters sect SSL settings and configure the Remate oso EJ Chapter a Basic Functions Unipro UGENE User Manual Version 1 11 3 4 16 4 File Format The Sequence Annotations settings allows to upper lower cae annotations during the fle reading proces Format options 1 Dow une annotations default made sequence reading and writing 2 Use annotation sequences are read and annotations with names cs are added When these nequences are written t Fle en the cae he original e Fle he case i saved Use upper annotation there a similar behavior but with upper _ cae annotations X36 UGENE Application Settings Unipro UGENE User Manual Version 1 11 3 4 16 5 Logging m enr o som V uberes pr
69. ORFs starting with alternative initiation codons accord ingly to the current translation table Boolean Optional Default al SEX CL Predefined Tasks Unipro UGENE User Manual Version 1 11 3 12 2 5 Finding Repeats Name ind repeats Searches o repeats in sequences and saves the regions ound ss annotations Parameters in of Sting Required output fle with the annotations String uid name af the annotated reins String Optional Default repeat unit 1 minimum length of the repeats Number Optional Default 5 ident ity percent identity betwen repeats Number Optional Default 100 nce minimum distance between the repeats Number Optional Default 0 max distance maximum distance between the repeats Number Optional Default 5000 inverted W ru searches fer the inverted repeats Bolean Optional Defaut fale Example 12 2 6 Finding Pattern Using Smith Waterman Algorithm Task Name finds Searches for a pattern in a nucleotide or protein sequence ining the Smith Waterman algorithm and ves the elon ound a annotations Parameters in input sequence fle Regie cout output fle with the annotations String Required name of the annotated resins String Optional Default mise feature subsequence pattem to seach for eg AGGCCT Strin
70. PHYLIP Neighbour Joining 742 Mia Assembly Browser aa a6 a Import BAM SAM File and Zooming Assembly 2 821 Opening Assembler Browser Window 802 Browser Window 823 Assembly Browser Window Components 824 Reads Area Description 325 Assembly Overview Description 826 Ruler and Coverage Graph Description 827 Go to Pasion in 828 Using Bookmarks for Navigation in Assembly Data Getting Information About Read Short Reads Vizualzation Read Highlighting 342 Reads Shadowing Associating Reference Sequence abi Consensus Sequence E Exporting 1 en ati Exporting Red 312 Vise Reads 873 Exporting Comenius BTA Exporting Image Options Panel in Assembly Browser lt Navigation 882 Assembly Browser Settings Statice Assembly Browser Hotkeys an 891 Assembly Overview Hotkeys 332 Reade Area Hotkeys na 120 122 122 122 122 im E 124 E 127 128 128 129 130 m m 132 132 132 im E 135 135 1 136 138 137 138 138 138 139 10 n Phylogenetic Tree Viewer 34 Adjusting Tree Settings 9 2 Adjusting Branch Settings 93 Selecting Tree Layout Da Modifing Labels Appearance Showing Miing Labels 942 Alaning Labele 343 Changing Labels Formatting os Zooming Tree 96 Working with Clade Wisin 261 Seleting Cade 362 Colapsi
71. SCLE Transcription Factor Tasks Buldog Searching fr TFBS with Buikding Searching for TFBS with Weight Matrices Building Statistical Profle for SITECON Searching for TFBS with SITECON Other Tasks Fetching Sequence Remate Database SEX GU Predefined Tasks m Unipro UGENE User Manual Version 1 11 3 122 1 Converting Sequences Task Name converses Converts sequence from one format o another Parameters input sequence String Required name of the output fle String Required Format format of the output fle String Options The following values are available me Example 12 2 2 Converting MSA Task Name converts Converts a multiple sequence alignment fle from one format to another Parameters ia input multiple sequence alignment fie Sting Required name of the output e String Required Format format of the output fle String Optional The lining values are available deu p o stata stockholm Example Chapter 12 UGENE Command Line Interface Unipro UGENE User Manual Version 1 11 3 12 2 3 Extracting Sequence Task Name extract sequence Extacs annotated regione from an input sequence Parameters in semicolan neparatad tof input String Required uk outa Sting Required annotation names lt of annotations wich wil be accepted or
72. Sequences Converting MSA Estactng Sequence Finding ORFS Finding Repeats Finding Pattern Using Smith Waterman Alger Adding Phred Quality Seares to Sequence Local BLAST Search Local BLAST Search Remote NCBI BLAST and CDD Requests Annatating Sequence with UQL Schema Building Bowie Index Aligning Short Resds with Bowtie Buiging Profle HUM Using RMMERE Searching HMM Signals Using HMMER2 Aging with Aging with Kalan Aligning with MAFFT with MUSCLE Balding Searching for TFBS with PEM PWM Searching for TFBS with Weight Matrices Bilding Statistical Profle fer SITECON Searching for TFBS with SITECON Fetching Sequence from Remote Database 123 Creating Custom CLI Tasks 13 APPENDICES 131 Appendix A Supported File Formats 1312 Speci File Formats UGENE Native File Formats Other File Formats 27 E 235 2s E E 238 239 239 240 240 PI 26 242 E 24a 2 245 245 26 246 Pd 247 249 249 250 250 21 251 252 252 2s 255 1 About Unipro Established in 1902 Unipro company has ta headquarters located in Novosibirsk Akademgersdok the home of Siberian Branch of Rusian Academy of Sciences The company s primary activity is IT cusaurcig solutions learn more about the company please it the company eb 1 1 Contacts Company website pi fni Miren Un 6 1 Lavrentiev Avenue 10000 Novosibirsk Rasa Marketing de
73. Types of SITECON Models Smith Waterman Search 2 1131 HMM Model HMM Build 11132 Calibrating HMM Model HMM Calbrate 11133 Searching Sequence Using HMM Profle HMM Search ILLO Building HMM Model HMMS Build 1114 2 Searching Sequence Using HMM Profle HMMS Search 11143 Searching Sequence Against Sequence Database Phmmer Search uMUSCLE 11151 Aligning with MUSCLE 052 Alene Pre to Poi wth MUSCLE 11153 Aging Sequences to Profle with MUSCLE 11161 Aligning Short Reads with Bowtie 11162 Bulging Index for Bowtie Bwa 11171 Aligning Short Reads with BWA 11172 Belding index for BWA UGENE Genome Aligner 1181 Aligning Short Reads with UGENE Genome Aligner 11182 Bulging Index for UGENE Genome Aligner capa Weight Matrix 11201 Searching JASPAR Database 11202 Building New Matic 170 m 174 175 175 175 175 175 178 7 m 178 Lj 183 185 186 187 E 194 194 195 Lj 197 200 202 202 E E 205 206 E 209 210 212 215 27 E E za 224 226 Unipro UGENE User Manual Version 1 11 3 1122 extemal Tools Configuring External Too 1123 Query Designer 12 Command Line Interface 121 CH Options 122 CLI Predefined Tasks 221 1222 1223 1224 1228 1226 1227 1228 1229 12210 pau E Bin aie 12215 12216 ES 12218 12219 122 1222 122 1225 122 Converting
74. Unipro J GENE Unipro UGENE User Manual Version 1 11 3 Contents 1 About Unipro Contacts 2 About UGENE a m 21 Key Features 22 User Interface 23 High Performance Computing 2a Cooperation lt Installation E 31 Installing UGENE on Windows 32 installing UGENE on Linux 33 Installing UGENE on Mac OS X 4 Basie Functions UGENE Terminology 42 UGENE Window Components 421 Project View A22 Tak View 423 Lag View 424 Main Menu Overview AA Creating New Project AS Opening Document 451 Opening for the Fist Time 452 Opening Document Present in Project Creating Document Exporting Documents Locked Documents Using Objects and Object Views 410 Exporting Objects 4201 Exporting Sequences to Sequen 4102 Exporting Sequences as Alignments A303 Exporng Alignment ta Sequence Format 204 Exporting Nucleic Alignment to Amino Translation Using Bookmarks 10 10 Dy 12 2 D 15 16 16 7 18 D 20 20 20 2 25 25 26 27 2a E a an m aus m ar Working with Projects Options Panel Adding and Removing Plugins Fetching Data fom Remote Database UGENE Application Settings SER y 61 General 4162 IES Navek A164 Fle Format 4165 Losine Opench A181 Designer 41610 Eternal Toot Creating and Using Index File rere Sequence View
75. a Rest When the search parameters has bain selected and the OK button has been prea in the dialog the Buta annotating bettas enabled n the Annotations editor the ORFs ataotons can be fund in the ir the has been fished you ean Lese the ets sort hem by length strand or start poston and save annotations to the original sequence In the Genbank format Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 6 Remote BLAST The Remote BLAST plugin provides the capability to annotate sequences with information stored in remote databases To perform a remate database search open the Sequence View select the sequence region to analyze and click the Analyze Query remate database content menu kem fa region not selected the whole sequence wl be xm ape m ala eee eae pen sepa e Egan UE PUEDE TE Sere HIM ST The following dialog will appear where you can the search optione aman uae agra oe nce Sievers oc e gnc Rer egy ene see TU Remote BLAST Unipro UGENE User Manual Version 1 11 3 General optione are Select the search type in the remote databases the blastn search a for nucleotide sequences sed cdd socia are fr arino UGENE provides a way to use blastp and celd searches for nucleotide sequences achieved
76. age vel as ies format su pg 6 2 7 Working with Several 3D Structures Views To add another vieu t the Structure Viewer you ean 1 Drag a required 34 object from the P to the 3D Structure Viewer EEr E ke PE Ier 2 Press the Add but on the toolbar The Select tem dialog will appear Select 3 abjecta to ad Hint Use the cel keyboard button to select several objects Chapter Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 Belin you can ee the 3D Structure Viewer with to vies Wi Keve 5 O ue To select an active click the vieuw area or select an appropriate valie in the Active view combo the toolbar To synchronize the views press the Synchronize 3D Stuctre Views sticky bution on the toolbar ee the ima above When the utor has been pressed the 3D structures are Pres the button ta the views an The views that are more required can be lased by selecting the Clase bution in the 3D Structure Viewer Also you can hideshow vens For a whe Use the menu of the green arrow button on the toolbar to do it Notie that the 3D Structure Viewer ean be closed from this menu EZ SO Structure Viewer 3 Unipro UGENE User Manual Version 1 11 3 6 3 Chromatogram Viewer The Chramatosram Viewer plugin brings DNA chromatogram data viewing and editing capables into Cu
77. ain learn more about veli covered reglon refer to the Assembly Srwsee Windle chapter o lean more about searching required position refer ta the Go ta Position in Assembly chapter 8 8 2 Assembly Browser Settings The Aste Browser Settings tab includes Reads Area Consensus Area and Ruler sting EI GRapter a Assembly Browser Unipro UGENE User Manual Version 1 11 3 i E Ta learn more about Beads Ares settings refer to the Reads Ares Settings chapter To learn more about Consist se the Consensus Sequence chapter Ta learn more abont Auer se Browsing and Zooming Auembl chapter 8 8 3 Assembly Statistics The Assembly Statisties tab includes the flowing Assembly Information Name the name of the opened assembly Length the length of the assembly Reads the number f reada in the tabs can include the Reference Information t is availabe in the assembly e Far example 5 URI 38 Options Panel in Assembly Browser 3 Unipro UGENE User Manual Version 1 11 3 8 9 Assembly Browser Hotkeys 83 1 Assembly Overview Hotkeys The following hotkeys are available for the Assembly Overview Acion Zoom the Overview 1o selection Zoom the Asently Overview Zoom the Overview x Move the Rey Overview 8 9 2 Reads Area Hotkeys The felling hotkeys are a
78. ales ito account quality values of reads and nucleotides and works with the extended alphabet lesve only between the sference and the consensus sequences highlighted on the consensus se quence select the Show diference reference tem in the contest menu of the Consensus Ares or the Diference reference item on the Assembly Browser Settings tah of the Onis Porc Ta export Consensus Sequence right click oni i the Consensus Ara and the Export Export consensi kem nthe contest menu For mar information abo rrsenss exporting see Exporting Consensus 8 7 Exporting 8 7 1 Exporting Read red on ita the Reads Ares and select the Export Current red Rem la the context The Export Read dislag appears Select a to export the read to and the format The read can be exported ether to FASTA or FASTO fie When the parameters are set click the Export button The read is to the fle and if the Add ta project check box has been checked it sade to the current from where you can open it 8 7 2 Exporting Visible Reads To export all reads visible in the Fac Ares select the Export gt Visible reds item in the Reads Area content The Export Reads dialog appears The dog is described in the Exporting Read section E Chapter Assembly Browser Unipro UGENE User Manual Version 1 11 3 8 7 3 Exporting Consensus To e
79. ample Open a sequence in the Aliment Editor the Satie Generate rid pole contest mona The dialog will appear p Eleonora otro Here is a bil description of the ations that ean be set in the dog Profle mode Count Percents select the Percent o have scores shown as percents i the report Show scores for check this iF you want gap characters statis to be shown in the report DNA Statisties 38 Unipro UGENE User Manual Version 1 11 3 Show scores fr sys not in aliment W a sel ot i th agent at all it won t be shown in the report Check this em to mal al snbol of alignment alphabet reported She sips in consenaus position increments costae ruler configuration I checked the gapa in ora not led niler tenenti profe to fle allows to save prole to a filein the HTML or CSV fermat The CSV fermat is convenient for further processing in worksheets editera Exel The result rie in the HTML made LE Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 5 ORF Marker From this chapter you can lam how to search fer Open Reading Frames ORF in DNA sequence The ORFs fund are stored ex automatic annotations This means thatthe automatic annotations highlighting has been enabled then ORFs searched and highlighted for each sequence opened Refer Automate Fishing to
80. an hide branches of a clade by selecting the Collapse in the contest menu of the clades root node Sen the result of a eallagsing on the image below E M De acier have boen To show the collapsed cde select the Expand item in the node s context 9 6 3 Swapping Siblings To interchange the locations of the the two branches of a dade sect the Sp Siblings em in the context mena of the root node of the clade LI Chapter 9 Phylogenetic Tree Viewer Unipro UGENE User Manual Version 1 11 3 9 5 4 Zooming Clade Additionally to other zoomning options you can use the Zool Rem ia the content menu of the sot node of a dade 9 5 5 Adjusting Clade Settings When a chade is selected the branch and the labels formating sega applied to the clade only Note that the settings are not applied to the collapsed branches if any an example of changing branch settings for a dade 9 7 Exporting Tree Image A tree image can be exported to raster format pn jpg mp ec or to a vector format sg Sekt ether the Export Trae Image toolbar button the Actions Export Tree tam in the main In the submenu appeared eet the Screen Capture item ta save the tree image to a raster format The standard Save As dialog wil appese where you select the fie name and format Te export a tree image ta a vector frt select the As SVG item in the Export Tree Image bens 9 8 Printin
81. an turn off the Sequence fiot by unchecking the Actins View Show main menu item or View gt Shaw contest menu tem Global coordinates This component displays tke coordinates of the upper left camer af the current selection IF no resin is eons the starting alignment pint TX Overview Unipro UGENE User Manual Version 1 11 3 Alignment lock status a i Sequence View ths component shows whether the alignment loched Locled documents are mot allowed t be modi 7 1 3 Navigation The Sequence area provides several flexible ways ta navigate through alignment The simplest way i to e the mase and the scroll Alterratlvely you can use arrow keys on the keyboard ta navigate The lst af hot keys for quick navigation Pagelip to move oe screen let PageDown la mave one sereen right Hone to center the starting columns of the alignment to mave ta the trailing columns of the alignment Hint if you use shie ey with the hot keys above jou will navigate through the rows For example shit PogeDown wll mave one sereen down Finally can ute the Go to position dialog rom the Actos menu the context menu or the editor toolbar Enter the column number base coordinate nd the view will be centered to the corresponding bare 7 1 4 Coloring Schemes Thare are various ering schemes for DNA and amino alphabets available Te change the scheme activate t
82. aph To run the search task on a remote machine you reed ta do the flowing Open a sequence and select the Tools e HMMERS tools Search HMM signals in the memens Inthe appeared HMM search dialog f required parameters and dick the Remate ton Tel Rgotrovetrik sudes o essem Goose ETT TT E sese 1 The Remote machines monitor dialog will appear You can al add remove or modif remote machines here Select a machine to run and cick the Run butten Note that only 1 machine tan be selected in the curent verson af UGENE That s all After the task sited you wil aee the task report in the Task View 10 3 Running HMMERS Search Task on Remote Machine E Unipro UGENE User Manual Version 1 11 3 10 4 Running Smith Waterman Search Task on Remote Machine Read the Si Waterman Search plugin documentation before reading thi paragraph To run the Sth Waterman Search task a remote machine you ned to do the following Open a sequence and cick the Analyze gt Find pattern Smith Waterman em i the Sequence wl wo ive Ey cer Em a You will see the Smith Waterman seach dilog Fil required fells and click the Remote run The Remate machines monitor dialog will appear You can al ad remove or madly remote machines here Select a machine to run and cick the
