Vantage microRNA Detection Kit
Contents
1. Cat No 11831 050 MiR 210 lacks homology with any other sequence in the Oncology Detection Panel 1 and shows gt 1 cross reactivity with any other miR assay in this multiplex 2502 Urbana Pike Ijamsville MD 21754 USA 301 874 4990 phone 301 874 4993 fax Customer Service marligen com www marligen com Page 7 of 8 20215 Rev3 b Balance Between Specificity and Sensitivity for Closely Related Sequences 400 attomoles of synthetic biotinylated miR 100 was incubated with the Vantage Oncology Detection Panel 1 Cat No 11831 050 The assay was performed using the protocol as described in the package insert except different temperatures were employed at the wash step Results show lt 10 cross reactivity with very similar sequences under standard protocol conditions 25 C Negligible cross reactivity was observed for all of the other miR sites Specificity for miR 100 increased by raising the wash temperature but the overall assay signal is reduced In this assay high sensitivity and low cross reactivity are maintained following the standard protocol although greater specificity can be obtained by increasing wash temperature 400 attomoles of synthetic let 7a was incubated with the Vantage Oncology Detection Panel 1 Cat No 11831 050 The assay was performed using the protocol described in the package insert except the wash step was also carried out at 60 C With the exception of the very similar let 7c sequence all miR sites2. 1 IMPORTANT Do not allow the filter membrane to dry throughout the transfer wash and detection steps 2 It is highly recommended to add 1 unit L of RNase Inhibitor to the SAPE Diluent 3 It is important to apply a slight vacuum of 2 3 in Hg during all wash steps Higher vacuum may result in the loss of beads and reduce bead count 4 During all wash steps cover unused wells with a plate sealer to ensure a seal necessary to pull a vacuum A Washes 1 Pre wet the wells in filter plate with 100 L Wash Buffer 2 Transfer the hybridized reactions to each pre wet well cover unused wells with a plate and apply vacuum to evacuate 3 Remove vacuum and immediately add 100 L of Wash Buffer to each well and apply vacuum to remove buffer Repeat this wash step for total of 3 washes Optional For customer convenience all washes are performed at room temperature As shown in Appendix B increased assay specificity may be achieved by increasing temperature of wash buffer to 60 C However please note that increasing the wash temperature may reduce overall assay signal 4 Remove vacuum and add 100 L SAPE Diluent to each well and apply vacuum to remove diluent Remove plate from manifold 5 Blot the bottom of the filter plate dry on a clean paper towel B SAPE Detection 1 Prepare SAPE Detection Reagent as shown in Table 2 Table 2 SAPE Detection Reagent Preparation Optional Add 1 unit of RNase Inhibitor e g Superase In
3. 50 reactions Hybridization Buffer 25 L 625 L 1250 L Bead Mix 8 L 200 L 400 L 4 Vortex the Hybridization Bead Mix to ensure that it is fully mixed 5 Add 33 L of the Hybridization Bead Mix into each well of a nuclease free PCR stripwell plate or into each nuclease free PCR tube 6 Transfer 20 L of the labeled RNA sample prepared using Vantage microRNA Labeling Kit into the 33 L of the Hybridization Bead Mix in the PCR wells or tubes mix by pipeting up and down Note If duplicates are to be performed add 10 L of the labeled RNA sample to the 33 L of the Hybridization Bead Mix in the PCR wells or tubes bring the volume to 53 L by adding 10 L nuclease free water and mix by pipeting up and down IMPORTANT As noted in the Set up duplicates should have double the amount of input RNA labeled with the Vantage microRNA Labeling Kit 7 Hybridize the reactions at 60 C by using a thermocycler or heating block for one hour with continuous shaking at 400 rpm Protect the reactions from light during this incubation Note If shaking is not possible during this step the MFI signals may be slightly reduced However the overall results will not be affected Part II Detection During this step non specific binding is removed by subjecting the reactions to high stringency washes The specific microRNAs present in the sample are then detected by labeling the biotins with SAPE Usage Notes
