Home

Platinum HSC Retroviral Expression System

image

Contents

1. 80 C until first culture Store subsequent cultured cells long term in liquid nitrogen Safety Considerations Remember that you will be working with samples containing infectious virus Follow the recommended NIH guidelines for all materials containing BSL 2 organisms Culturing Plat GP Packaging Cell Line I Establishing Plat GP Cultures from Frozen Cells 1 After quickly thawing the cells in a 37 C water bath immediately transfer the thawed cell suspension into a 15 mL tube containing 10 mL of culture medium Centrifuge the tube for 5 min at 1300 to 1500 rpm Discard the supernatant and break the cell pellet by finger tapping Add a few drops of culture medium with gentle shaking and finger tap the tube a few times Add 2 mL of culture medium to the tube and gently pipet the cell suspension up and down twice Transfer the cell suspension to a 10 cm culture dish containing 8 mL of culture medium Swirl the culture plate well to mix the cells then incubate the cells for two to three days before expansion Important Note Don t culture cells to complete confluence Split cells 4X to 6X every two to three days when the culture reaches 70 90 confluence 4 oe oy ee CELL BIOLABS INC ae II Splitting the Cells Note Avoid forming bubbles as much as possible during this procedure 1 Wash cells once with PBS 2 Add 4 mL of 0 05 Trypsin 0 5 mM EDTA solution to a 10 cm dish and incubate at 37 C for 3 5 min
2. Packaging your retrovirus is only the first step to ensuring successful expression of your gene The following steps should be considered prior to infection of your host cell 1 Concentration and purification of your retrovirus Because of the latent nature of retrovirus it is imperative that your virus be highly concentrated before infecting your host cell Also impurities from your viral supernatant can decrease the efficiency of infection We recommend using Cell Biolabs ViraBind Retrovirus Concentration and Purification Kit Catalog VPK 130 2 Measure the titer of your retrovirus This is an important step to ensure consistent viral transduction into your host cell However QPCR or stable clone counting can take as much as 1 2 weeks to perform QuickTiter Retroviral Quantitation Kit Catalog VPK 120 uses exclusive technology to determine the retroviral titer in 2 hrs 3 Use transduction reagents to increase infection efficiency Many cells are difficult to infect with retrovirus and without supplemental reagents transduction efficiencies can be low Reagents such as Polybrene can help but are often insufficient Cell Biolabs proprietary reagents in our ViraDuctin Retrovirus Transduction Kit Catalog RV 200 form a super complex with your virus to increase transduction efficiencies by promoting virus and cell interaction References 1 Miller A D amp Baltimore C 1986 Mol Cell Biol 6 2895 2902 2 Ma
3. Product Manual Platinum HSC Retrovirus Expression System Pantropic Catalog Number VPK 308 1 Kit FOR RESEARCH USE ONLY Not for use in diagnostic procedures CELL BIOLABS INC Creating Solutions for Life Science Research Introduction Retroviral gene transfer is a technique for efficiently introducing stable heritable genetic material into the genome of any dividing cell type With Moloney Murine Leukemia Virus MMLYV based vectors transduction efficiencies of gt 90 are achievable for most mitotic cell types and the copy number per cell can be easily controlled by varying the multiplicity of infection Current retroviral gene transfer technology is based on the coordinated design of packaging cell lines and retroviral expression vectors The packaging cell line usually contains the viral gag pol and env genes necessary for particle formation and replication these genes are stably integrated into the packaging cell genome Retroviral expression vectors provide the packaging signal w transcription and processing elements and a target gene Inserts of up to 6 5 kb can be efficiently packaged Transfection of the retroviral vector into a packaging cell line produces high titer replication incompetent virus Table 1 The viral env gene expressed by the packaging cell line encodes the envelope protein which determines the range of infectivity tropism of the packaged virus Viral envelopes are classified according to
4. Drive San Diego CA 92126 Worldwide 1 858 271 6500 USA Toll Free 1 888 CBL 0505 E mail tech cellbiolabs com www cellbiolabs com 2008 2014 Cell Biolabs Inc All rights reserved No part of these works may be reproduced in any form without permissions in writing eo CELL BIOLABS INC A A
