How Directional TOPO - Thermo Fisher Scientific
Contents
1. Transformants plated on selective plates containing the wrong antibiotic Use the appropriate antibiotic for selection 21 Appendix Performing the Control Reactions Introduction We recommend performing the following control TOPO Cloning reactions the first time you TOPO Clone to help you evaluate your results Performing the control reactions involves producing a control PCR product using the reagents included in the kit and using this product directly in a TOPO Cloning reaction Before Starting For each transformation prepare two LB plates containing 50 100 ug ml ampicillin Producing the Use your thermostable proofreading polymerase and the appropriate buffer to Control PCR amplify the control PCR product Follow the manufacturer s recommendations Product for the polymerase you are using 1 To produce the 750 bp control PCR product set up the following 50 pl PCR Control DNA Template 100 ng Tul 10X PCR Buffer appropriate for enzyme 5 pl dNTP Mix 0 5 ul Control PCR Primers 0 1 ug pl each 1 ul Sterile Water 41 5 pl Thermostable polymerase 1 2 5 units ul 1 ul Total Volume 50 pl Overlay with 70 ul 1 drop of mineral oil if required Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 55 C 25X Extension 1 minute 72 C Final Extension 7 minutes 722. end of the primer see Example below Below is the DNA sequence of the N terminus of a theoretical protein and the proposed sequence for your forward PCR primer The ATG initiation codon is underlined DNA sequence 5 ATG GGA TCT GAT AAA Proposed Forward PCR primer 5 C ACC ATG GGA TCT GAT AAA If you design the forward PCR primer as noted above then the ATG initiation codon falls within the context of a Kozak sequence see boxed sequence allowing proper translation initiation of the PCR product in mammalian cells The first three base pairs of the PCR product following the 5 CACC overhang will constitute a functional codon continued on next page Designing PCR Primers continued Guidelines to Design the Reverse Primer Example 1 of Reverse Primer Design When designing your reverse PCR primer consider the following points below Refer to page 6 for a diagram of the TOPO Cloning site e To ensure that your PCR product clones directionally with high efficiency the reverse PCR primer MUST NOT be complementary to the overhang sequence GTGG at the 5 end A one base pair mismatch can reduce the directional cloning efficiency from 90 to 50 increasing the likelihood of your ORF cloning in the opposite orientation see Example 1 below We have not observed evidence of PCR products cloning in the opposite orientation from a two base pair mismatch e If you wish to fuse your PCR product in frame w
3. reaction and the TOPO Cloning reaction OS control Too much PCR product used inthe e Dilute the PCR product ave colonies 5 TOPO Cloning reaction e Use a0 5 1 to 2 1 molar ratio of PCR product TOPO vector PCR product too dilute e Concentrate the PCR product Use a 0 5 1 to 2 1 molar ratio of PCR product TOPO vector PCR primers contain 5 phosphates Do not add 5 phosphates to your PCR primers Incorrect PCR primer design Make sure that the forward PCR primer contains the sequence CACC at the 5 end Make sure that the reverse PCR primer does not contain the sequence CACC at the 5 end Used Taq polymerase or a Taq proofreading polymerase mixture for PCR Use a proofreading polymerase for PCR Long PCR product Increase the incubation time of the TOPO reaction from 5 minutes to 30 minutes Gel purify the PCR product to remove primer dimers and other artifacts PCR reaction contains artifacts i e does not run as a single discrete band on an agarose gel Optimize your PCR using the proofreading polymerase of choice Gel purify your PCR product to remove primer dimers and smaller PCR products Cloning large pool of PCR products or a toxic gene Increase the incubation time of the TOPO reaction from 5 minutes to 30 minutes Use a0 5 1 to 2 1 molar ratio of PCR product TOPO vector 20 continued on next page Troubleshooting continued
4. Antibody HHHHHH COOH Anti His C term FITC R933 25 Antibody Purification of If your gene of interest in is frame with the C terminal polyhistidine 6xHis tag Recombinant you may use Invitrogen s ProBond or Ni NTA Purification System to purify Proteins your recombinant fusion protein See the table below for ordering information Product Amount Catalog no ProBond Purification System 6 purifications K850 01 ProBond Nickel Chelating Resin 50 ml R801 01 150 ml R801 15 Ni NTA Purification System 6 purifications K950 01 Ni NTA Agarose 10 ml R901 01 25 ml R901 15 Purification Columns 50 R640 50 10 ml polypropylene columns Overview Introduction Features of pcDNA 3 1D V5 His TOPO Tag On Demand System Introduction The pcDNA 3 1 Directional TOPO Expression Kit provides a highly efficient 5 minute one step cloning strategy TOPO Cloning to directionally clone a blunt end PCR product into a plasmid vector Blunt end PCR products clone directionally at greater than 90 efficiency minimizing screening No ligase post PCR procedures or restriction enzymes are required Once cloned analyzed and transfected the gene of interest can be expressed directly in mammalian cell lines pcDNA 3 1D V5 His TOPO is a 5 5 kb expression vector designed to facilitate rapid directional cloning of blunt end PCR products for expression in mammalian cells The vector allows high level expression dete
5. C 1X 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 750 bp band should be visible 5 Estimate the concentration of the PCR product and adjust as necessary such that the amount of PCR product used in the control TOPO Cloning reaction results in an optimal molar ratio of PCR product TOPO vector i e 0 5 1 to 2 1 Proceed to the Control TOPO Cloning Reactions next page continued on next page 22 Performing the Control Reactions continued Control TOPO Cloning Reactions Analysis of Results Transformation Control Using the control PCR product produced on the previous page and the a pcDNA 3 1D V5 His TOPO vector set up two 6 pl TOPO Cloning reactions as described below If you plan to transform electrocompetent E coli use Dilute Salt Solution in place of the Salt Solution 1 Set up control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Sterile Water 4 ul 3 pl Salt Solution 1 ul 1 ul Control PCR Product 1 ul pcDNA 3 1D V5 His TOPO 1 pl 1 ul Final volume 6 ul 6 ul Incubate at room temperature for 5 minutes and place on ice Transform 2 ul of each reaction into separate vials of One Shot TOP10 cells see page 11 4 Spread 50 200 pl of each transformation mix onto LB plates containing 50 100 pg ml ampicillin Be sure to plate two different volumes to ensure that at least one pl
6. TOPO Cloning Reaction and Transformation continued Problem Reason Solution Large percentage of inserts cloned in the incorrect orientation Incorrect PCR primer design Make sure that the forward PCR primer contains the sequence CACC at the 5 end Reverse PCR primer is complementary to the GTGG overhang at the 5 end Make sure that the reverse PCR primer does not contain the sequence CACC at the 5 end Large number of incorrect inserts cloned PCR reaction contains artifacts i e does not run as a single discrete band on an agarose gel e Optimize your PCR using the proofreading polymerase of choice e Gel purify your PCR product to remove primer dimers and smaller PCR products Incorrect PCR primer design e Make sure that the forward PCR primer contains the sequence CACC at the 5 end e Make sure that the reverse PCR primer does not contain the sequence CACC at the 5 end Few or no colonies obtained from sample reaction and the transformation control gave no colonies One Shot competent E coli stored incorrectly Store One Shot competent E coli at 80 C If you are using another E coli strain follow the manufacturer s instructions One Shot transformation protocol not followed correctly Follow the One Shot transformation protocol provided on page 11 Insufficient amount of E coli plated Increase the amount of E coli plated
