Home

Matchmaker One-Hybrid Library Construction & Screening Kit

1. Colonies appear pink on YPD or YPDA media The red pigment exhibited by ade2 mutants is an oxidized polymerized derivative of 5 aminoimid azole ribotide which accumulates in ade2 or ade7 strains grown in medium low in adenine YPD contains low levels of adenine which is why we recommend supplementing YPD with additional Ladenine hemisulfate Appendix D Protocol No PT3529 1 Version No PR732190 36 www clontech com Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit XIV Troubleshooting Guide continued id s 6 11 SOLUTION Failure to detect known protein DNA interactions Only one or two repeats of the target sequence are present Try increasing the number of repeats of your target sequence At Clontech we find that three sequence repeats often results in stronger interactions than One or two sequence repeats Presumably the central repeat is simply acting as a spacer between two binding sites If expression of the AD hybrid protein is toxic to the cell trans formants will not grow or will grow very slowly on the selection plate Sometimes truncation of the AD hybrid protein will alleviate the toxicity and still allow the interaction to occur If one of the following situations is occurring it may interfere with the ability of the AD hybrid pro teins to interact with the target element T
2. If 1 10 OR 1 100 dilutions were plated multiply by 10 and 100 respectively After transformation using 100 ng of pGBT9 control plasmid from Yeastmaker Yeast Transfor mation System 2 100 ul of a 1 10 dilution was plated from 1 ml total and yielded 300 colo nies after 3 days on SD Trp Transformation Efficiency 300 x 1 x 10 dilution factor 3x10 cfu ug 0 1 x 0 1 NOTE After transforming 100 ng of the pGBT9 control plasmid supplied with Cat No 630439 and plating 100 ul of the 1 100 dilution at least 30 colonies should grow after 3 days on SD Trp Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR732190 ATakara Bio Company 34 Matchmaker One Hybrid Library Construction amp Screening Kit XIII Tips on Plating Patching amp Streaking on Nutritional Selection Media A Problems with Patching or Streaking Too Many Cells Selection in the Matchmaker Yeast One Hybrid Systems is based on nutritional selection detecting growth of colonies on media lacking particular amino acids This type of selection works most effectively when the amount of cells plated on a plate is controlled e Dense plating or patching can result in some growth by cells obtaining nutrients from surrounding dead cells rather than from the medium Plating more than the recommended volumes can give the illusion of growth e For many protocols described in this user manual you will note that we recommend that
3. Break away end lt White end cap J 2 ml Collection Tubes Centrifuge at 700 g for 5 min to purge the equillibration buffer then discard collection tube and buffer The matrix will appear semi dry NOTE We recommend swing bucket or horizontal rotors Fixed angel rotors can be used but there is a risk that the sample will pass down the inner side of the columns instead of through the gel matrix resulting in incon sistent purification Replace spin column in second collection tube and apply your 93 pl sample to the CENTER of the flat surface of the gel matrix NOTE Do not allow sample to flow along inner wall of the column Centrifuge at 700 g for 5 min your purified sample is now in the collection tube Combine your two purified samples into a single microcentrifuge tube and ethanol precipitate the CDNA e Add 1 10th vol 3M Sodium Acetate pH 5 3 e Add 2 5 vol of ice cold ethanol 95 100 e Place in 20 C freezer for 1hr e Centrifuge at 14 000 rpm for 20 min at room temperature e Discard the supernatant do not disturb the pellet e Centrifuge briefly at 14 000 rpm and remove remaining supernatant e Air dry the pellet for 10 min Resuspend the cDNA in 20 pl deionized water The cDNA is now ready for library construction by im vivo recombination in yeast Section IX NOTE At this point you should have 2 5 ug of ds cDNA Clontech Laboratories Inc ATakara Bio Company www clo
4. be generated by various methods but we have found the most convenient and reliable method for generating them to be oligonucleotide synthesis It works nicely because well defined regulatory elements are usually lt 20 bp 1 Design and synthesize two antiparallel oligonucleotides with overhanging sticky ends compatible with the sticky ends of digested pHIS2 1 GO K NOTES The annealed oligos consist of one or more copies of the target element with a dif ferent restriction site on each end When the two strands are annealed the resulting double stranded DNA will have a different overhang at each end for directional clon ing into pHIS2 1 We recommend that you also create a pHIS2 1 construct containing a mutant se quence with point mutations to use as a negative control in Section IV If there is a protein that is already known to interact with your sequence you may wish to clone this into pGADT7 Rec2 for use as a positive control for your bait se quence See Appendix A for a simple cloning procedure via cotransformation 2 Anneal the oligonucleotides use a thermal cycler f g Resuspend each oligonucleotide in TE buffer to a final concentration of 100 pM Mix the oligos for the top strand and the bottom strand at a 1 1 ratio This mixture will ultimately yield 50 pM of ds oligo assuming 100 theoretical annealing Heat the mixture to 95 C for 30 sec to remove all secondary structure Heat at 72 C for 2 min He
5. 3 16 20 hr NOTE Continue incubating until OD is reached Do not over grow the culture 7 Centrifuge the cells at 700 g for 5 min at room temperature Discard the supernatant and resuspend the pellet in 100 ml of fresh YPDA Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 31 Matchmaker One Hybrid Library Construction amp Screening Kit XII Yeast Transformation continued 8 Incubate at 30 C until the OD reaches 0 4 0 5 3 5 hr NOTE Continue incubating until OD is reached Do not overgrow the culture 9 Divide the culture into two 50 ml sterile Falcon conical tubes Centrifuge the cells at 700 g for 5 min at room temperature Discard the supernatant and resuspend each pellet in 30 ml sterile deionized H 0 10 Centrifuge the cells at 700 g for 5 min at room temperature Discard the supernatant and resuspend each pellet in 1 5 ml of 1 1xTE LiAc 11 Transfer the cell suspensions to two respective 1 5 ml microcentrifuge tubes centrifuge at high speed for 15 sec 12 Discard the supernatant and resuspend each pellet in 600 pl of 1 1xTE LiAc The cells are now ready to be transformed with plasmid DNA NOTE For best results competent cells should be used for transformation immediately although they can be stored at room temperature for a few hours without siginificant loss in efficiency B Protocol Transformation of Competent Yeast Cells S
6. Fields S amp Song O 1989 A novel genetic system to detect protein protein interactions Nature 340 245 247 Guthrie C amp Fink G R 1991 Guide to yeast genetics and molecular biology In Methods in Enzymology Academic Press San Diego 194 1 932 Harper J W Adami G R Wei N Keyomarsi K amp Elledge S J 1993 The p21 Cdk interacting protein Cip1 is a potent inhibitor of G1 cyclin dependent kinases Cell 75 805 816 Rose M D amp Broach J R 1991 Methods Enzymol 194 195 230 Sikorski R S amp Hieter P 1989 Genetics 122 19 27 Thukral S K Chang K K H amp Bitter G A 1993 Functional expression of heterologous proteins in Saccharomyces cerevisiae METHODS A Companion to Meth Enzymol 5 86 95 van Aelst L Barr M Marcus S Polverino A amp Wigler M 1993 Complex formation between RAS and RAF and other protein kinases Proc Natl Acad Sci USA 90 6213 6217 Protocol No PT3529 1 Version No 38 PR732190 www clontech com Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit Appendix A Cloning amp Screening a Single Gene via Cotransformation The following protocol provides instructions for cloning and screening a single gene in pGADT7 Rec2 by cotransfor mation of yeast This procedure may be used to screen known prey sequences rather than a library You can blunt end ligate your sequence into
7. LD PCR Chenchik et al 1998 Only those ss cDNAs having a SMART anchor sequence at the 5 end can serve as a template and be exponentially amplified by long distance PCR LD PCR In the second step ss cDNA is amplified by LD PCR to produce a ds cDNA library We recommend using the Advan tage 2 PCR Kit Cat Nos 639206 amp 639207 to generate and amplify ds cDNA The Advantage 2 Polymerase Mix consists of TITANIUM Taq DNA Polymerase a nuclease deficient N terminal deletion of Taq DNA polymerase TaqStart Antibody to provide automatic hot start PCR Kellogg et al 1994 and a minor amount of a proofreading polymerase This polymerase system lets you amplify cDNA as large as 20 kb with a fidelity rate significantly higher than that of conventional PCR Barnes 1994 Protocol No PT3529 1 Version No 44 PR732190 www clontech com Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit Appendix D Yeast Media Recipes Agar containing medium can be purchased separately from Clontech For cat nos see Section VI Alternatively you can add 18 20 g L agar to media that lacks agar prior to autoclaving Allow plates to harden at room temperature Store plates in a plastic sleeve at 4 C Prior to use allow agar plates to dry unsleeved at room temperature for 2 3 days or at 30 C for 3 hr prior to plating cells Moisture droplets on the agar surface can lead
8. PT3529 1 ATakara Bio Company Version No PR732190 11 Matchmaker One Hybrid Library Construction amp Screening Kit VI Control Experiments Protocol days PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Use this procedure to perform a control one hybrid assay before screening a one hybrid library A General Considerations To familiarize yourself with the procedures and expected results of a one hybrid assay perform these control transfor mations before you begin screening the library e 3 amino 1 2 4 triazole 3 AT is a competitive inhibitor of the yeast H S3 protein His3p 3 AT is used throughout the protocols in this user manual to inhibit low levels of His3p expressed in the absence of an activating prey protein Fields 1993 Durfee et al 1993 e p53HIS2 is a positive control reporter vector that contains three tandem copies of the cis acting DNA con sensus sequence recognized by p53 p53HIS2 was constructed by inserting the DNA targets into the multiple cloning site of pHIS2 As a result the DNA targets are positioned just upstream of the minimal promoter of the HIS3 locus P and the HIS3 reporter gene min HIS3 e pGAD Rec2 53 is a positive control vector that encodes murine p53 as a fusion with the GAL4 AD Yeast cells that contain both p53HIS2 and pGAD Rec2 53 should grow on minimal SD media lacking histidine and containing 50 mM 3 AT i e on SD His Leu Trp 3 AT e A negative control can also be