5. Remove the cells from the dish surface by tapping the rim of the culture dish Transfer 10 mL of the culture medium to a 50 mL tube Using the same pipette with some residual culture medium wash the dish surface gently three times in 4 mL of the Trypsin EDTA solution 6 Gently pipette the cell suspension up and down 7 times and transfer the cell suspension into the 50 mL tube containing 10 mL medium from step 4 Centrifuge the cells for 5 min at 1300 1500 rpm Discard the supernatant and break the cell pellet by finger tapping Add a few drops of culture medium with gentle shaking and finger tap the tube a few times 0 Add 5 mL of culture medium and gently pipet the cell suspension up and down twice 1 Add 15 mL of culture medium then count and seed the cells Typically 10 cells can be harvested from one 10 cm culture dish e Oe Retroviral Expression Vectors pMYs Puro Cell Biolabs pMYs Puro retroviral vector includes hybrid LTRs containing elements from both MMLYV and MPSV PCMV and is capable of expressing genes in hematopoietic stem cells The vector provides the viral package signal transcription and processing elements and MCS for cloning of a target gene The vector contains the ampicillin resistance gene for propagation and antibiotic selection in bacteria Figure 1 5 LTR Amp MMLV PCMV pMYs Puro 6 9 kb 3 LTR MPSV MMLV 5 MCS SV40 Figure 1 Schematic representation of pM
6. the receptors used to enter host cells Table 1 Ecotropic virus can recognize a receptor found on only mouse and rat cells Amphotropic virus recognizes a receptor found on a broad range of mammalian cell types Pantropic virus such as retrovirus pseudo typed with the envelope glycoprotein from the vesicular stomatitis virus VSV G can infect both mammalian and non mammalian cells Unlike other viral envelope proteins VSV G mediates viral entry through lipid binding and plasma membrane fusion However stable expression of the VSV G envelope protein is toxic pantropic virus is usually produced by transiently cotransfecting a retroviral expression vector and pVSV G into a pantropic packaging cell line expressing only the viral gag and pol genes Conventional NIH 3T3 based retroviral packaging cell lines and Phoenix packaging cell lines have limited stability and produce low viral yields mainly due to poor expression level of the retroviral structure proteins gag pol env in the packaging cells The Platinum Packaging Cell Lines potent retrovirus packaging cell lines based on the 293T cell line were generated using novel packaging constructs with an EFloa promoter to ensure longer stability and high yield retroviral structure protein expression gag pol env Platinum cells can be kept in good condition for at least 4 months in the presence of drug selection and can produce retroviruses with an average titer of 1 x 10 infectious units mL by
7. Ys Puro retroviral vector Detailed plasmid sequences available at www cellbiolabs com 5 CELL BIOLABS INC P i eo 5 MCS Enzyme Sites 5 BamHI EcoRI 3 MCS Sequence TTAATTAAGGATCCCAGTGTGGTGGTACGGGAATTCAAGCTTGATC 3 MCS Enzyme Sites 5 EcoRI XhoI NotI 3 MCS Sequence GGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAA AATAATAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATT ATGTACTATTTAAACTCGAGCGGCCGCCAGC S V40 puro GTCGAC Note For optimal expression both 5 MCS and 3 MCS should be used to clone gene of interest and replace the stuffer sequence partial LacZ between them pMYs GFP The control vector contains the ampicillin resistance gene LTRs package signal and GFP insert Figure 2 Amp pMYs GFP 5 5 kb 3 LTR MPSV MMLV GFP Figure 2 Schematic representation of pMYs GFP retroviral vector CELL BIOLABS INC A A an pCMV VSV G The envelope vector contains the ampicillin resistance gene and CMV driven VSV G insert Figure 3 pCMV VSV G 6048 bp SV40polyA Figure 3 Schematic representation of pCMV VSV G envelope vector Retrovirus Production I Transfection 1 2 4 Clone your target gene into a retroviral expression vector or use the provided pMYs GFP control vector for control experiments Seed 2 x 10 cells in a 60 mm culture dish without antibiotics including puromycin and blasticidin one day before transfecti
8. nn R Mulligan R C and Baltimore D 1983 Cell 33 153 159 3 Morita S Kojim T and Kitamura T 2000 Gene Therapy 7 1063 1066 4 Takahashi K and Yamanaka S 2006 Cell 126 663 676 License Information This licensed product is intended for ACADEMIC GOVERNMENT AND NON PROFIT RESEARCH USE ONLY not for use in diagnostic or therapeutic procedures The product may not be transferred sold or otherwise provided to another laboratory except by an authorized distributor of Cell Biolabs Inc Use of this product by Biotechnology and Pharmaceutical companies requires a license for all fields of use including research Please contact Director of Business Development Cell Biolabs Inc busdev cellbiolabs com CELL BIOLABS INC ae o gt Warranty These products are warranted to perform as described in their labeling and in Cell Biolabs literature when used in accordance with their instructions THERE ARE NO WARRANTIES THAT EXTEND BEYOND THIS EXPRESSED WARRANTY AND CELL BIOLABS DISCLAIMS ANY IMPLIED WARRANTY OF MERCHANTABILITY OR WARRANTY OF FITNESS FOR PARTICULAR PURPOSE CELL BIOLABS sole obligation and purchaser s exclusive remedy for breach of this warranty shall be at the option of CELL BIOLABS to repair or replace the products In no event shall CELL BIOLABS be liable for any proximate incidental or consequential damages in connection with the products Contact Information Cell Biolabs Inc 7758 Arjons