7. 5 1 see figure below These results are generally obtained if too little PCR product is used i e PCR product is too dilute or if too much PCR product is used in the TOPO Cloning reaction If you have quantitated the yield of your PCR product you may need to adjust the concentration of your PCR product before proceeding to TOPO Cloning Tip For the pcDNA 3 1D V5 His TOPO vector using 1 5 ng of a 1 kb PCR product or 5 10 ng of a 2 kb PCR product in a TOPO Cloning reaction generally results in a suitable number of colonies 100 F lt amp 50 23 33 ze 0 0 1 1 10 PCR Product Vector Molar Ratio continued on next page Performing the TOPO Cloning Reaction continued Using Salt Solution in the TOPO Cloning Reaction Performing the TOPO Cloning Reaction You will perform TOPO Cloning in a reaction buffer containing salt i e using the stock salt solution provided in the kit Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells provided or electrocompetent cells see page ix for ordering information e Ifyou are transforming chemically competent E coli use the stock Salt Solution as supplied and set up the TOPO Cloning reaction as directed below e If you are transforming electrocompetent E coli the amount of salt in the TOPO Cloning reaction must be reduced to 50 mM NaCl 2 5 mM MgCl to preve
8. 750 and 1000 pg ml Geneticin 5 Replenish the selective media every 3 4 days and observe the percentage of surviving cells 6 Count the number of viable cells at regular intervals to determine the appropriate concentration of Geneticin that prevents growth within 1 3 weeks Once you have determined the appropriate Geneticin concentration to use for selection you can generate a stable cell line expressing your pcDNA 3 1D V5 His TOPO construct 1 Prepare Geneticin in a buffered solution e g 100 mM HEPES pH 7 3 2 Use the predetermined concentration of Geneticin in complete medium 3 Calculate concentration based on the amount of active drug 4 Cells will divide once or twice in the presence of lethal doses of Geneticin so the effects of the drug take several days to become apparent Complete selection can take from 2 to 4 weeks of growth in selective medium 19 Troubleshooting TOPO Cloning Reaction and Transformation The table below lists some potential problems and possible solutions that may help you troubleshoot the TOPO Cloning and transformation reactions To help evaluate your results we recommend that you perform the control reactions in parallel with your samples see pages 22 23 Problem Reason Solution Few or no colonies Suboptimal ratio of PCR Use a 0 5 1 to 2 1 molar ratio of PCR obtained from sample product TOPO vector used in the product TOPO vector
9. Your PCR Primers Guidelines to Design the Forward PCR Primer Example of Forward Primer Design Note The design of the PCR primers to amplify your gene of interest is critical for expression Consider the following when designing your PCR primers e Sequences required to facilitate directional cloning e Sequences required for proper translation initiation of your PCR product e Whether or not you wish your PCR product to be fused in frame with the C terminal V5 epitope and 6xHis tag When designing your forward PCR primer consider the following points below Refer to page 6 for a diagram of the TOPO Cloning site e To enable directional cloning the forward PCR primer must contain the sequence CACC at the 5 end of the primer The 4 nucleotides CACC base pair with the overhang sequence GTGG in pcDNA 3 1D V5 His TOPO e Make sure your sequence of interest includes a Kozak translation initiation sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1991 Kozak 1990 An example of a Kozak consensus sequence is G AJNNATGG Other sequences are possible but the G or A at position 3 and the G at position 4 are the most critical for function shown in bold The ATG initiation codon is underlined Note If your sequence of interest does not contain an initiation codon within the context of a Kozak sequence design the forward PCR primer to contain a Kozak sequence at the 5
10. complete nucleotide sequence for peDNA 3 1D V5 His lacZ is available for downloading from our Web site www invitrogen com or by contacting Technical Service page 30 gt Hind Ill BamH o pcDNA 3 1D V5 His lacZ Comments for pcDNA 3 1D V5 His lacZ 8586 nucleotides PUC ori CMV promoter bases 232 819 T7 promoter priming site bases 863 882 LacZ ORF bases 939 3995 V5 epitope bases 4083 4124 Polyhistidine 6xHis tag bases 4134 4151 BGH reverse priming site bases 4174 4191 BGH polyadenylation signal bases 4180 4404 SVA0 early promoter and origin bases 4905 5214 Neomycin resistance gene bases 5289 6083 SV40 early polyadenylation signal bases 6261 6391 pUC origin bases 6772 7445 complementary strand Ampicillin b a resistance gene bases 7590 8450 complementary strand bla promoter bases 8451 8549 complementary strand 29 Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate
11. confirm that your gene is cloned in the correct orientation and in frame with the C terminal V5 epitope and 6xHis tag The T7 and BGH Reverse primers are included in the kit to help you sequence your insert see the diagram on page6 for the location of the priming sites If you download the sequence for pcDNA 3 1D V5 His TOPO from our Web site note that the overhang sequence GTGG will be shown already hybridized to CACC No DNA sequence analysis program allows us to show the overhang without the complementary sequence You may analyze positive transformants using PCR For PCR primers use a combination of the T7 Promoter primer or the TK polyA Reverse primer and a primer that hybridizes within your insert You will have to determine the amplification conditions If you are using this technique for the first time we recommend performing restriction analysis in parallel Artifacts may be obtained because of mispriming or contaminating template The protocol below is provided for your convenience Other protocols are suitable Materials Needed PCR SuperMix High Fidelity Invitrogen Catalog no 10790 020 Appropriate forward and reverse PCR primers 20 uM each Procedure 1 For each sample aliquot 48 ul of PCR SuperMix High Fidelity into a 0 5 ml microcentrifuge tube Add 1 ul each of the forward and reverse PCR primer 2 Pick 5 colonies and resuspend them individually in 50 ul of the PCR cocktail from Step 1 above Incubat
12. products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time may yield more colonies 2 Place the reaction on ice and proceed to Transforming One Shot TOP10 Competent Cells next page Note You may store the TOPO Cloning reaction at 20 C overnight Transforming One Shot TOP10 Competent Cells Introduction Materials Needed Note Preparing for Transformation Once you have performed the TOPO Cloning reaction you will transform your pcDNA 3 1D V5 His TOPO construct into competent E coli One Shot TOP10 Chemically Competent E coli Box 2 are included with the kit to facilitate transformation however you may also transform electrocompetent cells see page ix for ordering information Protocols to transform chemically competent or electrocompetent E coli are provided in this section You should have the following materials on hand before beginning e 42 C water bath or electroporator with cuvettes optional e LB plates containing 50 100 pg ml ampicillin two for each transformation e 37 C shaking and non shaking incubator There is no blue white screening for the presence of inserts Most transformants will contain recombinant plasmids with the PCR product of interest cloned in the correct orientation Sequencing primers are included in the kit to sequence across an insert in the multiple cloning site to confirm orientation and reading frame For e
13. sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Two simple protocols are provided below The PureLink Quick Gel Extraction Kit page ix allows you to rapidly purify PCR products from regular agarose gels 1 Equilibrate a water bath or heat block to 50 C 2 Cut the area of the gel containing the desired DNA fragment using a clean sharp blade Minimize the amount of surrounding agarose excised with the fragment 3 Weigh the gel slice 4 Add Gel Solubilization Buffer GS1 supplied in the kit as follows e For lt 2 agarose gels place up to 400 mg gel into a sterile 1 5 ml polypropylene tube Divide gel slices exceeding 400 mg among additional tubes Add 30 pl Gel Solubilization Buffer GS1 for every 10 mg of gel e For gt 2 agarose gels use sterile 5 ml polypropylene tubes and add 60 ul Gel Solubilization Buffer GS1 for every 10 mg of gel 5 Incubate the tube at 50 C for 15 minutes Mix every 3 minutes to ensure gel dissolution After gel slice appears dissolved incubate for an additional 5 minutes Preheat an aliquot of TE Buffer TE to 65 70 C 7 Place a Quick Gel Extraction Column into a Wash Tube Pipette the mixture from Step 5 above onto the column Use 1 column per 400 mg agarose 8 Centrifuge at gt 12 000 x g for 1 minute Dis
14. 11811 023 58 11811 031 20 ml 50 mg ml 10131 035 100 ml 50 mg ml 10131 027 Phosphate Buffered Saline pH 7 4 500 ml 10010 023 B Gal Antiserum 50 pl R901 25 P Gal Assay Kit 100 reactions K1455 01 B Gal Staining Kit 1 kit K1465 01 continued on next page Accessory Products continued Detection of Expression of your recombinant fusion protein can be detected using Anti V5 or Recombinant Anti His C term Antibodies available from Invitrogen Horseradish peroxidase Proteins HRP or alkaline phosphatase AP conjugated antibodies allow one step detection using chemiluminescent or colorimetric detection methods Fluorescein isothiocyanate FITC conjugated antibodies allow one step detection in immunofluorescence experiments The amount of antibody supplied is sufficient for 25 Western blots or 25 immunostaining reactions FITC conjugated antibodies only Product Epitope Catalog no Anti V5 Antibody Detects 14 amino acid epitope R960 25 Anti V5 HRP Antibody derived from the P and V proteins R961 25 ofthe paramyxovirus SV5 Anti V5 AP Antibody Southern et al 1991 R962 25 Anti V5 FITC Antibody GKPIPNPLLGLDST R963 25 Anti His C term Antibody Detects the C terminal R930 25 Anti His C term HRP polyhistidine 6xHis tag requires 931 95 Antibody the free carboxy group for detection Lindner et al 1997 Anti His C term AP R932 25
15. 9 BGH reverse priming site bases 1102 1119 BGH polyadenylation signal bases 1108 1332 SV40 early promoter and origin bases 1833 2142 Neomycin resistance gene bases 2217 3011 SV40 early polyadenylation signal bases 3189 3319 pUC origin bases 3700 4373 complementary strand Ampicillin b a resistance gene bases 4518 5378 complementary strand bla promoter bases 5379 5477 complementary strand continued on next page 27 Map and Features of pcDNA 3 1D V5 His TOPO continued Features 28 pcDNA 3 1D V5 His TOPOS contains the following elements All features have been functionally tested Feature Benefit Human cytomegalovirus CMV immediate early promoter enhancer Allows efficient high level expression of your recombinant protein Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 T7 promoter priming site Allows for in vitro transcription in the sense orientation and sequencing through the insert TOPO Cloning site directional Allows directional cloning of your PCR product in frame with the V5 epitope and polyhistidine C terminal tag if desired V5 epitope Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Allows detection of your recombinant protein with the Anti V5 antibodies Southern et al 1991 C terminal polyhistidine tag Allows purification of your recombinant protein on metal chelating resin such as ProBond Allows d
16. ECIPES E NN 26 Map and Features of p DNA 3 1D V9 His TOPOS ni tad 27 Map OF pcDNA 3 ID NVS HIE ML nee 29 Technical SOVIET ad IAE 30 Product Qua AC O rt 31 BurchaserNotifieati n nose O e AEE E aS aE 32 References naa taa TR 34 N tes ne NN 36 TOPO Cloning Procedure for Experienced Users Introduction This quick reference sheet is provided for experienced users of the directional TOPO Cloning procedure If you are performing the TOPO Cloning procedure for the first time we recommend that you follow the detailed protocols provided in the manual Step Action Design PCR Primers e Include the 4 base pair sequences CACC necessary for directional cloning on the 5 end of the forward primer e Design the primers such that your gene of interest will be optimally expressed and fused in frame with any epitope tags if desired Amplify Your Gene 1 Usea thermostable proofreading DNA polymerase and the PCR primers of Interest above to produce your blunt end PCR product 2 Use agarose gel electrophoresis to check the integrity of your PCR product Perform the TOPO Cloning Reaction 1 Set up the following TOPO Cloning reaction For optimal results use a 0 5 1 to 2 1 molar ratio of PCR product TOPO vector Note If you plan to transform electrocompetent E coli use Dilute Salt Solution in the TOPO Cloning reaction Fresh PCR product 0 5 to 4 pl Salt Solution 1 ul Sterile water add to a final volume o
17. Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail E mail tech _serviceQinvitrogen com jpinfo invitrogen com eurotech invitrogen com Material Data Safety Sheets MSDSs Limited Warranty 30 MSDSs are available on our Web site at www invitrogen com On the home page click on Technical Resources and follow instructions on the page to download the MSDS for your product Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products be
18. NA 3 1D V5 His lacZ supplied with the kit in your experiments to help you evaluate your results Once you have generated your expression clone you must isolate plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic cells must be very clean and free from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HO Mini Plasmid Purification Kit Catalog no K2100 01 or CsCl gradient centrifugation For established cell lines e g HeLa consult original references or the supplier of your cell line for the optimal method of transfection We recommend that you follow exactly the protocol for your cell line Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 For high efficiency transfection in a broad range of mammalian cell lines we recommend using Lipofectamine 2000 Reagent Catalog no 11668 027 available from Invitrogen For more information about Lipofectamine 2000 and the other transfe