83. base o a conten sequence la as a function of the comesponding coms bases There are diesen calculate the coraeaus Each method reveals unique boli properties of the aligned Sequences The Alien allows switching between diferent consensus modes sch the consensus mide state the contest menu using the right mouse button or the Actions mens and select the Comenius mede hen rT 0 0 2 based on ea algorithm etum i f there are 2 charactere on Ireguency Spot in lawe casei te Bi bol Conen in wi ower than the teshold spaced P pi 4 Se There are modes Default it is base on the grim Returns f there are 2 characters wth igh frequency Returns symbol in lower case f the symbol conten i row uer than the speed threshold ClustalW emulates the ClustalW program and fle format behavior Levitsky this algorithm i proposed by Vicar Levitsky to calculate consensus of DNA alignments At fist It collects global aliment frequencies for every symbol sing extended 15 symbols DNA alphabet Then for every column it selects the rarest Symbool on the wile alignment with percentage in the colam or squale to the threshold vale Strict the algorithm retums gap character if symbol frequency in a column i lower than the shold specified ie Chapter 7 Alignment Editor Unipro UGENE User Manual Version
84. bed above Manipulating Sequence Unipro UGENE User Manual Version 1 11 3 5812 Exporting Selected Sequence Region Open a sequence object in the Sesion View and select a region by pressing and moving the left mouse button er the sequence e the Export gt Export selected sequence region context menu item ta save selection nt of a sequence amat QBH AXA bau SD o ereeeeretencercance The Export Selected Sequence Region dog wil appear which ts similar to the Export Selected Sequences dialog 5 8 13 Exporting Sequence of Selected Annotations Open the Sequence View with document that carta sonotatont A god candidate here codd be any fe in Genbank amat with both sequence and Select a single or severi annotations tr annotation groupa Inthe Annotation editor ciek the right mouse button to open the contest menu and select the Export Expert of elected aprottons tem Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 Foes Sele eer je 3 qim temere poo The Sequence of Selected dialog wi appear which is sinlar to the Export Selected Sequences dialog ic 58 14 Locking and Synchronize Ranges of Several Sequences important feature ofthe Sequence zoom view ithe to synchronize and lach aul ranges of dient sequences shown in the Sequence View This f
85. by translating the nucleotide sequence into the amino sequences When a sequence translated the translation table from the active Sequence View is Finaly all 6 translations are to query the remote database with the blastp or ed serch Eipectation valie this ton specifies the statistical significance threshold for reporting matches enirat database sequence Lower expect thresholds are more stringent leading ta fewer chance Patches being reported Mas ki the our of Hits that wil be shown oot equal to numberof annotate Database the target database Search or short nearly exact matches automaticaly adjusts the ward and ether parameters improve reals shore queries Magablat select this option to compare query with clonely related Sequences It works best if the target percent 95 or more but ti very fast You can se the description of the annotation saving parameters ore Search timeout sometimes a database doesn t respond therefore you reed to rexit for the response This option sets the time that wil be spent for reappes to the database Note that in ie of ong sequences time for request preparation acreses and the seach takes several minutes Alo there is Advanced option tab Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 n pp Mtem M rom The view of the Advanced options tab depends on the selected search For th
86. cat you are able to use Clastal from Stings dog Open multiple sequence alignment file the Algn with ClustalW item in the context menu or in the Actors main menu The with Clita dialog apear see below where you can adjust the following Cap opening penalty cost of opening up a new gap in the alignment Increasing this value wil rake gaps les Gap extension penalty cst of every item in a Increasing this value will make gps shorter Weight matrix species a single weight matrix for nuclestide sequences or series of matrices for For nucleotide sequence the weight matic selected defines the scores assigned to matches and mismatches including IUB ambiguity codes it can take aues JUB default searing matrix used by BESTFIT for the comparison of nucleic acid sequences Xs and Ns are weated ss matches to any IUB ambiguity symbol matches score 13 all mismatches for US symbol score 0 CLUSTALW previous system sed by in which matches score 10 and mismatches Score match for IUB symbol also core For protein sequences it describes the similarity of each amino acid to each other The flloving alit are avaible BLOSUM 1 lt of Amino Acid SUbsttutien Mati introduced in a paper by Hen and These matrices appear to the best available fr carrying out database arty homology searches PAM Point Accepted Muta
87. ced by redundancy in a particular part af the sequence It is represented on a plot a rectangular area filed with the matches 4 Low complesty regions sp sm EEE Aen Hints Compare sequence with itself to Fd low complexity regine in it 6 5 6 Editing Parameters posible ta parameters of a built dotplot Right click on the dott and select the Dotpbot Parameters Sekt es Crh The parameters dialog will be reopened See description of the available parameters here Unipro UGENE User Manual Version 1 11 3 6 57 Saving Dotplot as Image To save as image right click on the dotplt and select the Save Load 4 Save as image lable formats are png jog and bma 6 58 Saving and Loading Dotplot To save a in a native format right click onthe delat and select the Dotplt Seve Lond Save The Save dislag will appear A dotplat le saved in a with the dpt extension Later thedotlt can be loaded using the Dotplot Save Laat Lond contest menu item 6 5 9 Building Dotplot for Currently Opened Sequence Te build dept for curently opened sequences create a multiple view containing these sequences It can be arranged bj digging the corresponding sequence jects the ems strated with the it the same Than rightclick on the crested view and select the Analyze Bull dott item
88. chai enhancer achte B cs NET The p50 5 RELA heterodimer i the mast abundant frm of NEKE WEE homo The amp a member of the NF KB family cf transcription factors and con homology domain on ven pe TI SECON Unipro UGENE User Manual Version 1 11 3 11 1 continued from previous page eiad derved 2 ia 2 wansciton factor T Protein 53 Paranedian pontine frat Tea poten that in umana encoded y he SPI ge CAMP response clement binding acres AMP response demen binding En Serun repone denen Serum response factor Signal and civ c Tancig T Signal and of Transition Thyra a Upstream stimulatory factor rane encode the Prokaryotic Nan Description T Te aceiglaconaine reper negatively conl the eren of he aga gne ater D aC the domain a priced Nace gators vasgor ng PEP dependent ptem transcriptional dsl regulator eg comlesed with Largnine represses the Wanscpion of several genes ilv i biosynthese and transport of arginine transport of histidine and ts cam synthesis and actes genes for arginine cata DNA ining response regulator in be component regu
89. cking on the item the Export chromatogram fle dialog will appear em Cma Check the Reversed and Complmened options f you want to creste reverse and complement chromatogram Pres the Export button The export e will be opened in the Sequence View 6 3 2 Viewing Two Chromatograms Simultaneously To add another sequence to the Sequence Vine drag the required sequence abet fram the Project View and dro It in the Sequence View area Note that the dragged object ia the sequence object nt the chromatogra Ghromatogram Viewer E m ali ipler amp Sequence View Extensions Ghromatogram Viewer 3 Unipro UGENE User Manual Version 1 11 3 6 4 DNA Graphs Package The DIA Graphs Package dava contextual graphs for sequences The DNA Graphs Package i avaible for the Standard DNA alphabet A C G T and N Open a sequence in the Sequence View and the Graphs on the The popup menu appea Chase m Secon pr mos soos 0 mtn To see a graph select the graph item in he popup menu new area with the graph appears risht shove the snam vi Each point on a graph eaeulated for a window of a specified size
90. ct and activate the contet menu inside the Wido and select the view submenu X d ne oss nen ruse vk hw umm f pt v p n mae The picture above option to visualize the selected DNA sequere oet using the Sequence Vi Da teres and extensible Object View that facies on f sequence abject in cmibaton with erent hinds of related data sequence annotations graphs chromatograms sequence analyse algorithms Note thatthe Sequence View described i more details in the separate d 4 10 Exporting Objects The document ass can be exported into new document For more details see the following chapters Chapter a Basic Functions Unipro UGENE User Manual Version 1 11 3 4 10 1 Exporting Sequences to Sequence Format Sekt a single or several sequence objects inthe Project View window and dick the Export Export sequences Stent ena 00en tema mao S eran decane Lack demen for s ng Mae harani Es sina mecs ci pre The Export Selected Sequences dialog wil appear Exporiing Objects Unipro UGENE User Manual Version 1 11 3 RH poupee po E Secrets Omen pL e Here you select the location of the result fle ard sequence fle fermat You can choose to add newly create
91. d document tn the current project and expert sequence with annotations or without sanatatlons To do it cheek the corresponding Uke the Conversion options te choose a strand for saving sequences Abo you can translate sequence to amino alphabet Aka ies posible to specify whether to merge the exported sequences into a single sequence er store them as Separate sequences If you merge the sequences youre allowed to selec the symbols between Sequences ie the length of the inertan region between sequences that contain N symbols for nucle or for protein 4 10 2 Exporting Sequences as Alignments Suppose we vant to interpret FASTA as multiple alignment Todo this select single or several sequence objects nthe Pre Vn window liek right mous button to open the context menu and select he Export s pert sequences as aigue hem E Chapter a Basic Functions Unipro UGENE User Manual Version 1 11 3 Ge remm X deem B 7 ETE The Export Sequences as Alignment dialog will appear where you can point the result alignment location to a multiple alignment fle Fermat to Genbank SOURCE tags a name of sequences for Genbank sequences and optional add the created document the current pret ORC ot aes OH Cem 4 10 3 Exporting Alignment to Sequence Format Sele inde object with sequ
92. e MUSCLE alignments Rn remote MUSCLE tak Working with Alignment T Unipro UGENE User Manual Version 1 11 3 7 2 5 Working with Sequences List Adding New Sequences You can add new sequence to an alignment using the Add submenu in the Actions main menu or the context There are to ways to add sequence to the curent alignment Fle in the compatible format FASTA GenBank et The lat of the supported data formats can be found here From the project MF you seat this hem the folowing dalag wil appear p You see the Project View titre to show only appropriate sequences Select the tems to add and press the Ok button Copying Sequences To copy current selection click the Copy Copy selection item in the Actions main menu or the cones menu The hethey fer ths action Cert C To copy one ar several sequences do the following Select the sequences in the Sequence lat ae Sect the Cony gt Copy selection cotto menu item inthe Sequence re or hat hey combination Noe that fou activate contest menu in the Sequence ot area you wil se your curren selection Chapter 7 Alignment Editor Unipro UGENE User Manual Version 1 11 3 copy consensus sequence use the gt Cony consensus Hen Sorting Sequences To srt sequence by in tha alphabetical onder choose the View Sot sequences by name
93. e the more libely the heated chains are to more between isolated peaks in the posterior distribution Random a for the radar number generator ove tree to file to save the buil tee Pres the Build button to rn the analysis with the parameters selected and build a consensus tree E Chapter 7 Alignment Editor 8 Assembly Browser The UGENE Assembly Browser project started in 2010 was aspired by Ilumina IDEA Challenge 2011 and muhiple resist fom UGENE The ain gal f ihe Assembly Brower a toe a user sale and ficiently bose large net generation sequence assembles Currently supported formats are SAM Sequence Alignment Map and BAM which is a binary version of the format Both formats are produced by Salt and deseribed the folowing speifeation Support c other formats alo planned please send a request if youre interested in a certain format To bronse an assembiy data in UGENE or SAM fle should be imported UGENE database fle After thot you can convert the UGENE database into SAM The Import to a database le has both advantages and dsadvantages The disadvantages ae that the impor moy take time for a large fle and there Should be enough dak space to store the database fle On the other hand this allows ane to overview the whale assembly and navigate in it rather rapidly In addition during the impart you can select contigs ta be imported from the B
94. e Add button In the appeared dialog select the protocol and fil other ds U Add remote machine pra Ca Cee Modification ofa remote machine is as simple a adding a new one Just dec the machine and click the Modi batten Ta remove a remate machine fom the monitor select the machine in the abe and dick the Remove Button You can Ping remote machine ta cheek alve and is sil running there Some network protocol fer example direct socket protocol can do scanning of local never search fer running UGENES through such protocols cick the Sean button Abo you can use one of the publie UGENE machines to run your tasks on it To add publie machines to the monitor click the Get publie machines button emote Machines Monitor Unipro UGENE User Manual Version 1 11 3 10 2 Running Workflows on Cloud 102 1 Introduction The Heros Designer is a powerful extension of Uniro UGENE which allows to easily construct and execute computational wake ea interactive visual interface and provides a lt of capable This manual section explains how to launch workflow schemas on the clout Make sure to read the documentation pages devoted ta the Viri Designer There also video tul Using Workflow Designer to export sequences rom ik into FASTA 1022 Cloud Computing Basically clout is cluster of virtual servers available over the Internet One can use
95. e blastn search looks like on the picture above We stae the of the subseqence parameter or the initiated search Gp costs costs to create and entend a gap in an alignment Increasing the cost will result in alignments which decrease the numberof Caps troduced Match scores reward and penalty for matching and mismatching bases Entre query a BLAST seach be lite to the result of an Entree query giat the database hon This restricts the search toa of entries From that database ng the requirement of the Entren gury Examples are given belon protease NOT hivtforganism this wil limit a BLAST search to all proteases exept thee in HIV 2000 200je this limits the search to entries with lengths between 1000 to 2000 tes for nucleotide entries or 1000 t 2000 rendus for pratenn entier Mos muscuhaforganin AND biomal_menafpraperties this limits the search to mouse URNA entres inthe database For common one can abo select om the menu 10000 10000 ia yet another example usage mhich nits the search ta protein sequences with calculated molecular weight between 10 KD to 100 D sre specimen voucherforaperties limits the search ta entries that are annotated With a Japecimen voucher udi er on the source feature TU Remote BLAST 187 Unipro UGENE User Manual Version 1 11 3 Mfr NOT emviromnental simple NOT metagenomesjorgr this se urea
96. e mapping and wil be written at the BC SAM tae For pared end reads the barcode from both ends are concatenated Colanpace color the input is read in colorspace colors are encoded as characters A C G T Acte Gaange Tred Long ealed gap penalty for long deletion 2 gap penalty for long deletion Nomterative mode N disable iterative search All Hts with na more than AT differences tall be found This mod much slower than the deal Select the required parameters and press the Start button 11 17 2 Building Index for BWA To build AWA index select the Tools Assembly Buld Index item in the maln menu The Build Index appears Set the Align short reads method parameter to BWA The dialog looks as fellows There are the flowing parameters eleresce sequence DNA sequence to which short reads would be aligned to This parameter is Indo sae ile to sve idet to This parameter is required Indes Algorithm for constructing BWT indes Available options are I implements three firent olgonthns 1 designe for short reade up to 200bp with low errar rate It does gapped global reade spart pred end renda and ce of the fastest short read alent ia date wil ao suboptimal i 2 bes la designed ar long with mare errors t paroi uiti Sith Waterman the to ind high scoring local hits
97. e reference x Reference sequence mismatch To copy the information about the read to the cligheard select the read information to elfaba item in Reads Area contet Now you can paste ein any tert edite To copy the current postion of the read select the Copy curent pasion to elpbaard tm in the Reads Area 8 4 Short Reads Vizualization Thare are various modes of reads highlighting and shadowing 8 4 1 Reads Highlighting To apply reads highlighting made select it in the Reads highlighting menu of the ds Area contert menu or the Assembly Browser Settings tab of the Options Panel The folowing modes are slab Nucleotide shoes all cli in diferent coo t s aed by deat Diference highlights gaps and nucleotides that differ fram the reference sequence oe Ea Shor Reads Vizualization E Unipro UGENE User Manual Version 1 11 3 Strand direction highlights reads locate onthe direct standi e and read on the complement strand Paired each Highlights all paired reads in Note tat the information about the pl is shown ia 84 2 Reads Shadowing Various modes of enum Wighlighting malae fom the Reads shadowing iem ia the content menu of the Pend Area Dialed highlights all columns of nucleotides Free highlights all reads that intersect a given column In this mode you can lock a position Click the Lock here em contest menu