9. Screening Kit VII Constructing and Testing your Bait continued 4 Plate 100 pl of 1 10 and 1 100 dilutions on on each of the following agar plates Incubate plates colony side down at 30 C for 3 5 days e SD Tip e SD His Trp e SD His Trp 50 mM 3 AT SD His Trp 100 mM 3 AT NOTE We generally do not recommend plating undiluted transformed cells for the reasons described in Sec tion XIILA 5 Expected results after 3 5 days s Many healthy colonies on SD Trp e Siginificantly fewer colonies on SD His Trp No colonies on either SD His Trp 50 mM 3 AT or SD His Trp 100 mM 3 AT NOTES e Ifyou still have many colonies on media containing 50 mM 3 AT but no colonies on 100 mM 3 AT use 100 mM 3 AT for your library screen e If you have no colonies with either dose of 3 AT you have a choice of using either concentration 100 mM for highest stringency e If you have a similar number of colonies on SD His Trp 100mM 3 AT but they grow very slowly compared to the positive controls on SD His Leu Trp 100 mM 3 AT you still may be able to perform the one hybrid library screening Dilute your co transformed bait library Section IX Step 6 onto more plates and avoid picking very small colonies after 4 5 days on SD His Leu Trp 100 mM 3 AT Large healthy colonies may harbor prey proteins that interact strongly with your bait sequence Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Ve
10. performed using pHIS2 1 and pGAD Rec2 53 Yeast cotransformed with these two plasmids will grow on SD Leu SD Trp and SD Leu Trp minimal media colonies should not grow on TDO His Leu Trp 50mM 3 AT e Table V indicates the selection media required for transformants containing the bait vector the prey vector or both as well as the selection for protein DNA interactions Table V Cotransforming Y187 with Control Plasmids Plate on SD Minimal Agar Cotransformation a fteu ss PGAD Rec2 53 0 Rec2 53 pGAD Rec2 53 Leu Trp DDO Cotransformed pHIS2 1 pGAD Rec2 53 His Leu Trp 50 mM 3 AT One hybrid Interactions B Protocol Cotransformation 1 Materials e Y187 Yeast Strain e Yeastmaker Yeast Transformation System 2 provided with the One Hybrid Kit or available separately Cat No 630439 e SD Trp agar plates Appendix D e SD Leu agar plates Appendix D e SD His Leu Trp 50 mM 3 AT agar plates Appendix D e YPD liquid medium 25 glycerol Freezing Medium YPDA agar Appendix D 2 Streak the provided Y187 strain from the glycerol stock on YPDA Protocol No Version No 12 PT3529 1 PR732190 www clontech com Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit VI Control Experiments continued E e Attention 3 Grow at 30 C for 3 days NOTE If you wish you may stop the experiment at this s
11. the linear pGADT7 Rec2 via traditional cloning in E coli However it is much easier to utilize the highly potent homologous recombination system of S cerevisiae Simply amplify your prey of interest with additional sequence homologous to the insertion site of pG ADT7 Rec2 and cotransform the PCR product and linear pGADT7 Rec2 into competent yeast cells as described below 1 Materials e cDNA of your prey s that you wish to clone e pHIS2 1 Bait construct e Yeastmaker Yeast Transformation System 2 Cat No 630439 e SD Leu Agar plates e SD Trp Agar plates e SD Leu Trp Agar plates e SD Leu Trp His 50 100 mM 3 AT agar plates e Primers specific for your gene of interest with additional sequence see Step 3 e Advantage 2 PCR Kit Cat Nos 639206 amp 639207 2 Determine the optimum 3 AT concentration for your bait construct Section VII B 3 Amplify the cDNA of your prey construct via PCR so that it contains additional flanking SMART sequence that is homologous to the insertion site of p6ADT7 Rec2 Gel purify the amplified band Primer Design Forward Primer 5 GAATTC CAC CCA AGC AGT GGT ATC AAC GCA GAGTGG xxx xxx xxx XXX XXX 37 Reverse Primer 5 ATC GAT GCC CAC CCT CTA GAG GCC GAG GCG GCC GAC yyy yyy yyy YYY yyy 3 xxx Codons at the start of your gene of interest yyy Reverse complement of the end of your gene of interest 4 Using the small scale transformation procedure Section XII B to cotransform the followin
12. used for culturing S cerevisiae is called synthetically defined medium or SD SD base supplies everything that a yeast cell needs to survive including carbon and nitrogen sources with the exception of essential amino acids which are added separately as a dropout DO supplement The particular DO supplement that is chosen will determine which plasmids and or activated reporters are selected for e For example SD base mixed with Leu Trp dropout supplement SD Leu Trp is used to select for the bait and prey plasmids Cells harboring these plasmids are able to grow because the vectors encode tryptophan and leucine biosynthesis genes respectively that are otherwise absent from the cell We often refer to SD Leu Trp as Double Dropout DDO in this user manual e Similarly SD His Leu Trp selects for the presence of bait and prey plasmids but also selects for the activa tion of the HIS3 reporter as part of the one hybrid assay Colonies that grow on this Triple Dropout TDO contain both bait and prey plasmids and also express proteins that interact with the target sequence cloned into pHIS2 1 Table Ill Yeast Media and Supplements Required for a One Hybrid Screen Yeast Media Clontech Cat No Rich Media for routine culturing of untransformed yeast YPDA Appendix D YPD Medium 500 g 630409 YPD Agar Medium 700 g 630410 Minimal Media Minimal SD Base Medium 267 g 630411 Minimal SD Agar Base 467 g 630412 Drop
13. you perform serial dilutions prior to plating If you plate undiluted transformations for example you may see a lawn of back ground growth after 1 2 days It may be difficult to discern the transformed colonies appearing later over this background growth e Be particularly aware of this when verifying phenotypes after screening see Section XI A If for instance you patch too many cells even untransformed yeast may give the appearance of some growth on TDO 3 AT selection medium Clontech Laboratories Inc www clontech com Protocol No PT3529 1 ATakara Bio Company Version No PR732190 35 Matchmaker One Hybrid Library Construction amp Screening Kit XIV Troubleshooting Guide PROBLEM Inability to suppress e basal HIS3 expression CAUSE Improper media preparation see Section IV SOLUTION Repeat experiment with the control vectors to confirm and remake media if necessary with 100 mM 3 AT You are plating too many cells per plate see Section XIII An indication of high basal HIS3 expression is that single colo nies appear in 5 days If you do not see single colonies but a lawn instead it is possible that there are too many cells on the plate Repeat with diluted transformation mix Your target sequence is strongly recognized by endogenous yeast transcription factors see Section X The one hybrid system may not be suitable in this particular case Too few or too many See Sect
14. 0 8 TAE Agarose EtBr gel e Master mix using Advantage 2 Polymerase as described below e LD insert screening amplimer Cat No 630433 Advantage 2 Cat No 639201 2 Prepare a PCR master mix by combining the components specified in Table VI Table VII Recommended PCR Master Mixes for PCR Amplification of Library Vector Insert Reagent 1 rxn 10 rxns 1 extra 25 rxns 1 extra PCR grade deionized H O 41 ul 451 ul 1 066 ul 10X Advantage 2 PCR Buffer 5 ul 55 ul 130 ul 5 AD LD Amplimer Primer 20 uM 1 ul 11 ul 26 ul 3 AD LD Amplimer Primer 20 uM 1 ul 11 ul 26 ul 50X dNTP Mix 10 mM each Tul 11 yl 26 ul 50X Advantage 2 Polymerase Mix 1 ul 11 yl 26 ul Total 50 ul 550 ul 1 300 ul 3 Prealiquot 50 pl of PCR mix into tubes or wells Then using a pipette tip scrape a few cells from a colony into an individual tube or well and pipette up and down to mix the cells Test 50 colonies le TIP Using too many cells can inhibit the PCR reaction Simply touching the colony with the tip should provide a sufficient quantity of cells If your PCR mix turns turbid you may be e using too many cells Attention 4 Follow the following PCR cycling parameters e 94 C for 3 min e 25 30 cycles 94 C for 30 sec 68 C for 3 min 5 Analyze PCR products by electrophoresis on a 0 8 TAE Agarose EtBr gel e Load 5 pl per lane e The presence of more than a single band is common indicating the presence of more than o
15. 0 ug ml ampicillin using any commonly used cloning strain of E coli e g DH5a or Fusion Blue from Clontech Clontech Laboratories Inc www clontech com Protocol No PT3529 1 ATakara Bio Company Version No PR732190 27 Matchmaker One Hybrid Library Construction amp Screening Kit XI Confirmation of Positive Interactions amp Rescue of the Prey Plasmid continued D Protocol Distinguishing Genuine Positive from False Positive Interactions With every one hybrid screen there is a chance of detecting false positives and it is important to confirm that your interactions are genuine using the following criteria see Figure 6 e Genuine Positive Both Bait and Prey are required to activate the H S3 reporter e False Positive Prey can activate the H S3 reporter even in the presence of a mutated bait sequence Genuine Positive Bait sequence absent or mutated AD Bait Sequence Mutated Minimal Promoter HIS3 m Bait Prey Positive interaction AD e gt Prey Bait Sequence Minimal Promoter HIS3 False Positive Prey Alone Activation AD e gt Prey Bait Sequence Mutated Minimal Promoter HIS3 m Figure 6 Illustration of the activation of reporter gene expression in genuine and false positives You can confirm one hybrid interactions in yeast on selective media see Appendix D for recipes using the following co transformation procedure Figure 7 1 Materials Protocol 5 days e Competent Y187
16. 20 pg pGAD Rec2 53 Control Vector 500 ng pl e 20 pg p53HIS2 Control Vector 500 ng pl 0 5 ml S cerevisiae strain Y187 e 50 ml NaCl Solution 0 9 10 g Leu DO Supplement 10 g Ttp DO Supplement 10g Leu Trp DO Supplement 10 g His Leu Trp DO Supplement Protocol No PT3529 1 Version No 6 PR732190 www clontech com Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit ll List of Components continued Yeastmaker Yeast Transformation System 2 provided with the One Hybrid Kit e 50 ml 1M LiAc 10X 50 ml 10X TE Buffer 50 ml YPD Plus Liquid Medium e 20 pl pGBT9 0 1 pg pl control plasmid e 2x1 ml Herring Testes Carrier DNA denatured 10 mg ml 2x50 ml 50 PEG 3350 Other Matchmaker One Hybrid Library Construction amp Screening Kit User Manual PT3529 1 Yeast Protocols Handbook PT3024 1 pGADT7 Rec2 Vector Information Packet PT3704 5 pHIS2 1 Vector Information Packet PT3951 5 Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 7 Matchmaker One Hybrid Library Construction amp Screening Kit lll List of Abbreviations AD library plasmid AD library protein AD vector Bait Prey Yeast Phenotypes His Leu or Trp Miscellaneous SD DO TDO YPD YPDA Plasmid encoding a fusion of the Gal4 ac