19. PCR Products Checking the PCR Product Once you have decided on a PCR strategy and have synthesized the primers produce your blunt end PCR product using any thermostable proofreading polymerase Follow the guidelines below to produce your blunt end PCR product You should have the following materials on hand before beginning Note dNTPs adjusted to pH 8 are provided in the kit e Thermocycler and thermostable proofreading polymerase e 10X PCR buffer appropriate for your polymerase e DNA template and primers to produce the PCR product Set up a 25 ul or 50 ul PCR reaction using the guidelines below e Follow the instructions and recommendations provided by the manufacturer of your thermostable proofreading polymerase to produce blunt end PCR products e Use the cycling parameters suitable for your primers and template Make sure to optimize PCR conditions to produce a single discrete PCR product e Usea7 to 30 minute final extension to ensure that all PCR products are completely extended e After cycling place the tube on ice or store at 20 C for up to 2 weeks Proceed to Checking the PCR Product below After you have produced your blunt end PCR product use agarose gel electrophoresis to verify the quality and quantity of your PCR product Check for the following outcomes below e Be sure you have a single discrete band of the correct size If you do not have a single discrete band follow the manufactu
20. PO charged DNA and adapting it to a whole vector format In this system PCR products are directionally cloned by adding four bases to the forward primer CACC The overhang in the cloning vector GTGG invades the 5 end of the PCR product anneals to the added bases and stabilizes the PCR product in the correct orientation Inserts can be cloned in the correct orientation with efficiencies equal to or greater than 90 Topoisomerase o CCCTL CACC ATG NNN NNN AAG G6G GGGAAGTGG 6TGG TAC NNN NNN LTC CC s PCR product Overhang Overhang invades double stranded O DNA displacing the bottom strand Topoisomerase CCCTTCACC ATG NNN NNN AAG GG GGGAAGTGG TAC NNN NNN TTC CC amp Experimental Outline Experimental The flow chart below outlines the experimental steps necessary to clone and Outline express your blunt end PCR product a Determine strategy for PCR Produce blunt end PCR product using properly designed PCR primers TOPO Cloning Reaction Mix together PCR product and pcDNA 3 1D V5 His TOPO Incubate 5 minutes at room temperature Transform into TOP10 E coli cells Select and analyze colonies Prepare purified plasmid for transfection Transfect mammalian cell line and test for expression of gene of interest Methods Designing PCR Primers Designing
21. ach transformation you will need one vial of competent cells and two selective plates e Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli e Warm the vial of S O C medium from Box 2 to room temperature e Warm LB plates containing 50 100 pg ml ampicillin at 37 C for 30 minutes e Thaw on ice 1 vial of One Shot TOP10 cells from Box 2 for each transformation continued on next page Transforming One Shot TOP10 Competent Cells continued One Shot TOP10 Chemical Transformation Protocol Transformation by Electroporation 1 Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 9 into a vial of One Shot TOP10 Chemically Competent E coli and mix gently Do not mix by pipetting up and down 2 Incubate on ice for 5 to 30 minutes Note Longer incubations on ice seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Ne 7 Spread 50 200 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C We recommend that you plate two different volumes to ensure that
22. are using ProBond to purify your protein refer to the protocol below to prepare cells for lysis If you are using another metal chelating resin refer to the manufacturer s instructions to prepare the cells Use the procedure below to prepare cells for lysis prior to purification of your protein on ProBond You will need 5 x 10 to 1 x 10 stably transfected cells for purification of your protein on a 2 ml ProBond column see ProBond Purification System manual 1 Seed cells in either five T 75 flasks or 2 to 3 T 175 flasks 2 Grow the cells in selective medium until they are approximately 80 90 confluent 3 Harvest the cells by treating with trypsin EDTA for 2 to 5 minutes or by scraping the cells in PBS 4 Inactivate the trypsin by diluting with fresh medium and transfer the cells to a sterile microcentrifuge tube 5 Centrifuge the cells at 1500 x g for 5 minutes Resuspend the cell pellet in PBS 6 Centrifuge the cells at 1500 x g for 5 minutes You may lyse the cells immediately or freeze in liquid nitrogen and store at 70 C until needed TM If you are using ProBond resin refer to the ProBond Purification System manual for details about sample preparation for chromotography If you are using other metal chelating resin refer to the manufacturer s instructions for recommendations on sample preparation Creating Stable Cell Lines Introduction Geneticin Determining Genetic
23. at least one plate will have well spaced colonies 8 An efficient TOPO Cloning reaction may produce several hundred colonies Pick 5 colonies for analysis see Analyzing Transformants page 13 Refer to the Troubleshooting section on page 20 if you have problems obtaining transformants Use ONLY electrocompetent cells for electroporation to avoid arcing Do not use the One Shot TOP10 chemically competent cells for electroporation 1 Add 2 pl of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 9 into a sterile microcentrifuge tube containing 50 pl of electrocompetent E coli and mix gently Do not mix by pipetting up and down Avoid formation of bubbles Transfer the cells to a 0 1 cm cuvette 2 Electroporate your samples using your own protocol and your electroporator Note If you have problems with arcing see the next page Immediately add 250 ul of room temperature S O C medium Transfer the solution to a 15 ml snap cap tube e g Falcon and shake for at least 1 hour at 37 C to allow expression of the ampicillin resistance gene 5 Spread 20 100 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of S O C medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies 6 An efficient TOPO Cloning reaction may produce several hundre
24. ate has well spaced colonies 5 Incubate overnight at 37 C Hundreds of colonies from the vector PCR insert reaction should be produced To analyze the transformations isolate plasmid DNA and digest with the appropriate restriction enzyme as listed below The table below lists the digestion patterns that you should see for inserts that are cloned in the correct orientation or in the reverse orientation Vector Restriction Expected Digestion Patterns Enzyme bp pcDNA 3 1D V5 His TOPO Xba I Correct orientation 4727 5537 Reverse orientation 167 6097 Empty vector 5514 Greater than 90 of the colonies should contain the 750 bp insert in the correct orientation Relatively few colonies should be produced in the vector only reaction pUC19 plasmid is included to check the transformation efficiency of the One Shot TOP10 competent cells Transform one vial of One Shot TOP10 cells with 10 pg of pUC19 using the protocol on page 11 Plate 10 pl of the transformation mixture plus 20 pl of S O C on LB plates containing 100 ug ml ampicillin Transformation efficiency should be 1 x 10 cfu ug DNA 23 Gel Purifying PCR Products Introduction Using the PureLink Quick Gel Extraction Kit 24 Smearing multiple banding primer dimer artifacts or large PCR products gt 3 kb may necessitate gel purification If you wish to purify your PCR product be extremely careful to remove all