98. e seach parameters Here you can see effective weighting strategie opone pre rama iy 11 14 2 Searching Sequence Using HMM Profile HMM3 Search The HMM search tok rend a HMM eoe from a ad sachen a sequence for significantly similar sequence watches The sequence must be selected in the Project or there must be an active So ce View window opened the selected sequence cee and profile HMM ia built fram amino alignment the sequence wil be automat ily translated and searched in ll possible frames 6 total Ifa proe HMM bull fer roce alignment the search is performed fer both stra direct and complement The HMMS search accepte the HMIMER2 HMM poles amino only as backward compat feature An interesting pat about using the HMMERZ models withthe HMMERS is avalable n the Sean Ey oy areas T EET voeien fte amp J O esas ense 3 imu Genere mane mam mM LI Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 For example reporting thresholds options can be configured using the dialog ESET Retire ht vaie bestan xe 8 gar The search are stored as sequence annotations in the Genbank format Warning The search works only with Fles that contain single HMM model ES Unipro UGENE User Manual Version 1 1
99. e segues Aso you can al aly GERE Genome Aligner m Unipro UGENE User Manual Version 1 11 3 SAM output checking this allows one to save ovtput Fles in the SAM format The default emat of output ls the UGENE database format agendi Short reads each added shert read i small DNA sequence fle At leatt one read should be ed ote Tie Aligning Short Reade with Genome Alier has Uinitation on shart ead length Comman parameters Miratches allowed check this bex o allow mismatch between the ference sequence and a short etd Select one of the folowing Mismatch number to set the number of mismatched nucleotides allowed Tha p ean vile 1 2 and 3 Percentage of mismatches to set the umbar oF iamatehes in percents Nate that in this the achte mmber of mismatches can vay fr dierent rede Tus parameter can take values 1 10 Align options Use GPll aptimiestion use an openClenabled GPU during the alignment the corresponding hardware sho be available your computar gt Align reverse complement res baih a red and its reverse complemen during the alignment Use best daring the alignment report only about bat alignments in terma rates reds with qualities lawer than all wth quan lower than the specied value Reads that have na qualites ate not ome Advanced parameters Mari hot rendi
100. e vere guided by the allowing principes Make the HMMER scesite to a wider user audience by providing graphical interface for all pe posed utile for of the platforms Be compatible with the original HMMER2 package Create the high perfrmance elution utilising modem multicore processors and SIMD instructione The current version of UGENE provides user interface for three HMM tools HMM build HMM calibrate and Mant serch Inthe original program the corresponding command are hb hemealizate and imme access these tools select the Took HMMER tools submenu of the program main menu Tor ne N Di p m Kt RT PP We beh recommend reading the original HHMER2 documentation to learn haw to lies provided by the m Note SSE2 algorithm implemented by Leonid Konya State University Use of the SSE2 op ized version ol the HUM sure algorithm with quad care CPU gs gt 30 performance boot when compared ih the orginal wagle threaded algonthm unge sequence mode 11 13 1 Building HMM Model HMM Build HM boi tol ta build a new HMM profe from a multiple alignment You can une any fle formats supported by The output HMM prie format compatible with the HMMER2 package LE Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 n LJ LJ ritos tange cnc T
101. ean mere To open the ORF Marker dale select the Analyze Find ORFs item in the context um e a AL 5 C Ab overige ae CEU The following search settings are available Min length ORF with length ower than Min length value wil nat be found Must terminate within regian this option ignores boundary ORFs located beyond the search region start with init codon tem switches the ORF Marke algorithm to the mode when any non stop amino scd code i interpreted reglon start potion Allow overlaps alternative downstream initiators when anather start codon is located within a longe ORF Le all ORFs wil be found not aniy the longest ones liq alternative hit endon option ORFs starting with alternative initiation codons ac rng ta the curent translation table ORF Marker Unipro UGENE User Manual Version 1 11 3 che codon includes stop codon ino resulting annotations Tie other available parameters are DNA to Amino translation tabe defines the way start alternative start ad stop codons are encoded Strand where t search the ORFs in the direct strand the complement strand or in both iranda Pieve slaw to preview the regions strands and lengths of the found ORIS Cla ets becomes avaiable when some results have been found crt these renh
102. eature ia available when there are two or more sequences opened in the same Sequence View JE ue iick the Lock scales button the second sequence sae wil be adjusted ta be the same as the focused seale and socked Now we move srr or zom buttona for any of the segues Vial Tanges fer the rest sequences wil ae be adjusted 1E al Lock seals buton Synchronize Manipulating Sequence a Unipro UGENE User Manual Version 1 11 3 To unlock the scale ick the same button You may ise the Adjust scales button to synchronize scales without locking them Note that if you have a selected sequence region or a selected annotation the scales wil be synchronized by the start positon ofthe region or the annotation If there o active selection the gions are syrehronzed by the vile sequence position on the sereen Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 5 9 Annotations Editor The Annotations editor contains toole to manipulate annotations for sequence It provides convenient way to organize and single annotation wel annotation groups An annotation fer a sequence consiste of Mame or hey indicates the biological nature of the annotated feature Location coordinates in the sequence The lst of qualiiers qualifiers are the general mechanism for supplying information about annotation Quaere stered pa
103. en sort 3 E nm lin p a O Gate ilr Sese 8 The dialog parameters Tandem preset specify the tandem repeats parameters with predefined values by selecting the avaiable pet Min perd Max period the minima and raum acceptable length in base symbol ein to specify the region to search in the whole sequere a esto region or the reglon sf the selection f aj annotations t specify the existing or new annotations table fle to save the resulting Annotation parameters you can change the defaut group and sme vla of he eating Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 EXEC n pp Additional search options can be found in the Advanced tab Algorithm the algorithm parameter allows ta select the sereh algorithm The default and fast ane in optimized array Minimum tandem size the minimum tandem sie sets the limit on minimum acceptae length of ihe tandems the minimum total repeat length af the searched tandem Minimum repast count tha nina number of repeats of a searched tandem Show overlappe tandems check if the plugin should search for the overlapped tandem lherise Keep unchecked Tandem Repeats Search Result An example of the search ret for the microsatellite p
104. ence ligament in the Project View window and dick the Export Export gman to sequence Frat contest mets tem 10 Exporting Objects E Unipro UGENE User Manual Version 1 11 3 Voice etd jn Tad doctor fie Ingo ger pue por nasi signere me neis ces 8 Here posible ta specify the result fle location ta select a sequence format define whether to beep remove gapa chan in the sequences and optionally add the created document to he current project 4 104 Exporting Nucleic Alignment to Amino Translation Select single with a rule sequence alignment in the Project Vies window and click the Export Export nuclei alignment to amina translation context menu tem EJ Chapter a Basic Functions Unipro UGENE User Manual Version 1 11 3 Tk dee es Meses Hep amp Emm perm tect decent P puru t Lg se Save ected doen m 7 77 Here it posible specify the Fle location t sedet Gle format and an amin translation to export he alignment or selected and optonally ad the crested document tn the curent project 4 11 Using Bookmarks One of the most important features supported by most Object Views ean ability to save and restore vial view state Saving and restoring state of an Object View enables rapid between dieren
105. ent MSA Select a subalgnment and choose the Edit Extract selected as MSA item in the Actions main menu or in the contest The fling dialog appears the nae of the new MSA file in the File name The curently selected region is extracted by default when you res the Extract button You can change the columns to be tracted sing the Fram and to fell And change the rows to be extracted by checking unchecking required sequences in the Selected sequence lat Use batons selection to avert the selection ofthe sequences Select to select al section to clear the selection of all sequences The Add to project check box species ta add the MSA fle created from the ubaligunen ta the active project Removing All Gaps se the Edit Remove all gaps item in the Action maia or in he context to remove all gaps from the alignment Removing Selection remove a tbalient select it and chose the Edit gt Remove selectia item ia he contest menu or press the Delete ie Chapter 7 Alignment Editor Unipro UGENE User Manual Version 1 11 3 Removing Columns of Gaps Te remove cantalng certain number of gapa select the Edit Remove columns of gps tem in the contest The dialog appears O ane gare Tiere options Remove numbe
106. ent that contains annotations Select a single or several annotations or annotation groups m the Annotation editor select the Export Export anpotatirs context menu em The Export Annotations dialog wll appen Here you can set the path to the Fle choose the format and optional fr CSV fermat you can ave the sequence along with annotations and sve sequence names C Chapter 5 Sequence View 6 Sequence View Extensions sence View Extensions Blow is can be significantly increased with the demonstrant functionali The Cicul Vie ITem Unipro UGENE User Manual Version 1 11 3 Chapter Sequence View Extensions Unipro UGENE User Manual Version 111 3 The provides a tol to build dotplts for DNA or RNA sequence B Na seven rh 1 deri 20090 numberof ather instruments add graphical interface for popular sequence analysis methods Unipro UGENE User Manual Version 1 11 3 atere vans vmm we amp IX coe A avant pa raters ta d pa mripat attr dms lt menn Eun E gt Bl arn EH dn B retos f ro E sear TIM sarak hr ee 9 peine CECE Cau For details ses the next sections of the docume
107. er The default value 1 bp Threshold the threshold value of the tis angle see above The default value i 137 You can remember the laput values or etre the default values using the Remember Sting and the Restore Defaults buttons The annotations names and other parameters can be changed on the Output tab of the dialog m Once the Search button has been pressed the annotations For the regora of he high DNA ibi are created 11 3 2 Result Annotations Each annotation ha the following quar merge ferio average window threshold In the area ie dal wir ons mune edd num of al window thresholds in the area number vibe of videt in tha re Note Using the Graphs Package you can se the Hell graph af a DNA sequence LI Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 4 DNA Statistics The DNA Statisties pg provides exportable statistic repart tn the current UGENE venion the DNA Statisties plugin provides only Aligamant Gd Profle report The Alert Grid Prale shows positional amino acid or counts highlighted according to the requerey of symbol ina ro The original idea of the MSA Grid Profle is acted in the flowing paper Alberta Roca Albert Almada and Aaron C Abajian as a new visual representation of large multiple sequence alignments a cae study ofthe RecA protein fni BMC Bioinformatics Usage ex
108. ertions and for deletions Le a pattem and the searched reglon can vay in their length Vou ca specify the percentage of the pattern and a searched reglon match in the fid nea Note hat th value abo depende the pattern length and disabled when the pattern hasn t been specified Substitute pattern may contain characters diferent from the characters la the searched region When thi has been selected you can abso specii the match percentage and additionally possible te account ambiguous bases Regular expression a regular expression may be speci instead of a natem For example character matches any character 7 matches zero or mare of any characters Thee i the Limit esl length ption that spes the mammum length of 3 Searchin Ll a Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 In this group you can specify where to search for a pater in what region and in which strand for nucleotide sequences Abo for nucleotide sequaces posible to search for a pattern on the sequence translations Stand for ucleotidesequeces only Specifies on which strand to search fra pattern Diet Reverse complementary or Bath sand Search ia for nucleotide sequences you can select the Translation vale fr this option In this cate he input pattern il be searched in the amino acid translatione egion peces the sequence range where to se
109. f the document but if you ue the advanced dialog yo can choose the frat early To open the advanced dialog select one of the following Add 4 Existing document item in the Projet View contest mena File Open As tem in the main mena To simply open the document select one of the folowing Open item in the main toolbar File s Open item in the main menu E Chapter 4 Basic Functions Unipro UGENE User Manual Version 1 11 3 oF drag the fle ta the UGENE window Warning Documents crested not by UGENE are copy ofthe document and continue waking with the To be abl to di the document you shoul save Advanced Dialog Options Open the Add existing document dig Add existing document poe p Opening Document a Unipro UGENE User Manual Version 1 11 3 The following parameters are availible Dicument location ofthe document It can be a local a shared network or a web for Document format specifies how to interpret the data stered in the fle At specified above the Fermat s detected automaticaly but you occ manual Force mode lods the document or editing Fl to disk before opening this option becomes avaliable if a web reference has been specified in the Document cation Saves the remote le ta he local dak ber opening i Custom settings the bution i available for Genba
110. fr cu Seket an appropriate minimum and maximam value and click the OK button ta show the graph f eu The ph i divided ino 2 parta The upper part shows values greater than the Maximum value The lover Part of the graph shows values lover tan te speced Minimum value For example REET Ty Sy EET IES ei Values greater than Maximum Values lower than Minimum LI Chapter Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 6 5 Dotplot The Dopo plugin provides tol to build dotplots fer DNA or RNA sequences This allows to compare thse sequenes graphically Using dotplat raphe you can easy deny such differences betuen sequence od mutations verior insertion deletions and ewncomplety regions the plugin provides advanced features comparing multiple dott navigation in syn saving and lending a eic An ample of a view B NC034257 eames nin The Doro plugin uses the Repeat Finder plugin to build a make sure you have the Repent Finder plugin installed The Features described in moe detalls below 6 5 1 Creating Dotplot To creste depot select the Toots s Build main menu The Build from sequences dislag wil appear Unipro UGENE User Manual Version 1 11 3 m 5 arn
111. g Required percent identity beeen the pattern and a subsequence Number Optional Default 90 matri scaring matric String Optional Default Auto Amang others the flowing values are available m gt dna m E Chapter 12 UGENE Command Line Interface Unipro UGENE User Manual Version 1 11 3 The matrices available stored inthe GOGENE sate weight matin directory iiiter results fltering strategy String Optional Default ite intersections The following values are available fitenatrections 12 2 7 Adding Phred Quality Scores to Sequence Task Name jin sul Adds Phread quality scores to sequence and saves the result to the output FASTA Parameters in input sequence String Required gust ey input Pred quality scores String Required output FAST fle Sting Required Example 12 2 8 Local BLAST Search Task Name local ast Performs a search on a lacal BLAST database using old version of the NCBI BLAST Warming BLAST is as an external toal and must be installed your system tosipath path to the blasta11 erectae By default the path specie in the Application Settings sapped Swing Optional Dau default directory for temporary flea By default the path specified in the Application Settings ia applied ting Optional Default del in semieolan separated list of input sequence fles Stri