17. A binding sequence in p53HIS2 Upon binding the consensus sequence the GAL4 AD p53 fusion stimulates transcription of the HIS3 reporter gene in p53HIS2 and confers the His phenotype to the host pGAD Rec2 53 contains an autonomous replication sequence ARS4 and LEU2 nutritional marker for replication and selection in yeast the centromeric sequence CEN6 ensures proper segregation of the plasmid during mitosis and meiosis The vector also contains a pUC ori and ampicillin resistance gene Amp for propagation and selection in E coli This vector has not been completely sequenced 3 x p53 DNA elements EcoR 2 Pe minHIS3 HIS3 CEN6 ARS4 Xho 1051 3 UTR amp p53HIS2 TinHis3 7 2 kb Figure 11 Map of p53HIS2 Control Vector p53HIS2 is a yeast one hybrid reporter vector that serves as a positive control in the Match maker One Hybrid Library Construction amp Screening Kit Cat No 630304 It contains 3 tandem copies of the consensus DNA binding site for p53 The three DNA targets are located upstream of the minimal promoter of the H S3 locus P inss and the H S3 nutritional reporter gene p53HIS2 is designed for use with pGAD Rec2 53 a plasmid that encodes murine p53 as a fusion to the GAL4 AD Yeast cells that contain both of these plasmids will display the Hist phenotype as a result of the interaction between murine p53 and the DNA binding sites in p53HIS2 When the GAL4 AD p53 fusion interacts with these
18. Kit ll List of Components This kit contains sufficient reagents to make five one hybrid libraries Store deionized H O CHROMA SPIN Columns NaCl Solution Dropout DO Supplements NaOAc LiAc PEG TE Buffer and YPD Plus Medium at room temperature Store yeast strains Control Poly A RNA and the SMART HI Oligo at 70 C Store all other reagents at 20 C First strand cDNA synthesis e 10 pl SMART III Oligo 10 uM 5 AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG 3 The SMART II Oligo is a modified oligo e 10 pl CDS III Primer 10 pM 5 ATTCTAGAGGCCGAGGCGGCCGACATG d T VN 3 e 10 pl CDS HI 6 Primer 10 pM 5 ATTCTAGAGGCCGAGGCGGCCGACATG NNNNNN 3 N A G C or T V A G or C 20 pl MMLV Moloney Murine Leukemia Virus Reverse Transcriptase e 7p RNaeH 100 pl 5X First Strand Buffer 250 mM Tris pH 8 3 30 mM MgCl 375 mM KCl e 100 ul DTT dithiothreitol 20 mM 5 ul Control Poly A RNA Human Placenta 1 ug pl e 50 pl dNTP Mix dATP dCTP dGTP dTTP 10 mM each cDNA amplification e 50 pl 5 PCR Primer 10 pM 5 TTCCACCCAAGCAGTGGTATCAACGCAGAGTGG 3 e 50 pl 3 PCR Primer 10 pM 5 GTATCGATGCCCACCCTCTAGAGGCCGAGGCGGCCGACA 3 e 500 pl 10X GC Melt Solution cDNA purification e 10 CHROMA SPIN TE 400 Columns e 300 pl Sodium Acetate 3 M pH 4 8 One Hybrid Library Construction e 20 pg pHIS2 1 Reporter Vector 500 ng pl e 20 pg pGADT7 Rec2 AD Cloning Vector Sma I linearized 500 ng pl e
19. Library Construction amp Screening Kit XI Confirmation of Positive Interactions amp Rescue of the Prey Plasmid Protocol 3 5 days ck oe Attention PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Detailed instructions are provided for confirmation of phenotype Section A yeast colony PCR to eliminate duplicates Section B rescue and isolation of library plasmids responsible for activation of the HIS3 reporter Section C and distinguishing genuine positive from false positive interactions Section D The following represents the recommended order of events to confirm that the positive interactions are genuine Note however that your preferred order of events may be somewhat determined by the number of positives obtained from your assay For instance if your bait sequence interacts with a protein that is abundant in the library you may have a large number of potential positives to sort many of which may be the same In this case you may choose to perform colony PCR Section XI B to sort the duplicate clones before segregating and rescuing the plasmid If you have a low number of positive clones you may choose to omit the colony PCR screening step altogether We recommend performing the following steps prior to sequencing your positive clones e Confirmation of phenotype by restreaking e Yeast Colony PCR e Rescue and isolation of the library plasmid responsible for activation of reporters e Distinguishing genui
20. Matchmaker One Hybrid Library Construction amp Screening Kit PT3529 1 PR732190 Published 6 April 2007 Matchmaker One Hybrid Library Construction amp Screening Kit Table of Contents l Introduction amp Protocol Overview ccccccecescesseeeesecesseesecesseeseeeseeeeneeeseeseneanenesesenees 4 Ii Listof COMPOMOMts ii viens si scce cee nhcoec ects bse bien ted ncees beh iNANO ARAKEA ANARA RANAMA DATARAN RANAN 6 Il List OF Abbreviations siccsisciciesiesiceciessccecctiscccsinvessceesinvsecceveessaeesntenseeestoewsse ssoeeesteaseeeenetesceess 8 IV Host Strain Information sssini te eaat aeara aa EE EEE aae N ER Eea EE 9 V Yeast Media amp Additional Materials Required cccccccceeessseceeessceeeeeeeeseeeeeeeeesseeeeees 10 Vi Control EXPErIMG tS ncccccccrsersnnsessennnecinaeeeniggsnadnnannceeconednsacnadetanioasdenscnnscseesingtsensnanninacenness 12 A General Considerations sevcsssucecescivsazivasuasesesssvcevtazaucevaveevsvgnsaves ETEA EESTE EAE NEATE 12 B Protocol Cotramsformation sses aeei eaa a Aaea S EE oe nare aa aE Aa ARETES eE EEEE 12 VII Constructing and Testing your Baiit cececeeeeceeee eee ee ee eee ee eeeeeeeeaeeeeeeeeee eee eeeeeeaeeaeeeeeeees 14 A Synthesize and Clone Your Target Element cccccscssssesesesseseecscseececeeseceseaeseseeseecscaseeeecseaeeesenaeaees 14 B Protocol Testing your Target Reporter Bait c scscjcesccsesscnesetaessenssessssnsessesesdhcesshonsche
21. NA synthesis step MMLV Moloney Murine Leukemia Virus Reverse Transcriptase RT is used to transcribe RNA into DNA To prime RNA for cDNA synthesis you may use either a modified oligo dT primer our CDS III Primer or a random primer our CDS III 6 Primer The composition of the resulting cDNA library may differ depending on which primer you choose If you use the CDS III Primer which hybridizes to the 3 end of poly A RNA sequences close to the 5 end of the transcript may be slightly under represented If instead you use the CDS HI 6 Primer a random primer that can hybridize to many different sequences on the RNA template your library should contain a variety of 5 and 3 end sequences which are represented in near equal proportions When MMLV RT encounters a 5 terminus on the template the enzyme s terminal transferase activity adds a few additional nucleotides primarily deoxycytidine to the 3 end of the cDNA The SMART II Oligonucleotide which has an oligo G sequence at its 3 end base pairs with the deoxycytidine stretch creating an extended template Figure 8 RT then switches templates and continues replicating to the end of the oligonucleotide In the majority of synthe ses the resulting ss cDNA contains the complete 5 end of the mRNA as well as the sequence complementary to the SMART III Oligo which then serves as a universal priming site SMART anchor in the subsequent amplification by long distance PCR
22. a Bio Company 48 Matchmaker One Hybrid Library Construction amp Screening Kit Appendix D Yeast Media Recipes continued SD His Leu Trp 100 mM 3 AT Agar 1 L Reagent Minimal SD Agar Base 46 7 g His Leu Trp DO Supplement 0 62 g Deionized water Up to 900 ml Adjust pH to 5 8 then autoclave After cooling to 65 and adding 3 AT store at 4 C in subdued light 100 mM 3 AT 100 ml cool autoclaved agar to 65 C before adding 1 For 1 M 3 AT make a stock of 84 08 g l of 3 AT using deionized water Clontech Laboratories Inc www clontech com Protocol No PT3529 1 ATakara Bio Company Version No PR732190 49 Matchmaker One Hybrid Library Construction amp Screening Kit Notes Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc SMART Technology is covered by U S Patent Nos 5 962 271 and 5 962 272 For Profit and Not For Profit purchasers of SMART Prod ucts are entitled to use the reagents for internal research However the following uses are expressly prohibited 1 performing services for third part
23. ar plates SD Tip SD Leu SD Leu Tip Plate the remainder of the transformation mix 15ml 150 pl per 150mm plate on the following plates e SD His Leu Trp 50 100mM 3 AT 100 plates Incubate the plates colony side down for 3 5 days Protocol No Version No 22 PT3529 1 PR732190 www clontech com Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit IX One Hybrid Library Screening continued 8 Calculate the number of screened clones by counting the colonies from the SD Leu Trp DDO plates after 3 5 days e Number of Screened Clones cfu ml on DDO x resuspension volume ml e It is imperative that at least 1 million clones are screened using less than this will result in less chance of detecting genuine interactions Example Calculation e Resuspension volume 15 ml e Plating Volume 100 ul e 250 colonies grew on the 1 100 dilution on DDO plates Therefore Number of Clones screened 250 x 15 x 10 x 100 3 75 million Clontech Laboratories Inc www clontech com ATakara Bio Company Protocol No PT3529 1 Version No PR732190 23 Matchmaker One Hybrid Library Construction amp Screening Kit X Analysis of Results After a one hybrid screen to identify potential binding partners for your sequence of interest you may have very few positives or too many positives to analyze In these scenarios we recomme
24. at at 37 C for 2 min Heat at 25 C for 2 min Store on ice The annealed oligonucleotide is now ready for ligation into the pHIS2 1 vector Alternatively the annealed oligonucleotide can be stored at 20 C until ready to use 3 Ligating the ds oligonucleotide into pHIS2 1 a Dilute the annealed oligo from Step 2 g 1 100 with TE buffer to obtain a concentration of 0 5 pM NOTE To ensure good ligation efficiency it is necessary to dilute the oligo so that it is only in moderate excess Using an excess of the oligo will inhibit ligation Protocol No PT3529 1 Version No PR732190 14 www clontech com Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit VII Constructing and Testing your Bait continued Q Protocol 5 7 days ck eo Attention b C Assemble a ligation reaction for each experimental annealed oligonucleotide For each ligation combine the following reagents in an Eppendorf tube e 1 pl digested pHIS2 1 Vector 50 ng pl e 1 ul diluted annealed oligonucleotide 0 5 pM 1 5pl 10X T4 DNA ligase buffer e 0 5 pl BSA 10 mg ml e 10 5 ul nuclease free H O 0 5 pl T4 DNA ligase 400 U pl e 15 pl total volume NOTE If desired a control ligation can be assembled using 1 ul of nuclease free H O instead of annealed oligonucleotide Incubate the reaction mixture for 3 hr at room temperature and trans