4. CJ Lee YC Chen HS Su TJ Chiang CC Li HN Hong QS Su HY Chen CC Chen WJ Liu CC Chan WK Chen WJ Li KC Chen JJ Yang PC 2008 MicroRNA signature predicts survival and relapse in lung cancer Cancer Cell 13 1 pp48 57 301 874 4993 fax Customer Service marligen com www marligen com Page 4 of 8 20215 Rev3 Vantage microRNA Multiplex Detection Kit Oncology Detection Panel 1 Store at 2 8 C APPENDIX A TABLE OF microRNAs AND xMAP BEAD REGIONS The sequences and nomenclature of the mature microRNAs are extracted from The miRBase Sequence Database version 12 0 released in September 2008 in Sanger Institute in UK Names annotated with indicate a mature microRNA sequence that originated from a stem loop molecule that generated two mature microRNA sequences In these cases one mature sequence has a standard name while the other sequence from the same stem loop has an annotated name The nomenclature of the sequences detected by Vantage Oncology Detection Panel 1 is designated using the human sequence nomenclature The equivalent mouse and rat sequences are indicated in the table below xMAP Bead Number Human microRNA Nomenclature Human microRNA mature sequences Equivalent Mouse Mus musculus Nomenclature Equivalent Rat Rattus norvegicus Nomenclature Notes 1 hsa let 7a UGAGGUAGUAGGUUGUAUAGUU mmu let 7a rno let 7a 2 hsa let 7c UGAGGUAGUAGGUUGUAUGGUU mmu let 7c rno let 7c 3 hsa
5. Vantage microRNA Multiplex Detection Kit Oncology Detection Panel 1 Store at 2 8 C Catalog No 11831 050 50 Reactions Overview and Intended Use The Vantage microRNA Detection Kit offers researchers a fast and simple method for profiling the expression levels of multiple microRNAs from many different sample types including total RNA enriched low molecular weight LMW RNA and degraded RNA The assays are configured on the xMAP bead array allowing for the detection of multiple microRNAs in one sample In addition the 96 well format allows many samples to be analyzed in one run MicroRNAs are a class of small molecules about 21 23 nucleotides in length that regulate gene expression by various methods including translational repression mRNA cleavage methylation and deadenylation Differences in the expression levels of microRNAs have been associated with the pathogenesis of many diseases including cancer By measuring the expression levels of microRNAs researchers obtain a better understanding of the processes involved in tumor development and progression In addition researchers can observe distinct expression patterns associated with particular stages of disease The specific microRNAs detected in the Vantage Oncology Detection Panel 1 are given in Appendix A These microRNAs have been associated with a variety of solid tumors ref 1 5 Principle of Method The Vantage microRNA Detection Kit utilizes a simple hybrid
6. let 7g UGAGGUAGUAGUUUGUACAGUU mmu let 7g 4 hsa let 7i UGAGGUAGUAGUUUGUGCUGUU mmu let 7i rno let 7i 5 hsa miR 100 AACCCGUAGAUCCGAACUUGUG mmu miR 100 rno miR 100 6 hsa miR 106a AAAAGUGCUUACAGUGCAGGUAG mmu miR 106a 7 hsa miR 10a UACCCUGUAGAUCCGAAUUUGUG mmu miR 10a rno miR 10a 5p 8 hsa miR 10b UACCCUGUAGAACCGAAUUUGUG mmu miR 10b rno miR 10b 9 hsa miR 125a 5p UCCCUGAGACCCUUUAACCUGUGA mmu miR 125a 5p rno miR 125a 5p 10 hsa miR 125b UCCCUGAGACCCUAACUUGUGA mmu miR 125b 5p rno miR 125b 5p 11 Not in use 12 Not in use 13 hsa miR 132 ACCGUGGCUUUCGAUUGUUACU 14 hsa miR 135a UAUGGCUUUUUAUUCCUAUGUGA mmu miR 135a rno miR 135a 15 hsa miR 136 ACUCCAUUUGUUUUGAUGAUGGA mmu miR 136 rno miR 136 16 hsa miR 138 AGCUGGUGUUGUGAAUCAGGCCG mmu miR 138 rno miR 138 17 hsa miR 141 CAUCUUCCAGUACAGUGUUGGA mmu miR 141 18 hsa miR 16 UAGCAGCACGUAAAUAUUGGCG mmu miR 16 rno miR 16 19 hsa miR 17 CAAAGUGCUUACAGUGCAGGUAG mmu miR 17 rno miR 17 20 hsa miR 181b AACAUUCAUUGCUGUCGGUGGGU mmu miR 181b rno miR 181b 21 hsa miR 185 UGGAGAGAAAGGCAGUUCCUGA mmu miR 185 rno miR 185 22 hsa miR 195 UAGCAGCACAGAAAUAUUGGC mmu miR 195 rno miR 195 2502 Urbana Pike Ijamsville MD 21754 USA 301 874 4990 phone 301 874 4993 fax Customer Service marligen com www marligen com Page 5 of 8 20215 Rev3 xMAP Bead Number Human microRNA Nomenclature Human microRNA mature sequences Equival