112. g Tree print a tree select either the Print Tree toolbar button or the Actions Print Tree item in the maln meni The standard print dialog will appear where you can select a printer to use and specify other settings 37 Exporting Tree Image 10 Distributed Computing Distributed computing allows to notably increase the performance of computational tasks by distributing the task data among computational unis However he dotibutd computing assumes complex solutions specialized eios o orn actui communication ete Unipro UGENE projet provides advanced distributed computing capables Despite the complexity of the internal structure for usera running computational asa a remate machine as eas iot local machine Starting with version 112 UGENE supports cloud computing For example computational workflows can be on the Amazon EC2 cloud Check fr deals the documentation section Running Worki on Cloud There are alka several distributed algorithms that can be executed remote machine HMMERS search Sith Waterman seach 10 1 Remote Machines Monitor Remote machines to peri calculation can he atin the Remote machines monitor dialog It can be sect by selecting the Settings s Hemte machine monitor main meni E ma Lk J ingens oars p iita d Unipro UGENE User Manual Version 1 11 3 To add a remote machine click th
113. hanged to the to remove after restart value The Remove pin n nore available the calet the pagi Intend the Era plagin appear in the cantet menu I you select this item the plugin wil be enabled again ke jt wil not be removed after restart Otherwise the Pci wil not be available after UGENE restart Basic Functions Unipro UGENE User Manual Version 1 11 3 4 15 Fetching Data from Remote Database UGENE slows fetching data from remote bilgi databases such as NCBI GenBank NCBI protein sequence database some othe To fetch data select the Feo Access remote database kam the aln me The dialog will appear U Fetch data from remote mawam 77 ipse temm dose J E pU Cs Here you to enter unique id of the biological object and choose a database Unique enters are dierent dar varus databases For example for NCBI GenBank sch unique id could be Accession Number or NCBI Gl Optionally you can rone for a directory to save the etched Fle After you click the OK button UGENE dawnlasds the biological object DNA sequence protein sequence 34 model ete and adds to the caret project something goes wong check the Lag Vin it will help you to diagnase the problem 4 16 UGENE Application Settings To open UGENE Application Settings dialog choose he Settings Preferences item in the main The flowing setting are available X338 Fetc
114. hat the ensyme appears in the Selected enzymes area of the log You use the Select button select all he enzymes available the Select None button te deselect al the enzymes To selec enzymes with recognition sequence length shorter than the speci value ick the Select by length button and input the rimum length in the dialog appeared To invert section dick the Invert selection button Ja son as neyne ae selected you an dick the OK button to serch for corespnding restriction sites in the 11 8 2 Using Custom File with Enzymes To lead a custom with enzymes clk the Enzymes file button and bronse for the fle The must be af the Bairoch fra For details about the format vefer httg rebase neb com rebase rese 19 ht You can save the currently selected enzymes to a fle Clik the Save selection button to do that 11 8 3 Filtering by Number of Hits itr the results by the namber af restriction sites found for an enzyme chech the Filer by number of eue heck boc and input the minimum value and the maximum value of hit 11 Excluding Region a sequence regian fom th search check the elle raglan check bor and input the start and the end positiona ofthe region Ha uequence hs ben selected before opening the dialog you can clc the Selected tn to automaticaly il the vale with the selected subsequens start and end penton 11 8 5 Circular Molecule T consider the sequence as circular and be
115. he context using the risht muse button or the Actions main menu and slt the required scheme in the Colors men 7 1 5 Zooming and Fonts To perform oom operations use the corresponding buttons the editor lola Chapter 7 Alignment Editor Unipro UGENE User Manual Version 1 11 3 i AS By default the Base characters are visible when zooming But for rather lng sequence there another zoom mode In tha rode the basea are sot showa This alla owing very sequence regions up fa 00 8 Yeu can zoom to the selected region by the Zoom to selection button It la very convenient operation wen the alignment size a rather large For eramale you can zoom ta percentage elect an teresting and then zoom to the selection Yeu can change font by clicking the Change fnt button To reset stom and font ick the Reset zoom button 7 1 6 Searching for Pattern You can serch or a pattern inde an alignment Enter a query string in the eit bax under the Sequence ar Pres the right sero to search in the direction From let ta right from top to bottom Press the left arrow to search in the doen From right ta let rom bottom to top I the pattern found the result wil be focused and highlighted inthe Sequence area You can continue the search In any direction from thls posto TA Overview ns Unipro UGENE User Manual Version 1 11 3 7 17 Consensus Esch
116. he nk on the UCENE documentation paze zu Chapter TI Plugins 12 UGENE Command Line Interface UGENE comand interface CLI i developed keeping in rind he following principles To make It as easy as popular shell commands all significant UGENE features Tools users to add their command To ute UGENE CLI pake sure to add the path to the UGENE executable to your PATH environment variable The general ia the ning Hee task task to execute it can be one of the predefined tasks or a task you hae rate ask parameter parameter of the speci task Some parameters af a task are required Vn ad cot parameters c some ta option one of the options the example below 12 1 CLI Options help h lt option name gt lt tack name gt Shows help information For example Species the task to run A user defined UGENE workflow schema can be as tash name For eo parenetersmvalus ss Unipro UGENE User Manual Version 1 11 3 A task progres shown by dealt when a task is running This option pecie not to show the progres Ses the log level per category IF a category is not spied the lag level is applied to all categories The following categories are available Algorithms Console Core Series inpas Output e Performance Remote Service Seriais The flowing le
117. he sequence toolbar buttons ia shown onthe pete below Ti DA GraphPack x lagi MAREL T Semen Fa a o Amine tamtn pm 1 Zooming Sequence 32 Global Actions Unipro UGENE User Manual Version 1 11 3 5 4 Sequence Overview The Sequence over is an ara af the Sequence View bl the sequence toolbar Iota the sequence in hale 4 provides handy navigation in the Sequence zoom cw and the Sequence det vic CELLES 4 Serolis the Sequence zoom view Scrolls the Sequence details view 9 When the sigma button in the right part of the Sequence overview is pressed density of annotations in the sequence shonn For example nthe picture below here are annotations a the parta of the sequence that are with dark grey color a aa Noe ra ee TR dd pm Seno Zoom View Sequence Detail View Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 5 5 Sequence Zoom View The Sequence or is designad ta provide Nesibe tool fr navigation i ge annotated sequence reins The mast Sequence zoom vew apace used annotations for the sequence The annotations are anid in by the namen aotations with Lhe rame ovn an eia row created For ry raw the nam and the tala sumber of annotations la the ow are shown with ght test atthe let part of the aes LXI
118. hing Data rom Remote Databas Unipro UGENE User Manual Version 1 11 3 po opere p p d The felling settings are available on the ab Language of User nterface applied after restart here you ean select UGENE localization Currently sealable localisations are EN RU CS and ZH The default value Autedetcton specs that should use the operating ptem regional options to select the localization The setting it applied only alter UGENE reopened Appearance defines the appearance af the aplication fr example here is a part of the same dialog hen the Cleanlooks appearance hs been applied x Chapter a Basic Funcions Unipro UGENE User Manual Version 1 11 3 55 n Prefered bone Window Layout this option allows to conta the behavior of windows multigle or Prefered Web browser you can use either Sytem default Browser or specify some other browser Open lst project at startup ithe option is checked the ast project opened when UGENE is ben Path to download data specifies the path where les downloaded rom the remote databases will bestand Enable statistica reports collecting coilects information about UGENE usage and sends it to the team t help improve the application Note The collected information includes 1 System info UGENE version OS name Qt vention ete 2 Counters inf number of lunches of certain tasks eg HM
119. ic you can identify such the flowing between the sequences 1 Matches A match between sequaces locks a diagonal ine on the dotplat graphic representing e eaniouou match or repeat Unipro UGENE User Manual Version 1 11 3 2 Frame shifts a Mutations Mutations are distinctions between sequences On the graphie they are represented by gapa diagonal ines They interrupt matchs Insertions ae arts o sequence that are maed in the another while the surrounding parts match In ether words insertion i subsequence that wat into a sequence Graphical insertions are represented by gaps which lie only on one ais A little shit towards the ether a meats a mutation hve c Deletions A deletion a subsequence that vas deleted from a sequences A deletion fom sequence found in sequence B can be considered as an insertion into sequence B and contained n sequence MUN Inverted repeats The Dslr plugi allows to search or inverted repeats as wel Inverted repeats are shown contrary to the direct repeats Use the Search dimet repeats and Search inverted repeats options of the Dotplat parameters dialog to select wich repeats t daw the dialog is described here Chapter Sequence View Extensions Unipro UGENE User Manual Version 111 3 AN ME lowcomplesity region a region produ
120. ile alignment i presented on the below TUS uMUSCLE Unipro UGENE User Manual Version 1 11 3 The original alignment i not modifed only columns with gap character can be inserted The second profile was considered as a of sequences and therefore modified Nate that if a fle with another alignment is used as a source of unaligned sequences the ga moved and each input sequence i processed Independently This method quite fast for example an alignment f 3000 sequences 1000 bases each to the exiting profile bea about 5 mind the Core2Dua compte haces are E Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 16 Bowtie Bowtie la popular shart vead aligner Chek this nk to Bowtie homepage Bowe embedded as sera tol inta Open Tools DNA Assembly submenu of the main men TU Bowtie Unipro UGENE User Manual Version 1 11 3 11 16 1 Aligning Short Reads with Bowtie When you select the Tools DNA Assembly Align shert read item in he maln menu the Align Short Reads dialog appear Se vale of the Align shart rede method parameter to Bowie The dalog aa fll T d jG Rester Create p Ls Cte arae S Clearer cto accu E pd po E AS jteviscorcknertoan 700 ermen rere ect et Dnata pe p a
121. ill specify the separator foreach pared Ine It is posse to use line number in the sex pe Using the aros you the necessary number of ines at the beginning of he document from parsing can ako skip ines that start with the specie tx marose See By Preview one can bring up the view of tha curent annotations table hich the ile with the speci parameters values The input contenta will abo be shawn at the bottom part of the dao Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 9 The preview table headline indicates the types of the information contained in the corresponding columns delit the values gnare To speci alum rele click onthe conganding headline element The annotation start and end positions must be spaced I is possible to add an to every red start position by checking the Add cher and to shorten annotations by one from the end by uaceking the Tice hector When al the roles are specified preas Run With the Add to project checkbox pacified and a Sequence View pened on success you wall see the Sequence View with annotations linked 310 Manipulating Annotations 7 Unipro UGENE User Manual Version 1 11 3 EE perl E EM seg 5 10 9 Exporting Annotations Open the Sequence View docum
122. in the Reads Area Reads Area Displays the read Coverage Graph Shas the coverage of the Reds Area See the example below EZ Browsing and Zooming Assembly Unipro UGENE User Manual Version 1 11 3 Assembly Overview Reference Are Consensus Area T T T T t PUT Ruler 1 Coverage Graph 8 2 4 Reads Area Description The ead Aves provides a visualization of reade of an assembly part To zoom in or out ratate the mouse To perform zooming you can ise the Zoom In and Zoom Cut buttons on the toolbar or the Actions Zoom in and Actions Zoom Out Here the main men when you double click on a read I is zoomed in and moved to the center of the window By dragging the mouse while holding the left mouse button you can navigate in the Ress Area navigate long ditanca in the Reads Are use the Assembly Overview described below Other ways to navigate in the assembly are Use the horizontal and veil serali bars of the Reads Area Go t0 a specified postion an amendi To learn about available hotkeys refer ta Assembly Browser Hotkeys By default assembly rendering i optimized while scaling While you are moving aereas an assembly it shows the aem in gray color but when you stop t shows the assembly in diferent colors To dale thi option uncheck the Optimize tbe rendering whl scrolling item i the content menu of the Reade Area or Optimize tem
123. ine species the number of eyes of iterative refinement to pelo Coffee T Cafe a multiple sequence alignment package home page T To make T Cofee salable UGENE see the External Tools Te use T Cofiee open a multiple sequence alignment fle and select the with Tle tem in the conte ena o the Arona maia menu The falling dalog appen m The following parameters are available Gap opening penalty indicates the penalty applied or opening a ap The penalty must be negative Gp extension penalty indicates the penalty appli for extending gap Number of iterations spes the number af iterations TU External Tools EI Unipro UGENE User Manual Version 1 11 3 11 23 Query Designer The Que Designer lisa a molecular biog to saly nucleotide sequence uti dierent gra Repeats der ORF finder Weight matrix matching eic at the same time imposing constraints on the pesivonl relation o the results obtained fom the Ase ely interac sued to create of the algorithms constrains The elemen Ye esen m Alternatively you ean create edit a schema using a text editor When the schema has been created and all ta parameters have been set you can run for a nucleotide sequence The resulta are saved as of annotations to the specie in the Genbank format Te leam more about the Query Designer read the Query Designer Manual follow t
124. ing the Tools Designar main menu item and prepare a werk ow schema Don t forget o validate it before launching Once the schema i ready select the Remote machine mode on the Workflow Designer toolbar 4 Lal hot E emote macie Qe mno qme aigner iut aigner der m 5 mua sis Qo Ron the schema eg by clicking the corresponding Url Desire toolbar button The Remate machines manitor dialog will appear Select the remate machine that represents the EC service and click the Run Dutton TOZ Running Workflows on Cloud E Unipro UGENE User Manual Version 1 11 3 10 2 5 Useful Tips and Recommendations Before launching a schema on a cloud try launching it on a local machine with some test data This wil help to prevent schema ers check the Log View at the bottom of UGENE window it contains important information aad all When a remate is executed its progress shown in the Tas View When anasing Large datasets gt 10 make sre that jour acheta works corse with amall datasets M something goes wrong don t panie Report about your problem on our forum or contactus direi E Chapter 10 Distributed Compuling Unipro UGENE User Manual Version 1 11 3 10 3 Running HMMERS Search Task on Remote Machine Read the HMMS plugin documentation belore reading this paragr
125. ional e reports alignments with at most rumber mistmatches agers and seeden are and quality values have o efect on what alignments are via mutually exclave with 1 Optional Chapter 12 UGENE Command Line Interface Unipro UGENE User Manual Version 1 11 3 eed for puerto random number generator Number Optional soos en numberof bases on the igh quality end af the ead ta whieh the n cing apples The lowest permitted sting ia 5 and the default 28 Bowtie faster for ager Optional eyaz finds valid alignments when they esis including alignments Bocka Optional chunkeia numberof megabytes a certain thread given to store descriptors in bast mad amer Optional best guarantees that reported singleton alignments are best in terma of statum Le number f miratehea ar matches in tha eed in he of made and n tarma of the ality values at the mismatched Example 122 14 Building Profile HMM Using HMMER2 Task Name hmm build Bull a proie HMM using the HNIMER2 tools Parameters it of input multiple sequence alignment Fle String Required out output HMM fle Sting Required name of the profile HMM Sting Optional Default hrs proie enable disables arto Bola Optional Default true seed random
126. irs of name value stings Bel la the default layout of the Annotations editor with an extra eum for the nati qualifier added Eare m jects lh anna T I MS EE eem Bb pm PEE Amato mam S O TE MR Ones pr Smart Tiere are una several objects annotations in the Annotations editor special Auto ansatatant object is aways presented fr ach segune opened Ir contains annotations automaticaly calculated forthe sequence below for details An object contains groups of annotations sed by UGENE for ogeal organization of the annotations An anne tation must always belongs to ome group S8 Annotations Editor 5 Unipro UGENE User Manual Version 1 11 3 For documents erated not by UGENE annotations grouped by their names For annotations crate in UGENE ia peste to arbitrary group names Groups can contain both annotations and other groups The numbers in the brackets after a group name in the Action altar are the count of subgroups und annotations in the curent grou A single annotation is allowed to he presented in several groups An annotation ia removed frr the document when does not belong to any 5 9 1 Automatic Annotations Highlighting Enabling the automatic annotations highlighting alow you to automatiallycalculte and highlight annotatione con each nucleotide sequence opened Currently the foll