9. num GP Retroviral Packaging Cell Line Pantropic 4 RV 200 ViraDuctin Retrovirus Transduction Kit 5 VPK 120 QuickTiter Retroviral Quantitation Kit 6 VPK 303 Platinum ES EC Retroviral Expression System Ecotropic 7 VPK 304 Platinum ES EC Retroviral Expression System Amphotropic 8 VPK 305 Platinum ES EC Retroviral Expression System Pantropic 9 VPK 306 Platinum HSC Retroviral Expression System Ecotropic 10 VPK 307 Platinum HSC Retroviral Expression System Amphotropic CELL BIOLABS INC eo Kit Components 1 Plat GP Retrovirus Packaging Cell Line Part No RV 103 One sterile tube 1 0 mL gt 3 X 10 cells mL in DMEM containing 20 FCS and 10 DMSO pCMV VSV G Part No RV 110 One sterile tube 10 ug of pCMV VSV G plasmid at 0 25 ug uL in TE pMYs Puro Part No RTV 024 One sterile tube 10 ug of pMYs Puro plasmid at 0 25 ug uL in TE pMYs GFP Part No RTV 052 One sterile tube 10 ug of pMYs GFP plasmid at 0 25 ug uL in TE Materials Not Supplied 1 2 Plat GP Culture Medium DMEM 10 fetal calf serum FCS 10 ug mL blasticidin penicillin and streptomycin Platinum Cell Freeze Medium 70 DMEM 20 FBS 10 DMSO 3 Transfection Reagent Plasmid Isolation Kit Storage Store Platinum Retrovirus Packaging Cell Line in liquid nitrogen and plasmids at 20 C Note For best results begin culture of cells immediately upon receipt If this is not possible store at
10. on After 16 to 24 hours start transfection when the culture becomes 70 80 confluent Note We suggest transfecting cells with FUuGENE Transfection Reagent Roche Applied Science or Lipofectamine Plus Invitrogen For example 1 ug pCMV VSV G plasmid and 2 ug retroviral expression plasmid are mixed with 9 uL FuGENE Transfection Reagent according to the manufacturer s recommendation The mixed DNA FuGENE complex is added by dropwise into the culture media Harvest retroviral supernatant 48 hours after transfection II Selection of Stable Virus Producing Cell Lines 1 2 3 4 Plate transfected packaging cells in puromycin selection medium 24 36 hr after transfection Culture cells for one week with the appropriate antibiotic Isolate large healthy colonies and transfer them to individual plates or wells Determine the viral supernatant titer with desired method and select the clones producing high titer retrovirus Culture the selected clone until cell culture reaches the desired culture volume Store cell clones in liquid nitrogen eo CELL BIOLABS INC i 6 Retaining one plate for the continuation of the culture 7 Viral supernatants can then be harvested every 24 hr after cells reaches 60 80 confluence until cells are no longer viable Storage of Viral Stock VSVG pseudotyped retrovirus can be concentrated by 50 000g for 90 min and then stored in aliquots at 80 C Post Packaging Considerations
11. transient transfection In addition replication competent retroviruses RCR are virtually nonexistent because only coding sequences of viral structural genes are used avoiding any unnecessary retroviral sequences Cell Biolabs Pantropic Platinum HSC Retrovirus Expression System provides a simple method to generate RCR free pantropic retrovirus at high titer The kit includes Plat GP packaging cells pCMV VSV G pMYs Puro retrovirus expression vector and pMYs GFP control vector pMYs retroviral vector includes hybrid LTRs containing elements from both MMLV and MPSV PCMV and is capable of expressing genes in hematopoietic stem cells CELL BIOLABS INC L A Shuttle Amphotropic Ecotropic Pantropic Vector Human N S Mouse Transfect i ji ttt i into Monkey N S Platinum Cells Cat N S Dog N S Hamster N S Harvest Bird Viral AN N 4 N S N S Supernatant f W Fish N S N S AN Frog N S N S Incubate with Insect N S N S Ji Target Se Ss gt Sas Mollusk Cells N S N S Virus must be packaged with a pantropic envelope protein such as VSVG N S Not Suitable Table 1 Retrovirus Production in Packaging Cells and Virus Tropism Related Products 1 RV 101 Platinum E Retroviral Packaging Cell Line Ecotropic 2 RV 102 Platinum A Retroviral Packaging Cell Line Amphotropic 3 RV 103 Plati

Download Pdf Manuals

image

Related Search

Related Contents

  Epson VS400 Start Here Guide    owner`s manual manual de utilización manuel d`utilisation 14 GPM  三洋電機株式会社 様  BT Versatility Owners manual Rev 5 draft D  Scotsman Flockeneisbereiter AF 200 - biovendis  

Copyright © All rights reserved.
Failed to retrieve file