7. results Each specific software used with the Luminex or Luminex based instrument may have different instructions for obtaining the high gain setting Below are instructions using the Luminex 2 3 software Please see manufacturer s guidelines for instrument software specific instructions e g BioPlex 1 Create a new lot number for CAL2 and enter lot number with an HG at the end to designate High Gain 2502 Urbana Pike Ijamsville MD 21754 USA 301 874 4990 phone 301 874 4993 fax Customer Service marligen com www marligen com Page 2 of 8 20215 Rev3 2 Record the CAL2 Calibrator target RP1 which is usually around 3832 3 Multiply the CAL2 Calibrator target RP1 by 4 55 to get a new target value of approximately 17 436 4 Enter the new Calibrator target RP1 as the value for your New CAL2 lot 5 Run the CAL2 calibration Detection Protocol Part I Hybridization During this step the microRNAs present in the sample are hybridized to their complimentary sequences on the xMAP beads 1 Vortex the Bead Mix vigorously for 20 seconds 2 Sonicate the Bead Mix in a sonicating waterbath for 2 minutes 3 Prepare the Hybridization Bead Mix based on the number of reactions to be run in the assay as illustrated in Table 1 Table 1 Hybridization Bead Mix Preparation 2502 Urbana Pike Ijamsville MD 21754 USA 301 874 4990 phone Component Volume per reaction Volume per 25 reactions Volume per
8. Ambion Cat No AM2694 or equivalent per microliter of SAPE Diluent 2 Mix the SAPE Detection Reagent by vortexing 3 Add 100 L of SAPE Detection Reagent into the washed well of the filter plate 4 Incubate the filter plate in dark for 30 minutes at room temperature Note To increase MFI signal the plate may be shaken at 400 rpm during this incubation Protect the reactions from light Component Volume per reaction Volume per 25 reactions Volume per 50 reactions Detection reagent 1 L 25 L 50 L SAPE Diluent 100 L 2 5 mL 5 mL 301 874 4993 fax Customer Service marligen com www marligen com Page 3 of 8 20215 Rev3 5 Add 100 L of SAPE Diluent to each well and apply vacuum to remove buffer Repeat this wash step for total of 3 washes 6 Blot the bottom of the filter plate dry on a clean paper towel 7 Add 100 L of SAPE Diluent into each well to resuspend the beads in the filter plate by shaking for 2 minutes at 400 rpm or by pipeting up and down 8 Read the filter plate in Luminex instrument at high gain setting see Luminex Instrument Set up DATA Analysis 1 Use the MFI data output from the Luminex Instrument to collect the raw MFI 2 Subtract the background MFI in negative control from the Sample MFI Note If after subtraction of background MFI signal is negative regard results as zero i e that specific microRNA is not detectable in the sample 3 Control 1 bead 49 dete
9. R 99a AACCCGUAGAUCCGAUCUUGUG mmu miR 99a rno miR 99a 45 hsa miR 137 UUAUUGCUUAAGAAUACGCGUAG mmu miR 137 rno miR 137 46 hsa miR 182 UGGUUCUAGACUUGCCAACUA 47 hsa miR 221 AGCUACAUUGUCUGCUGGGUUUC mmu miR 221 rno miR 221 48 hsa miR 372 AAAGUGCUGCGACAUUUGAGCGU 49 NA Control 1 2502 Urbana Pike Ijamsville MD 21754 USA 301 874 4990 phone 301 874 4993 fax Customer Service marligen com www marligen com Page 6 of 8 20215 Rev3 APPENDIX B PERFORMANCE CHARACTERISTICS OF VANTAGE ONCOLOGY DETECTION KITS 1 Protocol Overview 2 Assay Sensitivity a The limit of detection of the Vantage microRNA Detection Kits for specific microRNAs was calculated using synthetic microRNAs labeled with the Vantage microRNA Labeling Kit Cat No 11820 025 and detected using Oncology Detection Panel 1 Cat No 11831 050 Limit of Detection Range 0 03 0 1 pg 5 15 attomoles b The limit of detection of the Vantage microRNA Detection Kits in tissues was calculated using total RNA extracted from human brain labeled with the Vantage microRNA Labeling Kit Cat No 11820 025 and detected using Oncology Detection Panel 1 Cat No 11831 050 Limit of Detection Range 3 40 ng total RNA 3 Assay Specificity a No Cross reactivity Observed Between Unrelated Sequences 200 pg of synthetic miR 210 labeled with the Vantage microRNA Labeling Kit Cat No 11820 025 and detected using Oncology Detection Panel 1