25. by tapping 2 0 pl 5X First Strand Buffer 1 0 pl DTT 20 mM 1 0 pl dNTP Mix 10 mM Recipe 1 0 pl MMLV Reverse Transcriptase 9 0 pl total volume 6 ONLY if using Random Primer CDSIII 6 Omit this step if using Oligo dT CDSIID and continue to Step 7 Incubate at 25 30 C for 10 min at room temperature 7 Incubate at 42 for 10 min NOTE Carry out the incubation in a hot lid thermal cycler If you are using a water bath or non hot lid cycler add a drop of mineral oil to prevent loss in volume due to evaporation 8 Add 1 pl SMART IT oligo mix and incubate at 42 C for 1 hr 9 Place the tube at 75 C to terminate first strand synthesis 10 Cool to room temperature add 1pl RNase H 2 units 11 Incubate at 37 for 20 min 12 Proceed to LD PCR amplification Section VIII B NOTE Any first strand synthesis reaction that is not used immediately should be stored at 20 C for up to 3 months Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR732190 ATakara Bio Company 18 Matchmaker One Hybrid Library Construction amp Screening Kit Vill Generating the cDNA for Your Library continued Protocol 5 hr B Protocol Amplify cDNA Using Long Distance PCR LD PCR Table VI shows the optimal number of thermal cycles to use based on the amount of RNA used in the first strand synthesis Fewer cycles generally mean fewer nonspecific PCR products The optimal cycling paramet
26. cells Section XII A e SD Leu Trp Appendix D DDO e SD His Leu Trp Appendix D TDO 50 100 mM 3 AT 2 Using the small scale transformation procedure Section XII B cotransform 100 ng of each of the following pairs of vectors e pHIS2 1 Bait Prey in pGADT7 Rec2 e pHIS2 1 Mutant sequence Prey in pGADT7 Rec2 NOTE We recommend that you perform the experiment side by side with the positive and negative controls Section VII 3 Spread 100 pl of 1 10 and 1 100 dilutions of the transformation mix on the following plates e DDO e TDO 3 AT 50 100 mM Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR732190 ATakara Bio Company 28 Matchmaker One Hybrid Library Construction amp Screening Kit XI Confirmation of Positive Interactions amp Rescue of the Prey Plasmid continued 1 Cotransform a pHIS2 1 Bait b pHIS2 1 Mutant candidate candidate prey prey 2 Plate on the following media a DDO b TDO 3 AT Figure 7 Using cotransformation on selective media to verify interactions Expected results from genuine interactions 4 Expected results after 3 5 days at 30 C a Genuine Positive Sample dC eleva Agar Pate _ __ Dintine 2mm Colonies Sa E a re b False Positive C TDO 3 AT Clontech Laboratories Inc www clontech com Protocol No PT3529 1 ATakara Bio Company Version No PR732190 29 Matchmaker O
27. eeeeceeecee erea TE Eare eea R ETE O E oadet Eagas saarnaa 31 As Protocol Preparation of Competent Yeast Cellgirerinesiasnessriii a iiien ieiet 31 B Protocol Transformation of Competent Yeast Cells cccecseceseseseseeseeceeseeeeeeeeseseeeseseeesseeseseeneeeeee 32 C Protocol Plating and Determination of Transformation Efficiency ceeceseeeeeeteeeseseeeeeeeteeeeeteeeees 34 XIII Tips on Plating Patching amp Streaking on Nutritional Selection Media ccceeeee 35 A Problems with Patching or Streaking Too Many Cells 2 ccececescssseeceecesseseeseseseseeseececaeeeeesesateetesanaees 35 XIV Troubleshooting Guid sii cicicseies cccsstevad iv ctoevieciescceecciesteteeicevstnesieeesoetieesetvescesstomtinewae nines 36 XV References croira E xuceec ced E suvaeeusdeesaesedestqacenaacasaceeees 38 Appendix A Cloning amp Screening a Single Gene via Cotransformation ceeeeeeeeees 39 Appendix B Plasmid Information cccccccccccsseneeceeeeseeeeeeenseeeeeeeesseaeeeeensneaeseeessneaeseeesenaeeees 41 Appendix C SMART Technology Overview cccsssccccssssseeeessseeeeeeesssneeeeeesseeseeeesssneeeeees 44 Appendix D Yeast Media Recipes cccccceceeeeeeeeeeeeeeeeeeceeeeeeeeeesaaaaaeeesaeeeeeeeeeeeeeeeeneaeeeeees 45 Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR732190 ATakara Bio Company 2 Matchmaker One Hybrid Library Construction amp Screenin
28. er segregation of the plasmid during cell division in yeast Sikorski et al 1989 Rose et al 1991 Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 41 Matchmaker One Hybrid Library Construction amp Screening Kit Appendix B Plasmid Information continued CEN6 ARS4 1480 SV40 NLS GAL4 AD Amp pGADT7 Rec2 p_ 7 6 kb Hind III Not 2351 4590 HA epitope tag SMART III ds cDNA Hind Ill CDS III xX Recombination gt x SMART III Sequence Sma 2038 CDS Ill Sequence pGADT7 Rec2 GAL4 AD z Taom pGADT7 Rec2 LEU2 pGADT7 Rec2 Vector Sma l linearized Figure 9 Map of pGADT7 Rec2 Vector pGADT7 Rec2 is engineered for constructing GAL4 AD cDNA libraries by homologous recombi nation in yeast To construct AD fusions in pGADT7 Rec2 first generate double stranded ds cDNA using SMART DNA Synthesis Then transform yeast with the cDNA products and Sma l linearized pGADT7 Rec2 Cellular recombinases will use the ds cDNA to repair the gap in pGADT7 Rec2 Figure 2 Successful recombination results in a fully functional circular expression vector which confers the Leu phenotype to Leu auxotrophs such as yeast strain Y187 Protocol No PT3529 1 www clontech com Version No PR732190 42 Clontech Laboratories Inc ATakara Bio Company Matchmake
29. ers in Table VI were determined using the Control Poly A Human Placenta RNA these parameters may vary with different templates and thermal cyclers Table VI Relationship between Amount of RNA and Optimal Number of Thermal Cycles Total RNA pg Poly A RNA yg Number of Cycles 1 0 2 0 0 5 1 0 15 20 0 5 1 0 0 25 0 5 20 22 0 25 0 5 0 125 0 25 22 24 0 05 0 25 0 02570 125 24 26 1 Prepare e First strand cDNA Section A Preheat thermal cycler 2 Set up TWO 100 pl PCR reactions for each experimental sample and one reaction for the control sample 2 pl First Strand cDNA Section A 70 pl Deionized H O 10 ul 10X Advantage 2 PCR Buffer 2 pl 50X dNTP Mix 2 pl 5 PCR Primer 2 pl 3 PCR Primer 10 pl 10X GC Melt Solution 2 pl 50X Advantage 2 Polymerase Mix 100 pl total volume 3 Begin thermal cycling using the following parameters e 95 C 30 sec e x Cycles 95 C 10 sec 68 C 6 min e 68 C a Refer to table VI to estimate the number of cycles b Program the cycler to increase the extension time by 5 sec with each successive cycle For example in the second cycle the extension should last 6 min and 5 sec in the third 6 min and 10 sec and so on 5min Clontech Laboratories Inc ATakara Bio Company Protocol No PT3529 1 Version No PR732190 19 www clontech com Matchmaker One Hybrid Library Construction amp Screening Kit Vill Generating the cDNA for Your Library continued Pr
30. eseeeeeeeeiees 10 Table IV Additional Media Supplement ssrin aea nt E E EE i 11 Table V Cotransformine the Control Stains iiser Eae ayna E e EE EEEE EIEE UEN 12 Table VI Relationship between Amount of RNA and Optimal Number of Thermal Cycles 19 Table VII Recommended PCR Master Mixes for PCR Amplification of Library Vector Insert 26 Clontech Laboratories Inc www clontech com Protocol No PT3529 1 ATakara Bio Company Version No PR732190 3 Matchmaker One Hybrid Library Construction amp Screening Kit Introduction amp Protocol Overview The Matchmaker One Hybrid Library Construction amp Screening Kit provides a simple and highly efficient method for constructing and screening cDNA libraries for yeast one hybrid screening Your library is constructed and screened directly in yeast by in vivo recombination There is no need for labor intensive library cloning amplification and harvesting in E coli Matchmaker Library Construction amp Screening Systems use SMART cDNA Synthesis technology which allows you to construct CDNA libraries from any tissue source starting with as little as 100 ng of total RNA Principle of the one hybrid assay a protein DNA interaction assay One hybrid assays enable you to identify and characterize proteins that bind to a target cis acting DNA sequence In a Matchmaker one hybrid assay potential DNA binding proteins the Prey are expressed as fusions to the GAL4 activation d
31. fee et al 1993 Matchmaker Screening Protocol Overview The entire Matchmaker screening process consists of the following steps e Step 1 Perform control experiments e Step 2 Clone your target sequence bait and optimize 3 AT e Step 3 Construct and screen library by cotransformation and in vivo recombination e Step 4 Confirm and interpret results Protocol No PT3529 1 Version No 4 PR732190 www clontech com Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit l Introduction amp Protocol Overview continued DNA target x x Prepare competent yeast cells and cotransform pGADT7 Rec2 Sma linearized GAL4 AD LEU2 r Amp In vivo recombination between cDNA and Prey vector Plate on SD His Leu Trp 3AT Figure 2 One hybrid library construction and screening Your target bait sequence is cloned upstream of the His3 reporter in pHIS2 1 The high complexity pretransformed cDNA library which expresses fusions with the Gal4 AD is generated by cotransformation of the library cDNA with pGADT7 Rec2 Expression from the HIS3 reporter is detected in colonies that are able to grow on minimal medium that lacks histidine and contains 3 AT Clontech Laboratories Inc www clontech com Protocol No PT3529 1 ATakara Bio Company Version No PR732190 5 Matchmaker One Hybrid Library Construction amp Screening
32. form coli B Protocol Testing your Target Reporter Bait 3 amino 1 2 4 triazole 3 AT is a competitive inhibitor of the yeast H S3 protein His3p 3 AT is used throughout the protocols in this user manual to inhibit low levels of His3p expressed in the absence of an activating prey protein Fields 1993 Durfee et al 1993 ATTENTION Successful use of any yeast one hybrid system is dependent upon no low recognition of yourtarget sequence by endogenous yeast transcription factors For this reason it is critical to test your construct for histidine expression before screening the library The following experiment will determine how much 3 AT you will require in your library screen to suppress any basal expression from your specific bait construct 1 Materials Y187 Yeast Strain Yeastmaker Yeast Transformation System 2 provided with the One Hybrid Kit or available separately Cat No 630439 SD Trp Agar plates Appendix D SD His Trp agar plates Appendix D SD His Trp 50mM 3 AT agar plates Appendix D SD His Trp 100mM 3 AT agar plates Appendix D YPD liquid medium 25 glycerol Freezing Medium 2 Perform Control Experiments Section VI 3 Transform your bait construct using the Small Scale Transformation Protocol Section XII Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 15 Matchmaker One Hybrid Library Construction amp