25. card the flow through Place the column back into the Wash Tube 9 Optional Add 500 ul Gel Solubilization Buffer GS1 to the column Incubate at room temperature for 1 minute Centrifuge at gt 12 000 x g for 1 minute Discard the flow through Place the column back into the Wash Tube 10 Add 700 pl Wash Buffer W9 with ethanol add 96 100 ethanol to the Wash Buffer according to instructions on the label of the bottle to the column and incubate at room temperature for 5 minutes Centrifuge at gt 12 000 x g for 1 minute Discard flow through 11 Centrifuge the column at gt 12 000 x g for 1 minute to remove any residual buffer Place the column into a 1 5 ml Recovery Tube 12 Add 50 ul warm 65 70 C TE Buffer TE to the center of the cartridge Incubate at room temperature for 1 minute 13 Centrifuge at gt 12 000 x g for 2 minutes The Recovery Tube contains the purified DNA Store DNA at 20 C Discard the column 14 Use 4 ul of the purified DNA for the TOPO Cloning reaction continued on next page Gel Purifying PCR Products continued Low Melt Agarose Method Note If you prefer to use low melt agarose use the procedure below Note that gel purification will result in a dilution of your PCR product and a potential loss of cloning efficiency Use only chemically competent cells for transformation 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE b
26. ction and purification of heterologous proteins in most mammalian cells The vector contains the following features Human cytomegalovirus CMV immediate early enhancer promoter for high level constitutive expression of the gene of interest in a wide range of mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 e TOPO Cloning site for rapid and efficient directional cloning of blunt end PCR products see next page for more information e C terminal peptide containing the V5 epitope and a polyhistidine 6xHis tag for detection and purification of recombinant protein e Neomycin resistance gene for selection of stable cell lines using Geneticin Southern and Berg 1982 TM The control plasmid peDNA 3 1D V5 His lacZ is included for use as a positive control for transfection and expression in the mammalian cell line of choice The pcDNA 3 1D V5 His TOPO vector is compatible with the Tag On Demand System which allows expression of both native and C terminally tagged recombinant protein from the same expression construct The System is based on stop suppression technology originally developed by RajBhandary and colleagues Capone et al 1985 and consists of a recombinant adenovirus expressing a tRNA suppressor When an expression vector encoding a gene of interest with the TAG amber stop codon is transfected into mammalian cells and the tRNA suppressor supernatant is presen
27. ction reagents available from Invitrogen refer to our Web site www invitrogen com or contact Technical Service page 30 TM pcDNA 3 1D V5 His lacZ is provided as a positive control vector for mammalian transfection and expression and may be used to optimize transfection conditions for your cell line This vector allows expression of a B galactosidase fusion protein that may be detected by Western blot or functional assay 15 Detecting Recombinant Fusion Proteins Introduction Preparing Cell Lysates Polyacrylamide Gel Electrophoresis You may express you gene of interest in either transiently transfected cells or stable cell lines see page 19 for guidelines to create stable cell lines You may use a functional assay or a Western blot analysis to detect your recombinant protein see below To detect your fusion protein by Western blot you will need to prepare a cell lysate from transfected cells A sample protocol is provided below Other protocols are suitable To lyse cells 1 Wash cell monolayers 5 x 10 to 1 x 10 cells once with phosphate buffered saline see page ix for ordering information Scrape cells into 1 ml PBS and pellet the cells at 1500 x g for 5 minutes Resuspend in 50 pl Cell Lysis Buffer see the Appendix page 26 for a recipe Other cell lysis buffers are suitable Vortex 4 Incubate cell suspension at 37 C for 10 minutes to lyse the cells Note You may prefer to lyse the cel
28. d colonies Pick 5 colonies for analysis see Analyzing Transformants page 13 Refer to the Troubleshooting section on page 20 if you have problems obtaining transformants continued on next page 11 Transforming One Shot TOP10 Competent Cells continued To prevent arcing of your samples during electroporation the volume of cells 2 should be between 50 and 80 pl 0 1 cm cuvettes or 100 to 200 ul 0 2 cm cuvettes e If you experience arcing during transformation try one of the following suggestions e Reduce the voltage normally used to charge your electroporator by 10 e Reduce the pulse length by reducing the load resistance to 100 ohms e Ethanol precipitate the TOPO Cloning reaction and resuspend in water prior to electroporation Analyzing Transformants Analyzing Positive 1 Pick 5 colonies and culture them overnight in LB or SOB medium containing Clones Sequencing Important Analyzing Transformants by PCR 50 100 pg ml ampicillin 2 Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend using PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 3 Analyze the plasmids by restriction analysis to confirm the presence and correct orientation of the insert Use a restriction enzyme or a combination of enzymes that cut once in the vector and once in the insert You may sequence your construct to
29. e reaction for 10 minutes at 94 C to lyse cells and inactivate nucleases Amplify for 20 to 30 cycles For the final extension incubate at 72 C for 10 minutes Store at 4 C nT p p Visualize by agarose gel electrophoresis continued on next page 13 Analyzing Transformants continued If you have problems obtaining transformants the correct insert or inserts in the Important correct orientation refer to the Troubleshooting section see page 20 We also recommend that you perform the control reactions described on pages 22 23 These reactions will help you troubleshoot your experiment Long Term Once you have identified the correct clone be sure to purify the colony and Storage make a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colony on LB plates containing 50 100 pg ml ampicillin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 100 pg ml ampicillin Grow until culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C Transfecting Cells Introduction Plasmid Preparation Methods of Transfection Positive Control Once you have the desired construct you are ready to transfect the plasmid into the mammalian cells of choice We recommend that you include the positive control vector pcD
30. echnical Service page 30 Note If you are using the peDNA 3 1D V5 His TOPO vector in the Tag On Demand System your gene of interest must contain a TAG stop codon see page 1 3 end of CMV promoter TATA y Putative transcriptional start E Sal CCCATTGACG CAAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CTGGCTAACT AGAGAACCCA T7 promoter priming site Hind Ill Aspr1e l Kpn pamik l CTGCTTACTG GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAGT TAAGCTTGGT ACCGAGCTCG GATCCAGTAC CCT TING ce CATG GGAAG TG GA Xba Apal Sacil V5 epitope EcoR v BstX Not u AAG GGT CAA GAC AAT TCT GCA GAT ATC CAG CAC AGT GGC GGC CGC TTC CCA GTT CTG Lys Gly Gln Asp Asn Ser Ala Asp Ile Gln His Ser Gly Gly Arg l TCG AGT CTA GAG GGC CCG Cac TTC GAA GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT Ser Ser Leu Glu Gly Pro Arg Phe Glu Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Age Polyhistidine region Pme BGH reverse priming site BEE f r 1 T 1 ACG CGT ACC GGT CAT CAT CAC CAT CAC CAT TGA GTTTAAACCC GCTGATCAGC CTCGACTGTG CCTTCTAGTT Thr Arg Thr Gly His His His His His His BGH polyadenylation signal GCCAGCCATC TGTTGTTTGC CCCTCCCCCG TGCCTTCCTT GACCCTGGAA GGTGCCACTC CCACTGTCCT TTCCTAATAA a AATGAGGAAA TTGCATCGCA TTGTCTGAGT AGGTGTCATT CTATTCTGGG GGGTGGGGTG GGGCAGGAC Producing Blunt End PCR Products Introduction Materials Needed Producing Blunt End
31. en 1 327 339 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 2000 2006 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 34 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