10. are changed frequently to avoid contamination 3 There should be designated solutions tips tubes lab coats pipettes etc for RNA only 4 All RNA solutions should be prepared using at least 0 05 DEPC treated autoclaved water or molecular biology grade nuclease free water 5 Clean all surfaces with commercially available RNase decontamination solutions 6 When working with purified RNA samples ensure that they remain on ice during downstream applications Assay controls 1 Control 1 bead 49 detects 5 8S RNA that is ubiquitously expressed in mammalian cells and is selected as a house keeping gene for the Vantage Detection Kits A signal of 4000 10000 MFI is typically observed when using 1 2 g of high quality RIN gt 8 total RNA 2 An additional assay control is available from Marligen The Vantage MiR plex Control Cat No 11830 001 contains 7 synthetic biotinlyated RNAs including 5 8S miR 21 and miR 9 that are detected by the Vantage Oncology Detection Panel 1 Add 20 L of the Vantage miR plex Control into 33 L of the Hybridization Bead Mix at Hybridization Step 6 then follow protocol as described Expected results for this assay control is shown in Appendix B Note There is no need to label this sample as the MiR plex Control is already biotinylated Set up Prior to Starting Detection Protocol 1 Prepare labeled RNA Prior to using this detection kit the microRNAs present in the samples must
11. be labeled with biotin To obtain optimal results it is recommended that the Vantage microRNA Labeling Kit Cat No 11820 025 is used to label samples 2 Use 0 5 2 g of labeled RNA per reaction If duplicates are to be performed in the detection assay double the amount of input RNA to be labeled and split the sample accordingly Notes Less than 0 5 g reaction may be used for some samples However it is recommended that a pilot study is carried out to determine the optimal amount of labeled RNA for a particular sample type Refer to the protocol for Vantage microRNA Labeling Kit for further details on sample labeling 3 Set thermocycler or heating block to 60 C 4 Warm up the Luminex or Luminex based instrument Luminex Instrument Setup A Set up the instrument as described in the user s manual Setup details specific to this kit are described below 1 The XY platform heater should be off 2 Set the events bead to 50 3 Set the minimum events to 20 4 Enter the number of samples 5 Set the sample size to 50 L 6 Set the flow rate to Fast 7 Enter the bead region numbers as indicated in the table in Appendix A 8 Check the probe height and adjust it if necessary to accommodate the filter plate 9 Perform 1 prime with sheath fluid 1 alcohol flush and 2 sheath fluid washes B Adjust Luminex Instrument to High Gain Setting A high gain setting for the Luminex instrument is recommended to provide the best
12. cts 5 8S RNA that is ubiquitously expressed in mammalian cells and is selected as a house keeping microRNA gene for the Vantage Oncology Panel 1 When comparing two samples normalize the MFI with Control 1 MFI of Control 1 in Control Sample Normalization factor MFI of Control 1 in Tumor or Treated Sample 2502 Urbana Pike Ijamsville MD 21754 USA 301 874 4990 phone For example Control 1 in normal tissue MFI 20000 Control 1 in tumor tissue MFI 16000 20000 Normalization factor 16000 1 25 4 Then multiply Tumor or Treated Sample MFI by the normalization factor 1 25 5 The fold change in microRNA expression can be calculated by dividing the normalized MFI for the Tumor or Treated Sample by the MFI for the Control Sample Plot results using Excel or equivalent Note that if an MFI value is zero or close to 0 lt 10 the microRNA is not detectable in the sample and should be considered as not expressed 6 To determine assay precision calculate standard deviation SD and assay coefficient of variation CV CV SD mean x 100 Assay CVs are typically less than 5 for technical replicates Technical Support For further technical assistance please contact us at 866 464 4990 ext 102 or technical support marligen com Technical support and troubleshooting guides for these products can also be found on our website at www marligen com Related Products To see our full line of Vantage micr