127. ith UGENE are located in the SUGENE data ponit ion weight matrix folder 11 20 2 Building New Matrix To create a postion weight or frequency matis from an alignment or a with several sequences pes the Build new matric burton in the Weight matrix serch dialog or select the Tole Wight matric gt Bail weight The Build weight or frequency matris dog wil appear E E pre p venetus O ean ec dont ns mb Emme Emmy The following parameters are available Input file an alignment c a Fe with several sequences to build the matis from The parameter Fle the eating ati be saved in thia fl The parameter is mandatory Staite defines the way in which the statis wil be collected The opin is basically god for small alignments and the Dinale option must give more appropriate ess for big alignments Matris type defines the type af the resulting ati zu Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 IH the Frequency matri option s selected then the Fequency matrix wil be created and saved into the ending M the Weight matrix option l then the intermediate frequency vill be crated and then vardlomed ite a weight matis on basis ofthe sdeced Wight alant Then the weight matris ba saved inta the esting For same input the cared Alignment Log ap
128. l parts of the Robert C Edgar s MUSCLE too for multiple alignment Note MUSCLEA is not supported since UGENE version 17 2 The package la integrated completely there i need era fles for using it It is posite t run several sulle alignment tanks i parallel check the progress and cancl the running tasks safely Note The homer clustering part ofthe MUSCLE algorithm was optimized for multicore systems by Timur Novak State Technical University 11 15 1 Aligning with MUSCLE To run the lassie MUSCLE use the Align Alga with MUSCLE context mena tem in the Algen alps pete wma peered Brem p E tont aranga aquest Eher 1_232 es toe gt 79 Warning default UGENE does not rearrange sequence order in an alignment but the original MUSCLE package does To enable sequence rearrangement uncheck the Do no re range sequences stable option in the alg E Chapter T1 Plugins Unipro UGENE User Manual Version 1 11 3 One af the improvements to he MUSCLE package i the ability t align only a part of the model When e Column range tem tected the region of the specie clams any passed a the MUSCLE alignment engine The rested alignment mered mto the original one with gaps added or removed om the rion boundaries Note To visual select the column range ta align make selection in the aliment editor frst Then invoke the MUSCLE plugin Hs column range boundary vales
129. latory stem with receptor path B Gaeta Cridine Regulator Desk Deseos Regulater Dra Dra be element ia he latin c DNA repeat a E cl Fatty acd degradation Regon Factor frin tiation Opern that exces regitur Far FAR the primary regulator that mediates the anao aeri te anaerobic growth though the regulation of hundreds of gen EZET LI Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 Table 11 2 continued from previous page Face peor Fie Uptake Regulation lacte alton phosphate reper a member ofthe amy tone the raced staring poti oce hase Regulator Itegration hest ctor Trafic guitar T Tron sur cater Regulater 3 Leh represses the of several genes Involved in the cellular sponse to DNA damage ar inhibition of DNA replication regula Met gren ved and apart of ethionine poricpates controling several genes volved in methionine biosynthesis Wess bacha and a gene involved in protection against nitric ie Dp better known makes large clone ea transcriptional dual regulator hat controls the caresion of a number of genes encoding eneymes of the Escherichia phasphotransferase PTS
130. lect ether the Tool Cloning Digest inta Fragments or the Actions gt Cloning gt Digest ito Fragments tm inthe maln mena or the Cloning gt Digest ito Fragments em in the contest mena The Digest Sequence o Fragments dialog appears On she Restriction Sites tab f the dialog you can see the name of the molecule the list of restriction enzymes usd during the restriction ana that can et the malecle and the Lat of eyes selected opes he damnon To digest the sequence into fragments you should select at least one enzyme move an enzyme ta the Select enzymes at click i in the Available enzymes iat and press the Ad bution Note that you can select several stems in list by holding the Ce key whe clicking on the Ta select availble enzymes press the Add button Te remove enzymes from the Selected enzymes lit select them in the list and press the Remove butten To remove all itema ram the Selected enzymes list press the Clear Selection button Molecular Cloning in silico Unipro UGENE User Manual Version 1 11 3 On the Conserved Annotations tab of the ilg you can select the annotations that must not be disrupted during On the Output tab of the dialog you can select the to save the new molecule to As soon aa the required parameters are selected press the OK button The fragments will be saved annotations Alu al the generated fragments are available
131. ligned to Thi parameter is Indos le sae filet sve idet to This parameter is required eeresce fragmentation thia parameter he amount of parta the reference vil be itis etr hu Influences dh amu of tad during the agent Total memary usage shows the total memory usage System merry des dis the ttl waters memory sise UGENE Genome Aligner a Unipro UGENE User Manual Version 1 11 3 11 19 CAP3 CONTIG ASSEMBLY PROGRAM Version 3 is a sequence assembly program for small scale assembly with or without quali values Clek this Int to open CAP homepage CAPS is embedded ss an externs rol Open Tools assembly submenu of the main mena Select the Contig assembly with CAPS iter to use the CAP The Contig Assembly With CAPS dialog appear You can add or remove input using Add and Remove buttons To remove all fles cli the Remove ll button oput fies are with along DNA reads in FASTA or FASTQ formats At least one input Fle should added Input Result contig name and grs the Run button CAPS produces sembly results m the ACE le fermat Wace The e contains one ar several contigs assembled from the input read Chapter TI Plugins Unipro UGENE User Manual Version 1 11 3 Alo you can change the folowing advanced parameters seesatosf ree a B oecesemtarsyseris m S
132. lization in the Sequence details wow sing the Show complement sand andthe Show amio translations toolbar tutor puppe clement On the picture below the both stand are ured Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 8 5 8 8 Selecting Sequence You can use ferent fom the Select submenu of he menu to select sequence Here you can specify the sequence range you woul like to select You can open the same dislag using the Select sequence region button on sequence toolbar or wing the Ctr A key sequence Ta use the Sequence Between selected annotations select two annotation the Annotations editor holding the Oost key at the same tme Manipulating Sequence Unipro UGENE User Manual Version 1 11 3 4 focii cw mt urn I gt select the Select gt Sequence between selected annotations item in the contest menu The Sequence und elected annotations em selects the selected annotations and the sequences between these ES 25 ah Ts Ag NETS E HG i ea te C CENE wares F Sequence batueeh selected annotations 3 le Giese aoa C Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 Aether way t select a sequence atend annotations to
133. low schemas comprise reproduce reusable and self documented research routines with a imple and unambiguous val representation suitable for publications The workflow schemas can be run bath locally and remote ther using graphical interface or launched from the command ne elements that a schema consists of correspond ta the bulk of algorithms integrated into UGENE Additionally cam create custom worklow elements Te lean mere about the Designer rend the Designer Manual fellow the ink on the UCENE documentation pg TUE Designer 187 Unipro UGENE User Manual Version 1 11 3 11 2 DNA Annotator The DNA Annotator plugin provides an algorithm to ar eques regions that contain a predefined of Usage example pen the Sequence View for a sequence that has annotations A goad candidate here cou ay Fe in Genbank mat with a ich set of annotations Select the Anales Find annotated reins item in the context menu The dialog will appear as Annotations to sareh ttn ete mentre Using this dle you can search for DNA sequence resins that contain every annotation fram the list on the left side The found regions are displayed on the right side of the dialog the Sive regions as annotations button to atte the regions as new annctationa to the sequence LI Chapter 11 Plugins Unipro UG
134. lt 86 strands to search in Number Optional Default 0 The following vales are available both strands 1 rec strand 1 complemen strand SEX CL Predefined Tasks Unipro UGENE User Manual Version 1 11 3 Enamel 12 2 24 Building Statistical Profile for SITECON Name secon tld stati prole for SITECONL I can be later used to search for TFBS Parameters ia semiclon separated at of input DNA multiple sequence alignment Fles An input must net cantain gapa Require cut output fle several input have hoen supplied ten a rofle ia buit fr ach input ie several output uith dese are generated String Reque weise window size The window is a region ofthe alignment used to build the pofle Iti Tice up fom the center of the algnment and occupies the spaced length The edges ol the beyond the window are ot taben into account Therecammendel length bit len than the alignment length but not mere than 50 bp Number Optional Default 40 length length of a random synthetie sequence used to calibrate the prole Humber Optional Dedi 1000000 andom sed used to calibrate the prole to generate the random syathetie sequence Ue the same value get the sime calibration venita ice on the same data By default random sed s generated each tene a calibration cecus Number
135. merry for shart vesd This pa rameter allows ta decrease the lead on the computer on one side an to increase the Compute speed ofthe ask onthe other ie Total memory shows the total memory usage Sistem memory ste shows the tatal system memory Indes parameters Reference fragmentation this parameter inlences the number of parts the reference Wil be divided Itin better male t bigger bu it iences the amount of memory ied rog the Index memory usage sise shows the index memory usage Directory for inde temporary directory for saving index fles Vou ean chase temporary directory for song les for the reference that will be ball during the alignment H you ned to run tl sre one mere time with the sam reference and with the same reference fragmentation parameter you use this prebuit indes hat wil be located in the temporary dicto Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 18 2 Building Index for UGENE Genome Aligner You can build an index to optimize short reads alignment using Genome To open the Bull Index dialog select the Tool s DNA index tem in the main Set value o the Algo short rads method parameter to UGENE Genome Aligner The dialog looks as fellona parameters are the folowing eferesce sequence DNA sequence to which short reads would be a
136. mes Enable ong gapa checking ths bok lla an to set the Mas extentions parameter Max gop extensions maximum number af gap extensions Inde ofset slow insertions and deletions within the spaced numberof base pairs tard the ens Max long deletion extensions d disallow long deletions within the specified numberof bate pues toward the end Send length 1 take the subsequence ofthe specified length as seed If the specified length is lage than the query sequence sedin wil be ed For long ed hs option 8 ranged from 25 35 Max seed diferencas 4 marimar edit distance in the seed Ma queue entries 0 maximum queue Threads 4 number of treads Mismatch pealy BWA wil na search fr suboptimal Hit wih a scare lover than the specie value Gap open penalty 0 zap open penalty Gap extension penalty gap extension penalty TT awa Unipro UGENE User Manual Version 1 11 3 hits 8 proceed with suboptimal alignments f there are no more than specified number of eguali best hits This option affects rael end mapping Increasing thia threshold helps ta improve the paling securacy at the cost of speed specialy for short reads Quality threshold 2 parameter for read trimming Barcode length 8 length of barcode starting from the S end When the species length i pestis the barcode of each read vil be trimmed befor
137. n a run of hydrophilic amino acids No end gap separation penalty teat end gaps just like internal gaps o avoid gaps that are too doe side ages gaps off amino acd specific gap penalties that reduce or increase the gap opening penalties at eseh position im the alignment or For example positions that are ich pce are more likely have an adjacent gn than positions that are rich in valine D Original MAFET multiple sequence alignment proram for unite operating systems However currently is available Fr Mac OS X Linux and Windows I td far both macie and protein sequaces MAFET home page iio maft ebre polen oltre To make MAFFT available from 1 Instali he MAFFT program on your system 2 Set the path to the MAFFT executable on the Extemal to tab of UGENE Application Settings dialog For example on Windows you need to specify the path ta the maf ft hat To use MAFFT open a multiple sequence alignment fle and select the Align with MAFFT tem in the contest seni or Actions maia The flog dialog appear m Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 T ofe peris ieoa estena pensin p The lining parameters are available Gap opening penalty Gap opening penalty at group to group alignment vers gap extension penalty aliet value which werks gan extension penalty far group te group alignment Maumum number of iterative ref
138. nal Default the Fle saved Exam 122 11 Annotating Sequence with UAL Schema Task Name query Annotates sequence in compliance with a UGENE Query Language UQL schema Thi allows to sequence using derent algorithms at the same time impesing constraint the postana relationship o the rst To lear more about the UQL schemas read the Quer Designer Manual in ist of input sequence fles String Required cout output Genbank fle with the annotations Sting Require UQL schema Sting Required mezge W true merge egens ofeach result into single annotation Boolean Optional Deal offset merge lett true speci left and gh oft fr merged annatations Number Optional Deal i SEX CL Predefined Tasks Unipro UGENE User Manual Version 1 11 3 122 12 Building Bowtie Index Task Name bti ul Bowtie index sing a reference sequence The index can later be used to olism short react te the reference sequence Parameters zef reference sequence Sting Required bwt name of the inde The indes in stared as a set of 6 fles with aes Zebt ba debut ev ev 2 cher trag Required Example 12 2 13 Aligning Short Reads with Bowtie Task Name bowie Alig shart reada to a reference sequence with Bowtie using its prebuilt inde Parameters vemicson
139. nalrze 4 Find pattern Smith Waterman tem n the content menu The Smith Waterman Search dialog appears Waterman algorithm to S peu serata nas ease M m Emm x d cem 1 Fist of all you need to specify the pattern to search fer The rest parameters are optional Sch in select eher ta search inthe sequence or in its translation Stand select the sand t serch ia direct complementary or bah strand gion species the region of the sequence that vill be sed to search for the pattern By deal subsequence has been selected when the dialog has ben opened then the selected subsequence is searched for the Others the whale sequence s used You can input custom range Algorithm version version o the algorithm implementation versions produce the Same rss as clie ut much faster To ve these optimizations cur system mut support these pabies Clase 2 CUD OPENCL Scoring mati tan be chosen Iram bunch of matrices supplied with UGENE To mati Sita clk the View button SURE Smith Waterman Search E Unipro UGENE User Manual Version 1 11 3 Gap open penalty fer opening a gp ap extension pony for tending a an Report results simple heuristic which allows to Fler intersected hits If it is set to rone the Meilen may repart lege et OF identical raisin the same region Minimal score another simple eii which asses
140. nd the sequence region Alignment Editor A Object View ied to visualize and eit DNA RNA or protein mall sequence alignments Options Pane An Options Pane iti the panel with diferent information abs and taba with settings for Sequence View fe Assembly Browser In the image below you can see typical UGENE window with a Project View and a single Object View window ped 3 Unipro UGENE User Manual Version 1 11 3 02055 ET nett ana no ne 8 4 2 UGENE Window Components chapter describes UGENE main window components Project View Tak View Log View and the Notifies popup window 42 1 Project View The Project View shows documents and bookmarka of the curent project The documents are fies added to the projet And the bockmarks iia View states ofthe document Red Using Bookmarks to leam more about bookmarks To show hide the Project View dick the Project button in the main UGENE window Chapter 4 Basic Funcions Unipro UGENE User Manual Version 1 11 3 SN Project view RETINERI DEAN jore Bookmarks You can abo use the 1 1 hotkey to show hide the Proec View erste project ref r to renting New Project Note that I you have no project created when opening Fie with a sequence an alignment or any ber belegal data a new anonymous projet created automaticly 422 Task View Tie Task View shows ac