33. g 125 ng amplified cDNA from Step 2 e 250 ng pGADT7 Rec2 e 250 ng pHIS2 1 Bait or pHIS2 1 Mutant 5 Plate 100 pl of 1 10 and 1 100 dilutions on the following 100 mm dishes e SD Leu agar plates e SD Trp agar plates e SD Leu Trp agar plates DDO e SD Leu Trp His 50 100mM 3 AT agar plates TDO 3 AT Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 39 Matchmaker One Hybrid Library Construction amp Screening Kit Appendix A Cloning amp Screening a Single Gene via Cotransformation continued 6 Expected results if there is a genuine interaction after 3 5 days at 30 C Sample sid Selective Agar Plate Distinct 2 mm Colonies eS r So Protocol No PT3529 1 Version No PR732190 40 www clontech com Clontech Laboratories Inc ATakara Bio Company Appendix B Matchmaker One Hybrid Library Construction amp Screening Kit Plasmid Information MCS EcoRI 2 SacI 12 Mlul 14 BamHI Go Spel 26 Pri n R HIS3 3 UTR amp Ta inHIS3 CEN6 ARS4 BamHI 1433 pHIS2 1 7190 bp TRP1 ic E1 ori Sacl EcoRI Mlul Spel Ae ee w 1 GAATTCGAGC TCACGCGTGG ATCCACTAGT A CTTAAGCTCG AGTGCGCACC TAGGTGATCA T Figure 8 Map and Multiple Cloning Site MCS of pHIS2 1 Vector Unique restriction sites are in bold pHIS2 1 is a reporter vector that can be used in yeast one hybrid assays to identify a
34. g Kit Table of Contents continued List of Figures Figure 1 Screening for protein DNA interactions with the Matchmaker One Hybrid System 4 4 Figure 2 One hybrid library construction and screening cscecseesesesseseeeseseeececeeseeeeatseseeeetsenseeeesetaes 5 Figure 3 Synthesis of high quality ds cDNA using SMART technology os cceeeesesesseeesenseeteeeneeeeees 17 Figure 4 Double stranded cDNA synthesized from Control Human Placenta Poly A RNA uu eee 20 Figure 5 CHROMA SPIN column and collection tubes ecseeseeecsseseeeecseeeeceeseseeeeeseeenseetesseneeeeee 21 Figure 6 Illustration of the activation of reporter gene expression in genuine and false positives 28 Figure 7 Using cotransformation on selective media to verify interactions ccccssesseeseenseeeeeeeeeeees 29 Figure 8 Map and Multiple Cloning Site MCS of pHIS2 1 Vector ceecesseseesseenseeeteenseeteeeeeeeeees 41 Figure 9 Map of pGADT7 Rec2 Vecto enonciar e E EE E ERER 42 Figure 10 Map of pGAD Rec2 53 AD Control Vector sisirin a 43 Figure 11 Map of p53HIS2 Control Vector ccecceecseseseseeseseseeceseseecseeseececseecsecaesescaeeassesenseesesaeaeeesaes 43 List of Tables Table I Yeast Host Strain Genotypes soreer cursen E e e Ee EE EE E EEE NOAN IEEE 9 Table II Phenotype Testing on Various SD Medidinssiiicsisisostser ietie ia i aa e 9 Table III Yeast Media and Supplements Required for a One Hybrid Screen ceicceeesessseees
35. he AD or no fusion peptide at all keep sequencing beyond the stop codon You may find another larger open reading frame ORF Such gaps can occur when a portion of the 5 untranslated region of an MRNA is cloned along with the coding region A Western blot using HA Tag Polyclonal Antibody Cat No 631207 will reveal the pres ence and size of an AD fusion protein e In some cases two different ORFs may be expressed as a fusion with the AD even though a non translated gap comes between them This is due to occasional transla tional read through e lf your sequencing results fail to reveal any ORF in frame with the AD coding region it could be that the positive library clone is transcribed in the reverse orientation from a cryptic promoter within the ADH1 terminator Chien et al 1991 although this is a very rare occurence Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR732190 ATakara Bio Company 30 Matchmaker One Hybrid Library Construction amp Screening Kit XII Yeast Transformation Protocol 5 days Attention PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Detailed instructions are provided for preparation of competent yeast cells Section A trans formation of competent yeast cells Section B and transformation plating amp determination of efficiency Section C The following protocol assumes that you are using Clontech s Yeastmaker Yeast Transformati
36. he hybrid proteins are not stably expressed in the host cell The fused GAL4 AD occludes the site of interaction The hybrid protein folds improperly The hybrid protein cannot be localized to the yeast nucleus See van Aelst et al 1993 for one example In these cases it may help to construct hybrids containing different domains of the DNA binding protein Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 37 Matchmaker One Hybrid Library Construction amp Screening Kit XV References e An extensive list of Matchmaker System citations can be obtained from our website www clontech com Chenchik A Diatchenko L Chang C amp Kuchibhatla S 1994 Great Lengths cDNA Synthesis Kit for high yields of full length cDNA Clontechniques IX 1 9 12 Chien C T Bartel P L Sternglanz R amp Fields S 1991 The two hybrid system A method to identify and clone genes for proteins that interact with a protein of interest Proc Nat Acad Sci USA 88 9578 9582 Durfee T Becherer K Chen P L Yeh S H Yang Y Kilbburn A E Lee W H amp Elledge S J 1993 The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit Genes Devel 7 555 569 Fields S 1993 The two hybrid system to detect protein protein interactions METHODS A Companion to Meth Enzy mol 5 116 124
37. ies 2 identifying nucleic acid sequences to be included on nucleic acid arrays blots or in libraries or other cDNA collec tions which are then sold to third parties Reproduction modification reformulation or resale of the reagents provided in SMART Products is not permitted For information on licensing SMART Technology for commercial purposes please contact a licensing repre sentative by phone at 650 919 7320 or by e mail at licensing clontech com Parafilm is a registered trademark of the American Can Co Clontech the Clontech logo and all other trademarks are the property of Clontech Laboratories Inc unless otherwise noted Clontech is aTakara Bio Company 2007 Protocol No Version No 50 PT3529 1 PR732190 www clontech com Clontech Laboratories Inc ATakara Bio Company
38. ion X See Section X positives Low transformation e Problems with starter culture or Make sure that you set up your starter culture efficiency plasmid DNA quality from a fresh healthy colony and use high qual ity plasmid DNA Set up 3 4 starter cultures from separate colonies and proceed with the faster growing culture Perform the control transformation with pGBT9 supplied in the Yeastmaker transforma tion kit e Problems with Herring Sperm Denature and cool your Herring Sperm Carrier DNA Carrier DNA quality prior to the transformation If your carrier DNA ali quot is old purchase a fresh aliquot from Clontech Cat No 630440 e Problems with cDNA quality Ensure that the quality of your cDNA is good see Section VIII and that you have gt 2 ug Problems with DMSO quality Purchase a fresh bottle of DMSO since we find that some batches of DMSO result in low transforma tion efficiencies e pH of growth medium is not Ensure that you checked the pH of your growth optimal medium all SD media should be adjusted to pH 5 8 prior to autoclaving Yeast growth media e SD Agar media did not set Ensure that you adjusted the pH of the media to pH issues properly 5 8 prior to autoclaving If you did not adjust the pH the media may be too acidic and the agar will be hydrolyzed in the autoclave and will not set The agar also breaks down if the media is over au toclaved preventing it from setting properly
39. ix D Yeast Media Recipes continued C Single Dropout Media Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR732190 ATakara Bio Company 46 Matchmaker One Hybrid Library Construction amp Screening Kit Appendix D Yeast Media Recipes continued D Double Dropout DDO Media NOTE Not all Double Dropout supplements are available but they can be easily made by adding back individu al amino acids to other supplements SD His Trp Agar 1 L For 1 M 3 AT make a stock of 84 08 g l of 3 AT using deionized water Clontech Laboratories Inc www clontech com Protocol No PT3529 1 ATakara Bio Company Version No PR732190 47 Matchmaker One Hybrid Library Construction amp Screening Kit Appendix D Yeast Media Recipes continued SD His Trp 100 mM 3 AT Agar 1 L Deionized water Up to 900 ml Adjust pH to 5 8 then autoclave After cooling to 65 and adding 3 AT store at 4 C in subdued light 100 mM 3 AT 100 ml cool autoclaved agar to 65 C before adding 1 For 1 M 3 AT make a stock of 84 08 g l of 3 AT using deionized water E Triple Dropout TDO Media SD His Leu Trp Agar 1 L His Leu Trp DO Supplement 0 62 g Adjust pH to 5 8 then autoclave Store at 4 C in subdued light For 1 M 3 AT make a stock of 84 08 g l of 3 AT using deionized water Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR732190 ATakar
40. mall Scale Library Scale 1 Materials e Yeastmaker Yeast Transformation System 2 provided with the One Hybrid Kit or available separately Cat No 630439 Protocol 3 hr e Competent Yeast Cells Section XII A e PEG LiAc e 0 9 w v NaCl e DMSO NOTE For PEG LiAc combine 8 ml 50 PEG 3350 1 ml 10xTE and 1 ml 1 M LiAc or 800 ul PEG 100 ul 10xTE and 100 pl 1 M LiAc 2 Combine the following in a prechilled sterile tube 1 5 ml tube 15 ml tube e Plasmid DNA 100 ng 3 ug linear pGADT7 Rec2 20 pl ds cDNA e Herring Testes Carrier DNA denatured 10 pg pl 5 ul 20 ul Note To denature carrier DNA heat to 95 100 C for 5 min then cool rapidly in an ice bath 3 Add competent cells and gently mix 50 pl 600 ul 4 Add PEG LiAc and gently mix 500 ul 2 5 ml 5 Incubate at 30 C 30 min 45 min NOTE Mix cells every 10 15 min Protocol No PT3529 1 www clontech com Version No PR732190 32 Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit XII Yeast Transformation continued 6 Add DMSO and gently mix 7 Incubate in a 42 C water bath NOTE Mix cells every 5 10 min 8 Centrifuge to pellet yeast cells discard supernatant 9 Resuspend cells in YPD Plus liquid medium incubate shaking for 90 min NOTE YPD Plus is specially formulated to promote high trans formation efficiencies and is strongly recommended for librar