32. etection of your recombinant protein with the Anti His C term antibodies Lindner et al 1997 BGH reverse priming site Allows sequencing through the insert Bovine growth hormone BGH polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Goodwin and Rottman 1992 SV40 early promoter and origin Allows efficient high level expression of the neomycin resistance gene and episomal replication in cells expressing the SV40 large T antigen Neomycin resistance gene Allows selection of stable transfectants in mammalian cells Southern and Berg 1982 SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin Allows high copy number replication and growth in E coli bla promoter Allows expression of the ampicillin resistance gene Ampicillin resistance gene B lactamase Allows selection of vector in E coli Map of pcDNA 3 1D V5 His lacZ TM Description pcDNA 3 1D V5 His lacZ is a 8586 bp control vector containing the gene for P galactosidase The lacZ gene was amplified and directionally TOPO Cloned into pCDNA 3 1D V5 His TOPO such that it is in frame with the C terminal peptide The size of the B galactosidase fusion protein is approximately 120 kDa Map of Control The figure below summarizes the features of the peDNA 3 1D V5 His lacZ Vector vector The
33. f 5 pl TOPO vector 1 ul Total volume 6 ul 2 Mix gently and incubate for 5 minutes at room temperature 3 Place on ice and proceed to transform One Shot TOP10 chemically competent E coli below Transform TOP10 Chemically Competent E coli 1 Add 2 pl of the TOPO Cloning reaction into a vial of One Shot TOP10 chemically competent E coli and mix gently 2 Incubate on ice for 5 to 30 minutes 3 Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tube to ice 4 Add 250 ul of room temperature S O C medium 5 Incubate at 37 C for 1 hour with shaking 6 Spread 50 200 ul of bacterial culture on a prewarmed selective plate and incubate overnight at 37 C Control Reaction We recommend using the Control PCR Template and the Control PCR Primers included with the kits to perform the control reaction See the protocol on pages 22 23 for instructions vi Important Information Shipping Storage Types of Kits TOPO Reagents The pcDNA 3 1 Directional TOPO Expression Kit is shipped on dry ice Each kit contains a box of pcDNA 3 1D V5 His TOPO reagents Box 1 and a box of One Shot TOP10 chemically competent E coli Box 2 Store Box 1 at 20 C and Box 2 at 80 C This manual is supplied with the following kits Kit Amount Catalog no pcDNA 3 1 Directional TOPO Expression Kit 20 reactions K4900 01 40 react
34. imer sequence TG AGC TGC TGC CAC AAA 5 continued on next page Designing PCR Primers continued Example 2 of Reverse Primer Design Below is the sequence for the C terminus of a theoretical protein The stop codon is underlined GCG GTT AAG TCG GAG CAC TCG ACG ACT GCA TGA 3 To fuse the ORF in frame with a C terminal tag remove the stop codon by starting with nucleotides homologous to the last codon TGC and continue upstream The reverse primer will be 5 TGC AGT CGT CGA GTG CTC CGA CTT 3 This will amplify the C terminus without the stop codon and allow you to join the ORF in frame with a C terminal tag If you don t want to join the ORF in frame with a C terminal tag simply design the reverse primer to include the stop codon 5 TCA TGC AGT CGT CGA GTG CTC CGA CTT 3 Important pcDNA 3 1D V5 His TOPO vector accepts blunt end PCR products Do not add 5 phosphates to your primers for PCR This will prevent ligation into the peDNA 3 1D V5 His TOPO vector We recommend that you gel purify your oligonucleotides especially if they are long gt 30 nucleotides TOPO Cloning Site 761 841 921 984 1050 1123 1203 CAAT Use the diagram below to help you design PCR primers to clone your PCR product into p DNA 3 1D V5 His TOPO The complete sequence of pcDNA 3 1D V5 His TOPO is available for downloading from our Web site www invitrogen com or by contacting T
35. in Sensitivity Geneticin Selection Guidelines The pcDNA 3 1D V5 His TOPO vector contains the neomycin resistance gene to allow selection of stable cell lines using Geneticin If you wish to create stable cell lines transfect your pcDNA 3 1D V5 His TOPO construct into the mammalian cell line of choice and select for foci using Geneticin General information and guidelines are provided below Geneticin blocks protein synthesis in mammalian cells by interfering with ribosomal function It is an aminoglycoside similar in structure to neomycin gentamycin and kanamycin Expression in mammalian cells of the bacterial aminoglycoside phospho transferase gene APH derived from Tn5 results in detoxification of Geneticin Selective Antibiotic Southern and Berg 1982 To successfully generate a stable cell line expressing your protein of interest you need to determine the minimum concentration of Geneticin required to kill your untransfected host cell line Test a range of concentrations see protocol below to ensure that you determine the minimum concentration necessary for your cell line 1 Plate or split a confluent plate so the cells will be approximately 25 confluent Let cells attach overnight before adding selective medium Prepare a set of 7 plates Prepare Geneticin in a buffered solution e g 100 mM HEPES pH 7 3 Add the following concentrations of antibiotic to each plate 0 50 125 250 500
36. invitrogen pcDNA 3 1 Directional TOPO Expression Kit Five minute directional TOPO Cloning of blunt end PCR products into a mammalian expression vector Catalog nos K4900 01 K4900 40 Version F 10 November 2010 25 0396 Table of Contents A A O iii TOPO Cloning Procedure for Experienced Users una lien v Important Informa HoN aa e a Eaa E ana ga vii ACCESSORY Products negro e deena Guan oe AA E SA AA AAA EA ix Introduction ola 1 A O aiy 1 How Directional TOPO Cloning Works a rail io is ese ee ale dea canes 2 Experimental Outline sau Be is LH nun 3 MethodS sr ae ee ee En 4 Designing PER Primer vaa alt 4 Producing Blunt End PCR Products coccconononcnonononenonnnnnnnnnnenonnnnnnrnnnnnennnnnnraranannnnnnnronananan E e nn nara Ea 7 Performing the TOPOSCE ohne Reaction aaa 8 Transforming One Shot TOP10 Competent Cells iu ii ea 10 Analyzing Transformants ii A a dai 13 Transfecting Cells ci A a A E A A DA 15 Detecting Recombinant Fusion Proteins snnsnesnnenenenssnnnsnsenennnnnnnnnnnnnnnesennnannnn 16 Purifying Recombinant Fusion Prot i S nsession ivete e aeae re EA Eaa KAE EEE Pe ARRE KASE ESEE 18 Creating Staple Cell Lines ii Er Bu A EEE E EE one toes 19 Troubleshooting mser nenns ensenada tas roeren heane E a s eae eliana Aia E dsd Ion aaa aaa 20 APPENGIX E E aa a 22 Performing the Control Reactions netin e a e E E AE a E A E EA AEE 22 Gel Purifying PCR Products nn AEA AEE E EAE nenn E EE OEE EER 24 R
37. ion and may include but is not limited to 1 use of the product or its com ponents in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicensi
38. ions K4900 40 pcDNA 3 1D V5 His TOPO reagents Box 1 are listed below Note that the user must supply a thermostable proofreading polymerase and the appropriate PCR buffer Store Box 1 at 20 C pcDNA 3 1D V5 His lacZ Item Concentration Amount pcDNA 3 1D V5 His TOPO 15 20 ng pl plasmid DNA in 20 pl 50 glycerol 50 mM Tris HCl pH 7 4 at 25 C 1mM EDTA 2mM DTT 0 1 Triton X 100 100 pg ml BSA 30 uM bromophenol blue dNTP Mix 12 5 mM dATP 125 mM dCTP 10 pl 12 5 mM dGTP 12 5 mM dTTP in water pH 8 Salt Solution 1 2 M NaCl 50 pl 0 06 M MgCl Sterile Water 1ml T7 Sequencing Primer 0 1 pg pl in TE Buffer pH 8 20 pl BGH Reverse Sequencing 0 1 ug ul in TE Buffer pH 8 20 pl Primer Control PCR Template 0 1 ug ul in TE Buffer pH 8 10 pl Control PCR Primers 0 1 ug ul each in TE Buffer pH 8 10 pl Expression Plasmid 0 5 ug ulin TE Buffer pH 8 10 pl continued on next page vii Important Information continued Sequencing Primers One Shot Reagents Genotype of TOP10 Cells viii The table below provides the sequence and pmoles of the T7 sequencing primer and the BGH Reverse sequencing primer Primer Sequence Amount T7 5 TAATACGACTCACTATAGGG 3 328 pmoles BGH Reverse 5 TAGAAGGCACAGTCEGAGG 3 358 pmoles The table below describes the items included in the One Shot TOP10 chemically competent E coli cell kit Bo