141. ng Require path ta the BLAST database fles Suing Required dbname base name of the BLAST database fles Sting Required output Genbank the results of the each are tre as annotations String Require nane name f the annotations String Optional Default Blast result T22 CLI Predefined Tasks E Unipro UGENE User Manual Version 1 11 3 pe pe of the BLAST seach Sting Optional Default The following values ae available m Haste m mm e expectation value threshold Number Optional Default 10 Example 12 2 9 Local BLAST Search Task Name loca tinte Performs search on a local BLAST database using BLAST Warning BLAST used as an extemal too and must be installed on your system Parameters telpsth path to an appropriate BLAST eq blastn blastp ee By dau the pth in the Application Settings applied Sting Optional Def dca repose directory fer temporary fles default the path specified inthe Application Settings is applied String Optional Default deal in semieolon separated list of input sequence fles String Required Spatii path to the BLAST database flex String Required dbname bate name of the BLAST database String Required output Genbank the f the search are stored as annotations String name name of the annotations Sting
142. nk EMBL FASTA and FASTQ document formats The button opens the following dialog AST Manat tos p rcr a Wf thee are several sequences i the document then selecting the Separate sequences option wl open several sequence Sequence View wide Contrariwise selecting the Mere sequence Open Sl merge the sequences into one sequence The Gap length parameter species the length of the Tara inserted between the merged Your cele wil be saved as default you check the Sve as default stings check ba Note that if you select to merge the sequences then the annotations of the sequences if any are aso relocated automatically 45 2 Opening Document Present in Project Ta apen a document that already pretent in the cent project it in the Project View and dick Enter doubles dik on t or drag te an empty apace of the UGENE window Basic Functions Unipro UGENE User Manual Version 1 11 3 4 6 Creating Document To create a new sequence from tet select the File New document fram text main menu item You can input the created sequence to the Paste dta here el The fling Custom settings are available here you can select the alphabet Bornean eter Ore on rte Skip unknown symbol Replace unknown symbols with you can select either to skip unknown input symbols or to replace them with the specified symbol 36 Creating Document Unipro UGENE User Ma
143. ns Expanding Branches 863 Swapping Sings 364 Zooming Clade 565 Adjusting Clade Setings 9 7 Exporting Tree Image Printing Tree Distributed Computing 101 Remote Machines Monitor 102 Running Workflows on Cloud 1021 reduction 1022 Computing 1023 Chad Remote Machine 1024 Launching Wallon 1025 Ui Tips and Recommendations 103 Running HMMERS Search Task on Remote Machine 10 4 Running Smith Waterman Search Task on Remote Machine 105 Running MUSCLE Align Task on Remote Machine Plugins Workflow Designer panes 112 ONA Anota DNA Flexibility 1131 Configuring Dislog Settings 1132 Result Annotations DNA Statisties 115 ORF Marker 116 Remote BLAST 117 Repeat Finder 142 2 m m us s Me Ms MS 7 ur 148 150 150 160 10 151 154 156 159 160 160 E 165 na naa nas nas nas nar nas nag na 1171 Finding Repeats 1172 Finding Tandem Repeats Restriction Analysis T amp L Selecting Restriction Enzymes 1182 Uong Custom Fle with Enzymes 1183 Fiteing by Number of Hits 1134 Exduding Region 185 Molecule Rets Molecular Cloning in sico 1191 Digesting into Fragments 1192 Creating Fragment 183 Comiti Molecule Secondary Structure Prediction SITECON 11111 SITECON Searching Transcription Factors Binding Sites 11112
144. ntation Chapter Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 6 1 Circular Viewer The Circular Viewer plugin provides capability to the cile view of a nucleotide sequence Usage example Open a nucleotide sequence object in the Sequence View The Show circular view button i availible on the sequence toolbar DI EET Pressing the button wil show the cireular view of the sequence ET Nota The Crear Viner opened automatically when the Sequence View la opened fer a plasmid The cee represents the sequence clockwise the ele show the corresponding sequence positions The sequence sections are represented as cured ord regn at he aide a the ee Cireular Viewer helps to navigate within the sequence You can sect annotation the circular view and the annotation wil sle be focused and highlighted in all Sequence View area Sequence overview Sonance mom ie Sequence details ew and Annotations editor Circular Viewer Unipro UGENE User Manual Version 1 11 3 You can select a sequence region This wil ao the Sequence View Note that the cesar view ia zoomed automatically when the Circular ener area aie l Chapter Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 Se yu can adjust it to an appropriate is t
145. nual Version 1 11 3 Document location location of the created document Document frat fast of the crested document Currently avaliable formats are FASTA and Sequence name name of the sequence in the created document le immediately check this opin if you want to save the document immediately after the nale button pressed Tie crested document will be added to the current project and opened in the Sequence View 4 7 Exporting Documents Ma document has a format that supports writing in UGENE ee the Supported File Formats hte you can the document to a aew document In a required format To do it use the Export document herm in the context menu mee tedster ing pet tot The following dialog appears Here you may select the name of the output Fle in the Save to e feld and optionally choose the fermat of he ouput fie in the File format Uee the Compress fle checthor to compress the He The Add to project elon checked by default adds the output Fle to the current project fie choosing all parameters elek the Export baton E Chapter a Basic Functions Unipro UGENE User Manual Version 1 11 3 48 Locked Documents The lock loni the document element indicates that the document can t be maid chain 1 satan Barr dae UGENE does not allow radiation of some formats that were created not by UGENE
146. o the circular view using the mouse whe le the Esport 4 Save circular view as image contet menu er the Actions main mena item ta save the image of the Ey qercaregen A aman oen Different fle formats are available pre bmp jpt ug and pl Note that AF a sequence e contains several sequences it ponsible to the circular of the sequaces inthe srt Viewer Nos ean werk with these cil vina at the same tine Circular Viewer a Unipro UGENE User Manual Version 1 11 3 6 2 3D Structure Viewer D Structure Viewer la intended for visualization of 3D stricture of bilgi molecules 30 Structure you can work with data from the Protein Data Bank a repository for the 3D structural data of large biological oles ich pres and ac nad y the the NCB Base MMDB ako known as Entrez etal structures obtained from the RCS Prote Data E Find the description of the 3D Structure features belo 6 2 1 Opening 3D Structure Viewer The sene automatically when you open or fie For example op 3 he 3D Structure Viewer adds a view ta the pm 6 D Ste vener Ace Dy Une rorem Notie the Links button on the toolbar with de Jhen you click the button the menu appears with quick links to online matian about the molecule
147. og very to the dialog described in the Remote BLAST chapter except the following parameters Selec input fle this parameter presented if the dialog has been opened from the Toole main mena Here you must input query sequence fe that would be aed search the BLAST pets Ifthe dig has ben opened using the Sequence View contest menu then the currently active sequence is used query sequence Search type here you shold select the toal you woud t ue M the query sequence nucleotide sequence then blastn blaser and thle teme are available For 2 poten sequence the hems are blastp and tlt Select database path path to the database fles Base name for BLAST DB Fles base for the BLAST database fies Number of CPUs being used numberof processors to use To learn about other parameters please refer to the Remote ALAST chapter 2l ia widely sed multiple sequence alignment proram eased for both nucleotide and protein sequences a a command ine vein of the program Cost home page http w chao Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 If ou are using Windows OS there are no addon configuration steps required as ClustalW executable included tothe UGENE distribution package Others 1 Ital he Clustal program on your system 2 Set the path to the ClustalW executable on the External toc tab of UGENE Appli
148. ompute Und Device Architecture CUDA you can use it to speedup some calculations in UGENE doit the vide driver and check the comaponding check ba Now you can for example ube OpenCL optimization for the Sith Waterman aioe Chapter a Basic Functions Unipro UGENE User Manual Version 1 11 3 4 16 10 External Tools Here you can set the paths to the external tools executable ome three eae X36 UGENE Application Settings Unipro UGENE User Manual Version 1 11 3 4 17 Creating and Using Index File UGENE provides the capability to index large fles It may be important there la a very big file that can t be leaded to meray a whole because fts ong To an ides select the Tools Ind large hen ib Chapter 4 Basic Functions Unipro UGENE User Manual Version 1 11 3 Ard specify the Document location in the appeared dialog meine 7 po The Inde location value wil appear automatically after you choose the document location but you can choose some other Optionally you can cheek the Compras option to archive the result indes fle with the gzip ui it chuc pro Open the crested indes e Fer example the screenshot below demonstrates an index fle created from a FASTA Bie wth and sequences Project UGINE m Lr um ea oner v f um
149. on the Assembly Brener Settings tab of the Option Pal E Chapter Assembly Browser Unipro UGENE User Manual Version 1 11 3 8 2 5 Assembly Overview Description Tie Assembly Overview shows a coverage overview af the assembly The longer the depth fa Enea the overview and the deeper lr the mare are located in th region Ta open a region ofthe assembly in the Reads Ares click tia the Assembly Overview On the ever the selected regen a displayed either at a gray rectangle a rd ros or a red rectangle For example If you held isst and select a reglan on the overview the overview is zoomed to the selection Note that when the Assembly Overview i in focus and you use either the zoom buttons the toolbar the zoom Rena in the Actions main mea or a rove wie the Reads Area appropriata The Assembly Overview can alto be resized To zoom in the overview select either the Zoom in or the Zoom in 100 emi the Assembly Overview context mena Yo can the read overview by dragging the moe ble presing down the mouse wheel To zoom out the overview select the Zoom ot em nth comes menu he estre global overview Rer in ie context retra the fut ovis size when the whale corti sown Notice that the Assembly Overview shows the coordinates of the assembly visible in the Reade rea and in the Assembly Overview EEE oof nites To sal the resized overview drag the meus while
150. opened PDB Wii PDE Chapter 6 Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 NCBI MMDE Note that if you re online yu can acts the by ita PDB ID see Fetching Data from A Hint Don t ferget to select the correct database I tin Data Bank directly from UGENE and load a required file skas for deal DB while fetching 6 2 2 Changing 3D Structure Appearance This chapter deseribes how you can change a 3D appearance Selecting Render Style The follwing render styles are Balad Sick Space i Tiber To change the render te select an appropriate m inthe Render Sl menu it can be eter in the 30 Sine Vice imet ri e the on the ica meme Wore EZ 30 Structure Viewer 3 Unipro UGENE User Manual Version 1 11 3 Selecting Coloring Scheme a Send St Ta change the coloring scheme open the Caring Scheme menu salle the Calculating Molecular Surface Surface i the 3D Structure Viewer f the flowing em To caute the molecular surface of a molecule elect the Male contes menu xin the Display menu onthe tocar and check on SAS solvent accesible surface SES surface select the item To remove the molecular surface that has already been eae Nou can also select the Molecular Surface Render Style to modi the caute molec
151. ou v stad the UGENE Full Package ax abeady contin al the tools by default Otherwise Ifyou ve installed the UGENE Standard Package ou would need to configure an external toli order te E Note that in thie case you can downloud the package with all the external tol rom hs page Te eam how to configure an external td read below 11 22 1 Configuring External Tool Te configure an external tod 1 Make sure the tol on your ste 2 Set path to the tool esecutable fle in It ean be set on the External Tale tab of the Application Settings dae path hasn t been set for a tool UGENE menu ema that lunch the tool re displayed in talle For example the image below a path for the ClustalW external tool has been set and paths for and T Colfee has ramas seus roe wth SLE ens cams Asher TUI External Tools zm Unipro UGENE User Manual Version 1 11 3 BLASTIBLASTs The Basie Local Alignment Search Tol BLAST fads regions of local smarty between sequences The program compares nucleotide or protein sequences to sequence databases and calculates the statistical sgnfeance ol matches BLAST can be to infer functional and evolutionary relationships between sequences s well help identity members of gene fates BLAST is a new version of the BLAST package from the NCBI From UGENE you can ute the following tois of the old BLAST package
152. ow Designer schemas schema See Des UGENE Query ul format to store UGENE Designer Query Designer schemas schema See Wes d X Format fo staring venen demens at ement or an lunch an eternal command ie toal command de See Wie Desig tool 13 1 3 Other File Formats Tic Format extension Comment Example of usage annotations can be exported to tha farmat the Weight Matric matrices lat sve to this format Tui For example iri to stare report Tage formats lbp Jog Tha format are aed thoughout the program to ive eren ec Tong t yg ete pd Tri posite to and adi ie fess UGERE Appendix A Supported Fl Formats 258
153. owing annotations types support the automatic highlighting Open reading fames Restriction tes The corteaponding of annotations fund ae stored in the Autesanootationt abject lathe Annotations editor oe amie E pr EI daabefenale the automatic annotations calculations use the Automatic Amnotations Highlighting mens bution an the Sequence View toolbar of bae on 5 9 2 The db xref Qualifier Some fles in Genbank fermat contain the db xref saber A value of this qualifier i a reference to a database O ne mereme orn pu When you ick on the value a web page is opened or a fle loaded specified in the reference The loaded fle i aed ta the curret pet LJ Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 5 10 Manipulating Annotations 5 10 1 Creating Annot To ceste a new annotation for the active sequence prets the C211 ey sequence select the New annotat Sock tes c wa Add Naw annotation a How voto content am 87 This will setivate a dialog where to set ug annotation parameters The dialog where to save the annotation I could ether an existing annotation table objet ara new document fle Yos can also specify the nare of the group andthe name of the annotation IF the group rame ast to cauto UGENE wil the annotation name ss the
154. partment Td 7 300061 Fae 7 303 3302960 Emal mathetingBunipo ra UGENE website technical support Email ugereDunipro e 2 About UGENE Unipro UGENE free cre platform genome analyse suite It distributed under the terms of the GNU General Pill License Ta lean more about UGENE vist UGENE website werks on Windows Mac OS X or Linux and anly a few clicks to ista 2 1 Key Features Cheating editing and annotating nucleic acid and protein sequences Search through online databases NCBI UniProtKB Swiss Prot UniProtKB TEMBEL Multiple sequence alignment MUSCLE MAFFT T Coffee Onine and local BLAST search Restriction analysis with integrated REBASE restriction enzyme database Integrated Primers package for PCR primers Search for direct inverted and tandem repeats in DNA sequences Constructing dotplots fer nucleic acid sequences Search fer transcription factor binding sites TFBS with weight matrix and SITECON algorithms Aligning short reas with Bowtie and UGENE genome aligner Search for ORFS Cloning in sileo 3D structure for fles in and formats anaglyph view support Protein secondary structure prediction with GOR IV and PSIPRED algorithms HMMER and HMMERS packages integration Balding using integrated PHYLIP package and viewing phylogenetic trees Local sequence alignment
155. pears at he bottom of the dialog I gives the representation sf the selected alignment weight or frequency matriz gl Omne wer Lo O att smtm round ree ERIE Note The Alignment ago appears when The input format pim an it fle with several sequences The size o the input is small enough To start the operation preas th Start button The mati wil be created and saved IF the weight Frequency matrix dialog an invoked from the Weight matrix search dilag then the matrix also wl be chosen an the erent prof TUI Weight Matric Unipro UGENE User Manual Version 1 11 3 11 21 Primera The Primer hai port ofthe Primer tol It in tended ta pick primers DNA sequence ite the open DNA sequence and select the Anabse Ped context menu kem The dialog M MATT Sao Soo Al available parameters are the same as in the original Prime Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 22 External Tools The Ewer Tools plugin allows one to launch an external too frem UGENE The flog tos are supported Boni BLAST BLAST m e T use an external tool from UGENE the tod needs to be installed the sat and the path to it should be properly confined However there ia no need in the additional configuration f y