41. nance of yeast see the Yeast Protocols Handbook YPH We also recommend the Guide to Yeast Genetics and Molecular Biology Guthrie amp Fink 1991 Table I Yeast Host Strain Genotypes Transformation Strain Genotype Reporters Markers Reference Y187 MATa ura3 52 his3 200 MEL1 LacZ trp1 leu2 Harper ade2 101 trp1 901 leu2 3 112 et al 1993 gal4A gal80A met URA3 GAL1 GAL1 LacZ MEL1 1 The LacZ reporter construct was integrated into the yeast genome by homologous recombination at the ura3 52 mutation A Holtz unpublished Recombinants were selected on SD Ura The met phenotype in this strain is unstable Table Il Phenotype Testing on Various SD Media Strain SD His SD Leu SD Trp SD Ura Y187 Y187 p53HIS2 Y187 pGAD Rec2 53 ar Y187 pGAD Rec2 53 p53HIS2 Clontech Laboratories Inc www clontech com Protocol No PT3529 1 ATakara Bio Company Version No PR732190 9 Matchmaker One Hybrid Library Construction amp Screening Kit V Yeast Media amp Additional Materials Required Table III contains a list of yeast media components and corresponding Clontech catalog numbers required for the protocols described in this user manual while Table IV lists additional media supplements Recipes for the media are located in Appendix D The following considerations should be taken into account when culturing yeast for a one hybrid screen e Minimal media that is routinely
42. nd characterize DNA binding proteins The vector was specifically designed for use with the Matchmaker One Hybrid Library Construction amp Screening Kit Cat No 630304 It contains a HIS3 nutritional reporter gene located downstream of a multiple cloning site MCS and the minimal promoter of the HIS3 locus PminHIS3 Cis acting DNA sequences or DNA target elements can be inserted into the MCS and used as baits to screen GAL4 AD cDNA fusion libraries for proteins that interact with the target sequence A protein DNA or one hybrid interaction can be detected by performing the assay in a yeast strain such as Y187 that is auxotrophic for histidine Positive one hybrid interactions drive expression of the HIS3 reporter gene which enables the host cell to grow on histidine deficient media In the absence of activation the constitutive HIS3 expression from PminHIS3 is very low During library screening basal expression of HIS3 is controlled by adding 3 amino 1 2 4 triazole 3 AT to the medium The concentration of 3 AT needed to fully suppress HIS3 expres sion must be determined empirically for each DNA target element pHIS2 1 can be maintained in both yeast and bacteria It contains an autonomous replication sequence ARS4 and TRP1 nutritional marker for replication and selection in yeast 1 2 it contains a Col E1 origin and a kanamycin resistance gene Kanr for propagation and selection in E coli The centromeric sequence CEN6 ensures prop
43. nd first checking the following A Too Few Positives e Have you screened gt 1 million independent clones Refer to Section IX Step 8 to determine if you screened 1 million independent clones Optimize the transformation procedure see Section XIII Troubleshooting Guide and repeat the screening procedure e Check that your TDO 3 AT growth media performs as expected with the positive and negative controls e Ifyou screened gt 1 million independent clones and detected no positive colonies on high stringency TDO 100mM 3 AT repeat the screen with a reduced 3 AT concentration e Try increasing the number of repeats of your target sequence Generally we find that three repeats work well B Too Many Positives Have you determined the optimal 3 AT concentration for your bait Section VII B e Check that your TDO 3 AT media performs as expected with the positive and negative controls e If you used 50 mM 3 AT repeat the screen with 100 mM 3 AT e Pick only large healthy colonies after 3 5 days to analyze further in Section XI e Your bait may interact with a partner that is abundant in the library Sort duplicates by Yeast Colony PCR Section XI B After the clones have been sorted into groups a representative of each unique type can then be analyzed for false positive interactions Section XI D Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR732190 ATakara Bio Company 24 Matchmaker One Hybrid
44. ne Hybrid Library Construction amp Screening Kit XI Confirmation of Positive Interactions amp Rescue of the Prey Plasmid continued E Sequence Analysis of a Genuine Positive Once an interaction has been verified as being genuine the prey insert can be identified by sequencing Use only DNA isolated from E coli for this procedure AD library cDNA inserts can be sequenced using the following e Matchmaker AD LD Insert Screening Amplimer Set Cat No 630433 e T7 Sequencing Primer Verify the presence of an open reading frame ORF fused in frame to the GAL4 AD sequence and compare the sequence to those in GenBank EMBL or other databases NOTES Before considering any of the following possibilities we recommend that you verify that your clone is not a false positive Section XI D e Most library clones will contain some 3 untranslated region be sure to scan the en tire sequence to find any portion of coding region fused in frame to the GAL4 AD see Appendix A Section A e Yeast tolerate translational frameshifts A large ORF in the wrong reading frame may correspond to the protein responsible for the interaction To verify this re clone the insert in frame this can be easily done using Clontech s In Fusion PCR Cloning Sys tem see www clontech com and determine if the H S3 reporter is still active if your bait is also present e f your sequencing results reveal a very short peptide lt 10 amino acids fused to t
45. ne positive from false positive interactions A Confirmation of Phenotype by Restreaking 1 Materials e Single colonies of yeast obtained from the library screen growing on TDO 3 AT e SD His Leu Trp 3 AT agar plates Appendix D 2 Restreak positive clones to single colonies on TDO 3 AT plates Appendix D 3 Expected results Positive colonies will grow as healthy single colonies in 2 4 days TIP Be careful not to patch too many cells Section XIII A e If you have many potential positives to test continue to Section B for yeast colony PCR to eliminate duplicates e Otherwise proceed to Section C for rescue and isolation of library plasmids responsible for activation of reporters Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 25 Matchmaker One Hybrid Library Construction amp Screening Kit XI Confirmation of Positive Interactions amp Rescue of the Prey Plasmid continued B Protocol Yeast Colony PCR to Eliminate Duplicates This procedure uses the Matchmaker AD LD Insert Screening Amplimer Set Cat No 630433 and Advantage 2 PCR Polymerase Mix Cat No 639201 We strongly recommend using the Advantage 2 Polymerase Mix rather than Protocol any other DNA polymerase formulation because we find that it performs well in yeast cell samples a 1 Materials e Single colonies of yeast from one hybrid screen growing on TDO 3 AT Appendix D e
46. ne prey Oo plasmid in a cell see Section XI C ZA NOTE To confirm that similar sized bands contain the same insert you may choose to digest the PCR prod uct with Alul or Haelll or other frequently cutting enzymes and electrophorese on a 2 agarose EtBr gel Protocol No PT3529 1 www clontech com Version No PR732190 26 Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit XI Confirmation of Positive Interactions amp Rescue of the Prey Plasmid continued 6 If a high percentage of the colonies appear to contain the same AD library insert expand your PCR analysis to another batch of 50 colonies NOTE Alternatively eliminate the abundant clones by performing yeast colony hybridization on each mas ter plate Refer to the Yeast Protocols Handbook for this procedure Section IX A Use a vector free oligo nucleotide probe designed from the sequence of the most abundant insert 7 At this stage to quickly identify the clones the PCR products observed as a single band on gel can be spin column purified and sequenced using T7 primer C Protocol Rescue and Isolation of Library Plasmid Responsible for Activation of Reporters 1 Segregation of Library Plasmid in Yeast moo Transformed yeast cells unlike transformed F coli cells can harbor more than one version of a related plasmid This days means that in addition to containing a prey vector that expresses a
47. nents have been optimized for the volumes specified The procedure consists of three steps e First strand cDNA synthesis e Ampification of cDNA by long distance PCR LD PCR e Column purification of ds cDNA with a CHROMA SPIN TE 400 column In the protocol that follows you have the option of priming first strand cDNA synthesis with an oligo dT CDSM or random primer CDSIII 6 The reaction conditions vary slightly depending on the primer used Clontech Laboratories Inc www clontech com Protocol No PT3529 1 ATakara Bio Company Version No PR732190 17 Matchmaker One Hybrid Library Construction amp Screening Kit Vill Generating the cDNA for Your Library continued 1 Prepare high quality Poly A or total RNA G Y IK NOTE We recommend NucleoSpin RNAII kits Cat Nos 635990 635991 amp 635992 for purification of total RNA form a variety of sources and NucleoTrap mRNA Kits for polyA mRNA enrichment from total RNA 2 Combine and mix the following reagents in a sterile microcentrifuge tube 1 2 pl RNA sample 0 025 1 0 pg poly A or 0 10 2 0 ug total RNA 1 0 pl CDS III or CDSIII 6 Primer 1 2 pl Deionized H O to bring volume up to 4 0 pl Recipe 4 0 pl total volume NOTE For the control reaction use 1 ul 1 ug of the control RNA CDSII Oligo dT CDSIII 6 Random Primer 3 Incubate at 72 C for 2 min 4 Cool On Ice for 2 min spin briefly 5 To the reaction add the following and mix
48. ntech com Protocol No PT3529 1 Version No PR732190 21 Matchmaker One Hybrid Library Construction amp Screening Kit IX One Hybrid Library Screening Protocol 5 7 days PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Detailed instructions are provided for screening a one hybrid library IMPORTANT See Appendix A if you plan to test specific prey proteins and not an entire library Materials e Competent Y187 yeast cells Section XII A e pHIS2 1 Bait Section VII e pGADT7 Rec2 Linear e The following SD agar plates Appendix D SD Trp 5 10x 100 mm plates SD Leu 5 10x 100 mm plates SD Leu Trp 5 10x 100 mm plates SD His Leu Tip 50 100 mM 3 AT Section VII 100x 150 mm plates e 2xYPDA liquid medium Appendix D e 0 5xYPDA liquid medium Appendix D e kanamycin sulfate 50 mg ml e YPD 25 glycerol liquid freezing medium Perform Control Experiments and test your pHIS2 1 Bait on SD His Leu Trp 50 mM 100 mM 3 AT Sections VI and VII Synthesize ds CDNA using SMART technology Section VIII to obtain 2 5 pg of cDNA in a volume of 20 ul Perform cotransformation of the following using the library scale transformation procedure Section XII B e 20 pl SMART amplified ds cDNA 2 5 pg e 6 pl Linear pGADT7 Rec2 3 ug e pHIS2 1 Bait vector 5 pg From the transformation mix spread 100 pl of 1 10 1 100 1 1 000 and 1 10 000 dilutions on each of the following ag