13. ent Mouse Mus musculus Nomenclature Equivalent Rat Rattus norvegicus Nomenclature Notes 23 hsa miR 199a 5p CCCAGUGUUCAGACUACCUGUUC mmu miR 199a 5p rno miR 199a 5p 24 hsa miR 200b CAUCUUACUGGGCAGCAUUGGA mmu miR 200b 25 hsa miR 205 UCCUUCAUUCCACCGGAGUCUG mmu miR 205 rno miR 205 26 hsa miR 20a UAAAGUGCUUAUAGUGCAGGUAG mmu miR 20a rno miR 20a 27 hsa miR 21 UAGCUUAUCAGACUGAUGUUGA mmu miR 21 rno miR 21 28 hsa miR 210 CUGUGCGUGUGACAGCGGCUGA mmu miR 210 rno miR 210 29 hsa miR 212 UAACAGUCUCCAGUCACGGCC mmu miR 212 rno miR 212 30 hsa miR 218 UUGUGCUUGAUCUAACCAUGU mmu miR 218 rno miR 218 31 hsa miR 23b UGGGUUCCUGGCAUGCUGAUUU 32 hsa miR 24 2 UGCCUACUGAGCUGAAACACAG mmu miR 24 2 rno miR 24 2 33 hsa miR 27a AGGGCUUAGCUGCUUGUGAGCA mmu miR 27a rno miR 27a 34 hsa miR 29a ACUGAUUUCUUUUGGUGUUCAG mmu miR 29a rno miR 29a 35 hsa miR 29b 2 CUGGUUUCACAUGGUGGCUUAG rno miR 29b 2 36 hsa miR 29c UGACCGAUUUCUCCUGGUGUUC mmu miR 29c rno miR 29c 37 hsa miR 30d UGUAAACAUCCCCGACUGGAAG mmu miR 30d rno miR 30d 38 hsa miR 34a UGGCAGUGUCUUAGCUGGUUGU mmu miR 34a rno miR 34a 39 hsa miR 34b UAGGCAGUGUCAUUAGCUGAUUG rno miR 34b 40 hsa miR 9 UCUUUGGUUAUCUAGCUGUAUGA mmu miR 9 rno miR 9 41 hsa miR 93 CAAAGUGCUGUUCGUGCAGGUAG mmu miR 93 rno miR 93 42 hsa miR 95 UUCAACGGGUAUUUAUUGAGCA 43 hsa miR 96 UUUGGCACUAGCACAUUUUUGCU mmu miR 96 rno miR 96 44 hsa mi
14. in the assay show negligible cross reactivity under standard protocol conditions Specificity for let 7a increases significantly by increasing the wash temperature although this decreases the overall assay signal For the most sensitive assay follow the standard protocol but for higher specificity increase the wash temperature 4 Vantage MiR plex Control Expected Results Vantage microRNA Detection Kit Oncology Detection Panel 1 47 plex Breast Cancer Panel 1 8 plex Pancreatic Cancer Panel 1 12 plex Ovarian Cancer Panel 8 plex Cardiac Panel 1 10 plex Diabetes Panel 1 11 plex Hypoxia Panel 1 10 plex Cat No 11831 050 11833 050 11832 050 11834 050 11835 050 11836 050 11837 050 microRNA Expected MFI Values miR 1 Low Low miR 107 Low Low miR 126 Low miR 203 Low miR 21 High High High High High High miR 9 High High 5 8S Medium Medium Medium Medium Medium Medium Medium 2502 Urbana Pike Ijamsville MD 21754 USA 301 874 4990 phone 301 874 4993 fax Customer Service marligen com www marligen com Page 8 of 8 20215 Rev3
15. itions Store all components at 2 8 C Handling Instructions The kit is shipped on ice packs Upon receipt the components should be stored at 2 8 C 2502 Urbana Pike Ijamsville MD 21754 USA 301 874 4990 phone 301 874 4993 fax Customer Service marligen com www marligen com Page 1 of 8 20215 Rev3 Materials and Equipment Required But Not Supplied Nuclease free PCR stripwell plate or nuclease free PCR tubes 1 5 mL RNase free microfuge tubes Plugged micropipette tips Nuclease Free water Ambion Cat No AM9934 or equivalent Microcentrifuge Thermocycler or heating block at 60 C Plate Shaker Vortex Mixer Sonicating waterbath 96 well filter plate vacuum manifold Luminex Instrument Optional RNase Inhibitor Superase In Ambion Cat No AM2694 or equivalent Important Information READ ENTIRE PROTOCOL BEFORE USE ADDITIONAL PRECAUTIONS SHOULD BE TAKEN TO PREVENT THE DEGRADATION OF RNA RNases are very stable and robust enzymes that degrade RNA Autoclaving solutions and glassware is not always sufficient to actively remove these enzymes The first step when preparing to work with RNA is to create an RNase free environment The following precautions are recommended as your best defense against these enzymes 1 The RNA area should be located away from microbiological work stations 2 Clean disposable gloves should be worn at all times when handling reagents samples pipettes disposable tubes etc It is recommended that gloves