39. ith the C terminal V5 epitope and 6xHis tag design the reverse PCR primer to remove the native stop codon in the gene of interest see Example 2 on the next page e If you do not wish to fuse your PCR product in frame with the C terminal V5 epitope and 6xHis tag include the native sequence containing the stop codon in the reverse primer or make sure the stop codon is upstream from the reverse PCR primer binding site see Example 2 on the next page Below is the sequence of the C terminus of a theoretical protein You want to fuse the protein in frame with a C terminal tag The stop codon is underlined DNA sequence AAG TCG GAG CAC TCG ACG ACG GTG TGA 3 One possibility is to design the reverse PCR primer to start with the codon just up stream of the stop codon but the last two codons contain GTGG underlined below which is identical to the 4 bp overhang sequence As a result the reverse primer will be complementary to the 4 bp overhang sequence increasing the probability that the PCR product will clone in the opposite orientation You want to avoid this situation Another possibility is to design the reverse primer so that it hybridizes just down stream of the stop codon but still includes the C terminus of the ORF Note that you will need to replace the stop codon with a codon for an innocuous amino acid such as glycine alanine or lysine see below DNA sequence AAG TCG GAG CAC TCG ACG ACG GTG TGA 3 Proposed Reverse PCR pr
40. ls at room temperature or on ice if degradation of your protein is a potential problem 5 Centrifuge the cell lysate at 10 000 x g for 10 minutes at 4 C to pellet nuclei and transfer the supernatant to a fresh tube Assay the lysate for protein concentration Note Do not use protein assays utilizing Coomassie Blue or other dyes NP 40 interferes with the binding of the dye with the protein 6 Add SDS PAGE sample buffer see the Appendix page 26 for a recipe to a final concentration of 1X and boil the sample for 5 minutes 7 Load 20 ug of lysate onto an SDS PAGE gel and electrophorese Use the appropriate percentage of acrylamide to resolve your fusion protein To facilitate separation and visualization of your recombinant fusion protein by polyacrylamide gel electrophoresis a wide range of pre cast NuPAGE and Novex Tris Glycine polyacrylamide gels and electrophoresis apparatus are available from Invitrogen Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use to visualize your recombinant protein refer to our Web site www invitrogen com or contact Technical Service page 30 continued on next page Detecting Recombinant Fusion Proteins continued Detecting Fusion Proteins Note Assay for B galactosidase Activity To detect expression of your recombinant fusion protein by western blot a
41. nalysis you may use the Anti V5 antibodies or the Anti His C term antibodies available from Invitrogen see page x for ordering information or an antibody to your protein of interest In addition the Positope Control Protein Catalog no R900 50 is available from Invitrogen for use as a positive control for detection of fusion proteins containing a V5 epitope or a polyhistidine 6xHis tag The ready to use WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescent methods For more information refer to our Web site www invitrogen com or contact Technical Service see page 30 The C terminal peptide containing the V5 epitope and the polyhistidine region will add approximately 3 6 kDa to your protein If you use the expression control plasmid you may assay for P galactosidase expression by Western blot analysis or activity assay using cell free lysates Miller 1972 Invitrogen offers the P Gal Antiserum the B Gal Assay Kit and the P Gal Staining Kit see page ix for ordering information for fast and easy detection of P galactosidase expression 17 Purifying Recombinant Fusion Proteins Introduction Preparing Cells for Lysis Lysing Cells You will need 5 x 10 to 1 x 10 transfected cells for purification of your protein on a 2 ml ProBond column or other metal chelating column If you
42. ng Harbor New York Cold Spring Harbor Laboratory continued on next page 33 References continued Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Mol Cell Biol 7 4125 4129 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Southern P J and Berg P 1982 Transformation of Mammalian Cells to Antibiotic Resistance with a Bacterial Gene Under Control of the SV40 Early Region Promoter J Molec Appl G
43. ng lifetech com This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany continued on next page References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Cheng C and Shuman S 2000 DNA Strand Transfer Catalyzed by Vaccinia Topoisomerase Ligation of DNAs Containing a 3 Mononucleotide Overhang Nuc Acids Res 28 1893 1898 Cheng C and Shuman S 2000 Recombinogenic Flap Ligation Pathwa
44. nt arcing during electroporation Dilute the stock Salt Solution 4 fold with water to prepare a 300 mM NaCl 15 mM MgCl Dilute Salt Solution Use the Dilute Salt Solution to set up the TOPO Cloning reaction as directed below Use the procedure below to perform the TOPO Cloning reaction Set up the TOPO Cloning reaction depending on whether you plan to transform chemically competent E coli or electrocompetent E coli Reminder For optimal results be sure to use a 0 5 1 to 2 1 molar ratio of PCR product TOPO vector in your TOPO Cloning reaction Note The blue color of the TOPO vector solution is normal and is used to visualize the solution Reagents Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5to4 pl 0 5 to 4 pl Salt Solution 1 ul Dilute Salt Solution 1 4 1 ul Sterile Water add to a final volume of 5 pl add to a final volume of 5 ul TOPO vector 1 ul 1 pl Final volume 6 ul 6 ul Store all reagents at 20 C when finished Salt solution and water can be stored at room temperature or 4 C 1 Mix reaction gently and incubate for 5 minutes at room temperature 22 23 C Note For most applications 5 minutes will yield a sufficient number of colonies for analysis Depending on your needs the length of the TOPO Cloning reaction can be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR
45. pg ml ampicillin 25 ug ml streptomycin 50 ug ml kanamycin or 15 pg ml chloramphenicol to verify the absence of antibiotic resistant contamination 31 Purchaser Notification Introduction Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer 32 Use of the peDNA 3 1 Directional TOPO Expression Kit is covered under a number of different licenses including those detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for considerat
46. rer s recommendations to optimize your PCR with the polymerase of your choice Alternatively you may gel purify the desired product see pages 24 25 e Estimate the concentration of your PCR product You will use this information when setting up your TOPO Cloning reaction see Amount of PCR Product to Use in the TOPO Cloning Reaction next page for details Performing the TOPO Cloning Reaction Introduction Amount of PCR Product to Use in the TOPO Cloning Reaction Once you have produced the desired PCR product you are ready to TOPO Clone it into p DNA 3 1D V5 His TOPO and transform the recombinant vector into TOP10 E coli It is important to have everything you need set up and ready to use to ensure that you obtain the best possible results We suggest that you read the this section and the section entitled Transforming One Shot TOP10 Competent Cells pages 10 12 before beginning If this is the first time you have TOPO Cloned perform the control reactions on pages 22 23 in parallel with your samples When performing directional TOPO Cloning we have found that the molar ratio of PCR product TOPO vector used in the reaction is critical to its success To obtain the highest TOPO Cloning efficiency use a 0 5 1 to 2 1 molar ratio of PCR product TOPO vector see figure below Note that the TOPO Cloning efficiency decreases significantly if the ratio of PCR product TOPO vector is lt 0 1 1 or gt
47. t the stop codon will be translated as serine allowing translation to continue and resulting in production of a C terminally tagged fusion protein TM For more information refer to the Tag On Demand Suppressor Supernatant manual This manual is available for downloading from our Web site www invitrogen com or by contacting Technical Service page 30 How Directional TOPO Cloning Works How Topoisomerase Works Directional TOPO Cloning Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites and cleaves the phosphodiester backbone after 5 CCCTT in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products Directional joining of double strand DNA using TOPO charged oligonucleotides occurs by adding a 3 single stranded end overhang to the incoming DNA Cheng and Shuman 2000 This single stranded overhang is identical to the 5 end of the TOPO charged DNA fragment At Invitrogen this idea has been modified by adding a 4 nucleotide overhang sequence to the TO
48. ttern when electrophoresed on an agarose gel The pcDNA 3 1 Directional TOPO vector is lot qualified using the control reagents included in the kit Under conditions described on pages 22 23 a 750 bp control PCR product is amplified using a forward primer containing CACC at its 5 end and a reverse primer The PCR product is TOPO Cloned into the pcDNA 3 1D V5 His TOPO vector and transformed into the One Shot TOP10 chemically competent E coli included with the kit Each lot of vector should yield greater than 85 cloning efficiency Forty transformants are characterized by restriction digest Of the transformants characterized greater than 90 should be in the correct orientation Both primers have been lot qualified by DNA sequencing experiments using the dideoxy chain termination technique 1 One Shot TOP10 chemically competent cells are tested for transformation efficiency using the control plasmid included in the kit Transformed cultures are plated on LB plates containing 100 pg ml ampicillin and the transformation efficiency is calculated Test transformations are performed in duplicate Transformation efficiency should be greater than 1 x 10 cfu ug plasmid DNA 2 To verify the absence of phage contamination 0 5 1 ml of competent cells are added to LB top agar and poured onto LB plates After overnight incubation no plaques should be detected 3 Untransformed cells are plated on LB plates containing 100
49. uffer Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts Place the tube at 37 C to keep the agarose melted Add 4 ul of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 9 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted Transform 2 to 4 ul directly into One Shot TOP10 cells using the method on page 11 The cloning efficiency may decrease with purification of the PCR product You may wish to optimize your PCR to produce a single band see Producing Blunt End PCR Products page 7 25 Recipes LB Luria Bertani Medium and Plates Cell Lysis Buffer 4X SDS PAGE Sample Buffer 26 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes at 15 psi Allow solution to cool to 55 C and add antibiotic 100 ug ml ampicillin if needed 4 Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes at 15 psi 3 After autoclaving cool to 55 C add antibiotic 100
50. ug ml of ampicillin and pour into 10 cm plates 4 Let harden then invert and store at 4 C 50 mM Tris pH 7 8 150 mM NaCl 1 Nonidet P 40 1 This solution can be prepared from the following common stock solutions For 100 ml combine 1 M Tris base 5 ml 5 M NaCl 3 ml Nonidet P 40 1 ml 2 Bring the volume up to 90 ml with deionized water and adjust the pH to 7 8 with HCl 3 Bring the volume up to 100 ml Store at room temperature To prevent proteolysis you may add 1 mM PMSF 1 pM leupeptin or 0 1 uM aprotinin before use 1 Combine the following reagents 0 5 M Tris HCI pH 6 8 5 ml Glycerol 100 4ml B mercaptoethanol 0 8 ml Bromophenol Blue 0 04 g SDS 0 8 g Bring the volume to 10 ml with sterile water Aliquot and freeze at 20 C until needed Map and Features of pcDNA 3 1D V5 His TOPO Map The map below shows the elements of the peDNA 3 1D V5 His TOPO vector The complete nucleotide sequence is available for downloading from our Web site www invitrogen com or by contacting Technical Service page 30 pcDNA 3 1D V5 His TOPO Comments for pcDNA 3 1D V5 His TOPO 5514 nucleotides PUC ori CMV promoter bases 232 819 T7 promoter priming site bases 863 882 TOPO recognition site 1 bases 930 934 Overhang sequence complementary strand bases 935 938 TOPO recognition site 2 bases 939 943 V5 epitope bases 1011 1052 Polyhistidine 6xHis tag bases 1062 107
51. x 2 Store at 80 C Item Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at 4 C 0 5 Yeast Extract or room temperature 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose TOP10 cells 21x 50 pl pUC19 Control DNA 10 pg ul in 5 mM Tris HCI 0 5 mM 50 pl EDTA pH 8 F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recAl araD139 A ara leu 7697 galU galK rpsL Str endA1 nupG Accessory Products Introduction Additional Products TM The products listed in this section may be used with the peDNA 3 1 Directional TOPO Expression Kit For more information refer to our Web site www invitrogen com or contact Technical Service page 30 Many of the reagents supplied in the peDNA 3 1 Directional TOPO Expression Kit and other reagents suitable for use with the kit are available separately from Invitrogen Ordering information for these reagents is provided below Item Amount Catalog no One Shot TOP10 Chemically Competent 10 reactions C4040 10 es 20 reactions C4040 03 One Shot TOP10 Electrocompetent Cells 10 reactions C4040 50 PureLink HQ Mini Plasmid Purification 100 reactions K2100 01 Kit PureLink Quick Gel Extraction Kit 50 reactions K2100 12 Ampicillin 20 ml 11593 027 Lipofectamine 2000 Reagent 1 5 ml 11668 019 0 75 ml 11668 027 Geneticin Selective Antibiotic 1g
52. y for Intrinsic Repair of Topoisomerase IB Induced Double Strand Breaks Mol Cell Biol 20 8059 8068 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nuc Acids Res 15 1311 1326 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nuc Acids Res 15 8125 8148 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biol 115 887 903 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Lindner P Bauer K Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Miller J H 1972 Experiments in Molecular Genetics Cold Spri
53. yond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Product Qualification Introduction Vectors TOPO Cloning Efficiency Primers One Shot TOP10 Chemically Competent E coli This section describes the criteria used to qualify the components of the pcDNA 3 1 Directional TOPO Expression Kit The pcDNA 3 1 V5 His parental vector of peDNA 3 1D V5 His TOPO and pcDNA 3 1D V5 His lacZ plasmids are qualified by restriction digest Restriction digests must demonstrate the correct banding pa
Download Pdf Manuals
Related Search