49. omain in pGADT7 Rec2 The target DNA sequence or Bait Sequence is cloned into pHIS2 1 as one copy or tandem repeats Interaction between a DNA binding protein and the target sequence stimulates transcription of HIS3 Figure 1 enabling the yeast host strain Y187 to grow on minimal media lacking histidine Both Bait and Prey plasmids in this system are low copy number vectors yielding fewer false positives than the high copy number vectors that are generally used for two hybrid studies This technology can be used to e identify novel DNA protein interactions e confirm suspected interactions e define interacting domain sequences Transcription activator GAL4 AD Library protein transcription Figure 1 Screening for protein DNA interactions with the Matchmaker One Hybrid System In this construct three copies of the DNA target T have been inserted into the pHIS2 1 reporter vector Nutritrion Reporter to Detect One Hybrid Interactions HIS3 Yeast strainY187 is unable to synthesize histidine and is therefore unable to grow on media that lack this essen tial amino acid When the prey and your bait sequence interact His3p is expressed from the pHIS2 1 reporter vector and permits the cell to biosynthesize histidine and grow on a his minimal medium 3 amino 1 2 4 triazole 3 AT a competitive inhibitor of His3p is used to inhibit low levels of His3p expressed in the absence of an activating prey protein Fields 1993 Dur
50. on System 2 When using the components from this kit high transformation efficiencies of gt 3x10 per ug of plasmid are readily achieved A Protocol Preparation of Competent Yeast Cells 1 Materials e Yeastmaker Yeast Transformation System 2 provided with the One Hybrid Kit or available separately Cat No 630439 e 1 1x TE LiAc e YPDA agar plates Appendix D e YPDA liquid medium Appendix D e Appropriate SD selective medium e Frozen stock of Y187 cells e Sterile deionized water NOTE For 1 1xTE LiAc combine 1 1 ml of 10x TE with 1 1 ml of 1 M LiAc 10x Bring the total volume to 10 ml using sterile deionized H O 2 Streak a YPDA agar plate with Y187 cells from a frozen yeast stock Incubate the plate upside down at 30 C until colonies appear 3 days NOTE If you wish you may stop the experiment at this step and resume work later The plates can be stored at 4 C in subdued lighting for up to one month 3 Inoculate one colony diameter 2 3mm lt 4weeks old into 3 ml YPDA medium in a sterile 15 ml culture tube TIP Set up four separate 3 ml cultures from four separate colonies and choose only the fastest growing 3 ml culture to proceed We find that faster growing cultures tend to result in higher transformation efficiencies 4 Incubate at 30 C with shaking at 200 rpm for 8 12 hr 5 Transfer 5 pl of the culture to a 250 ml flask containing 50 ml of YPDA 6 Incubate shaking until the OD reaches 0 15 0
51. otocol 2hr 4 Analyze a 7 yl aliquot of the PCR product from each sample alongside 0 25 pg of a 1 kb DNA size marker ona 1 2 agarose EtBr gel Typical results obtained with Human Placenta Poly A RNA after column chromatography are shown in Figure 4 NOTE If your PCR product does not appear as expected refer to the Troubleshooting Guide Section XII 5 Proceed with Column Chromatography Section C or store ds cDNA at 20 C until use Double stranded cDNA kb M 1 2 3 4 M Figure 4 Double stranded cDNA synthesized from Control Human Placenta Poly A RNA 1 ul 1 0 ug of Control Human Placenta Poly A RNA was used as the template for first strand cDNA synthesis Two first strand samples were prepared One with a random primer our CDS III 6 Primer Lanes 1 amp 3 and the other with an oligo dT primer our CDS III Primer Lanes 2 amp 4 Next 2 ul of the single stranded cDNA was amplified by LD PCR Each ds cDNA product was then purified with a CHROMA SPIN TE 400 Column The ds cDNA was ana lyzed on a 1 2 agarose EtBr gel before Lanes 1 amp 2 7 ul cDNA per lane and after Lanes 3 amp 4 5 ul cDNA per lane column purification Lane M was loaded with 250 ng of a 1 kb ladder DNA molecular marker C Protocol Purify ds cDNA with CHROMA SPIN TE 400 Columns In the following protocol a CHROMA SPIN TE 400 Column is used to select for DNA molecules gt 200 bp CHROMA SPIN Columns are packed with resins that fractionate molec
52. out Supplements Trp DO Supplement 10 g 630413 Leu DO Supplement 10 g 630414 His DO Supplement 10 g 630415 Ura DO Supplement 10 g 630416 Leu Trp DO Supplement 10 g 630417 His Leu DO Supplement 10 g 630418 His Leu Trp DO Supplement 10 g 630419 Freezing Medium YPD Medium amp 25 glycerol e Tools for plating yeast include a sterile glass rod bent Pasteur pipette or 5 mm glass beads for spreading cells on plates Use 5 7 beads per 100 mm plate Protocol No PT3529 1 Version No 10 PR732190 www clontech com Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit V Yeast Media amp Additional Materials Required continued Table IV Additional Media Supplements Supplement Name Clontech Cat No Stock Solution Concentration LAdenine Hemisulfate Sigma A9129 0 2 stock solution LLeucine Sigma L8000 Kanamycin Sulfate 50 mg ml stock solution Dimethyl Formamide 3 AT 3 Amino 1 2 4 Triazole Sigma A8056 1 M 84 mg ml stock solution Unless otherwise specified Recipes for each of these media are found in Appendix D Rich Media YPDA liquid YPDA agar Single DO Media SD Tip liquid SD Tip agar SD Leu liquid SD Leu agar Double DO Media SD Leu Tip liquid SD Leu Trp agar Triple DO Media SD His Leu Trp liquid SD His Leu Trp agar Clontech Laboratories Inc www clontech com Protocol No
53. protein responsible for activating the HIS3 reporter it may also contain one or more prey plasmids that do not express an interacting protein e Ifyou rescue the plasmid via E coli transformation without first segregating the non interacting prey there is a chance that you will rescue a non interacting prey plasmid e To increase the chance of rescuing the positive prey plasmid we recommend that you streak 2 3 times on TDO 3 AT each time picking a single colony for restreaking The plasmid should be rescued from one of these clones see Step 2 2 Rescuing the Library Plasmid from Yeast The following methods are recommended for rescuing your plasmid from yeast e To identify the gene responsible for the positive interaction rescue the plasmid from yeast cells grown on TDO 3 AT using the Yeastmaker Yeast Plasmid Isolation Kit Cat No 630441 or other suitable method An alternative procedure is described in the Yeast Protocols Handbook e The nucleic acid rescued directly from yeast will be a mixture of Bait Plasmid Prey Plasmid and Yeast Ge nomic DNA so you will need to isolate the prey plasmid by transformation and selection in E coli followed by any standard plasmid preparation procedure see Step 3 3 Transformation of E coli and Isolation of the Library Prey Plasmid If your bait is cloned in pHIS2 1 pHIS2 1 contains a kanamycin resistance gene therefore you can select for the prey plasmid simply by selection on LB plus 10
54. r One Hybrid Library Construction amp Screening Kit Appendix B Plasmid Information continued CEN6 ARS4 Hind Ill 14 r Amp pGAD Rec2 53 Notl Hind III 3146 5385 Figure 10 Map of pGAD Rec2 53 AD Control Vector pGAD Rec2 53 encodes a fusion of the GAL4 AD and murine p53 a known DNA binding protein Thukral S K et al 1994 The vector is derived from pGADT7 Rec2 and was constructed at Clontech by homologous recombination in E coli Specifically the vector was produced by transforming competent E coli cells with EcoR BamH I linearized pGADT7 Rec2 and ds cDNA encoding murine p53 a a 73 391 As a result this vector does not contain the T7 RNA polymerase promoter or hemagglutinin HA epitope tag nor does it share any homology with the SMART III or CDS III oligonucleotides pGAD Rec2 53 is designed for use as a positive control vector in Matchmaker yeast one hybrid assays It is not intended to serve as a cloning vector nor is it intended to be used as a source of murine p53 cDNA Instead use pGAD Rec2 53 with p53HIS2 to produce a posi tive control yeast strain Yeast strain Y187 which is normally unable to grow on histidine deficient media will grow on medium lacking histidine when transformed with pGAD Rec2 53 and p53HIS2 Transformants acquire the ability to synthesize histidine as a result of the interaction between the GAL4 AD p53 fusion expressed by pGAD Rec2 53 and the p53 consensus DN
55. restreak onto fresh DDO plates and incubate at 30 C for 3 4 days e Short term storage lt 4 weeks Seal with Parafilm and store at 4 C e Long term storage Scoop a large healthy colony and fully resuspend in 500 pl of YPD 25 glycerol Store at 80 C Notes e These cotransformants are useful as reference strains for checking new batches of growth media and for comparisons in future experiments e When reviving frozen stocks remember to restreak onto DDO selective medium Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 13 Matchmaker One Hybrid Library Construction amp Screening Kit VII Constructing and Testing your Bait PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Detailed instructions are provided to synthesize and clone your target element Section A and to test your target reporter bait for histidine expression Section B A Synthesize and Clone Your Target Element Each target reporter construct should contain at least one copy of the DNA target element inserted upstream of the 2 days reporter gene Many early studies indicated that the reporter should contain at least three tandem copies of the DNA target Generally three copies are preferred However as Wei et al 1999 have demonstrated a single copy may be sufficient in many cases For more information about target copy number see Ghosh et al 1993 Tandem copies may
56. rsion No PR732190 ATakara Bio Company 16 Matchmaker One Hybrid Library Construction amp Screening Kit Vill Generating the cDNA for Your Library PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Detailed instructions are provided for first strand cDNA synthesis Section A cDNA amplifica tion using long distance PCR LD PCR Section B and column purification of ds cDNA using a CHROMA SPIN TE 400 column Section C Use the following protocol for generating cDNA using Clontech s simple and highly efficiency SMART technology Figure 3 For detailed description of SMART technology refer to Appendix C Poly A RNA SAD DDD DPD DDD PDP PDP PPPS poly A 3 m CDS III oligo dT or random primer First strand synthesis coupled with dC tailing by RT SMART III Oligonucleotide Template switching and extension by RT 5 mmm GGG AANA poly A oes CCC Ss Amplification by LD PCR ds cDNA with SMART III amp CDS Ill anchors Figure 3 Synthesis of high quality ds cDNA using SMART technology A Protocol First Strand cDNA Synthesis It is strongly recommended that you perform a positive control cDNA synthesis with Human Placenta Poly A RNA This control verifies that all components are working properly and lets you compare to the yield and size range of the Protocol ds cDNA synthesized from your experimental RNA sample 1 day IMPORTANT Do not increase the size volume of any of the reactions All compo
57. sites it stimulates transcription of H S3 giving yeast strains such as Y187 which is normally auxotrophic for histidine the ability to grow on histidine dropout medium p53HIS2 contains an autonomous replication sequence ARS4 and TRP1 nutritional marker for replication and selection in yeast the centromeric sequence CEN6 ensures proper segregation of the plasmid during mitosis and meiosis The vector also contains a Col E1 ori and kanamycin resistance gene Kan for propagation and selection in E coli This vector has not been completely sequenced Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 43 Matchmaker One Hybrid Library Construction amp Screening Kit Appendix C SMART Technology Overview A SMART Technology Messenger RNA transcripts are efficiently copied into ds cDNA using SMART Switching Mechanism at 5 end of RNA Transcript technology Zhu Y Y et al 2001 This cDNA synthesis and amplification system is particularly well suited for one hybrid and two hybrid library construction because it consistently delivers high yields of CDNA while maintaining sequence representation By maintaining the complexity of the original tissue the SMART procedure provides you with the best opportunity of detecting rare and potentially novel interactions during yeast one hybrid and two hybrid screening B Mechanism of cDNA Synthesis In the first strand cD
58. tep and resume work later The plates can be stored at 4 C in subdued lighting for up to one month Pick one 2 3 mm colony and cotransform the following using the Small Scale Transformation Protocol Sec tion XII B e Positive Control p53HIS2 and pGAD Rec2 53 e Negative control pHIS2 1 and pGAD Rec2 53 Plate 100 pl of 1 10 1 100 and 1 1 000 dilutions on each of the following agar plates Incubate plates colony side down at 30 C for 3 5 days e SD Trp e SD Leu e SD Leu Trp DDO e SD His Leu Trp 50 mM 3 AT TDO 3 AT NOTE We generally do not recommend plating undiluted transformed cells for the reasons described in Sec tion XIILA Expected results after 3 5 days Positive control healthy colonies on DDO similar number of healthy colonies on TDO 3 AT agar plates Negative control healthy colonies on DDO no colonies on TDO 3 AT agar plates Notes e For positive interactions theoretically the number of colonies should be the same on both DDO and TDO 3 AT DDO selects for both plasmids andTDO 3 AT selects for the plasmids as well as for the interactions of the p53 protein with its target sequence However a difference approximately 10 lower onTDO is usually observed e If you see no colonies on DDO compare to colony counts on SD Trp and SD Leu single dropout media to determine if there was a problem with the bait or the prey respectively Pick healthy 2 mm colonies from DDO plates
59. tivation domain and a library cDNA A protein fusion comprised of the Gal4 activation domain and a polypeptide encoded by a library cDNA Plasmid encoding the yeast Gal4 activation domain pHIS2 1 containing repeats of your target sequence of interest pGADT7 Rec2 vector containing a library gene Requires histidine His leucine Leu or tryptophan Trp in the medium to grow i e is auxotrophic for one or more of these specific nutrients Minimal synthetically defined medium for yeast is comprised of a nitrogen base a carbon source glucose unless stated otherwise and a DO supplement Dropout supplement or solution a mixture of specific amino acids and nucleosides used to supplement SD base to make SD medium DO solutions are missing one or more of the nutrients required by untransformed yeast to grow on SD medium Triple dropout medium SD His Leu Trp or SD Ade Leu Trp A blend of yeast extract peptone and dextrose in optimal proportions for growth of most strains of S cerevisiae YPD medium supplemented with adenine 0 003 final concentration Protocol No PT3529 1 Version No 8 PR732190 Clontech Laboratories Inc ATakara Bio Company www clontech com Matchmaker One Hybrid Library Construction amp Screening Kit IV Host Strain Information The phenotypes and complete genotypes of yeast strain Y187 are shown in Tables I and II For additional information on the growth and mainte
60. to uneven spreading of cells Media should be autoclaved at 121 C for 15 min Autoclaving at a higher temperature for a longer period of time or repeatedly may cause the sugar solution to darken and will decrease the performance of the media Store liquid SD medium at 4 C YPD and SD Base from Clontech contain Glucose Ensure that the pH is adjusted appropriately pH 5 8 for SD Minimal Media and pH 6 5 for YPD and YPDA Optional To reduce the incidence of bacterial contamination the antibiotic kanamycin may be added to all media Prepare and autoclave the media once the medium has cooled to 55 C add kanamycin to a final concentration of 50 pg ml To prepare YPD Agar Medium or minimal SD agar medium from YPD Medium or minimal SD base me dium respectively add agar 18 20 g L just prior to autoclaving Continue spreading the inoculum over the agar surface until all visible liquid has been absorbed This is es sential for even growth of the colonies B Rich Media YPDA Liquid 1 L 50g L Adenine Hemisulphate 15 ml of 0 2 stock solution Adjust pH to 6 5 if necessary then autoclave YPDA Agar 1 L Reagent YPD agar 70g L adenine hemisulfate 15 ml of 0 2 stock solution Adjust pH to 6 5 if necessary then autoclave Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 45 Matchmaker One Hybrid Library Construction amp Screening Kit Append
61. ules based on size Molecules larger than the pore size are excluded from the resin These molecules quickly move through the gel bed when the column is centrifuged while molecules smaller than the pore size are held back For more information about CHROMA SPIN Columns please refer to the CHROMA SPIN Columns User Manual PT1300 1 available at our web site at www clontech com 1 Prepare e dsCDNA by LD PCR Section B e sodium acetate 3 M pH 5 3 e ice cold ethanol 95 100 Protocol No PT3529 1 Version No PR732190 20 www clontech com Clontech Laboratories Inc ATakara Bio Company Matchmaker One Hybrid Library Construction amp Screening Kit Vill Generating the cDNA for Your Library continued 2 Prepare one CHROMA SPIN TE 400 column for each 931 cDNA sample see Figure 5 e Invert each column several times to resuspend the gel matrix completely e Snap off the break away from the bottom of the column e Place the column in a 2ml collection tube supplied e Remove the top cap NOTE You will use 2 columns for each library to be constructed lt Clear top cap lt lt CHROMA SPIN Column main body Figure 5 CHROMA SPIN column and collection tubes Note that a con lt lt Matrix ventional tapered 1 5 ml microcentrifuge tube can be substituted for the 2 ml collection tube This will allow the sample to be confined to a narrower area for easier handling lt lt
62. veenenechevnenevnete 15 VIII Generating the CDNA for Your Library ccccccceccseeceeeeeeeeeeeeesseseseeseseesseeeesaesseeeeeesenenenes 17 A Protocol First Strand GINA Synthesis vcsscsssnsesensezensssedertesesseunses a iiien en i SEE EEEa ANE riS a 17 B Protocol Amplify cDNA Using Long Distance PCR LD PCR sssssssssssssssssssererseressereriererrereerrrrersere 19 C Protocol Purify ds CDNA with CHROMA SPIN TE 400 Columns cccescseseeeseeeceeeeeteeeeeeeeneees 20 IX One Hybrid Library Screening ccccccceeeeeeeeesneeeeeeeeeeeeeeeeseaaeeeeeesaaeeeesesnaaeeeeennaaeeeeneaea 22 X Analysis Of Results scscsussenine in EE EEEE 24 A TOO Few POSIAVES cori Sero E eE E E E EE 24 B LOG Many POST eV 6S srice aerie e Syn Enana ES eines OEN rE e Eae aeon S as ES VAE N 24 XI Confirmation of Positive Interactions amp Rescue of the Prey Plasmid c0e 25 A Confirmation of Phenotype by Restreaking ccccecscesesesesseseecseseeeeeceeseeceesseseaeeseesecaeeeesesateeeenenates 25 B Protocol Yeast Colony PCR to Eliminate Duplicates cc ccceesesesseseeeecseeeeseeeseseeesesesenseetesseneeeeee 26 C Protocol Rescue and Isolation of Library Plasmid Responsible for Activation of Reporters 27 D Protocol Distinguishing Genuine Positive from False Positive Interactions 28 E Sequence Analysis of a Genuine Positive reiignis iussi ense rT E ESOS SERE aE ESEESE 30 XII Yeast Transformation cece eeeeee
63. y scale transformations For small scale procedures that do not necessarily require the highest transformation efficiencies YPD liquid medium can be substituted for YPD Plus 10 Centrifuge to pellet yeast cells discard supernatant 11 Resuspend cell pellet in 0 9 w v NaCl NOTE This volume 1 ml or 15 ml is the suspension volume see Section C Small Scale Library Scale 20 ul 160 pl 15 min 20 min high speed 700 g for 15 sec for 5 min 1 ml 3 ml high speed 700 g for 15 sec for 5 min 1 ml 15 ml Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3529 1 Version No PR732190 33 Matchmaker One Hybrid Library Construction amp Screening Kit XII Yeast Transformation continued C Protocol Plating and Determination of Transformation Efficiency 1 Spread 100 pl of 1 10 and 1 100 dilution onto a 100 mm plate containing the appropriate SD selection medium Section VII B Table V For example Protocol 3 5 z days For pHIS2 1 use SD Trp e For pGADT7 Rec2 use SD Leu e For cotransformations use SD Leu Trp S ZK NOTE We generally do not recommend plating undiluted transformed cells for the reasons described in Section XIII A 2 Incubate plates upside down at 30 C until colonies appear 3 5 days 3 Calculate transformation efficiency Example Calculation Transformation Efficiency cfu x Suspension Volume ml Vol plated ml x amount of DNA ug

Matchmaker One-Hybrid Library Construction & Screening Kit

Contents

Download Pdf Manuals

Related Search

Related Contents

Matchmaker One-Hybrid Library Construction &amp; Screening Kit

Contents

Download Pdf Manuals

Related Search

Related Contents

Matchmaker One-Hybrid Library Construction & Screening Kit