156. pened Sequence 6 5 2 Navigating Dotplot To zoom in out a you can Rotate the mause wheel Press corresponding zoom buttons located on the left meve the sored reglon you car 24 Minimap se Worse ora eye Hod the mide rou button ad the mouse over the sored region of the dope the desired region of the minimap in the ght betta cere Activate the Scr tel hold the left mouse butten and nove the mouse cursor over the zoomed E 1 Chapter amp Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 6 5 3 Zooming to Selected Region select a dotlot region activate the Select toa hold down the mouse Button and drag the mouse cursor over the dott When you select a regian on depot the corresponding regn is also selected in ther Sequence View areas Sequence detale view Sequence zoom view ete The opposi tre as well AF you select region in a Sequence View are the corresponding reglon also select in the ew To zoom to the region selected click the Zoom in on the m om om 6 5 4 Selecting Repeat Te select repeat activate the Select too and dick on the repent To deselect the repeat either click on ether repeat hold ct and click somewhere on the dott 6 5 5 Interpreting Dotplot Identifying Matches Mutations Ivertions etc ng adopt graph
157. ppears zm Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 U Format database O etter thu s Teese Gm es Here you must select the input fles If ll the you want to se are located in one directory you can simply select the directory with the fles By default only the Fes are taken int acount with fa and fct tensions can change by specifying ether Ince Ales fiter or Exclude Bles fier Yeu can choose either protein or nucleotide type of the Then you must select the path to save the database and specify Base name fr BLAST and a Title for database Making Request to Database To make request to local BLAST database do the Felling using BLAST Tools BLAST BLAST Search If youre using 1 open Open Tools BLAST 4 BLAST Search JE there ia a sequence opened you can abo initiate the request to oc BLAST database from the Sequence View you re using BLAST select the Analyze Query with BLAST item in the context menu orin the Actions If you re using BLAST select the Analyze Query with BLAST item in the contest or in the Actions main mena The Request to local BLAST database dialog appear TU External Tools z Unipro UGENE User Manual Version 1 11 3 eser healers d e F3 Sere Seater ie nm ET eue ET The dial
158. pressing down the mouse whe To learn about available hotkeys refer to Aser Browser Hotkeys 8 26 Ruler and Coverage Graph Description The Ruler shows the coordinates in the Reach Avea When yeu move the mouse cursor in the Reade Area the coordinate ofthe selected locaton with the coverage of reads shom onthe ruler im dark red The Coverage Graph shows the exact coverage of the sequence at each position For sample on the image below the coordinate and the coverage of reads 251 1 Y i m m To show hide the coordinate on the ruler you click theflloving button on the toolbar To show hide the coverage on the ruler you can lik the fling button on the toolbar E Ahertatiah you can iae the Show cordate and Show coverage under cur check baies located on the Assembly Browser Settings tab of the Options Pane 32 Browsing and Zooming Assembly E Unipro UGENE User Manual Version 1 11 3 827 Go to Position in Assembly To ge to the required postion in an assembly use the folowing located on the Assembly Browser tocar Input the location and dick the Go button similar Ga Feld available on the Navigation tab of the Options Panel 8 2 8 Using Bookmarks for Navigation in Assembly Data Use bookmarks to save and restore visual state of an assembly for example position in the assembly zoom sesle 8 3 Getting Information About Read A displayed in the Ress
159. puse ES 52 E sa ss 56 sa so s10 Sequence View Components Global Actions Sequence Toolbar Sequence Overview Sequence Zoom View 551 Managing Zoom View Rows Sequence Details View amp Information about Sequence mE A Manipulating Sequence 581 Cong To Posion 332 Tossing Views 333 Capturing Sreeshat 584 Zooming Sequence 585 Creating Now Ruler 586 Selecting Amino Translation 587 Showing and Hiding Translations 583 Sequence Sao Copying Sequence 5810 Sench in Sequence Eating Sequence 5812 Exporting Selected Sequence Region 3313 Exporting Sequence of Selected Annotations Locking and Synchronize Ranges of Several Sequences Annotations Editor 591 Automatic Annotations Highlighting 592 The db wel Quir Manipulating Annotations E 36 Ed E 2 49 E s s s s 9 se 56 56 57 57 57 E El E E 70 T 5101 Creating Ansetation 5102 Editing Annotation 3303 Highlighting Annotations S104 Creating and Editing Qualifier 5105 Adding Column for Qualifier 5106 Copying Qualifier Tert 510 7 Deling Annotations and Qualifier S108 importing Annotation CSV 5108 Exporting Annotations 6 Sequence View Extensions 2525 ET 62 6 9 Cice Viewer lt 30 Structure Viewer 621 Opening 3D Structure Viewer 622 Changing 3D Structu
160. r of gaps removes comas with number of gapa rete than or equal to the specie value Remove columns with percentage of gape removes columns with percentage of gaps greater than ual to the speed value Remove all columns of gaps thi selected by default It specifies ta remove lunas from the alent i they entirely canst of gps Select the option required and press the Remove button Filing Selection with Gaps Select in the alignment and chocs the Eit Fil selection with gap item in the context meniu or pres the Spacebas The rin ll with gapa shifting the sdblnert fom the reglon o the ihi 7 24 Aligning Sequences The Aliment Ete integrates several popular multiple sequence alignment algrthns Below i the list of and inks to the documentation Port of the popular MUSCLE algorithm KAllen plugin effective wok with hug alignments ClustalW and MAFFT these algorithms appeared in the venion 17 2 of UGENE with the External Tole plugin Coe this alignment algorithm i available since version 1 8 1 of UGENE with the Eterna Tools plugin sequences choose preferred alignment method in the Actions main or in the context Ale you may find useful the following video tutorials devoted ta the multiple sequence alignment Making a multiple sequence alignment FASTA Fle Working with large alignments in UGENE Performing proie role and profil
161. rameters in seman separated list of input MSA fles String Required cor output Fle Sting Require ofthe matrix Balan Optional Default fan The following values are available tue inal type fakse mononeleic type matrices are moe dead while mononucleie one we mare useful For small input data ets SEX CL Predefined Tasks a Unipro UGENE User Manual Version 1 11 3 12221 Searching for TFBS with Task Name Searches fer transcription factar binding sites TFBS with position weight matrices PWM converted input Frequency matices and saves the regions ound as annotations Parameters seq semicolon separated lat of input sequence Fles to search TFBS in String Required matrix semicolon separated Nat of the input String Resid cout output Genbank fle name of the annotated reins Sting Optional Default mise etur type of the matic Boolean Optional Default fae The following values are available ue lacks type fite mononeli type Dimsdale matrices ae more detailed while monesuek i ane are mar useful for small input data sets sigo grit to convert PFM to a PWM ting Optional Default Berg and von Pod Tie losing values re soie Be and von Hippel mm m m minim percentage ere dett TFBS umber Optional Deu 25 Strand
162. rch fer a pattern You can search in the whale sequence or peal a cutom regio Other settings revenge This group contains additional common setting Remove ovre results annotates one of the overlapped enl Lini results uber to lits number of the seared results to the pected value Annotations settings E Bl In the Save annotationfa to group you can up a fle to stare sanatatiens It could either an esting annotation table abject ra new document Inthe Ametation parameters group you and the anmlations name and a group in the Editer 5 8 11 Editing Sequence If the document not loched it i possible to edit the sequence Manipulating Sequence a Unipro UGENE User Manual Version 1 11 3 Tie it sequence salle the Actions maia menu and i the Sequence View context menu When you select the Insert subsequence tem the following dialog is opened Lise torte scc Lx Jl a Chapter 5 Sequence View Unipro UGENE User Manual Version 1 11 3 Description ofthe dialog parameter Paste dia here you must Iit the insted subsequence This parameter is mandatory Annotated regions resolving defines either to Resize Remove ot Split an annotation into two notado case when te aeequence is inserted to the sequence postion where some re presented Start postin the seq
163. re Appearance 523 Zooming and Spinning 3D Structure 624 Seleting Sequence Region 625 Selecting Models to Display 626 Erporting 3D Structure Image 627 Working with Several 3D Structures Views Chromatogram Viewer 631 Exporting Ciematogam Dota 32 Viewing Two Chromatogr ONA Graphs Package E 641 Description of Graphs 542 Graph Settings 651 Creating Dotplot 552 Navigating in 553 Zooming to Selected Regan 654 Selecting Repeat 655 Interpreting Matches Mutations herons ete 656 Editing Parametere 687 Saving Datplot as image 558 and Loading Detplt 659 Building Dotplet for Currently Opened Sequence 6910 Comparing Several 7 Alignment Editor n Overview amp Alignment Editor Features 112 Alignment Editor Components 713 Navigation Tl4 Coeing Schemes TLS Zooming and Fonts 716 Searching for Pater TITO n Li 2 75 E as E o2 96 97 100 m 102 103 108 106 107 107 107 109 To 0 To 12 n2 na na a ns ne 12 Working with Alignment 721 Undo Redo Framencrk 122 Selecting Subsignment 723 Editing Algnment 124 Aligning Sequences 125 Working with Sequences List Advanced Functions 131 Grid Profile 732 Exporting Image 733 HMM Profle Building Phylogenetic Tree vanes 741
164. reset The tandem repeats annotations are located side by side Repeat Finder Unipro UGENE User Manual Version 1 11 3 11 8 Restriction Analysis Fro ts chaptar you learn how to search far restriction stt on DNA sequence The restriction sites found are stored as automatic annotations This means that If the automate annotations ighighting i enabled then the rection sitea ar searched and highlighted fer each mucleotide sequence opened Refer Automatic Annotations Highlighting to learn mor Open a DNA sequence in and cliek the felloning button on the Sequence View tela R Alternatively select either the Actions Analyze Find restriction sites tem in the main menu er the Analyze Find lm nthe content mea The Find restriction sites dog appears Dreirad rone E manne Clete lale mite fee eed You can see the lat of restriction enzymes that can be used to search for restriction sites The information about enzymes obtained from the FEBASE database For each enzyme in the Tat a bef dsergtion s callable the accession ID in the database the recognition sequence ta If you re online you can get more deta information about an enzyme selected by dicing the REBASE Info button Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 8 1 Selecting Restriction Enzymes To select an enzyme check it in the ist Notice t
165. rrently supported chromatogram formats are ABIF and SCF To view chromatogram just open an interesting fle in UGENE by standard means eg dragon the fle or pra the Cer 1 0 ahortit The Chromatograms Viewer automaticaly embedded into the gerere Sequence View F chromatogram data are found a on the screenshot bear Ge ce ae 8 Chromatogram view zoom in to see base calls 5 M A U Q C ML s PI I V8 9 Q AL T WP CN V I 8 LR L PF KON CACATBGCCTGGCAATOTCATCTCTOTCCGATTATAGTTTCACAACAAGCOTTA tii 8 Afr zooming in mone chromatogram data available AATATTGAA ETILE 2002076 To edt sequence data rightclick on the chromatogram view and select the Edit new sequence kem in the appeared contre menu The original DNA sequence 1 not allowed to be changed however you can 3dd and new sequence stored in a separate The sequence being diaplayed right above the ane Symbols can be changed by clicking on interesting value modifications are shown im bold Chapter 6 Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 6 3 1 Exporting Chromatogram Data IRI 07 arf He lathe Project View contest Open example the UGENE data samples mend there Export chromatogram to SCF tem X4 oho tte chromatogra D After cli
166. rs A C G T ral Ne Maq rounding nomaground Mas Mapping and Assembly with Quality accepts quality values in the Phred quay scale but internally rounds ales to the nearest 10 with a maium of 30 By default Bowie alaa rounds this way No Mag rounding prevents tha rounding in Bowtie o forward orientation nof do no attempt ta align against the ford reference stand Na reverse complement orientation noc do nat attempt to align against the reversexcarm plement lene strand Tey as hard try as hard as posse to d valid alignments when they including paced nd alignments TU Bowie Unipro UGENE User Manual Version 1 11 3 Best alignments best make Bowtie guarantee that reported singleton alignments are best in tema estat le miensithe or mismatches in the sed Rr the cae f made and in terms of the quality aues at the mismatched position s Alfaligenents a report al valid alignments per read or pair Validity of alignments is determined by the policy combined eects of a mode v mode Sed length and Mag ema Select the required parameters and resa the Start ttn 11 162 Building Index for Bowtie To build owe index select the Tools DNA Assembly Bul inde tem in the main menu The Build Index dalog appears the Align short reade method parameter ta Bowtie The dialog looks as follows There are the following parameters
167. s for a protein sequence using the Analyze Predict secondary structure content menu The dialog ill appen Ulsecondary structure prediction 3 21 qeu 1t supports th losing options Algorithm you can choose the reed algorithm Currently GORIV ard PsPre algorithms ie salle ange sa f Range end select the sequence range fr prediction sults visual representation of the prediction results for example TUS Secondary Structure Prediction TE Unipro UGENE User Manual Version 1 11 3 UJ Secondary structure prediction grim sten ossi eats E emm as annitation select this button t sive the as ancaations of the curent pot Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 11 SITECON SITECON a program package for recognition of potential transcription factor binding sites basing on the dita about conservative conformational and physcachonicl properties revealed the basis ofthe binding sites sets anni To ite SITECON use the following article Oshchegkov D Y Viae EE Grigarovich DA Ignatieva E V Khlebodarova TMSITECON tool for detecting conservative cnfermational and physicochemical properties in transcription factor binding site alignments and for stercogniton Acids Res 2004 Jul 132 Web Server ise Wa0s 12 version of SITECON provides a tol for recognition of potential binding ste fer over
168. se of quality value a1 in a gap is gen a score minfa 43 where gi the specie value 2 the value of the base the other sequence Aet before the gap The specified value should more than CAPE Unipro UGENE User Manual Version 1 11 3 The srry score is caelulated as the sum of scores of each match each mismatch and each gap Based on tha value and the flowing value some overlaps are removed Overlap similarity score cates remove overlaps with similarity sere less than the Specified value The specified value should be more than 250 Length and percent identity of an overlap parameters Overlap length cutoff lt o minimum length of an overlap in base pairs The speced valor Should be more than 15 base pairs Overlap percent identity cutoff xp minimum percent identity of an overlap The specified value Should be more than 65 Other parameters Maximam number of word matches 4 an upper limit of word matches between a read and other reads Increasing the value would resi in more accuracy however th could slow dann the program The speaied value should mare than 0 Band expansion size a number of bases to expand a band of diagonals for an overlapping alignment sequence reads The specifed value should be more than 10 Max gap length in any overlap 4 reject overlaps with a gap longer than the specifed value A small value may cause the program
169. sequences similarity K la mare tmv than using some abstract scares If set to 1009 the algorithm wil search for exact substring match The results of the seach are saved annotations ar as multiple alignment To set the saving parameters go to the Input and output tab of the dig M you want to save the eau as annotations input the annotations saving parameters Annotation name Group sone file t save the anatation Y ou to save the renis as agent select the flowing parameters Here you can select a o the aliment to es path parameter Using he Set danced options checka you can select the saving options You can set the different templates for files names creste your oan or create by using the following E a subsequence end position fs adds a time MDY adda date S adda a sequence start Position LJ ads a subsequence length SN adde reference sequence name pref a pattern Sequence name prefix C adds counter Vou can rete templates fr ront fle nares reference abtequesc names pattem subaequence names and for pattern sequence name LE Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 TUE Smith Waterman Search w Unipro UGENE User Manual Version 1 11 3 11 13 HMM2 The plugin ook based on the Sean Eddy s HMMER2 package While working on thia plugin w
170. t data regions ad sla bookmarka in Web brow EN Using Bookmarks Unipro UGENE User Manual Version 1 11 3 Ilan View cad as tant ears that state is not td curet state ef a set an m wh the view rame i th Boos of te Pri icc window and let the Add donar iam i de cantent men S rm i For every persistent view GENE automatically saves the state of the view in the Auto savad bookmark when the Nw by activating bookmarks you can restore the original wlew state For example for the Sequence View bookmarks you can store aval postion ard som seale for the sequence region the keyboard shortcut to rear bookmark To rece a bookmark preas the Del GENE has limited set of llt Object Views Extensions modules or plugina used to adjust the eating ws orto add new views the bak 4 12 Working with Projects Al the opened documents and bookmarks along with the corresponding views states can be saved within a project fle do set File Epor Project Te will vce the Export projet dialog where you can select he destination oder and the project He name E Chapter a Basic Functions Unipro UGENE User Manual Version 1 11 3 To lud a saved project later Fle Open and specily the path to the project fie 4 13 Options Panel The Options Ponelis availible in the Sequence View and in the Assembly Browser