16. ization procedure where samples are ready for detection on the Luminex reader within 90 minutes The samples are first labeled with multiple biotins using the Vantage microRNA Labeling Kit Kit sold separately See Cat No 11820 025 The biotinylated samples are incubated with a Bead Mix containing a mixture of different fluorescently dyed xMAP beads Each distinct xMAP bead is coupled with a unique probe that recognizes a specific microRNA The beads and sample are incubated at 60 C allowing the microRNAs present in the sample to hybridize to the specific probes Following hybridization the samples are subjected to a high stringency wash to remove any non specific binding Finally the samples are incubated with streptavidin phycoerythrin SAPE which binds to the biotinylated microRNA hybridized to the xMAP bead The samples are read on Luminex or Luminex based instruments e g BioPlex that detect the specific microRNAs present in the sample by their unique bead region and quantify the microRNAs by the intensity of the SAPE signal Terms and Conditions By opening this Assay Product which contains fluorescently labeled microsphere beads authorized by Luminex Corporation or using this Assay Product in any manner you are consenting to be bound by the following terms and conditions You are also agreeing that the following terms and conditions constitute a legally valid and binding contract that is enforceable against you If
17. oRNA analysis products visit our website at www marligen com Limited Use License and Use Restrictions A limited research use only license is conveyed to the purchaser of this product Trademarks Vantage is a trademark of Marligen Biosciences Inc Luminex and xMAP are trademarks of Luminex Corporation References 1 Calin GA Sevignani C Dumitru CD Hyslop T Noch E Yendamuri S Shimizu M Rattan S Bullrich F Negrini M Croce CM 2004 Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers Proc Natl Acad Sci 104 19 pp8017 8022 2 Volinia S Calin GA Liu CG Ambs S Cimmino A Petrocca F Visone R Iorio M Roldo C Ferracin M Prueitt RL Yanaihara N Lanza G Scarpa A Vecchione A Negrini M Harris CC Croce CM 2006 A microRNA expression signature of human solid tumors defines cancer gene targets Proc Natl Acad Sci 103 7 pp2257 2261 3 Blower PE Verducci JS Lin S Zhou J Chung JH Dai Z Liu CG Reinhold W Lorenzi PL Kaldjian EP Croce CM Weinstein JN Sadee W 2007 MicroRNA expression profiles for the NCI 60 cancer cell panel Mol Cancer Ther 6 pp1483 1491 4 Gaur A Jewell DA Liang Y Ridzon D Moore JH Chen C Ambros VR Israel MA 2007 Characterization of microRNA expression levels and their biological correlates in human cancer cell lines Cancer Res 67 pp2456 2468 5 Yu SL Chen HY Chang GC Chen CY Chen HW Singh S Cheng CL Yu
18. you do not agree to all of the terms and conditions set forth below you must promptly return this Assay Product for a full refund prior to using it in any manner You the customer acquire the right under Luminex Corporation s patent rights if any to use this Assay Product or any portion of this Assay Product including without limitation the microsphere beads contained herein only with Luminex Corporation s laser based fluorescent under the name Luminex Instrument Safety and Use Statement All biological materials should be handled as potentially hazardous Follow universal precautions as established by the Centers for Disease Control and Prevention and by the Occupational Safety and Health Administration when handling and disposing of potentially infectious or hazardous agents This product is authorized for laboratory research use only The product has not been qualified or found safe and effective for any human or animal diagnostic application Uses other than the labeled intended use may be a violation of applicable law If you have any questions concerning the use of this product please contact Marligen Biosciences Inc at 866 464 4990 or visit www marligen com Components included with this kit Component Amount Hybridization Buffer 1 25 mL Oncology Panel 1 Bead Mix 400 L Detection Reagent 55 L Wash Buffer 2 x 10 mL SAPE Diluent 25 mL Aluminum Plate Sealers 2 Each Filter Plate 1 Each Storage Cond
Download Pdf Manuals
Related Search