171. t package for MacOS system donelcac 2 Launch the dg and the GNU license agreement The following window vill appear Tostart dikk on the gessi icon You can alo to the Applications oder dragging EI Chapter 3 Installation 4 Basic Functions 4 1 UGENE Terminology Project Storage fr a set of data and options Document A single Gle can be on a lacal hard drive or be a remate weh paga Each document contains a set Sf sec Object A minimal and compete modelo biologies daa For example a single sequence a et of annotations a multiple sequence dient Task A proces ually asynchronous that werka in background For example sme computations leading and oring is Plugin A dynamically loaded module that adds new functionality to UGENE Object View A graphical view for a single or a set of objects Project View A vial compares i manage acte projet Task View A visual component ied to manage active ts Log View A visual component wed to show og Notifications A viaal component ied to show notations Generally it sued to open tasks eps Plugin Viewer A visual component ied manage pss Sequence View An ject View aimed to visualize DNA RNA or protein sequences along with their properties like ano tations chromatograms 3D model statatieal data ee Annotation Additonal information about a sequence Identified by its name a
172. ted blow 3 1 Installing UGENE on Windows To instal UGENE on Windows 1 Download UGENE Windows installation package 2 Launch the downloaded ese Fle and follow the Unipro Setup wizard Welcome to the UGENE Setup Wizard hs vo roh tha of UNE pm lr er vaio Fo bt o coro ck Ne to corine Alternatively to ue without installing 1 Download UGENE zip package 2 Unpack it Launch the oe fle Unipro UGENE User Manual Version 1 11 3 3 2 Installing UGENE on Linux 1 Download the appropriate version of the package 32 bit Linun binary pado 2 bit Linu brneny package The demanded has lac extension 2 Unpack the archive Yeu can use this command ar RE name of the downloaded tar gz file 3 Change the working directory to the unpacked directory ied of the unpacked directory 4 Launch the UGENE GUI version using the command the commandline verson using the comma Note Several native packages for specific distributions are also available Find out detail on the download Note UGENE a part of Ubuntu and Fedora Linux distributions 32 installing UGENE on Linux Unipro UGENE User Manual Version 1 11 3 3 3 Installing UGENE on Mac OS X 1 Download the Mac OS X Did image using the appropriate Unk on the download page MacOS X Frobui
173. tensions Unipro UGENE User Manual Version 1 11 3 Yau can select the color with which the repeats wil be displayed in the picture The debut Button sets the default cor Custom algorithm optionally you can select an lgrithm to calculate the repeats Diagonala Note The specie algorithm i povided tothe Finder plugin an input parameter In most cases the Asto ve a appropriate Minima repast length allw to draw such matches between the sequences that are cantin and iong enough For example It eguala then oniy repeats wil be found that contain 3 and more base symbols Pres the Dk button to automatically adjust the Minimum repeat length value Such value wil be that there will be about 1090 repeats found Repeats identity species the percents of the repeats identity Press the 100 button to set the 100 identity After the parameters ore set press the OK button The wil appear in the Sequence View two dimentional plat consisted of dots Ts Unipro UGENE User Manual Version 1 11 3 Each dot on the plot coeponde to a matched bate symbol at the 4 potion of the horizontal sequence ard y postin of the veil sequence Viale diagonal Iines indicate matches between sequences in the sven particular region interpreting Dotplot Matches Mutations etre ete Buildin Currently O
174. tion matrices introduced by Margaret Dayhoff These have been widely wed since the TO GONNET these matrices ware derived using alt the same procedure a the Dayhoff one above but are much mare up a date and bined on a far data They appear eror serae than the Dahl sre ID identity mati whieh gives a score af 10 ta bo identical aming acids and a seare of sre ration type specs the iteration type to use During the iteration step each sequence it removed i tum and reped IL kept te alignment is better than the ene hes been madk belo The proces i repented unt the score convergen or unti the uinum of era reached Available vue a NONE species not to use iterations TREE species to iterate it each step ofthe progresive alignment ALIGNMENT species to iterate on the final alignment Mas erations nasum number of tertiae TU External Tools E Unipro UGENE User Manual Version 1 11 3 pr d Creer sensn andy Create peste omno The following parameters are only available fer protein sequencer Gap separation distance tries to decrease the chances of gaps being too clase ta each other Gaps that are less than tha tance apart are penalized mere than other gaps This does aot prevent dose maps makes them ln frequent promoting Block Ike appearance of the alignment Hydrophilic gaps increases the chances of a gap withi
175. tive tasks For ear algorithrns computations To show hide the Task View cick the Tasks button in the maln UGENE window tnm ee E Jen mr pr X x Task view 1 Rares M oneru PM CEE Usu i weis TZ UGENE Window Components 17 Unipro UGENE User Manual Version 1 11 3 Tie hotkey fer showing hiding the Task View is e Task name column ofthe Task shows the taska names Task state description shows the status of the tasku Started Rumning Finished and soon The Task progress column shows the percentage of the tasi roges H you want to cancel a task click the rd bution In thie Action column for ihe atk 4 23 Log View The Lag View shows the program lag information he og Ves eck Lag button in the maln UGENE window ER BED men darin rr citar tl Fe be S Uem RUE TERAMO is icm Dd Bea sna ith LE tn Heb tto Eo Ei RES ae nae REBER E EE em gt La pue The hotkey fer this action is ALE At is possible t configure the Lg View settings the level of the Jog to show ERROR INFO DETAILS TRACE e category Tasks te and the format of the log messages format of the dates ete This can be configured inthe UGENE Applestion Set 4 2 4 Notifications The Not Sa 2 coe ac
176. to do t reor to a acid select tha to locked ie hom in the contest men Centered highlights al reda that intersect the column in the center of the sereen E Chapter Assembly Browser Unipro UGENE User Manual Version 1 11 3 8 5 Associating Reference Sequence To associate a reference sequence with the assembly open the sequence the sequence must be loaded and drag i tothe sembly Reference re The sequence appears in the Reference Area remove the select tbe Unsiscit itr in the Reference contest men 8 6 Consensus Sequence cones sequence can be found in the Consensus Area undar a reference niente It fen to the mot Comman nucleotide at particular position choose consensus algorithm select the Consensus alrite either in the context of the Consens Area in be menu of the ess Ares on the Assembly Eraser Stings tab of the Options Pare The following algorithms are currently available Default shows the most comman nuclestide at each position When there is equal numbers of dierent nucleotides in a poston the consensus sequence resulting nucleotide is selected randomly these 35 Associating Reference Sequence T Unipro UGENE User Manual Version 1 11 3 uses from the SAMLoce Text Alignment Viewer to build the consensus sequence The algorithms t
177. to remove true tveapa and to proce incorrect This ption may be ted by the vae ta st sede rom alternative spicing forms nto separate contigs The speaied value should be mare than 1 Assembly reverse reads consider reads in reverse orientation for assembly The default value is EJ Chapter 11 Plugins Unipro UGENE User Manual Version 1 11 3 11 20 Weight Matrix The eight Matris plugin a a tool for solving the problem of sequence annotating As wl as for the 5 the main use cape o the plugin ia recognition o potential transcription factar binding on basis of the data shout conservative conformational and physiochemical properties revealed with the Binding stes sels analis The iet contains lat of postin frequency matrices and position weight matrices PWM sab known as postion specifie stre matrices PSSM The matrices came Fam uo wide known open chee JASPAR which cantas frequency arcs and Un PROBE containing weight rates Ala the Weight trix plugin provides a tool for creating specifie pestion egueney and weight matrices from exiting alignment or from with several sequences The created matin can be s profile for the Starch as wel the JASPAR and UNIPROBE ones serch for transcription factor binding sites la a DNA sequence select the Analyze Search TFBS with context menu iem The Weight search dalag wil appear
178. uence poston where ta the subsequence Save resulted document to a new fle the result sequence can be saves to new file instead of modifying the current fle You mist select the Document beato FASTA and Genbank formats are tale when you da rot include annotations to the eat Fle If you check the Merge Annotations t this fle em the annotations wil also be saved ta the result Fle Genbank fe format i only sealable in this ease An cane a sibeequence has been the Fest n the Ed equence is called Replace subsequence instead of Insert subsequence The dialog opera in this case ie similar to the dialog described above excep it already cantans the sequente ta be an allau input the start postion Alo posible to select subsequence from a sequence When you select corresponding item in the rte or in the Actions menu the Remove subsequence dalog pears Aerators regi rocking note rant asin tare ses maneni HER Description ofthe parameters Region to remove secs the region of the sequence that will be removed inthe frm This parameters mandato Annotated regios resohing spacia what to do wiih annotations that overlap with the reglon that removed You can select either Resize ich annotations Le ale i amales or Rente ers raed document to a new He simlar t the parameter in the Insert subequence descri
179. ular surface appearance C Chapter Sequence View Extensions Unipro UGENE User Manual Version 1 11 3 US van dar Wazis surface Selecting Background Color To change the background open the Settings dislog choose the Settings in the 3D Structure Viewer context menu or in the Display menu on the toolbar press the Set Bachround color button and select a color Selecting Detail Level To select the detail level of a 3D Structure representation open the Settings dialog of the 3D Structure Viewer and drag the Detail level sider Enabling Anaglyph View GENE alis you to view a molecule in the anaglyeh mede To enable the anaglyph view open the Settings dialog of the 3D Structure Viewer and check the Anaghih view check You can modify the oor settings select one of the available Glasses colors t set cusam coors sap the eslora The fet of the cor layers can be adjusted by dragging the Eyes shift slider EZ 30 Structure Viewer Unipro UGENE User Manual Version 1 11 3 5 See the result the a 6 2 3 Moving Zooming and Spinning 3D Structure A 3D structure can be easly spied moved and eie a To spin the 30 structure drag the mouse on the 3D structure while holding the left mous bution To move the 3D structure hold the Ce keyboard button and drag the mous the eft button pressed Toms and Zoom Out buttons on At
180. vailable for the Reads Ares w Chapter 8 Assembly Browser Unipro UGENE User Manual Version 1 11 3 Hotkey ation Zoom the Reads Im Zoom ia ie Reads Zoom i the Rada Ara Esse use Move the Reads Ares Move one base in the corresponding direction n the Rests Area More one page in the copending direction ia the ende Pas Mave ne page up down in the Reads Ares ione J End Mare tothe beginning end of the seri athe Ronde rca the Go ts positon on the toolbar E Assembly Browser Hotkeys 9 Phylogenetic Tree Viewer The Phylogenetic Viewer is intended to display a phylogenetic tree from an alignment or loaded from a fle eg a Newik ie To oad a tree iom a follow the instruction described in the Opening Document paragraph For example you may open the data sampl e COL resample provided within UGENE package To build a tree from a multiple sequence alignment se the Sins Phylogenetic Tre paragraph Ta learn what you can do with a tree using UGENE Phylogenetic Tre Viewer read the documentation below 9 1 Adjusting Tree Settings To adjust tee stings select either the Tee Settings toolbar button ar the Actions Tree Settings item in maln The Tree Stings dialog wil appear Unipro UGENE User Manual Version 1 11 3 le
181. vels are available TRACE DETAILS INFO ERROR or NONE By default leges For expe Specie the format of a log ine Use the following notations L level category YYYY or YY year MM month dd day hh ow inten s second llaecands By default Showa license information Species the language to use e for the log output The folowing values are available GS Gel EW English RU Rusian M log output is enabled this option make it colored ERROR messages are displayed in red DETAILS messages are displayed in green TRACE messages are displayed in blue Chapter 12 UGENE Command Line Interface Unipro UGENE User Manual Version 1 11 3 12 2 CLI Predefined Tasks Using curent version of UGENE you can perform the felloning tasks by running simple command Converting Between Formats Tasks Converting MSA Corset Sequences Basic Analysis Tasks Extracting Sequence Finding ORFs Finding Resets Finding Pattern Using Smith Waterman Algorithm Ading Phd Quality Scores ta Sequence Local BLAST Sench Local BLAST Seach Remote NCBI BLAST and CDD Requests Annotating Sequence with URL Schema DNA Assembly Tasks Building Bowtie Index Short Reads with Bowtie HMMER2 Tasks Profle HMM Using HMMERZ Searching HMM Sigal Using HMMER2 Multiple Sequence Alignment Tasks Aligning with ClustalW MAFFT Aligning with MU
182. wil autormatseally match the gem selection 11 152 Aligning Profile to Profile with MUSCLE The Align Align profile to profile with MUSCLE context menu itm allows to ain an existing to an agent During ihe proces MUSCLE docs nat realign the profes ut ueris calme wid gapa Characters characters For example the alignment in the picture below could be used 3 proi Thare are two gap columns inserted into the source poll and gap columns inserted into the added one Therefore the profila columns kept intact and he alignments haven t been changed Note Aligning a profile to the active alignment you wil modify the original alignment fle since it will contain 2 profes after the operation is completed 11 15 3 Aligning Sequences to Profile with MUSCLE Another feature provided by the plugin aligning aset of unaligned sequence to an stating profile To use this select the Align Align sequences to profile wth MUSCLE content menu This option ls available in the original MUSCLE package 3 7 and ia functionality for original MUSCLE tera In this mode each sequence from the input i alind to the active roe seperately and merged the result akgnment nly after ail sequences are proceed For example the alignment in the picture above in be again And the added profile be used a stt of sequences The result of such Sequences to prof
183. with optimized Smith Waterman algorithm Combining varios algorithms into custom with UGENE Workflow Designer Search fer a pattern of various algorithme results in mule acid sequence with UGENE Query Designer 2 2 User Interface Vial and interactive gnome including circular plasmid view Multiple alignment editor Chromatograms visualization viewer fer fles in PDB and formats with anaglyph stereo made support Phylogenetic tree vier Unipro UGENE User Manual Version 111 3 ay to use designer for custam computational 2 3 High Performance Computing Complete support of modern multicore processors and SSE instructions Out ofthe bex support aF modern GPUs using NVIDIA CUDA and ATI Stream Integrated solutions for Cell Broadband Engine Supercomputers and distributed computing support Amazon EC2 cloud computing support 2 4 Cooperation Can be we for education purposes in schools and universities Features to be int the next rens are initiated by users UGENE team is ready for claboration in related projects both fee and commercial 23 High Performance Computing 3 Installation Ge the appropriate package the UGENE dowlond page t Jugene downland hml Fallow the installation instructins on the same page t Install UGENE on your system Quick guides on how to UGENE on Windowns Linux and Mac OS X are sta
184. xport a consensus sequence of the assembly select ether the Expert consensus in the Consensus Ares conter menu or the Export s Consensus em inthe Ress Ares content menu Select a fle and the file format The consens can be exported to a FASTA FASTQ GFF or GenBank fle Modify f required the exported sequence name and choose the consensus alor The exported with gapa if the Keep gaps chock box has been checked Alo you can select the exporting region It can be either a Whole sequence a Vile region Ciatom region When all the parameters are set dick the Expert button The conan sequence la exported to the and if the Add o project cheek been it is added to the current project and opened 8 7 4 Exporting Image exert the visible part of the assembly an image select either the Actions Expat as image in the main or the folowing buton on the tela The Export Image dialog appears th the diala you can select the immage Fle name and it format bi png some fermata the parameter sa becomes avaiable When the parameters are set cick the OK button poring 17 Unipro UGENE User Manual Version 1 11 3 8 8 Options Panel in Assembly Browser 88 1 Navigation The Navigation tal of the Options Pone i tha Assembly Browser the lat of elk covered regna af the sael ad the Fd far searching required p

Unipro UGENE User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents