Home

Full documentation - Molecular Evolution & Organelle Genomics

Contents

1. ID MYGSINIGE STANDARD PRT 153 AA AC P02181 DT 21 JUL 1986 REL 01 CREATED DT 21 JUL 1986 REL 01 LAST SEQUENCE UPDATE DT 01 JAN 1990 RE 13 LAST ANNOTATION UPDATE DE YOGLOBIN OS AMAZON DOLPHIN INIA GEOFFRENSIS OC EUKARYOTA METAZOA CHORDATA VERTEBRATA TETRAPODA MAMMALIA OC EUTHERIA CETACEA RN 1 SKELETAL MUSCLE SEQUENCE RA DWULET F E BOGARDT R A JONES B N LEHMAN L D GURD F R N RL BIOCHEMISTRY 14 5336 5343 1975 DR PIR A02503 MYDDAR KW HEME OXYGEN TRANSPORT RESPIRATORY PROTEIN USCLE SQ SEQUENCE 153 AA 17071 MW 108881 CN GLSDGEWQLV LNIWGKVEAD LAGHGQDVLI RLFKGHPETL EKFDKFKHLK TEAEMKASED LKKHGNTVLT ALGGILKKKG HHEAELKPLA OSHATKHKIP IKYLEFISEA IIHVLHSRHP GDFGADAQAA MNKALELFRK DIAAKYKELG FHG ll 6 6 Programme NBRF This will archive sequences which come from the NBRF It is sufficient to have the sequence of interest in a file in a file with the extension NBR and with the format described below There must not be more than one sequence in the file ENTRY MYDD
2. 35 11 11 3 The SAVEBANK program ceeceeeeeeeeceeeeaeeeeeeeeeeeeeeees 36 11 11 4 The LOADBANK program cceceeeeeeereeeeeeeeeeeeeeeeeeeeeetees 36 Il 12 The FILM program Miitnns 37 11 13 The TRANSLAT program 38 III MANAGMENT OF ALIGNED SEQUENCES 40 Hl T General introduction sereinement 40 Iln2 Program FAS ins Sn Re ete tt e a 40 IIS Program MAKETREE 58e suede ncanysonsthgearcapeeeteapsienceneabead 42 III 3 1 Modification of a tree 42 II 3 1 1 Moving in a tree 42 111 3 1 2 Adding a sister group 43 IIl 3 2 Creation of a Tres stone Me ent ptn ts 45 IIl 3 3 Management of the sub trees 000 eeeeeseereeeeeeeeeeeeeeeees 45 IIl 3 4 Management of the files of systematic frame 46 Il 4 Program ED oo chcceccncceptdeslapatderantencep anpal ne nee need cee santas 47 IIl 4 1 General introduction 47 il MUST user s manual Version 1 0 Apr 03 IIl 4 2 Choosing the file of aligned sequences 48 IIl 4 3 Choosing the species 48 IIl 4 3 1 Choosing the species one by one 48 IIl 4 3 2 Choosing a group Of species 49 111 4 3 3 Cupho rd gro p 14ramaernra nement 49 Ill 4 3 4 Correction of the list of selected species 49 I11 4 3 5 Archiving lists of species 50 I11 4 3 6 Other functions 0 2 0 ceeterttteee
3. 70 III 8 2 3 Regroupings present in more than 1 of samplings70 IIl 8 3 Utilisation of NJBOOT 0 0 cccceeeceeeeeeeeeeeeeeesaaeaaeeeeeeeeees 70 III 9 Recuperation of outputs from programs of phylogenetic construction 71 III 9 1 Transformation to TREEPLOT format 71 DRO 2 AP TE i a ce eh aie Sh at Per NA Soe ak OR ete 71 ESS ABT PAUP annan aaa a eaa Ea A oi ea AAAA A ESE AR 74 HPO AFT_PHYL SR ce nn ir te 76 III 9 5 Mode of employment of the utilities 76 11 10 The TREEPLOT program 77 111 10 1 Parenthesised tree file 77 111 10 2 Modifications of the tree ccceeccceceeeeeeeeeeeeeseeeeeeeeeneees 77 111 10 2 1 Choice of the root 78 111 10 2 2 Rotation around a node cccceceeeeeeeeeeeeeeeeeeees 78 111 10 2 3 Weight of the lower branch 78 I11 10 3 Matrix of distances Ernie rer cette chawtualynens 78 10 4 Output to printer scicccstisgeencdiccacnaschannathiiv cacuwhasaxsatenoninauscuens 79 111 10 4 1 Matrix printers nnnnnnnnnneneeeaeaae nenene eeeeeennenee nenna 79 111 10 4 1 Postscript printers 79 HF 10 5 Other functions nipn nnnans sn nimes 80 Il 11 The COMP_MAT program ccceeeeeeeeeeeeeeceeeeaeeeaeseeeeeeeeeeeees 80 111 11 1 Method of comparison used
4. 80 111 11 2 Visualisation of the species couples 81 IIl 11 3 Choice Of species se isrminunnnientinnutennines 81 Il 11 4 Indices OR PRE EE RO RES OR 81 Meta S PTN vocatieeno a dened te eet atone eas 82 Il 12 Diverse programs 83 111 12 1 The JACKMONO program ceeeecceeeeeeeeeeeeeeeeeeeeeetees 83 111 12 4 1 General information 83 4 2 Utilisatio N a E RRES 83 111 12 2 The AFT_EXT program 84 111 12 3 The JACKBOOT program sssssssssssessssssnersnerrrrrrrrrrrrrrnrnsnn 84 111 12 3 1 General information 84 111 12 3 2 Utilisation of JACKBOOT cceeeeeeeeeeeeeeeees 85 111 12 4 The COMP_BOO program 86 111 12 4 1 Description of the display 86 1242 Main Mens aiment 86 Il 12 4 3 Other options es terasse 87 111 12 5 The MONO HIS program 88 111 12 5 1 General information 88 111 12 5 2 Utilisation of MONO HIS 88 111 12 6 The COMP_POS program cccceeeeeeeeeeeeeeeeseeeeees 89 111 12 6 1 Method of comparison used 90 111 12 6 2 Options available ccccccccceeesssssseeeeeeeeeeeeees 90 iv MUST user s manual Version 1 0 Apr 03 111 12 7 The RESTRIC program 91 T2 ZT Utilisation ne ae ett ae nt 91 111 12 7 2 The ENZYME RES file 91 111 12 7 3 The RE
5. 1 10 The MUST program This is a call program for the principal software in the MUST package It is in the form of a selection menu which displays the program function followed by its name To activate a program you must use Return to validate the active line in yellow Using F1 you can get a terse description of the current program 16 MUST user s manual Version 1 0 Apr 03 Il SEQUENCE DATABASE ll 1 General presentation Two variables are used to define the type of sequence entered Molecule and Domain The first is used whatever the sequence while the second is of interest only for large molecules However both variables must always be named a simple dash can be used for Domain but one can also indicate the type of molecule by putting DNA or Protein It is advisable to cut a large molecule into domains of homogeneous variability in order to facilitate the alignment To define the sequence you simply assign it an identifier which must contain one and only one blank We advise the use of the following syntax lt genus name gt lt species name gt lt various characteristics gt where the use of various characteristics is facultative EXAMPLE Mus musculus Salmo salar_Bretagne Xenopus laevis_17 REMARK One unique sequence will be recognised by these three key words There are other types of information which permit a better characterisation of the sequence but these are not used for the program
6. Ill 6 7 2 Choice of the presentation of the identifier A sub menu permits you to choose the type of display for the identifier among the three following possibilities e Genius species complete generic and species name e G species initial of the genus name and entire species name e Genius generic name only Ill 6 7 3 Choice of the version of PHYLIP In order to obtain a file usable for TREEPLOT starting from output files generated by the PHYLIP ensemble the program AFT_PHYL see Ill 9 4 requires a file with the extension TRE The version 3 3 of PHYLIP requires the presence of the option Y to create 67 MUST user s manual Version 1 0 Apr 03 this file automatically NET adds the option Y in the output files formatted for the programs of the PHYLIP package version 3 3 lll 6 7 4 Level of GC This option concerns only nucleic acids For each sequence the program calculates the percentage in bases G C For this calculation only non retired positions are retained The program outputs the result in table form to a printer or to NET OUT see III 6 7 6 ordering the sequences according to the option chosen among the following possibilities e sort by increasing order of GC e sort by decreasing order of GC e no sort order of sequences at the moment of calculation Ill 6 7 5 Frequency of characters For each sequence the program determines the frequency of each character or of non determined charac
7. 49 MUST user s manual Version 1 0 Apr 03 To change the order enter the new position to the left of the species you want to move cancel by Backspace At that level you can also unselect some species by typing 0 before their name F2 activates the option to change the order F3 arranges in ascending order and come back to the tree To rearrange the species the program begins to position the numbered species then it fills up the empty locations with the remaining species respecting the initial ascending order For example 6 1 Aa gives then Li B B 2 Bb 2G oe 2 EE 22 LS ES 3 Dd 4 Dd 4 Ee 4 Ee 4 5 Ee 5 F f 6 F f 6 Aa 6 Aa 8 7 Gg 7 Hh 8 H h 8 Gg 8 Gg REMARK Note that if you come back to the tree with Escape or F4 the program does not take into account the values which are on the display However if you already used F2 to rearrange the initial list Escape or F4 will not retrieve this initial list the last order saved by F2 is kept IIl 4 3 5 Archiving lists of species In practice the user will often use the same list of species or a very similar one It is thus interesting to archive a list of species in order to avoid to rebuild the same list or so at each use F7 starts this operation and asks you for your name and for a list name With F8 you can load a list of species which was previously archived by F7 F8 displays a list of the lists of specie
8. 11 11 4 The LOADBANK program This program will recuperate a SAVEBANK file constructed by the program SAVEBANK and install it on the hard disk of a computer that to which the file was saved or another Simply indicate the unit on which the SAVEBANK file is located The program will integrate the sequences saved into the data base on the hard disk There are four cases possible e the sequence to be loaded i e that in the SAVEBANK file does not exist in the base and the program will then add it to the base e the sequence to be loaded exists in the base but the version in the base is older than that to be loaded the program will replace it with the newer version 36 MUST user s manual Version 1 0 Apr 03 e the sequence to be loaded exists in the base but the two versions are the same age the program will do nothing e the sequence to be loaded already exists in the base and the existing version is the more recent of the two the program does not change the existing version and informs you why While loading the data LOADBANK indicates the number of sequences treated and details the number of sequences corresponding to each possible case Once loading is finished you can visualise the list of treatments performed The information is automatically stocked in the LOADBANK OUT file but cannot be redirected to a printer 11 12 The FILM program This program is used to archive the films f
9. Consistency index 0 711 Tree no 1 rooted using designated ancestor Physarum 1 74 MUST user s manual Version 1 0 Apr 03 KKKKKKKKKKK Dictyost 2 KKKKKKKKKKKKKK Prorocen 3 KR KKK KK KK KK RK KKK KAKA SG LS ia Arabidop 4 kkxkxkxkxkxkxkxkxkxkxkxkxkxkx xxx 5 Citrus l 5 13 je 11 Sinapis 8 x KKKKKKKKKKKKKKT A 12 Fragaria 6 x 5 TYCOPEES 7 KKKKKKKKKKK Oryza sa 9 Example of the parenthesised tree obtained Arbre calcul avec le programme PAUP Version 2 4 1 Length 38 000 Characteristics of the tree Consistency index 0 711 S quences extraites du fichier BP1 F4 cr par bp le Dimanche 9 F vrier 1992 12 heures 48 dont le titre est tmp Fichier TOTO NET cr le Dimanche 9 F vrier 1992 13 heures 4 Fichier TOTO 1 NBS cr le Lundi 8 Juin 1992 18 heures 57 Type de parcimonie Tous les v nements 203 sites limin s car PRESENT2 _ 2 00 2 00 _ I 2 00 2 00 Il reste 24 positions sur les 227 s lectionn es total 227 Sinapis alba 0 000000 Citrus limon 0 000000 0 000000 Fragaria ananassa 1 000000 0 000000 Lycopersicon esculentum 1 000000 0 000000 Arabidopsis thalia na 0 000000 1 000000 Oryza_sativa 4 000000 6 000000 Prorocentrum micans 5 0000 00 8 000000 Dictyostelium_discoideum 4 000000 4 000000 Physarum_polycephalum 4 000000 111 9 4 AFT_PHYL This transforms an output file
10. Herv PHILIPPE Lab de Biologie Cellulaire 4 Bat 444 Universit de Paris Sud 91405 Orsay FRANCE T 33 1 69 41 64 81 Fax 33 1 69 41 21 30 E mail adoutte arthur citi2 fr MUST user s manual Version 1 0 Apr 03 TABLE OF CONTENTS I GENERAL INTRODUCTION 1 l 4 Functions oft MUST EE Sn a yee 1 I 1 1 Database management 1 I 1 2 Aligned sequence management 2 I 1 2 1 Sequence alignment 2 I 1 2 2 Choosing representative species 2 I 1 2 3 Choosing which regions to use 2 I 1 2 4 Visualisation of dendrograms and comparison of IIA ial ste ns mere een ton rene era 3 1 1 2 5 Concatenation of files of aligned sequences 3 l 2 Writing conventions used in this manual 4 l 3 Installing the software on hard disk 5 l 4 Work directories ss 6 I 4 1 Working with several users cceceeeeeeetteeeeeeeeeeeeeeeeeeees 6 Il 4 2 Creation of a new working directory 7 l 5 General keyboard coding 8 l 6 COlOF CONG sesadccevactstinttieentamviatidunnty canleledog shu ruscabsacvtacecetus cate avaiutumndateas 8 l 7 Printing FESUMS eccna din et cso nt 9 lZ Matrix printes intro a denim en neta 9 7 2 Postscript printers isa nate dti be a a 9 l 8 Summary of files used by MUST 11 l 8 1 MUSTEXENMUSTEAE sleigh nine ete ats 11 262
11. Apr 03 If you have the slightest doubt as to the validity of the operations you have performed there are two possible solutions e use Esc to exit from the program without modifying the sequence stocked in the bank e use F7 to annul all the modifications made in the sequence and return yourself to the initial state 11 7 5 Modifications in the files of aligned sequences Once the modifications are completed the program proposes the addition of Free commentaries justifying the modification change of species name change from GGGGAG to GGGGGAG It modifies the database and searches in all aligned sequences files containing the keywords Molecule and Domain for the corresponding dentifier When it is found the program transforms the former sequence to a commentary adding a in front of the sequence and places the new sequence just below the old one unless the file is not in the proper format in that case correct the format and use VERIFSEQ which will give the same result see below It is then sufficient to copy the old alignment on the new sequence ll 8 The VERIFSEQ program The purpose of this program is to verify the concordance between the archived sequences and those in the files of aligned sequences Of course it does not take spaces or gaps or into account Its default exit is the file VERIFSEQ OUT but you can redirect it towards the printer by using the option F3 To start the verification simply select a f
12. L pidosauria by F2 and Name of new node Diapsida Name of new group Lepidosauria To create a new node a minimal distance between nodes is required Only the horizontal distance is significant vertical distance is just used for an easier reading of the tree To move an internal node along the horizontal axis you must use the F3 key The node is then moved with the Left or Right Arrow keys quick move by combination of these keys with the Ctrl key To rotate daughter nodes around an internal node use F6 key To correct or modify the name of a node use F5 key Using F4 will either destroy a leaf or transform an internal node in a leaf in which case the entire downstream sub tree will be destroyed Once the construction of the systematic frame is finished Shift F5 will save it and return you to the main menu Shift F1 returns you to the main menu without saving the construction Escape exits the program without taking into account the modifications 44 MUST user s manual Version 1 0 Apr 03 111 3 2 Creation of a tree After you choose the option Creation of a new systematic frame with Return e The program asks for the Name of the systematic frame You validate your entry with Return e You must then enter the names of the two first Groups of your tree and validate each entry with Return e You can correct your entry using the direction arrows Name of the systematic frame corresponds to the nam
13. MUSTIMU S T 8 nm fe tte rate panne gees 11 BS MUSTAMUSTIAL in e a i 11 l 8 4 MUST IMUST DATA ceeeceeeee ee eeeeeeeeeeeneeaaeeeeaeeeeeeeeeeeeeees 12 l 8 5 MUSTAMUST TYPEi a Re ete 12 PSG MUSTIS EQ ii a a a aa EA EAG ah 12 l 8 7 Current working directory sssessssssssssssssrserrrrrrrrrrrrrrrnerrene 13 1 8 8 BAK TIES na a Me en a ns 15 l 9 Indications on the architecture of the database 15 I 9 1 General information 15 1 9 2 File descriptions cccccceecceeeseeeeeesseeeeeeeeeeeeeeesaaaaaagseseeees 15 l 10 The MUST program su nine nt nee nee 16 II SEQUENCE DATABASE 17 Il 14 General presentation cccccccsssssessssseeeeeeeeeeeseeeeeeeeeeesssseeeeeeeeseees 17 Il 2 The USER Pr draMm sn nnsean ee aieri 17 Il 3 The ENTRYSEQ Program sautant 19 11 3 1 Sequence acquisition 19 Il 3 2 Correction of acquired sequences 19 MUST user s manual Version 1 0 Apr 03 Il 3 3 End of the program sise smininreti mnt 19 Il 4 The SAVESEQ Program aisselles nie eanane 20 Il 4 1 General information 20 I 4 2 Molecule and Domain 21 l 43 Identifier ie een n e enue i te tt nn in es 21 I1 4 4 Other rubrics 0 2 eee cece eect e eee eect eeeaaeaaaaeaaaeeeaeeeeeeeeeeeeeees 22 Il 4 5 Integration into the files of aligned sequences 2 22 IL_5 The SAVECUT program 23 ll 5 1 SOUL NG TOM AL steed sn a eh eh ae es LAN de 23 123 2 Using SAVECUT S nn Rd t
14. Using this menu you can also create a file with the option to change the file containing the species names Simply supply a new name to create the corresponding file Il 4 4 Other rubrics You must then fill in the different rubrics being all the more careful if several people are working in collaboration This is the only way in which your co workers and yourself as well several months later can know precisely which individual of the species has been used and what level of confidence one can have in the sequence The film numbers will permit you to easily locate them again to check the estimated quality and the number and identity of readers This in turn will lead you to reread the film rerun the sequence or accept the data supplied Once all the rubrics are completed F5 archives the sequence and its related comments in the database ll 4 5 Integration into the files of aligned sequences SAVESEQ then displays the list of aligned sequence files corresponding to the type of molecule you have entered Remember that these files must be in the lt MUST gt SEQ directory and have an ALI extension You can then add the sequence to the end of the file activated by using Return or in a new file by using F3 If no file corresponds to the new molecule the program goes directly to create mode WARNING the program will simply add the new sequence to the end of the ALI file 22 MUST user s manual Version 1 0 Apr 03 115
15. a key to phylogeny FASEB J 7 113 123
16. in function of the number of sites These values are stored in a file with a BOO extension The file is generated by the AFT_ EXT see Ill 12 2 or JACKBOOT see Ill 12 3 programs from the OUT and GRP files created by DNABOOT or NJBOOT see 1II 8 The ensemble of bootstrap values is displayed in the first window you choose the file to be visualised by Return on the active file in yellow COMP_BOO Then displays the values in graphic form with the number of sites on the X horizontal axis and the bootstrap values on the Y vertical axis Each point represents an elementary file which stores a bootstrap value for a given number of sites The regression line is shown in yellow In the upper part of the screen from left to right the following information is displayed the correlation coefficient R the total number of points the name of the bootstrap file 111 12 4 2 Main menu The principal options are displayed in menu form below the graph Display of each point f mean value Display o Printing out the diagram Visualisation of points This furnishes the list of elementary files with the following data the name of the elementary file a percentage representing the distance which separates perpendicularly the examined point to the right of the line of regression calculated as a percentage of the longest observed distance between parentheses the value of the XY coordinates The p
17. programs described below Press F1 to access a help screen describing each program 40 MUST user s manual Version 1 0 Apr 03 Figure 2 Schematic flowchart of the management of aligned sequences FAST 41 MUST user s manual Version 1 0 Apr 03 I1 3 Program MAKETREE Practising phylogenetic construction sets the researcher a problem of sampling This sampling obligatory takes into account a pre existing set of systematic data It is thus useful to present the palette of sequenced species in connection with the phylogenetic frame to be tested so the user easily can evaluate permanently the bias in sampling The phylogenetic frame is displayed as a cladogram for the three following reasons e a cladogram presents a phylogenetic classification the only classification for which a comparison with a molecular phylogeny makes sense e most of the recent results are obtained using the cladistic method e on the same diagram are displayed both certain and uncertain branch line points The program MAKETREE creates a personalised systematic frame that you can modify Its use is quite cumbersome but infrequent The general principle of the systematic frame is a purely dichotomic tree in which all the nodes internal or external have a name This name must not contain the characters If the cladogram contains a polytomy this one can be represented by putting the internal nodes very close to each other The basic operation to b
18. transversions and deletions e all the substitutions ignoring deletions e in the case of DNA sequences only the transversions and not the gaps The type of events is chosen in the following menu the events the substitutions the transversions IIl 6 4 4 Jackknife Depending on the species representative of the taxons the robustness of a node or even its existence different topology can vary heavily Lecointre Philippe Le and Le Guyader submitted Since the result which will be obtained with a given species is not predictable the option JACKKNIFE allows to make an evaluation by random sampling of species or sites So far the program DNABOOT is the only one able to take advantage of this option the obtained files have thus this format Since DNABOOT is a parsimony program you will have to indicate what types of events have to be taken into account There are three ways to use this option These variantes are available in the following sub menu Jackknifing of species Systematic addition or removal of species Jackknifing of sites Jackknifing of species It is an easy way to study the phenomenon by several random samplings for a given number of species You are asked to enter the number n of species among the m existing species and the number N of samplings For each sampling the program creates a file with the format DNABOOT which thus contains a random choice of the n species r
19. 111 12 4 3 Other options Postscript file Using the F5 key a file in Postscript language allows you to print the graph on a Postscript type printer Several options available on a menu let you configure the impression Printing o f diagram Ch Ch Ch Ch Ch Ch oice oice oice X the name of file the number of diagrams per page le oice Y ti le oice print ting of the diagonal ange the shape of the point The choice of the number of diagrams per page has a direct influence on the unit size of each diagram The legends of the axes are centred on the axes Other Function keys F2 Displays the commentaries in the bootstrap file F3 Modifies the scale on the X axis F4 Modifies the scale on the Y axis SHIFT F1 Loads a new file of bootstraps SHIFT F2 Modifies the scale of the X axis so that the values are between 0 and the maximal value and modifies the scale of the Y axis so that the values lie between 0 and 1000 87 MUST user s manual Version 1 0 Apr 03 111 12 5 The MONO _HIS program 111 12 5 1 General information This program lets you display in histogram form the bootstrap values BE obtained by the DNABOOT or NJBOOT programs see III 8 Starting from OUT and GRP files generated by these two programs AFT_EXT Ill 12 2 or JACKBOOT see 111 12 3 create BOO files usable by MONO HIS 111 12 5 2
20. 2 1 1 1 100 50 50 50 66 100 50 100 50 100 100 100 66 50 100 50 100 100 100 100 0 0 0 0 100 0 100 50 100 100 100 50 0 100 O 100 100 100 19 20 21 22 23 2 2 1 1 2 50 100 100 100 50 O 100 100 100 0 xsteps 1 8 seconds Example of a parenthesised tree file created by AFT_HEN Arbre calcul avec le programme HENNIG86 bb length 38 ci 71 ri 64 trees 3 S quences extraites du fichier BP1 F4 cr par bp le Dimanche 9 F vrier 1992 12 heures 48 dont le titre est tmp Fichier TOTO NET cr le Dimanche 9 F vrier 1992 13 heures 4 Fichier TOTO 2 NBS cr le Lundi 8 Juin 1992 18 heures 58 Type de parcimonie Tous les v nements 203 sites limin s car PRESENT2 _ 2 00 2 00 _ I 1 00 2 00 Il reste 24 positions sur les 227 s lectionn es total 227 Physarum_polycephalum 1 Dictyostelium_discoideum 1 Prorocentrum_micans 1 Lyco persicon_esculentum 1 Oryza_sativa 1 Arabidopsis thaliana 1 Citrus_limon 1 Frag aria_ananassa 1 Sinapis_alba 1 1 1 1 The HENNIG86 program does not always create a dichotomous tree AFT_HEN can transform the tree into a parenthesised one but TREEPLOT is still unable to use it 111 9 3 AFT_PAUP This transforms an output file from the program PAUP into a file usable by TREEPLOT The PAUP program requests the name of the entry file and that of the output file For AFT_PAUP these two names must be identical The PAUP program truncates species na
21. 227 s lectionn es total 227 DNA parsimony algorithm version 3 31 38 trees in all found requires a total of 38 000 Oryza sativa 1 0 Citrus limon 1 0 Fragaria ananassa 1 0 Lycopersicon escu lentum 1 0 Sinapis alba 1 0 Arabidopsis thaliana 1 0 1 0 1 0 1 0 1 0 1 0 P rorocentrum micans 1 0 1 0 Dictyostelium discoideum 1 0 1 0 Physarum polycepha Lainie 0 7 111 9 5 Mode of employment of the utilities All the programs described in chapter III 9 are used in the same manner The utility displays the list of OUT files You choose your file validation of the active file in yellow with Return The program creates the file s of parenthesised tree s You can transform other output files or continue with another program notably TREEPLOT using F2 lil 10 The TREEPLOT program 111 10 1 Parenthesised tree file The program TREEPLOT traces a phylogenetic tree starting from a tree in parenthesised form obtained for example using the programs NJ AFT PAUP or AFT_PHYL The entry file must thus be of the form le Mardi 12 Mars 1991 a 13 heures 57 dont le titre est Domaines conserv s du 28S Fichier EX NET cr le Mardi 19 Mars 1991 a 16 heures 40 Fichier EX_0 MAT cr le Mardi 19 Mars 1991 a 16 heures 40 atrice calcul e avec Toutes les diff rences BORNES 1 27 1209 sites limin s car PRESENT2 _ 2 00 4 00 _ 1 00 4 00 Il reste 587 positions sur les 1796 s lectionn es total 1822 Arbre
22. MUST gt SEQ and its name must be different from that of all other files in this directory For raw sequence files the exit file is in the current directory and its name will have a PRO extension but may otherwise be the same as that of the file to be translated TRANSLAT displays the problems encountered during a translation for example a stop codon in the middle of the sequence You must press any key in order to acknowledge the error message before the translation will continue It is not possible to abort a translation in course 39 MUST user s manual Version 1 0 Apr 03 IT MANAGMENT OF ALIGNED SEQUENCES lll 1 General introduction This set of programs processes a group of aligned sequences in order to build phylogenies It was devised taking the following hypotheses into account 1 The alignment obtained from a high number of species remains unchanged whatever the sampling of the species so one can have an unique file of aligned sequences containing all the available species 2 Biological molecules are generally composed by different regions which have quite various rates of evolution For instance the active site of a protein performs evolution at a much slower rate than the other parts of the protein For a given group of species alignment will be possible in some domains and not in others For example all the Eukaryotes can be aligned in the domain C2 of 28S rRNA but not in the domain D2 which has a too high rate of
23. all underlines will be replaced by blanks during display and printing However the identifier must not contain more than 40 characters or it will be truncated 111 10 2 Modifications of the tree The first window of TREEPLOT displays the list of files of parenthesised trees ARB You choose you file validation of the active file in yellow using Return The program indicates the possible existence of negative distances then displays the commentaries associated with the file requesting confirmation of the choice REMARK The vertical lines have a null length they are present only to make the tree readable Only the horizontal lines represent distances between species 111 10 2 1 Choice of the root It is possible to choose an outgroup species the root will then be situated between that species and the nearest node or to choose to position the root at the left of a node Place the cursor on the species or node desired and create the root using F3 The tree is redrawn with the new root In addition one may choose the percentage of the length of the internode which is consecrated to the upper branch The program permits the acquisition of that value using F4 cf 111 10 2 3 111 10 2 2 Rotation around a node You place the cursor on the node around which you wish to make the rotation The F2 key gives a permutation of the upper and lower branches which emanate from the current node Obviously this function is not active when t
24. calculated in centimetres with respect to the adges of the sheet of paper cannot be less than 0 7 cm This limitation is imposed by many laser printers The size of characters and the thickness of lines is expressed in points The interline corresponds to the space between two lines and is null by default It is expressed in millimetres Three tree types are proposed Horizontal The branches of the tree are composed of horizontal and vertical lines but only the horizontal lines represent distances separating two nodes 19 MUST user s manual Version 1 0 Apr 03 Oblique The branches of the tree are composed of oblique lines running directly from a node to its daughter node Cladogram The tree is represented in cladogram form The option Change of print of BE allows you to display or not the bootstrap value to the left of each node The names of leaves are printed in Times Roman typeface you can choose the following styles Italic Normal or Bold As for the matrix printers the default horizontal scale is that which occupies the width of the sheet of paper By playing with the parameters character size interline and scale it is possible to modify the vertical space occupied by the tree The program will not verify that the tree will fit on a single sheet you must check that the value for space available is not negative 111 10 5 Other functions Here is a summar
25. characters of the corresponding sequence by blocks of 10 To move within the sequences you can use the directional arrows to move step by step and Pgup Pgdn Ctrl right arrow Ctri left arrow Home and End to move rapidly When the cursor is on the first or last line if you press on the Up or Down arrow the first species will be replaced by the second last species This is necessary to be able to see all the sequences when the number of selected species is larger than 23 the maximum number of species which can be displayed on the screen This is also useful to get a visual impression of the alignment since depending on the first species the dashes will differ in number and distribution The gaps due to the non selected species are not displayed on the screen This explains why the position counter yellow color at the bottom left of the screen can be incremented or decremented by more than one when the cursor is moved horizontally by only one step For the same reason the first nucleotide or amino acid displayed may be at a position value superior to 1 In the same way if you modify the alignment stars can appear where there was none at the right of the current position You just need to adjust the alignment and the stars will disappear Ill 4 4 2 Color palette Sequences are displayed according a color code This code can be personalised as a function of research thema or according your personal taste The color code can
26. choose the database using the two keywords Molecule and Domain manually or by using F2 which furnishes the list of molecule types After validation by Return the program displays the ensemble of aligned sequence files corresponding to the selected base You choose the target file validation of the active file in yellow using Return or create a new file with F3 The program updates the file and indicates e the number and names of added species e the number and names of species present in the file which are not in the base 34 MUST user s manual Version 1 0 Apr 03 e the name of species present several times in the file With F4 you can choose a new database F2 lets you change programs 11 11 Management of the database The following programs let you e to obtain information on the database of sequences e to save entire or partial databases e to keep the base intact in case of user error e to make updates on several machines 11 11 1 The INFOBANK program This program gives you all available information on the database It furnishes e the list of types of molecules already present e the list of species archived for a given molecule type e all the information corresponding to a species for a type of molecule e all the domains where a species can be found e all the domains where at least one species of a group can be found Depending on the type of information desired one or several of the following may be ask
27. combination Shift F3 allows to write in a file all the selected sequences of all the ensembles This file is written in the current directory with the extension NET since it is written with the format of the program NET see the description of this program in the Chapter III 6 The program NET is automatically launched after you validate the name of the file lll 5 Programs AFAS CAFAS and DAFAS Ill 5 1 Advantages and drawbacks of this set of programs The program AFAS prepares the files of aligned sequences to be used by the program CAFAS In particular it can concatenate sequences which are contained in different files The sequences which are contained in the prepared files cannot be modified anymore However these files are linked to a frame and the associations species name group will be frozen It is useful to be able to concatenate easily and quickly different files of aligned sequences Indeed the files of aligned sequences can be small sized a gene cut in several subunits they can also have a biological sense one gene The program CAFAS then allows you to choose the species and to write the sequences in a file formatted for the program NET Finally the program DAFAS provides a management of the previously prepared files REMARK It can be better to use this set of programs rather than to get aligned sequence files formatted for NET via the program ED since the selection of species and their writing in a file are much q
28. containing aligned sequences undergo frequent manipulations in the course of which errors are easily introduced The program VERIFSEQ controls the correspondence between the raw sequences saved in the database and those present in the files of aligned sequences MUST user s manual Version 1 0 Apr 03 1 1 2 Aligned sequence management Management of aligned sequences is a point of primary importance for all researchers who wish to use different algorithms and vary different parameters during the construction of phylogenies 1 1 2 1 Sequence alignment The first and probably most important parameter is the alignment of the sequences Clearly an objective alignment that is reproducible is that obtained using a precise algorithm with given weights for various events substitutions insertions or deletions For example using the algorithm of dynamic programming one can optimally align two sequences Unfortunately the weights are difficult to estimate More importantly we know because of the three dimensional structure of proteins that the weights cannot be the same throughout the sequence for example it is virtually impossible to have a gap ina transmembrane segment Nonetheless all the algorithms assume constant weights In addition there is no rapid algorithm which results in the optimal alignment of n sequences especially when n is large Consequently alignment programs offer suboptimal results with subjectively chosen para
29. divergence in this domain only groups like Mammals or Euteleosteans can be aligned It is thus better to cut in different domains the large molecules in order to build files of aligned sequences in which all the existing available species can actually be aligned 3 The sampling of the species is of prime importance since its quality governs the test to be done on the pre established phylogeny To do so the sampling has to be done in presence of this phylogeny The choice of the species is easily done browsing in a pre established systematic frame The program ED edits the sequences to be aligned in order to work this alignment according various techniques It can also select sub groups of species If large genes are cut into several domains it will be necessary to use the program AFAS which can concatenate sequences from different files Then the program CAFAS can select the species you want to use Finally the program NET can withdraw remove sites according various criteria compute matrices of distances according various methods and create sequence or matrix files usable by several softwares of phylogeny construction The available programs and the transfers of informations performed are shown in figure 2 The usage of each program will now be explained in detail Ill 2 Program FAST This program displays a pop up menu from which you can call the main programs of Management of Aligned Sequences without knowing the names of the different
30. e The search for possible common deletions positions where the presence of a gap or a blank is found more than 50 of the time SHAREGAP does not permit the modification of the alignment of sequences ED must be used to take advantage of the information supplied by SHAREGAP 111 12 8 1 Choice of the file of aligned sequences The first window of the SHAREGAP program displays the list of files of aligned sequences present in the lt MUST SEQ gt directories You choose the active file in yellow with Return The program displays the characteristics of the file and requests confirmation of the choice by Return before beginning the search for common deletions The name of the current systematic frame and the name of the file containing the names of species and their group name are displayed in the upper part of the window The names displayed correspond to those chosen during the last session of ED AFAS or SHAREGAP see complementary explanations in paragraph III 4 2 F3 gives access to the list of existing systematic frames to choose another The species will be arranged in the systematic frame in function of the group name associated with them in the file containing the species names F4 lets you change the file associating group names and species names do not give the path or the extension of the file name After calculation the program displays e The number of common deletions found e The number of sites with more than 50 of de
31. lll 12 1 The JACKMONO program 111 12 4 1 General information The DNABOOT program in the Felsenstein package constructs phylogenetic trees by parsimony Beginning from files in NET format JACKMONO creates files in DNABOOT or NJBOOT formats Starting from a pool of species belonging to different groups which are thought to be monophyletic JACKMONO generates an ensemble of all the species combinations possible in taking at random a single species per group One can thus study the impact of a species on a node Each combination is stored in a different for which a name is chosen as follows The name of the sequence file shortened to six characters An ordering number incremented with each file created A DBO extension for DNABOOT or NJB for NJBOOT Each DBO is associated with an NBS file see paragraph III 6 4 2 Since DNABOOT is a parsimony program you must detail the type of events that JACKMONO will take into account all events transversions only substitutions only In addition JACKMONO automatically eliminates all sites non informative for parsimony For NJBOOT also the type of events must be detailed 111 4 2 Utilisation The window of the JACKMONO program displays the list of sequence files in the active directories Choose the active file in yellow with Return The program then displays the characteristics of this file and asks you to confirm your choice with Return before launching the creation of all t
32. on the screen To generate the file OUT the NET program adds the following commands to the end of the file in HENNIG86 format with the extension HEN log lt nom de fichier gt OUT display HENNIG86 displays trees with the species names replaced by numbers AFT_HEN does the inverse In addition HENNIG86 does not give the branch lengths AFT HEN gives an arbitrary branch length of 1 AFT_HEN also creates one or several files of numbers of steps per position with the extension POS These files are created using the output obtained with the command xsteps c of HENNIG86 The result of this command must thus be placed in an OUT file AFT_HEN retrieves the exact value of the position and attributes to it the calculated number of steps see above Example of HEN file 71 MUST user s manual Version 1 0 Apr 03 mhenntg length 28 ER TL ori Oh Trees ABT HEN lit sequentiellementl 5i mhennig 0 7 seconds fichier il m morise la derni re ligne bb file 0 from mhennig 3 trees contenant lentgh pr sente avant le bb length 38 ci 71 ri 64 trees 3 5 PhO o cho ie premier arbre rencontr et associe tlist file 0 from bb 3 trees cette ligne l arbre De m me avec les arbres suivants tree 0 0 1 2 68 3457 tree 1 0 1 2 8 34 5 6 7 bree 2 0 1 2 8 6 34 5 7 tlist 0 1 seconds xsteps file 0 from bb 3 trees ree 0 length 38 ci 71 ri 64 haracte
33. on these fields In addition when the cursor is on the Free commentaries field F2 gives you access to a new window displaying in particular the article references in which the sequence has been published You can move within the window using the vertical displacement arrows and select any line by tapping Return An ordering number appears at the left of each line selected The selection is validated using F5 All the selected lines are then added to the Free commentaries field The F4 key lets you annul all selected lines at the same time To suppress the selection of a single line hit Return when that line is active Note that when the cursor is positioned on a line already written into Free commentaries the selected line in the aid furnished will replace the line marked by the cursor The fields Number of films and Characteristic of the organism are not displayed on screen but are completed automatically by the access number and the sequence mnemonic respectively These fields are displayed by the INFOBANK and MODIFSEQ programs and serve as a reference for the bibliographies of your articles 11 5 3 Choice of sequence portions After F5 validation of acquired fields the screen displays a selection of the portions of sequence to be extracted The sequences in an EMBL file are composed of the ensemble of nucleotides sequenced for example all of a chloroplast genome But generally one works on a given fragment coding sequence intron pse
34. sequence The current position is in yellow The program cuts to the left of that position To confirm the cut simply validate using Return the position is recorded and the cursor moves automatically to the level of the next reference sequence Escape will return you to the same list of similarities without recording the cut To advance to the next cut you must validate a position It is not possible to jump from cut to cut However there is another possible method you can jump a cut by using Escape This trick lets you eliminate domains which are not present in the gene you wish to cut 24 MUST user s manual Version 1 0 Apr 03 REMARK Because of the automatic displacement after validation of a position and the impossibility of moving along the cuts no corrections are possible For this reason be very prudent in your choices each validation of a cut is definitive When all the cuts have been traversed SAVECUT saves each domain in the corresponding aligned sequence file The program assumes that between two conserved domains there is a divergent domain It names this divergent domain using the letter D followed by the number of the preceding conserved domain If the gene begins with a divergent domain this one will be called DO ll 5 The EMBL program I1 5 1 Format EMBL It is also possible to archive sequences which come from the EMBL bank You need to have the sequence of interest in a file with the extension EMB in the form
35. species in the cloud of points using the option Choice of species of first group which displays the list of species Select the species which you wish to visualise movement using vertical arrows validation by Return Validate the list chosen with Escape All the points involving the chosen species will be in magenta on the graph The species thus selected will be integrated into the first group By choosing other species with the option Choice of species of second group you can limit the points displayed in color to species couples consisting of one species from each group For example you could visualise all species couples of type Aves Mammalia The selection of species is done as for the first group 111 11 4 Indices 4 indices are displayed above the graph R correlation coefficient 81 MUST user s manual Version 1 0 Apr 03 Standard deviation Fitch and Margoliash 1967 DS 100x pu nxa V2 Tateno s Indice Tateno et al 1982 nmo Eg 8 1 Farris Indice Farris 1972 FARRIS x dl d2 by Xle Ill 11 5 Printing Many options are available in menu form for the two printout modes proposed print into a file in Postscript language with F4 printout on a pin printer with F5 The choice of options is done in a similar manner in either case an upper frame displays the current printout choices and a lower frame lets you modify these choices by selection wi
36. type e Recording a file in NEIGHBOR JOINING format see chapter III 7 e Recording a file in FITCH format program of the PHYLIP ensemble e Creating files by a random JACKKNIFING of species see chapter III 6 4 5 files have a NEIGHBOR JOINING format e Displaying on the screen use the directional arrows and the keys PgUp PgDw Home and End to move along the matrix e Exit to a printer or record in the file of redirection see chapter III 6 5 65 MUST user s manual Version 1 0 Apr 03 REMARK if the matrix has more than 22 lines the direct output on the printer will be limited to the 22 first species to obtain the full printing of the matrix you must redirect the output towards the file NET OUT then print this file from the DOS environment The program proposes a filename for each output file This name is made as follows e name of the sequence file with the extension NET to which is added an ordering number e the ordering number corresponds to the order of the file creation it is preceded by a dash for the files numbered from 0 to 9 e if the name of the sequence file is longer than 6 characters it will be cut at that length It is possible however to enter a name of your choice by deleting with Backspace the proposed name then typing yours All files have automatically the extension MAT REMARK The calculation of matrices requires a lot of memory so the number of selected species is quite limited 1
37. 11 6 6 Positions One of the important functions of the MUST software lies in a simple management of positions in the aligned sequences Indeed as far as an alignment is not substantially modified adding a star in ED with Ins or destruction of a common deletion with SHAREGAP the positions given by the software correspond to the absolute positions in the initial file of aligned sequences The deletions common to a subset of species are suppressed but they are taken into account for the values of the positions This feature allows you 1 to use the same boundaries for two different selections of species so to build phylogenies using the same characters 2 to get after a parsimony program PAUP or PHYLIP the number of steps for a position and to know the absolute value of the position even if regions were eliminated with NET With the F7 function key you can save in a file with POS extension the values of the different criteria indices for each selected position the criteria indices are described in chapter 11I 6 3 The obtained files can be compared with the files resulting from the AFT_PHYL et AFT_HEN programs which calculate the number of steps of a site in a tree see chapters III 9 2 and III 9 4 111 6 7 Other options With the F6 key you can access to these options which are described in the following menu 66 MUST user s manual Version 1 0 Apr 03 Change of species order Choice of display of the identit Choi
38. 5 F6 the choice of different options F7 the usage of the positions It is possible to change the starting file with Shift F1 111 6 2 Choosing boundaries Use the F2 key to choose the sequence portions you want to delete the aligned sequences will then be displayed with 23 species and 60 characters at the most IIl 6 2 1 Display and movements If you want to see the species which are not displayed you can scroll the list of species by using the Up or Down arrows as well as the PgUp and PgDw keys As for ED it is useful to get a visual impression of the alignment 57 MUST user s manual Version 1 0 Apr 03 With the Right and Left arrows you move within the sequences and you can thus choose the sequence portion you want to visualise By combination with the Ctrl key you can move by steps of 30 characters With the Home and End keys you can move to the beginning and to the end of the sequences respectively IIl 6 2 2 Elimination of regions by stretch or character by character If you want to eliminate a region open a parenthesis while the cursor is at the beginning or the end of this region The current position will be set in red which means it is eliminated for the subsequent treatments Starting from this initial position as long as you do not close the parenthesis any movement of the cursor will eliminate a portion of sequence up to the most extreme position reached by the cursor Retracing the cursor ste
39. 67 11 TOTO 0 NJB Lote 24 11 TOTO 0 NJB 609 11 TOTO 0 NJB 367 11 TOTO 0 NJB Lee 24 11 TOTO 0 NJB It is necessary to add the symbol to the end of species names such that all names have the same number of characters This number must also be equal to the number of characters in the species names in the associated OUT file In addition in the case of NJBOOT the ensemble of OUT files which are studied together must be concatenated in a single joint file without extension In this file each OUT file must be separated from the precedent by a blank line JACKBOOT generates B00 files consisting of a series of lines each line must contain at least the following information the observed bootstrap value Mean the deduced bootstrap value Sites the ordering number for regrouping Nx The elementary name of the file with a period separating the name from the extension The number of sites and the filename must be separated by two periods Commentaries can be added to the file in this case the line must be preceded by the symbol A species list can be placed at the end of each line this would be the list of species associated with each bootstrap value 84 MUST user s manual Version 1 0 Apr 03 Example of a BOO file Raja montagui Raja radiata Mean 60 15 Sites 40 N1 t40 3 out Mean 96 94 Sites 20 N2 t20 4 out Mean 226 39 Sites 20 N3 t20 1 out Mean 424 71
40. AR Type Protein TITLE Myoglobin Amazon dolphin DATE 27 Nov 1985 Sequence 27 Nov 1985 Text 28 May 1986 PLACEMENT 428 0 12 0 1 0 20 0 50 SOURCE Inia geoffrensis Common name Amazon dolphin ACCESSION A02503 REFERENCE Sequence with experimental details Authors Dwulet F E Bogardt R A Jones B N Lehman L D Gurd F R N Journal Biochemistry 1975 14 5336 5343 COMMENT This myoglobin was isolated from skeletal muscle SUPERFAMILY Name globin KEYWORDS heme oxygen transport respiratory protein muscle SUMMARY Molecular weight 17071 Length 153 Checksum 1472 SEQUENCE 5 10 15 20 25 30 1GLSDGEWQOQOLVLNIWGKVEADLAGHGODVLIITI 31 RLFKGHPETLEKFODKFKHUKTEAE KAS ED 61 LKKHGNTVLTALGGILKKKGHHEAELKPLA 91 QOSHATKHKIPIKYLEFISEATIHVLAHS RHP 121GDFGADAQAA NKA F FRKDIAAKYKE LG 151 F HG Il 7 The MODIFSEQ program 11 7 1 Sequence recognition This program permits you to modify a sequence already archived but which contains errors or is incomplete either the sequence or the diverse associated comments 30 MUST user s manual Version 1 0 Apr 03 It is necessary to give the three keywords Molecule Domain and Identifier in order to determine within the base which sequence you wish to modify The F2 key can be used to give either the list of existing databases or the list of species archived for the type of molecule chosen to facilitate the search for an identifier in the list type in its initial see Il 4 3 The acquisition of a n
41. FAS ED and NET All the MUST programs which have a printout exit AFT_PAUP AFT_HEN and AFT_PHYL PAUP 2 4 NET DNAPENNY NET AFT_HEN AFT_PHYL and COMP_POS NET DNAPARS and PROTPARS AFT_PHYL GENBANK and SWISS NET PCFOLD The MAT and NI In the same way the PAU DBO P an NBS file EN HEN MLK MAC DEO ML 14 CLU INV and CLU files are associated with BM files form a pair they must be copied and moved together ALI NET 3 PRS MUST user s manual Version 1 0 Apr 03 1 8 8 BAK files These files can be in all directories belonging to the software except the current directory They contain a save of the previous version of the data files They can thus be destroyed by the user We strongly advise that this be done from time to time because they can take up a lot of room on the disk l 9 Indications on the architecture of the database 1 9 1 General information This section concerns you only if you have had an electrical failure at the moment a program was writing on the disk or if you have received a message of the FATAL ERROR type In these cases you may have to manually correct the contents of certain files to help you in this task a succinct description of the principle files is given below In case of problems begin by recuperating the lost files by executing the DOS command CHKDSK F From this point
42. GGCGTAA CTCAGGACGC TIGCGCTCAT CGCAGAACAG GGGTGGTGCC GCGGTTGGTG ATCCTGGTTG GACCGGTGGA GATGCGCGCG CACGAAGGGG AACATTTTGT TTGTTCTCTG TGAACTITTA GATGTGTTAA AGGCGGCGAA GAGTCCTCCT TGTIGGATTC TCTCTIGAAT TTCGCCCTIT If SAVESEQ finds E F L P or Q in the sequence it assumes a protein if not it assumes an nucleic acid It then verifies that the characters figure in one of the two following codes For nucleic acids For proteins A A A Ala C C C Cys G a G D Asp T U Ty O E Glu R A G Purine F Phe X C T Pyrimidine G Gly M Ay tC H His W A T I Ilu S C G K Lys K G T L Leu V Ay Cp G M Met H Ay Cy T N Asn D Ap Gy T P Pro B Cp Gy cL Q Gln N A C G T R Arg S Ser T Thr V Val W Trp DA fe Tyr 20 MUST user s manual Version 1 0 Apr 03 X undetermined If the program encounters unknown characters it proposes that they be transformed into X s This transformation is required for the remainder of the integration of the sequence If the user refuses the program aborts without saving the sequence We strongly recommend that you archive only sequences which have been precisely determined It is possible to modify stored sequences with the program MODIFSEQ but not simple 11 4 2 Molecule and Domain The program asks you to fill in a certain number of fields The fields Molecule Domain and Identifier are obligatory to save a sequence Apart fr
43. OOT NJBOOT and JACKBOOT Files of sequences in HENNIG86 format HENNIG86 Files of aligned sequences created by NET DNAINVAR NET in DNAINVAR format Files of sequences in MACCLADE or MACCLADE and PAUP 3 0 PAUP 3 0 formats Files of matrices of distances created by NET TREEPLOT NJ and NET or TREEPLOT COMP_MAT Files of aligned sequences created by NET DNAML NET in DNAML format Files of aligned sequences created by NET DNAMLK NET in DNAMLK format 13 MUST user s manual Version 1 0 Apr 03 Files Descriptions NBM Information concerning the treatments NET TREEPLOT NJ and NBR NBS NET OUT OUT PAU PEN POS PRS TRE k k done to create the files of matrices of distances Files in NBRF format Information concerning the treatments done to create the files of sequences Files of sequences usable by NET created by ED CAFAS and NET Redirection of an exit for printout Exit for programs PAUP HENNIG86 and PHYLIP Files of sequences in PAUP 2 4 format Files of aligned sequences created by NET in DNAPENNY format List of positions and associated values ex number of nucleotides at this position Files of aligned sequences created by NET in DNAPARS or PROTPARS formats Tree created by the PHYLIP programs Files in GENBANK and SWISS formats Files of raw sequences created by NET in PCFOLD format COMP_MAT NBRF NET AFT_PAUP AFR_HEN AFT_PHYL CA
44. STRIC OUT file 92 111 12 8 The SHAREGAP program 93 111 12 8 1 Choice of the file of aligned sequences 93 111 12 8 2 Suppression of common deletions 93 111 12 8 3 Search for possible common deletions 93 111 12 9 The AFT_CLUS program MUST user s manual Version 1 0 Apr 03 GENERAL INTRODUCTION l 1 Functions of MUST This ensemble of programs has two basic functions Database management which permits you to acquire and save non aligned sequences or raw sequences and to maintain their integrity in the files of non aligned sequences Management of aligned sequences begins with the files of aligned sequences and allows you to apply different treatments to the sequences leading to the construction of phylogenetic trees The user has the possibility to vary many parameters choice of species choice of sites etc In addition several modules aid in making critical analyses of data and inferences This group of programs has been conceived with user friendliness in mind They are written in C Microsoft 5 1 for any PC compatible computer with an EGA screen and a hard disk They are furnished in executable form To get an overall view of the software it is advisable to first read the article which describes it Nucleic Acids Research in press and read the documentation afterwards 1 1 1 Database management Database management is particularly useful for laboratori
45. Sites 40 N4 t40 2 out Other values can be added to the files without problems they will not be interpreted by the program Thus the file illustrated above could look like this Raja montagui Raja radiata Mean 60 15 Sites 40 Species 2 N1 t40 3 out Mean 96 94 Sites 20 Species 2 N2 t20 4 out Mean 226 39 Sites 20 Species 2 N3 t20 1 ou Mean 424 71 Sites 40 Species 2 N4 t40 2 ou ct ct 111 12 3 2 Utilisation of JACKBOOT 1 Choose the GRP file with the list of species using Return on the active file in yellow 2 Confirm the choice of file 3 Choose the desired option from the following menu Comparaison of observed and inferred BE for all nodes Comparaison of observed and inferred mean of BE Comparaison of observed and inferred corrected mean of BE Histogram of differences of observed and inferred means Histogram of differences of observed and inferred corrected means Histogram of differences of observed and inferred BE of all nodes 4 Acquire the name of the OUT file corresponding to the first file chosen or to the file concatenated for NJBOOT 5 Acquire the name of the output file which will take a BOO extension 85 MUST user s manual Version 1 0 Apr 03 111 12 4 The COMP_BOO program 111 12 4 1 Description of the display This program permits you to study the evolution of bootstrap values method measuring the solidity of a node
46. TREEPLOT format Many programs are used to construct phylogenies They require entry files of a particular format These files generated by NET cf Ill 6 4 3 are treated by their respective programs PHYLIP PAUP HENNIG86 Each construction program must furnish a file lt input file name gt OUT in its own format Utilities are included in MUST to make these output files uniform and so obtain one or several parenthesised trees usable by TREEPLOT These are described below The names of files of parenthesised trees created by these utilities are constructed in the following way e output file name OUT to which an ordering number is added if several files of trees are created e the ordering number corresponds to the order in which the files were created and is preceded by the underline symbol _ for files numbered from 0 to 9 e if the name of the output file has more than 6 characters it will be truncated to 6 e the file has an ARB extension The three utilities also require the information files NBS and NBM associated with files used by PHYLIP PAUP and HENNIG86 In addition AFT PHYL needs the file TRE to generate this last file automatically NET adds the option Y in the output file to the format of programs in the ensemble PHYLIP version 3 3 111 9 2 AFT_HEN This transforms an output file from the program HENNIG86 into a parenthesised tree file for TREEPLOT By default HENNIG86 gives only one display
47. The SAVECUT program The purpose of this program is to help the user divide a large gene into several domains For example the ribosomal RNA 23 28S LSU has been split into 20 domains 10 conserved and 10 variable in order to facilitate management and alignment see above To be able to use this program it is necessary to determine the conserved domains and to have the beginning and end sequences of highly conserved domains with very few gaps and around 20 characters These highly conserved sequences will then be used to search for the domain limits in new sequences to be archived The consensus sequences of domain limits for ribosomal RNA 28S are furnished in the lt MUST gt MUST DATA CUT files To optimise limit searches a consensus sequence has been determined for each of the three super kingdoms Eubacteria Archaebacteria and Eukaryota The sequences differ slightly between the three groups in practice it is possible but rather difficult to divide a eukaryotic gene with the sequences from Eubacteria SAVECUT lets you archive sequences which are in an ASCII file cutting the gene into several domains These sequences may have been acquired using ENTRYSEQ in that case they will be in the lt MUST gt MUST SEQUENCE BRU file You will need to know the name of the raw sequence file this is necessary to start the command SAVECUT lt filename gt You will also need a cut file corresponding to the molecule
48. The file ESPECE LST in the directory lt MUST gt MUST TYPEi contains on its first line the number of species archived for a given type of molecule then on the following lines the species names As above the order is fundamental since the information concerning the species is located in the file lt MUST gt MUST TYPEi SEQj j being the order number This file contains all the information in text mode preceded by a then the sequence on a line not beginning with a For example for the 28S C1 the file lt MUST gt MUST TYPEO ESPECE LST looks like this 2 Mus musculus Xenopus borealis And the file lt MUST gt MUST TYPEO SEQ1 contains all the information on Xenopus borealis as follows Molecule 28S Domain Cl Identifier Xenopus borealis Characteristic of the organism XEB28SRRNA Author s of the sequence Number of films X59733 Quality of the sequence A F B Reader s of sequence Archived Wednesday 4 August 1993 at 10 hours 6 Free commentaries Ajuh P M Heeney P A Maden B E and Edward H Xenopus borealis and Xenopus laevis 28S ribosomal DNA and its complete 40S ribosomal precursor RNA coding units of both species Proc R Soc Lond B Biol Sci 245 65 71 1991 UCAGACCUCAGAUCAGAC GUGGCGACCCGCUGAAUUUAAGCAUAUUACUAAGC GGAGGAAAAGAAAC UAACCAGGAUUCCCCCAGUAAC GGCGAGUGAAGAGGGAAGAGCCCAGCGCCGAAUC
49. Utilisation of MONO HIS Choose the current file in yellow by Return The program displays the commentary lines present in the file and asks for confirmation of the choice MONO_HIS displays a histogram of the ensemble of values in white If a list of species is associated with corresponding bootstrap values the sub histogram is displayed species by species in green The display on the screen represents 78 classes The following values are displayed above the histogram the second line represents the values of the ensembles of BE and the third line the values specific to the current species e on the first line the filename and the number of species e N total number of BE e MIN minimal BE value e MAX Maximum BE value e y mean value of BEs e Spread for type e spread between the two mean values The name of the current species is displayed in yellow above and to the right of the histogram This name appears only when a species list is associated with each BE value Diverse options are accessible using the keyboard Display of commentaries The lines of commentary at the beginning of a file preceded by the symbol are displayed with the F2 key Vertical scale of the histogram By default the program arranges the histogram so as to occupy the height available on the screen In order to compare several histograms it is useful to have a common vertical scale This operation is called using F3 the program as
50. according different options the number of informative sites and the number of variable sites e to the right one histogram representing one of the 4 criteria PRESENT1 is displayed as default histogram e on the last line the available functions Informative sites are defined on the basis of parsimony which means that an informative site has at least two different characters which are at least represented twice The variable sites are non constant sites e g with several different characters At the left of the main screen are displayed the number of removed sites for each criteria and the number of sites remaining into play This last value is of some importance since only the sites which are yet into play are taken into account for the writing of the output files and for the computing of the matrix of distance 56 MUST user s manual Version 1 0 Apr 03 Boundaries F3 Criteria number of species 15 HISTOGRAM OF PRESI F4 Sequence F5 Matrix F6 Option Seven functions are available through function keys F1 the help F2 the suppression of sequence portions by choosing boundaries cf III 6 2 F3 the suppression of sites using the criteria cf III 6 3 F4 the writing of output files with various format for use with other programs cf II1 6 4 F5 the writing of the matrix of distance cf III 6
51. alysis of bootstrap values Lecointre et al a et b 1 1 2 7 Critical analysis of homoplasy MUST user s manual Version 1 0 Apr 03 Philippe et al l 2 Writing conventions used in this manual C MUST Repertory name or filename SET MUST C MARIE DOS command line 2 File description Mus musculus Xenopus laevis INFOBANK Program name Shift Keystroke name a plus sign between two key names corresponds to a combination of keys which must be used at the same time Domain Keyword used in MUST REMARK Important remarks are also framed The figure shows the correspondence between the key names used in this manual and the names encountered on keyboards presently in use Names used in this manual MUST user s manual Version 1 0 Apr 03 Other names or symbols Alt ALT End EXD Fin Hose Origine Posi Py Ctrl CTRL CONT Controle Del Suppr DELETE DEL Ins Inser INSERT Insertion Return ENTER Entr e ENTREE eI Esc Escape ESCAPE ECHAP Echap Backspace BACE Retour arri re q Shift Maj A Pglp Fage haut j 1 PgDn Page bas i ll l 3 Installing the software on hard disk The installation of the MUST package requires at least 5Mo on a DOS unit To begin the installation simply insert the diskette MUST1 in the drive and type lt drivename gt SETMUST So if the diskette drive is A the command for installation is A SETMUST The program details all changes of disket
52. ame or code identifying the person doing the modification is obligatory 11 7 2 Change of molecule type This option corrects an error in the rubric type of molecule Molecule or Domain Once the sequence choice is made a window displays the ensemble of information available for that sequence You then choose the change of molecule type using F3 in lieu of validating by Return You can then choose the new molecule type from the list furnished However if the species already exists in the new type the program will refuse the change In this case you must either change the species name using MODIFSEQ or destroy the corresponding sequence with DELBANK REMARK This operation does not modify the aligned sequence files You have to use INTEGSEQ to incorporate the sequence whose molecule type you have altered and an editor to delete the sequence from its former file 11 7 3 Rubric modification Then without the operation affecting the aligned sequence files you can change Characteristic of the organism Author s of the sequence Number of films Quality of the sequence and Reader s of sequence If you change Identifier the program will automatically change this name in all aligned sequence files unless they are not in the proper format You must then put them in the needed format and correct the former Identifier yourself otherwise there will no longer be any correspondence between the sequence contained in the base and that in the alig
53. an arrow the F8 F9 et F10 keys manage node transfers between the tree and the sub trees Along all these operations of transfer the tree as well as the sub tree must keep at least 2 leaves F8 is used to insert the sister group of a sub tree into the latter F9 to transfer the uppermost daughter of a sub tree root into the tree while F10 transfers the lower daughter arbre sous arbre Monotremata Hannalia Edentata Chelonia Epitheria Crocodilia Marsupiala Aves Lepidosauria 45 MUST user s manual Version 1 0 Apr 03 Starting from the above configuration with Mammalia as the current node F9 will transfer the leaf Monotremata the uppermost daughter of the sub tree into the tree leading to the following configuration arbre sous arbre Hannalia Monotrema Edentata Theria Epitheria Chelonia Marsupiala Crocodilia Aves Lepidosauria Let s displace the current node from Mammalia to Theria arbre sous arbre Monotremata Edentata Theria JL srivneria Chelonia Marsupiala Crocodilia Aves Lepidosauria F10 will then transfer the leaf Marsupiala the lower daughter of the sub tree into the tree giving the following configuration arbre sous arbre Theria Monotremata Eutheria Marsupiala Chelonia Crocodilia Aves Lepidosauria Edentata Epitheria With F8 it is possible to reverse the process To transfer the sister group into the sub tree the current node has to be displaced to the lea
54. and LIS files are deletable using NET CAFAS and ED 1 8 5 MUST MUST TYPEi Descriptions Software database All programs called by USEB Information for the jth species of the ith All programs called by USEB database Each TYPEi directory corresponding to a database of sequences All these directories have the structure described below The files in these directories can be deleted by DELBANK 1 8 6 MUST SEQ Files of aligned sequences ED AFAS VERIFSEQ EMBL SAVESEQ MODIFSEQ and INTEGSEQ 12 MUST user s manual Version 1 0 Apr 03 1 8 7 Current working directory Several programs create files in the active directory the list of files likely to be found in that directory is given in the following table In order to conserve the readability of the MUST arborescence we advise that you create one or several work directories outside the arborescence REMARK These active directories can be anywhere on the disk or on a diskette Files Descriptions Files of aligned sequences in ED format NET AFAS and ED Trees usable for TREEPLOT NJ AFT_PAUP AFT_HEN AFT_PHYL TREEPLOT and NJBOOT Files of aligned sequences created by NET CLUSTAL NET in CLUSTAL format Files of aligned sequences created by NET DNABOOT NET in DNABOOT format Files of aligned sequences created by NET DNACOMP NET in DNACOMP format Files in EMBL format EMBL Description of the regroupings found by NJBOOT and JACKB
55. at described below For the EMBL program to operate this file can only contain one sequence WARNING Many sequence extraction programs concatenate all the sequences extracted into the same file It is then necessary to split this file into as many separate files as there are sequences The SPLITEMB program will do this for sequences pulled out of the EMBL bank see ll 6 1 ID GGHBBM standard RNA VRT 601 BP XX AC J00860 XX DT 02 DEC 1985 sequence correction DT 18 JUL 1985 incorporated XX DE Chicken hemoglobin beta chain mrna XX KW beta globin globin XX OS Gallus gallus chicken OC Eukaryota Metazoa Chordata Vertebrata Tetrapoda Aves OC Galliformes XX RN 1 bases 1 601 RA Richards R I Shine J Ullrich A Wells J R E Goodman H M RT Molecular cloning and sequence analysis of adult chicken beta RT globin cdna RL Nucleic Acids Res 7 1137 1146 1979 XX CC Formerly chkhbb compared with nbrf data XX FH Key Location Qualifiers FH FT CDS 52 495 FT note Beta globin message XX SQ Sequence 601 BP 135 A 202 C 148 G 116 T O other gctcagacct cctccgtacc gacagccaca cgctaccctc caaccgccgc catggtgcac tggactgctg aggagaagca gctcatcacc ggcctctggg gcaaggtcaa tgtggccgaa 25 tgtggggccg gcgtecktitg cacggcaaga aacaccttct ttcaggctcc actcctgaat cgcaagtacc cctgcagaaa MUST user s manual Version 1 0 Apr 03 aagccctggc ggaa
56. ated on Tuesday 1 December 1992 at 18 hours 56 Jackmono of 4 species in a total of 5 4 11 0 1000 0 Mus_musculus CGCCCCGCGCG Oryctolagus cuniculus XCX GGGAUA Homo sapiens CCCCCCCGGCA Xenopus laevis G GCCAUG Ill 8 2 Format of output files IIl 8 2 1 Major regroupings This file is named lt name of source file gt OUT Among the ensemble of regroupings determined NJBOOT selects the mutually exclusive ones For each ensemble of overlapping regroupings the one with the highest number of appearances is retained The regroupings are symbolised by a succession of points and stars the latter representing all the species belonging to the node under consideration The species are ordered as in the source file To the right of each regrouping the number of appearances the total number of characters and the name of the source file are displayed 69 MUST user s manual Version 1 0 Apr 03 Example gt TOTO 0 OUT Pears 822 11 TOTO 0 NJB Mus_musculus Oryctolagus cuniculus Homo sapiens Xenopus laevis 111 8 2 2 Parenthesised tree This file is named lt name of source file gt ARB This is a tree whose format respects the norms adopted on June 24 1986 by the Society for the study of evolution see chapter III 10 1 for a description of the format This tree can be visualised with TREEPLOT It is constructed using the major regroupings IIl 8 2 3 Regroupings present in more t
57. be set to a monochrome mode The modification is done by choosing the last option with F8 Choice of palette of colors p An 8 color choice is available the word EXAMPLE is displayed with the 8 possible colors that allows you to assess the utility of each color Each character has a default color This color code is represented by the list of characters to the right of the list of possible colors To modify the color of a character you have to move the yellow arrow at the level of the desired color To do so use the Up and Down arrows Then you just need to type the character which will be added to the current color list and deleted from the previous color list Modifications are validated by pressing F5 sequences are then displayed according 51 MUST user s manual Version 1 0 Apr 03 the new set of colors If you do not want to modify the color palette and keep the previous code you can exit this window by pressing Escape The blank character non sequenced site is not easy to represent it is displayed as an question mark on the background color IIl 4 4 3 Modification of the alignment You can modify the alignment in several ways by inserting a star or a space to the left of the current position into the sequence of the current species inserting with the Ins key one or several stars to the right of the current position into all the sequences of the file except into the current sequence This fun
58. calcul avec la m thode Neighbor Joining Mus_musculus 1 991875 Xenopus_laevis 1 994125 13 212914 Drosophila_melanog aster 20 867724 Caenorhabditis elegans 17 426275 1 356087 2 219244 Physarum_p olycephalum 27 000974 Euglena gracilis 27 842391 Trypanosoma_brucei 3 687273 C rithidia_fasciculata 2 819727 30 665610 9 815276 6 007036 2 907344 Saccharo myces cerevisiae 15 670047 Prorocentrum micans 12 954813 Tetrahymena thermophil S quences extraites du fichier CONSE28S cr par HP 76 MUST user s manual Version 1 0 Apr 03 a 14 863188 2 544453 0 561859 Oryza_sativa 3 350750 Citrus_limon 2 275250 13 369766 The lines beginning with an correspond to commentaries They must be placed at the beginning of the file All of the following lines are interpreted as the parenthesised description of the tree The tree must be presented in parenthesised form respecting the norms adopted June 24 1986 by the Society for the study of evolution It can be written over several lines Actually the carriage returns and spaces are eliminated during the reading of the tree The tree may be rooted or unrooted but must be strictly dichotomous If the tree is unrooted the program will choose the first species encountered as outgroup To obtain the complete identifier of a species you must separate the genus name from the species name by the underline symbol _ because
59. cctctc aagtgctcac cccaactgtc tgggtgacat gccaggctgc actaagcacc tgctccggag caggctgctg cagccccact ctcctttggg cgaactgcat cctcatcatt ctggcagaag agcaccaaag ctgacagctt atcgtctacc gccatccttg gatgctgtga tgtgacaagc gtcctggccg ctggtccgcg atcacggagc gtgacaaata cctggaccca gcaaccccat agaacctgga tgcatgtgga cccacttcag tggtggccca acctacaacc aagttcattc gaggttcttt ggtccgcgcc caacatcaag ccccgagaac caaggacttc tgccctggct attgcatgca agtgacactc a I1 5 2 Acquisition of characteristic sequence fields When you commence the EMBL program you can initially choose the file of interest among all the files in the current directory which have an EMB extension After file selection a screen comparable to that of SAVESEQ is displayed but with fewer rubrics and a supplementary window at the base of the screen In this window are displayed the text of the EMB file lines which begin with e KW if the cursor is on the fields Molecule and Domain OS and OC if the cursor is on the field dentifier e DE RN RA RT RL and CC if the cursor is on the Free commentaries field These concern information pulled from the EMB file which can provide aid in the acquisition of the diverse fields The rubric dentifier is completed automatically by the contents of the line beginning with OS The fields Molecule Domain and Identifier are obligatory to pursue the acquisition The F2 key offers the same functions as in SAVESEQ when the cursor is
60. ce of the PHYLIP version Calculation of relative level of GC Calculation of the frequencies of characters Change of printer type Redirect the output printer Ill 6 7 1 Changing the order of species The numbers between squared brackets indicate the current ordering number To change this order enter the new position to the left of the species you want to displace cancel with Backspace To suppress a species type 0 as new position CAUTION the program put back the removed sites as a function of the rate of X and of the criteria Moreover after validation the species is lost the only way to put it back is to reload the initial sequence file F2 activates the option to change the order see below the method F3 rearranges and comes back to the main window of NET To exit the window without rearranging you must use the Escape key the program will not take into account the ordering numbers which were entered However this last possibility cannot cancel a change of order already validated by F2 To rearrange species the program starts to place the numbered species then it fills up the empty places with the remaining species respecting the initial increasing order For example 6 1 Aa gives then 1 Bb 2 Bb 2 Cc 2 Cec 2 33 exe 3 Dad 4 Dd 4 Ee 4 Ee A ISJE e CSN EE 6 F 6 Aa 6 Aa 8 7 Gg 7 Hh 8 Hh 8 G g 8 Gg
61. ceeeeeeeeeeeeeeeeeees 50 Ill 4 4 Sequence alignment 51 IIl 4 4 1 Display and movement 51 H1 44 2 Color palettes acer teas tiens finite 51 IIl 4 4 3 Modification of the alignment 52 Ill 4 4 4 CONSENSUS SEQUENCES cccceceeeeeeeeeeeeeeeeeeeeeeees 52 IIl 4 4 5 Saving the modifications 53 IIl 4 4 5 Printing the sequences 53 IIl 4 5 Writing the sequences in a file 1 0 00 eeeeeeeeeeeeeeeeeeeeeeeeees 54 IIl 5 Programs AFAS CAFAS and DAFAS ccccccccsceeeseseeeeeeeeeeeeeeeees 54 III 5 1 Advantages and drawbacks of this set of programs 54 IIl 5 2 Preparing the files AFAS cccsscssseesseeeceeeeeeeeeeeeeeeeeees 54 Ill 5 3 Extracting sequences CAFAS ccssecteeeteeeeeeeeeeeeeeees 55 III 5 4 Management of the prepared files DAFAS 56 LEGO Program NET a tence de E 56 IIl 6 1 Description of the main window 56 IIl 6 2 Choosing boundaries cee eee eeeeeceeeeeeeeteeeaeeeeeeeeeeeeeeees 57 I11 6 2 1 Display and movements 57 I1 6 2 2 Elimination of regions by stretch or character by CHAPAGI R SSI ce Ur ee ie eae Peer erry 58 IIl 6 2 3 Eliminating sites as a function of the rate of non sequenced species of missequenced characters or of gaps TT anda al see Dak
62. ces during the choice of boundaries identical characters can be replaced by a dash The choice of printout of removed regions depending on the choice of boundaries if the choice is validated the symbol _ is added above the regions removed The printout can be directed towards the printer or towards the NET OUT file you can aslo redirect the printout using the F6 key cf III 6 7 5 The default printout file will contain control characters specific to most matrix printers so that it is also possible to obtain an ASCII printout compatible with non matrix printers These options are available in the following menu Ch Ch Ch Ch Ch Ch Printing of sequences ange of number of blocs ange of length of identifiers oice of printing of the positions oice of replacement of characters by dash ange of printer type oice of printing the regions removed due to the boundaries p Redirect the output printer 111 6 4 6 Other formats PHYLIP format Felsenstein Besides the strict parsimony options the ensemble of PHYLIP programs includes other programs with their own formats DNAML and DNAMLK maximum of likelihood DNACOMP method of compatibility DNAINVAR Lake s evolving parsimony 64 MUST user s manual Version 1 0 Apr 03 CLUKIM format for the calculation of matrices of distances Recording without deletions e PCFOLD Zucker for the determ
63. ction is interesting since it does not modify the existing alignment deleting a star or a blank either to the right of the current position with the Del key or to the left with the Backspace key deleting with the Shift F2 keys all the blanks and stars to the right of the current position up to the next nucleotide or amino acid Ill 4 4 4 Consensus sequences As described above it can be interesting to modify the alignment on a consensus sequence for one or several groups With ED you can build ensembles which can contain any number of species between 1 and 200 For each of these ensembles you will have the choice to display either all the sequences of the group or only the consensus sequence The latter is determined by searching at each position for the character which is the most represented The usage frequency of this character is displayed according the following color code bright white 100 light magenta more than 90 light cyan between 80 and 90 light green between 70 and 80 yellow between 60 and 70 light red between 50 and 60 red less than 50 The first time you choose your species the ensemble 1 is automatically built Then to create new ensembles you have to use F3 when the current window is displaying the consensus sequence The management of the ensembles is done with the F2 key by which you can modify the composition of an existing ensemble with the F6 key by which you can delete a ens
64. dering number corresponds to the order of creation of the files it will be preceded by an underline character _ for the files numbered from 0 to 9 e if the sequence filename is longer than 6 characters it will be cut at that length It is possible however to enter a name of your choice by deleting with Backspace the proposed name then typing yours REMARK others formats will be furnished upon request III 6 4 2 File NBS A file which contains informations pertinent to the ensemble of species is associated to the output files This file with the extension NBS is required for the programs creating parenthesed trees AFT_PAUP AFT_HEN AFT_PHYL It contains the breakdown of all 61 MUST user s manual Version 1 0 Apr 03 operations which were made starting from the aligned sequence file it allows you to know what really is contained in the final file Example of file NBS Sequences extracted from file VAN3 created by van on Tuesday April 9 1991 at 13 26 file title catzef File EX NET created on Sunday December 8 1991 at 21 22 File NBS created on Saturday May 30 1992 at 15 25 Type of parsimony All the events BOUNDARIES 136 147 182 189 209 209 432 435 458 520 575 625 669 678 774 1015 19 eliminated sites car CODON _ 2 00 3 00 _ 1 00 3 00 It remains 41 positions from the 60 selected positions total 238 List of the 21 species in use Protopterus dulli Ambystoma ca
65. determine the position of a particular stretch of nucleotides in the sequences of the file In the first case simply enter the following order after the DOS prompt RESTRIC TOTO ALI where TOTO ALT is the file of aligned sequences The program will search display the results on the screen go to the next page using Return and store these results in the file RESTRIC OUT In the second case you must specify the motif to be recognised by entering the following command after the DOS prompt RESTRIC TGCAGT TOTO ALI where TOTO ALLT is the file of aligned sequences and TGCAGT the motif sought 111 12 7 2 The ENZYME RES file The ENZYME RES contains the following name of the enzyme bases recognised by the enzyme You must place this information in two lines Example Eco RI GAATTC Eco RV GATATC Sma I Xma I Ava I CCCGGG Not I GCGGCCGC Hind III AAGCTT 91 MUST user s manual Version 1 0 Apr 03 111 12 7 3 The RESTRIC OUT file This is the exit file for the program RESTRIC It is generated automatically For each enzyme it gives the list of species containing the restriction site and between parentheses the position within the sequence It also furnishes the motif recognised RESTRIC accepts the indetermineds of sequencage whatever the letter of indertermination see code in chapter II 4 1 At the end of the file a
66. e group with just one operation e the internal alignment of a group remains unchanged However the use of groups during the alignment process is not bias proof Since the user creates groups according a pre established knowledge the alignment is not objective the user introduces into the alignment an imprint of the result he expects to rediscover This risk is a real one and to my knowledge the only way to solve this conflict consists in using NET to exclude rigorously the regions of ticklish alignment 47 MUST user s manual Version 1 0 Apr 03 Ill 4 2 Choosing the file of aligned sequences The first window of the program ED displays the list of the files of aligned sequences which are present in the directory lt MUST SEQ gt Pressing Return will select the current file yellow color The program will display the specs of this file and ask your choice to be confirmed before going on the step of choosing the species In the upper part of the window are displayed the name of the current systematic frame and the name of the file which contains the species names and their group name The names on display are those which were chosen during the last session of ED AFAS or SHAREGAP they are stored in the file lt MUST gt MUST DATA AFAS REF If this file does not contain any name of current systematic frame or if it does not exist the default systematic frame is the first in the list of systematic frames If so you will have to ente
67. e keyword ID as filename then gives the file an EMB extension If the identifier has more than 8 characters a period is inserted after the eighth character with the remainder of the identifier serving as the file extension If the identifier has more than 11 characters the extension is truncated to three characters REMARK since the EMBL program does not recognise files without an EMB extension those files with an identifier of fewer than 8 characters must be renamed so as to have this extension SPLITGEN works in the same way as SPLITEMB with the first keyword recognising a sequence being LOCUS REMARK since the formats of files from the EMBL and SWISSPROT banks are compatible the SPLITEMB program can also treat primary files extracted from SWISS PROT 11 6 2 The EMBLCUT program This archives sequences from the EMBL bank cutting the gene into several domains The sequence of interest must be in a file formatted for EMBL EMB for which the format is described in chapter Il 5 as well as a cut file corresponding to the molecule type The format of this latter CUT is described in chapter II 5 1 The usage of EMBLCUT is two step e the extraction of the sequence in a manner comparable to the extraction in EMBL e the determination of limits of conserved domains in a manner comparable to that in SAVECUT cf II 5 2 11 6 3 The GENBANK program This will archive sequences which come from the GENBANK It is su
68. e selection completed two functions are available 39 MUST user s manual Version 1 0 Apr 03 e F3 will continue with the program NET CAFAS will automatically format the file for NET with the extension NET e Shift F3 allows you to write the file NET without continuing with the program NET Ill 5 4 Management of the prepared files DAFAS To delete or rename a file which was prepared by AFAS you have to use the program DAFAS This program displays the list of the files which have the CAFAS format Pressing Return will choose the current file and the program prompts you for deletion Del key or renaming F2 key lll 6 Program NET This program works on the files contained in the current directory and which have the extension NET created by the programs ED or CAFAS You can choose a file among them Return will select the current file displayed in yellow color Once you confirmed your choice the main window is displayed Numerous functions are available from this window you can e choose the portions of sequences you want to use e remove the sites according various criteria e compute the distances on the selected positions e format the data for use with several software Ill 6 1 Description of the main window Once you chose a file the window presented above is displayed on the screen e on the first line the name of the file and the number of existing species e to the left the number of sites which are removed
69. e tna an aka edhe Re Tuan rain et tee panes 58 IIl 6 2 4 Elimination of regions by entering the boundary values Be E echo ea Ae Mae Nal ae ee eae De 59 I11 6 2 5 Saving chosen boundaries 59 Ill 6 2 6 Display ODtiIONS suite in ra 59 I11 6 3 Use of the criteria 60 IIl 6 4 Formatting of sequences 61 I11 6 4 1 General comments 61 W634 2 File NBS menant nee 61 Il 6 4 3 ParSiMoONy s sea ina dernmn tei aietenedels ene 62 I 6 4 4 Jackknif sssieshe inner dteetee na 63 IIl 6 4 5 Printing of the aligned sequences 64 I1 6 4 6 Other formats 64 IIl 6 5 Matrices of distance 65 IAG 6 POSION Snin a mean anes TT 66 ll 6 7 Other optiOnS sicing aa 67 IIl 6 7 1 Changing the order of species 67 IIl 6 7 2 Choice of the presentation of the identifier 67 IIl 6 7 3 Choice of the version of PHYLIP eee 68 IIl 6 7 4 Level of GC 2 vies oni nine en er At 68 IIl 6 7 5 Frequency of characters 68 ill MUST user s manual Version 1 0 Apr 03 LEGS F6 PAIN a ne ictus 68 UP The NJ program RM nin nent 69 Ill 8 The NIBOOT prOdFanr s element 69 I11 8 1 Format of entry file 69 I1 8 2 Format of output files 69 I11 8 2 1 Major regroupings 69 I11 8 2 2 Parenthesised tree
70. e you gave to the root of your tree That is this name which appears in the list of the systematic frames during the modification phase The root cannot have any sister group To enlarge your tree you must locate the cursor on one of the 2 Groups the 2 first leaves of your tree The following of the creation is done the same way as in the previous chapter Ill 3 3 Management of the sub trees One complication occurs because the screen can only contains 25 lines Thus it is not possible to have more than 23 leaves on one screen However the user often needs to have more than 23 leaves in a cladogram It is necessary to have sub trees For example the cladogram of the Metazoa includes a sub tree in which the phylogeny of Deuterostomata is detailed Here a sub tree is a leaf taxon for which a daughter sub tree is available on another screen There are different methods to manage sub trees If the cursor is on an internal node F7 transforms this node into a leaf of the current tree and put the daughter sub tree into a new sub tree if the cursor is on a leaf F7 creates a new sub tree and asks you for the names of the two first leaves of this tree The reverse operation i e the integration of a sub tree inside the tree is done using Shift F7 provided that the total number of leaves of the resulting tree do not exceed 23 In a tree which contains sub trees if the cursor is on a node leading to a sub tree node name followed by
71. ectly on the aligned sequences or by using indices of variability for example one may keep only ditypic this is a completely unknown word have no idea MUST user s manual Version 1 0 Apr 03 what the English spelling is but it looks wrong to me sites as suggested by Nanney You can also format the sequences or matrices of distances so as to be usable by different programs of phylogeny construction DNAPARS DNABOOT FITCH etc of the PHYLIP PACKAGE of Felsenstein PAUP from D Swofford HENNIG86 of J Farris CLUKIM CLUSTAL and CLUNJ of D Higgins PCFOLD from M Zuker 1 1 2 4 Visualisation of dendrograms and comparison of matrices The program TREEPLOT lets you visualise and print out the phylogenies obtained under dendrogram form in placing the root at any point and in pivoting the species around the nodes as you wish The program COMP_MAT visualises in a plane two matrices of distances The two matrices may be calculated from two different molecules or two different methods only transitions only transversions Jukes and Cantor etc or also from a tree This program lets you verify quickly whether the information contained in the two matrices is comparable and to visualise and evaluate the impact of a pair of species a single species or a group of species on that comparison You can also visualise the saturation curve of substitutions in comparing the number of observed differences with the number of substitutions infer
72. ed for Molecule Domain Species or Group The choice is made by selection from the lists validate using Return on the current element in yellow For the last two options the program searches in lt MUST gt MUST DATA AFAS REF for the name of the active file in lt MUST gt MUST DATA NOM or that of the active systematic frame For the last option it determines the ensemble of species belonging to the group you have chosen among those contained in the lt MUST gt MUST DATA NOM file which is active It displays these data on the screen and then gives you the possibility to print them The default file is INFOBANK OUT but you can redirect it to the printer by using F3 11 11 2 The DELBANK program This is useful only if you have made a grave error creating two bases with the same name the only difference being a upper or lower case letter indeed the keywords take account of the difference in capitalisation It lets you destroy an entire database as well as a given species for a molecule type You choose the item to be deleted from those in the lists validate the choice of the current element in yellow by using Return The program displays information on the data selected Molecule Domain Identifier number of species date of creation etc and requests confirmation before performing the deletion 35 MUST user s manual Version 1 0 Apr 03 11 11 3 The SAVEBANK program This program will save all or par
73. emble and with the F4 key which switches the display between the consensus sequence and all the sequences of the ensemble 52 MUST user s manual Version 1 0 Apr 03 REMARK The program will not issue any warning if you use the same species into different ensembles This will affect the pertinence of the color comparisons between groups Care should be taken in the choice of the species which constitute the ensembles When the consensus sequence alignment is modified all the sequences in the ensemble are affected in the same way Thus when a star is added to the consensus sequence all the sequences will have an added star at that position Note that you cannot delete a star in a consensus sequence unless all the species have a star or a space at that position Therefore you can delete a white star from a consensus sequence since this color indicates a 100 consensus However you can delete a non white star from a consensus sequence if the position contains only blanks and stars IIl 4 4 5 Saving the modifications F5 will save all the modifications made to the alignment since the beginning of the session even on sequences which are not displayed anymore During the saving the old file of aligned sequences is renamed with an extension BAK for example lt MUST gt SEQ TOTO ALI will be renamed lt MUST gt SEQ TOTO BAK and the new alignment will be in lt MUST gt SEQ TOTO ALI Ill 4 4 5 Printing the sequences F8 will
74. ence Since it is easier to align sequences which are not too different ED is able to construct a sub group of species from the group of the available sequences and to edit it without taking into account the gaps common to all species of this sub group In this way you have a much better view of the alignment However if you add a star in a species sequence the previously shared gaps will no longer be in common and will be displayed even though there were no displayed gaps on the previous screen The position of the current character is expressed as an absolute value for the whole group of species contained in the file Current position values are displayed at the bottom left of the screen and do not increase linearly since the common gaps are not displayed The absence of value indicates a common gap which is not displayed To align more divergent sequences ED offers the use of consensus sequences This way you can first align species inside two groups then align these two groups using for each only one sequence The consensus sequences are displayed using a color code which reflects the strength of the consensus you just need to align the high consensus regions in the two groups since if a group does not contain any consensus it does not make sense to try to align with a more distant group Two major advantages for using consensus sequences e in case a group contains a very large number of species you can modify the alignment of the whol
75. equested Jackknifing by systematic addition or removal of species You can study exhaustively the impact of all species on a tree First you must choose some species from the list furnished e g n species chosen among the m presented You can then choose between e using F2 the program will create a file which contains all of the chosen species plus a species taken from the m n remaining species e using F3 the program will create a file containing all the species chosen minus one In either case a file in DNABOOT format is created for all possible combinations Jackknifing of sites 63 MUST user s manual Version 1 0 Apr 03 Bootstrap values do not increase linearly in function of the number of sites the value may even raise when sites are removed Choose two parameters the number of randomly chosen sites n the number of samplings N For each sampling the program will create a DNABOOT file containing a random choice of n sites The ensemble of species is conserved in each file IIl 6 4 5 Printing of the aligned sequences Several ee options are available Printing of aligned sequences with the options specified in the upper window A block constitutes10 sites and it is possible to change the number of blocks printed per line The length of the identifiers in italic can be modified The absolutes positions can be printed if the user desires In order to obtain a printout comparable to the display of sequen
76. ercentage above the sequences The nucleotides identical between the two consensus sequences are represented by a dash The site is highlighted by writing the two nucleotides on a blue background The value of the position is displayed below the sequences It is not possible to move along the sequences you can only go from one site to the next by using Return Printing For each site it is possible to obtain a hard copy of the output or to direct it to a file redirect the exit using F5 on the preceding window The output has the following format e name of file of aligned sequences date and time of printing e list of species without a gap at the given position with mention of group name e the consensus sequence of the preceding species e the consensus sequence of species with a deletion Since a color code was not usable to specify the consensus value this value is represented by a number The number corresponds to the lower limit of each consensus value Thus a value of 9 corresponds to a consensus between 90 and 99 The absence of a number signifies a consensus value of 100 111 12 9 The AFT_CLUS program CLUSTAL1 is a program of alignment of sequences NET furnishes a file with the entry format of CLUSTAL1 CcCLU CLUSTAL1 generates three files named OUT1 OUT2 and ouT4 This last file contains the aligned sequences AFT_CLUS transforms the file of aligned sequences OUT4 into a file usable by ED It makes the following
77. ermining the readability of the sequence give a letter from A to E One can use the following type of codage A gt no reading problems B gt few reading problems C gt numerous reading problems but clearly readable sections D gt nearly no readable sections and E gt nothing 34 MUST user s manual Version 1 0 Apr 03 To move within the menu for archiving films use the up and down arrows Return and Tab to go to the following field and Shift Tab to go to the preceding field You can also destroy a line by using Shift F2 It is possible to modify a film or to recopy it particularly in the case of a reexposure where only the qualities change However it is not possible to destroy a film except by going directly into the file where it is stocked see below You can make various searches on the ensemble of films archived film species species and a primer species and an extract species an extract and a primer a primer between 2 dates c searching between 2 dates for all species in the archives Archiving Searching Searching f Searching f g 3 T g O O EEK gt FH FH FH HE O BK D 0 Searchi Searchin Systemat Searchin O KS Searching for all films in the archives Coping a film which is in the archives Modification of a film which is in the archives For a search between two dates if you wish to make a search without giv
78. ertical line When printing a single histogram you choose to print uniquely the general histogram However when you choose two histograms the printout is a superimposition of the general histogram on the histogram of the current species This option is available only when a list of species is associated to each bootstrap value When you change the maximum number of values per class you change also the vertical scale of the diagram see above Printing on a matrix printer The exit file is sent directly to the printer using F6 When a list of species is associated with each bootstrap value MONO_HIS offers to print either the global histogram and the current histogram or the global histogram alone Display of sub histograms You can review the ensemble of sub histograms species by species using the horizontal arrows The characteristic values associated to the current species are displayed above the histograms This function is available only when a list of species is associated with each bootstrap value 111 12 6 The COMP_POS program The NET AFT_PHYL and AFT_HEN programs generate files of positions with a POS extension in which for each position retained you give either an index value or the number of steps The COMP_POS program does a direct comparison of the values contained in the files of positions This comparison can be made between positions within a tree or those in different trees The module permits comparison by repr
79. es which produce sequences to use in constructing phylogenies A good many errors usually occur first in reading the autoradiogram then in entering the sequence on the computer The Program ENTRYSEQ minimises these errors by requiring that the new sequence be entered TWO times independently We advise that two different people read the film then enter the sequence Also the comparison of a new sequence with those of other species often points out specific nucleotides as questionable when they differ much too much from the consensus sequence or from that of the closest species In this case it is often necessary to recount runs of the same nucleotide since four G s can easily be interpreted as being three or five It also happens that a sequence must be redone to be sure the information is valid or to confirm a sequence which is difficult to interpret on gel Whatever the case the program MODIFSEQ allows modification of a sequence already archived In addition since many interesting sequences are furnished by international databanks several programs EMBL GENBANK etc allow you to easily incorporate sequences or parts of sequences contained in a file in the format of the international databanks into the database of MUST These programs archive at the same time the mnemonic the access number and the references of articles in which the sequence has been published This information is thus easy to consult in writing an article Files
80. esenting the values on a graph as in COMP_MAT 89 MUST user s manual Version 1 0 Apr 03 IIl 12 6 1 Method of comparison used You choose two files of positions two successive validations using Return on the active file For the comparison the program takes the two values of a position and makes all possible combinations of pairs of values To draw the graph use the plan in which each axis represents the values of a file of positions Each pair of positions is displayed within the plan by placing the two values of the position on the two axes The regression line is shown in yellow The correlation coefficient is displayed above and to the left You can display the information associated with each file of position on the X and Y axes respectively with the F2 and F3 keys Ill 12 6 2 Options available Printing the graph It is possible to direct the graph towards a matrix printer using F5 The F4 key lets you direct the exit file for COMP_POS OUT towards the printer and the contrary Beneath the graph a menu offers three options validation by Return on the active option in yellow Display of each position Write the differences into a file POS Write one kind of positions into a file Visualisation of positions This option displays the list of positions The percentage displayed corresponds represented by the distance at the right of that position with respect to the grea
81. f which leads to the sub tree Ill 3 4 Management of the files of systematic frame It is possible to destroy or to copy a systematic frame To do so you just select in the first MAKETREE screen the box Modification of existing systematic frame then choose and activate a systematic frame The Del key will destroy it while the Ins key will copy it To work on different computers you must know that the systematic frames are archived in the directory lt MUSTEXE gt MUSTEXE The file SYSTEME LST contains the list of 46 MUST user s manual Version 1 0 Apr 03 the names of the systematic frames and the files SYSO SYS1 etc contain the systematic frames themselves One needs only to copy these files on the different computers lll 4 Program ED Ill 4 1 General introduction This program is specifically designed to edit aligned sequences by modifying the alignment but not the sequences by themselves ED displays the aligned sequences this way the characters of the first sequence are explicitly displayed in the following sequences they are represented by an hyphen if they are identical to those of the first sequence and are explicit if they are different In this program two peculiar characters are used a star for a gap and a space or blank for a non sequenced part these two characters are always explicitly displayed even if they are identical to those of the first sequ
82. fficient to have the sequence of interest in a file with the format described below There must not be more than one sequence in the file REMARK Many programs for sequence extraction from sequence banks concatenate all the sequences extracted into the same file Thus it is necessary to split the primary extraction file into as many files as there 28 MUST user s manual Version 1 0 Apr 03 are sequences The SPLITGEN program will do this job for sequences pulled from GENBANK see 11 6 1 LOCUS CHKAGLBD 426 bp ds DNA VRT 15 DEC 1988 DEFINITION Chicken alpha globin D gene complete cds ACCESSION M15378 KEYWORDS alpha globin globin SOURCE Chicken nonanemic reticulocte DNA clone lambda C alpha G2 7 ORGANISM Gallus domesticus Eukaryota Animalia Metazoa Chordata Vertebrata Aves Neornithes Neognathae Galliformes Phasianidae Gallus domesticus REFERENCE 1 bases 1 to 426 AUTHORS Dodgson J B McCune K C Rusling D J Krust A and Engel J D TITLE Adult chicken alpha globin genes alpha A and alpha D No anemic shock alpha globin exists in domestic chickens JOURNAL Proc Natl Acad Sci U S A 78 5998 6002 1981 STANDARD simple staff entry FEATURES Location Qualifiers CDS 1 426 note alpha globin D BASE COUNT 91 a 120 c 121 g 91 t 3 others ORIGIN Unreported 1 atgctgactg ccgaggacaa gaagctcatc cagcaggcct gggagaaggc cgcttcccac 61 caggaggagt t
83. frame species are automatically sorted in alphabetical order If you do not want to sort the species use F8 to set the unsorted mode In this case you cannot concatenate files you just can access to the transformation via F3 The prepared files are in the directory lt MUST gt MUST ALI For each preparation two files are created one with the extension INF and the other with the extension ALI The file INF is write protected DOS command ATTRIB R TOTO ALTI and contains all the informations The file ALI contains only the aligned sequences REMARK The file ALI is not created in the ED format but in a more complex oneonly readable by CAFAS Ill 5 3 Extracting sequences CAFAS To extract sequences by choosing of species you need to use the program CAFAS It displays the list of the prepared files You choose the current prepared file yellow color with Return The program displays the informations which were entered during the preparation stage and prompts to confirm your choice Then the program acts like ED for the choice of the species functions described in paragraph IlII 4 3 List of the functions e F2 selects all the species e F4 changes the frame e F5 displays the list of the selected species e F6 lists the species contained in the cupboard group e F7 archives the current selection e F8 loads an archived selection e F9 searches for species using the beginning of their name Once the sequenc
84. from the programs of the PHYLIP package into a parenthesised tree file usable by TREEPLOT The option Y added by NET to the output file in PHYLIP format is needed for PHYLIP to write the tree into a file with the extension TRE Besides the files NBS and NBM AFT_PHYL thus requires the file TRE The PHYLIP program truncates species names to 10 characters AFT PHYL replaces these by the complete name AFT_HEN also creates a file of positions with the extension POS using the ouT file generated by the programs DNAPARS and DNAPENNY Example of a TRE file Oryza_sati Citrus_lim Fragaria_a Lycopersic Sinapis al Arabidopsi P rorocentr Dictyostel Physarum_p Oryza_sati Citrus_lim Fragaria_a Sinapis_al Lycopersic Arabidopsi P rorocentr Dictyostel Physarum_p 75 MUST user s manual Version 1 0 Apr 03 Oryza sati Citrus lim Fragaria a Sinapis al Lycopersic Arabidopsi P rorocentr Dictyostel Physarum p Example of the parenthesised tree obtained S quences extraites du fichier BP1 F4 cr par bp le Dimanche 9 F vrier 1992 12 heures 48 dont le titre est tmp Fichier TOTO NET cr le Dimanche 9 F vrier 1992 13 heures 4 Fichier TOTO O NBS cr le Lundi 8 Juin 1992 18 heures 57 Type de parcimonie Tous les v nements 203 sites limin s car PRESENT2 _ 2 00 2 00 _ 1 00 2 00 Il reste 24 positions sur les
85. g number disappears It is also possible to search for a species by typing the beginning of its name followed by the F9 key this feature is useful when the group contains more than 23 species limit of a full screen ED lists all species which start with these characters For instance if you type Mu the program will display Mucor racemosus et Mus musculus The selection of the species is done and undone the same way as above IIl 4 3 2 Choosing a group of species Press F2 will select all the species of the current group whatever it is a leaf or a node That can speed up establishing a list of species so long as you know which species are contained in a file When displayed you can also select the whole list of species of a group by pressing F2 IIl 4 3 3 Cupboard group If a species does not have its name in the file containing the species names or if its group name does not exist in the chosen frame this species is not associated to a group of the frame In this case it will be put in a particular group the Cupboard group F6 will access all the species of this group and the selection is done as in any other group Ill 4 3 4 Correction of the list of selected species F5 displays the list of species already selected and you can modify the ordering number of the species in this list This is a practical fast way to visualise the selection result and to verify it Numbers between square brackets indicate the current ordering numbers
86. gram SAVESEQ directly see below 11 3 1 Sequence acquisition This program is used to acquire nucleic acid or protein sequences By default it is configured in the acquisition of nucleic acids mode Use F2 to pass from one mode to the other The code is indicated by the letter used The program asks you to enter the sequence two separate times REMARK We recommend that two people work together on this one reading the films and the other entering the sequence then reversing roles for the second entry Each acquisition is done simply by using the alphabetic keys of the keyboard The acquisition is validated by using the Return key with the program asking for confirmation 11 3 2 Correction of acquired sequences After the second entry is validated the program compares the two entries and indicates differences between them The second sequence is displayed below the first with identical characters indicated by dashes The current element is displayed in yellow The only possible writing mode is insertion To replace a character remove it using Backspace or Delete then insert the new character The insertion of a new element occurs to the left of the current one Use the vertical displacement arrows to pass from one sequence to the other The horizontal displacement arrows let you travel along the sequence depressing Ctrl at the same time lets you move quickly in jumps of 30 characters The sequence cannot be definitively va
87. han 1 of samplings This file is named lt name of source file gt GRP It is the ensemble of regroupings which appeared in more than 1 of the replicates classed in descending order The description of each line is the same as for the file of major regroupings Example 800 11 TOTO 0 NJB 185 11 TOTO 0 NJB Lee 15 11 TOTO 0 NJB Ill 8 3 Utilisation of NJBOOT The NJBOOT program is very simple to use You choose the current file in yellow with Return NJBOOT displays a description of the chosen file and requests a validation with Return During its run NJBOOT displays a count of the number of random samplings done with respect to the total number of samplings expected generally 1000 NJBOOT generates a file in TREEPLOT format to which you have direct access by F2 It is useful to be able to automatically run a series of NJBOOT especially after an ensemble of formatting with JACKMONO To do so simply use the following DOS command or f in NJB do NJBOOT f NJBOOT then treats all files with the extension NJB in the current directory The only constraint is that the file of the parenthesised tree not exist or be older than the corresponding source file NJB If this is not the case NJBOOT will not treat this file 70 MUST user s manual Version 1 0 Apr 03 I11 9 Recuperation of outputs from programs of phylogenetic construction 111 9 1 Transformation to
88. he combinations possible The program displays temporarily the number of combinations made The name of the current systematic frame and the name of the file containing the species names and their group name are displayed in the upper part of the window The displayed names correspond to those chosen during the last session of ED AFAS or SHAREGAP see paragraph III 4 2 for complementary explanations 83 MUST user s manual Version 1 0 Apr 03 F3 gives access to the list of existing systematic frames in order to choose another F4 allows you to change the file associating species names and group names do not give either the path or the extension of the filename 111 12 2 The AFT_EXT program 111 12 3 The JACKBOOT program 111 12 3 1 General information This program prepares files usable by the COMP_BOO and MONO HIS programs from flies obtained with the DNABOOT or NJBOOT programs These prepared files contain the bootstrap values for the ensemble of species deduced from the values obtained for a sub ensemble of species Before using JACKBOOT it is necessary to add the list of species followed by a blank line to the beginning of the GRP file created by DNABOOT or NJBOOT This addition must be made manually using a text editor Example of a file in JACKBOOT format Mus musculus _ _ _ Oryctolagus cuniculus Homo sapiens _ _ _ _ _ _ Xenopus_laevis 609 11 TOTO 0 NJB 3
89. he cursor is on a leaf 77 MUST user s manual Version 1 0 Apr 03 111 10 2 3 Weight of the lower branch It is possible to modify the respective lengths of direct daughter branches of the root Whatever the position of the cursor the F4 key permits this modification to be made By default each branch has a weight of 50 After an explanation of this function you specify the weight in percentage from 0 100 which will be assigned to the lower daughter branch Thus a weight of 10 corresponds to a long upper branch 90 of the sum of the two branch lengths and a short lower branch 10 of the same sum The inverse is true if you acquire a value of 90 IlIl 10 3 Matrix of distances It is also possible to calculate the matrix of distances which corresponds to the tree e g patristic distances or estimated distances This has the format described for the program NJ By default the name of the file containing the matrix is lt name of source file gt MAT Thus starting from the file TOTO 0 ARB one obtains the matrix file TOTO 0 MAT However this name can be modified by the user efface using Backspace and type the new name in The order of species in the matrix corresponds to that of the tree in beginning from the top of the screen This function is available using F6 78 MUST user s manual Version 1 0 Apr 03 111 10 4 Output to printer I1 10 4 1 Matrix printers Using F5 one obtains a printout of the tree di
90. ify the exit point of the program when it s not optimal for example to correct printing codes on exit printers in text mode e you can work on a computer not connected to a printer and transfer on diskette what you wish to print onto a computer connected to a printer The default configuration is not necessarily an exit onto a printer check each program description for more details 1 7 2 Postscript printers For the programs TREEPLOT MONO_HIS COMP_MAT and COMP_BOO it is possible to obtain a print file in Postscript format This file contains commands in Postscript language which can be modified to adjust the final printout To print the file simply use the print command for the system of your machine applied to the Postscript file Some examples in DOS print TOTO PS in UNIX lpr TOTO PS with TOTO PS the file to be printed MUST user s manual Version 1 0 Apr 03 The impression is configured for a sheet to sheet printer using pages 21 cm by 29 7 cm The printout options differ depending on the program check each program description 10 MUST user s manual Version 1 0 Apr 03 l 8 Summary of files used by MUST 1 8 1 MUSTEXE MUSTEXE Descriptions Software Help files of the call menus MUST USEB and FAST Executable programs All Help files All Matrices of similarities for amino acids NET and NJBOOT Systematic frames created by MAKETREE ED AFAS MAKETREE CAFAS SHAREGAP JACKMONO The
91. ile using F4 or return to the list of files with an EMB extension using F5 Within that list you can discard unwanted files with the Del key WARNING no confirmation is requested before deletion of these files ll 6 Other extraction programs These programs function in the same manner as EMBL However the programs SWISS and NBRF permit neither the extraction of sequence portions nor sequence transformations 11 6 1 The SPLITEMB and SPLITGEN programs These programs are anterior to all programs which allow the transformation of sequences extracted from a sequence bank into a sequence usable by MUST Many programs for extraction concatenate into a single file all sequences extracted from a sequence bank But the transformation software furnished in MUST can only work with files 27 MUST user s manual Version 1 0 Apr 03 containing a single sequence Therefore it is necessary to split the primary extraction file into as many files as there are sequences The SPLITEMB and SPLITGEN programs do this job SPLITEMB splits extraction files in the format of the EMBL bank It searches for the keyword ID at the beginning of the line This keyword indicates to the program that a new sequence has begun To determine the end of the sequence the program seeks the keyword SPLITEMB creates a file with the ensemble of characters between these two keywords To name the new file the program takes the sequence identifier the word which follows th
92. ile using Return The program reads the first two lines of the file in order to know Molecule and Domain When these do not exist in the database the user is alerted There is nothing to prevent one from having an aligned sequence file for a molecule type without entering it in the archives it is however necessary to keep two lines beginning with at the start of the file for the group of programs in the MUST package When the two variables are present in the database VERIFSEQ will read all sequences contained in the file Two cases can then be found e the species does not exist in the database indicated at the beginning of the file the program communicates this fact but nothing prevents one from having unentered species in a file where there are entered species e the species is in the base the program will compare the reference sequence to that in the file If at least one difference is found the aligned sequence containing an error is placed in Commentaries by adding a before the sequence and the reference sequence placed just below it in the ALT file the program displays the two sequences on the screen as follows REFERENCE GAAGGCGTAA CTCAGGACGC TTGCGCTCAT CGCAGAACAG 33 MUST user s manual Version 1 0 Apr 03 WRONG C Finally the program displays as information all species in the corresponding database which are not present in this fi
93. ination of secondary structures of RNA e CLUSTAL1 Higgins for automatic alignment of sequences there is also a program which transforms a CLUSTAL exit file into ED format see AFT_CLUS in chapter III 12 9 e NEC P7 prints only the sequences without the deletions Recording in ED format l Recording in NET format See the corresponding paragraphs Recording in NJBOOT format l Ill 6 5 Matrices of distance Use the F5 key to calculate the matrices of distance which correspond to your sequences Nucleic acids The program starts first to calculate all the differences for each pair of species You must choose among the different types of measuring distances Return will validate the current element in yellow color You have the choice between the various combinations of events transition transversion and deletion and between KIMURA s formula and the one of JUKES and CANTOR Proteins You choose directly among the different types of measuring distances Return will validate the current element in yellow color You have the choice between 5 types e Boolean any difference 1 e Miyata hydrophoby and encumbrance e Hydropathy index Kyte amp Doolittle e Similarity of structures II Risler e Log odds matrix Dayhoff The program displays a warning if calculation results in null distances Output format After the program has calculated the matrix of distance it automatically goes on with the choice of the output
94. ing beginning and end dates tap Escape when the dates are requested Finally you should know that the archiving is done in the lt MUST gt MUST DATA FILM file which is write protected by the DOS command ATTRIB R lt MUST gt MUST DATA FILM Within this file each film is archived on a single line each field being separated by a tabulation Example GL34 1 8 1989 Myxine glutinosa 3 Qu g32P C2 c B This file must be edited directly if you wish to destroy a film Similarly in case of serious problems you can consult this file Each time a film is modified the former version is kept in the file lt MUST gt MUST DATA FILM BAK Finally to save simply copy the file onto a diskette Note that it is not easy to work on several different computers since this file must be transported each time 11 13 The TRANSLAT program This program lets you translate DNA or RNA sequences into proteins It offers the possibility to choose the genetic code utilised with the F4 key It works from raw sequence files ADN located in the current directory or aligned sequence files ALT in the directory lt MUST gt SEQ You pass from one type of file to the other by using F3 38 MUST user s manual Version 1 0 Apr 03 Choose a file to be translated from the list proposed validation of the current element in yellow using Return For files of aligned sequences the exit file is located in the directory lt
95. ks for the number of units likely to use the maximum height In raising this number you will diminish the size of the peaks Boundaries of bootstrap values By default MONO_HIS displays the histogram using the bootstrap values between 0 and 1000 these limit values can be modified with F4 88 MUST user s manual Version 1 0 Apr 03 Postscript files A file in Postscript is generated using the F5 key This file can be printed on any printer using Postscript Several printing options are available in a scrolling menu Printing of diagram Choice of the name of file Choice title Choice of the number of diagrams per page Choice of the number of intervals Choice of the printing of 1 or 2 histograms Change of maximal number of values per class The size of a diagram varies in function of the maximum number of diagrams per page The unit size of a diagram is calculated for optimal use of the page To print several diagrams on the same page simply give the same file name as long as there is space on the page the program will place diagrams successively from left to right in the case of six diagrams per page and from top to bottom The number of intervals is the total number of divisions along the BE axis It can be interesting to modify this number to refine the disposition of the BEs or during reduction of the width of a histogram so that each peak is not a simple v
96. le If there are modifications necessary in the file the program renames the old version from lt NAME gt ALI to lt NAME gt BAK and titles the corrected file lt NAME gt ALT If a file is not in the right format the program indicates this as clearly as possible Since the modifications are initially done in a temporary file if errors are detected VERIFSEQ does not recopy the temporary file and corrections previously found are not saved Il 9 The INTEGSEQ program This program lets you search for a single sequence which has already been archived You must initially give the two keywords Molecule and Domain manually or by using F2 which furnishes the list of molecule types The dentifier field is then accessible and F2 will then give the list of possible identifiers After validation by Return the program displays all the rubrics acquired during archiving Confirm your choice with Return You can then choose from the list of available ALI files or create a new file with F3 The sequence is then integrated into the ALT file of your choice If the chosen sequence already exists in the ALT file the program does not indicate this Using F4 you can choose another species to integrate without having to recall the fields Molecule and Domain 11 10 The INTEGALL program This program lets you update a file of aligned sequences by adding to it all the saved species not yet in the file You
97. letions It is then possible to choose between the two following options using Return e Suppress the deletions in common e Display the sites of possible common deletions IIl 12 8 2 Suppression of common deletions This is a simple elimination of positions where a common deletion exists The file of aligned sequences is rewritten in removing these positions A save is done to a file with a BAK extension I11 12 8 3 Search for possible common deletions The display of sites where the presence of a gap or blank is found in more than 50 of the sequences lets you visualise some surprising placements of deletions Notably one can find the following case 93 MUST user s manual Version 1 0 Apr 03 AX A A A A where the suppression of deletions is evident Description of the display window The choice of this option opens a window which displays e consensus sequence representing the ensemble of species with a nucleotide at the level of the site visualised e A second consensus sequence grouping the species with a gap or a blank at that site e To the right of each sequence the number of species and of groups constituting each consensus sequence e In the upper part of the window the list of species not having a gap at that position this list is in the order of the file of aligned sequences and not in taxonomic order A color code is used to highlight the consensus value for each site this code is displayed in p
98. lidated using Return until the two sequences are identical 11 3 3 End of the program After validation the program displays a menu with several functions For many people it is easier to read films in the direction 3 gt 5 but conventionally they are used in the 5 gt 3 direction So the program offers you the possibility to invert the acquired sequence It is also possible to generate the complementary sequence of DNA or RNA as such or inverted Example If the sequence entered is ACGTT depending on the option chosen the sequence archived will be 19 MUST user s manual Version 1 0 Apr 03 ACGTT if option Leave the sequence as it is TTGCA if option Invert the sequence AACGT if option Take the fragment of complementary ADN as it is TGCAA if option Take the fragment of complementary ADN and invert LE REMARK The program SAVESEQ is then automatically activated if there is some problem the sequence will be saved in the file lt MUST gt MUST SEQUENCE BRU ll 4 The SAVESEQ Program Il 4 1 General information You can also call SAVESEQ directly to archive a sequence contained in a file simply type at the DOS prompt SAVESEQ lt name of file containing sequence gt The file should consist only of sequence and spacing characters The blanks and line shifts placed in the sequence are automatically eliminated by the program For example a file might look like this GAA
99. liforniense Ambystoma tigrinum Pleurodeles waltl Rana esculenta Typhlonectes compressicauda Xenopus laevis Homo sapiens acaca mulatta Pan _ troglodytes Cricetus sp us musculus Rattus_rattus Bos primigenius taurus Sus_scrofa Equus_caballus Lacerta_lepida Natrix viperina Anas_platyrhynchos Columba_palombus Gallus_gallus 19 eliminated sites car CODON 2200 3 00 _ I 1 00 3 00 12 50 105 161 176 207 226 247 286 295 305 372 394 444 453 535 556 654 737 List of the 41 retained positions 20 48 72 86 126 1 50 155 162 174 179 198 206 208 237 240 257 267 292 293 299 303 319 369 377 393 395 440 449 451 456 457 521 536 538 558 567 648 653 661 751 762 Ill 6 4 3 Parsimony Several parsimony programs exist but they often require files having a particular format NET writes on disk the file with the appropriate format for each of the following programs Among all the programs PHYLIP Felsenstein several are parsimony programs e DNAPARS e DNAPENNY exhaustive research for all the trees DNABOOT bootstrap by parsimony PROTPARS parsimony for the protein sequences Others programs use also parsimony e PAUP Swofford Version 2 4 or 3 0 e The format MACCLADE is identical to the format PAUP 3 0 e REDUCSEQ Swofford Version 2 4 1 e HENNIG86 Farris 62 MUST user s manual Version 1 0 Apr 03 For all the programs listed above you have to precise what types of events you want to keep e all the events transitions
100. mes to 8 characters AFT_PAUP replaces these by the complete name Example of PAU file KKK KEK KKK KK KK KK KK KK KK KKK KE XK PAUP Version 2 4 1 Tllinois Natural History Survey OH F F HF F F HF 73 MUST user s manual Version 1 0 Apr 03 06 08 92 18359213 KKK KKK KKK KKK KK KKKK KKK KKK KKK Version du Lundi 8 Juin 1992 18 heures 58 KEKE KKK KKKKKKKKKK KK Analysis No 1 KKEKKKKKKKKKKKKKKKKK Option settings INO Hats Sls nl tice ane ts 9 NGHAR Su tes seen Ss See 24 UsS r tree s dii eieo ees NO APANC sis annees ee N rs a ADD SHO she dis sente ae oe CLOSEST HOLD te pate Sea nee ere oaks 1 SWAP eee de ere eure wile cal end ee GLOBAL WE PAR Sis ite lenge St re ee ee cele NO ORT Sas eee ma arte eset Me ee N A ROOTS ose sue GE sent dr oe jetons ee ANCESTOR Weights applied NO OQUTWI DDH site ia E a a bt sae ls 80 issing data code if IAXTREE acid de it ewewe eda N A All characters are unordered Branch lengths and linkages for unrooted tree no 1 Connected Branch Node to node length Dictyost 2 16 4 000 Prorocen 3 15 5 000 Arabidop 4 13 0 000 Citrus Ti 2 10 0 000 Fragaria 6 11 1 000 Lycopers 7 12 1 000 Sinapis 8 10 0 000 Oryza sa 9 14 4 000 10 11 0 000 TT 12 0 000 12 13 0 000 13 14 1 000 14 15 6 000 15 16 8 000 16 Physarum 1 8 000 Statistics for tree no 1 Length 38 000
101. meters Thus it is not very difficult to improve an automatic alignment of sequences Olsen and Woese 1993 The program ED lets you edit aligned sequences and ameliorate an alignment by eye using diverse visualisation options in particular dashes for identical nucleotides and calculation and display of consensus sequences of subgroups of sequences 1 1 2 2 Choosing representative species The second parameter is the choice of species considered as representative of a group Of course the user has already made a preliminary choice in making the sequences However to build a phylogeny he or she generally draws samples from among the ensemble of available species The program CAFAS facilitates such sampling by visualising the current phylogenetic information in cladogram form Then the user chooses his samples explicitly in function of the point to be tested Also this systematic frame allows you to verify the quality of the samples chosen by displaying for each group the number of available sequences and the number of sequences selected 1 1 2 3 Choosing which regions to use The third parameter is the choice of regions of sequences to be used Not only is it necessary to exclude the regions where alignment is dubious it is also possible to retire regions which do not evolve at a rate adequate with respect to the problem posed in particular those which evolve too rapidly The program NET lets you eliminate these regions either dir
102. modifications e the program CLUSTAL1 shortens the species names to 15 characters AFT_CLUS replaces them by the complete names e CLUSTAL1 symbolises gaps by dashes AFT_CLUS replaces them with stars 94 MUST user s manual Version 1 0 Apr 03 e it concatenates the sequences The file of aligned sequences in ED format is generated in the directory lt MUST gt SEQ It has an ALI extension Its name is that of the entry file for CLUSTAL1 Example of OUT4 file Gap fixed 10 Gap vary 10 Anacystis nidul CTGTACCCTAAACCGACACAGGTGGGACGGTAGAGTATACCAAGGGGCGCGAGGTAACTC Bacillus subtil CCGTACCGCAAACCGTCACAGGTAGGCGAGGAGAGAATCCTAAGGTGATCGAGAGAACTC Leptospira inte CCGTACCGCAAACCGACACAGGTAGGCAAGTAGAGAATACTAAGGTGTTCGAGATAACTC Pirellula marin CCGTACTA AAACTGACACAGGTAGGTAGGTCGAGTAGACCAAGGCGCTCGGGAGAACAG kK KKKK KKKK Ok KKKKKKK KK KKK Kk KKKK x Kk x KKK Anacystis nidul TCTCTAAGGAACTCGGCA Bacillus subtil TCGTTAAGGAACTCGGCA Leptospira inte TCGTTAAGGAACTCGGCA Pirellula marin TGGTTAAGGAACTCTGCA KKKKKKKKKK KKK Below the sequences stars symbolise the characters identical for all the species Utilisation of AFT CLUS Simply enter the following command after the DOS prompt APT CLUS lt file gt CLU where file is the name of the entry file for CLUSTAL1 AFT_CLUS also proposes the transformation of T s to U s 95 LITERATURE CITED Olsen G J and CR Woese 1993 Ribosomal RNA
103. nal node located immediately to the left e f the cursor is on the root of the sub tree pressing the Left Arrow key will display the preceding tree Right Arrow key e This key is only used to display a sub tree when the cursor is on a leaf for which the name is followed by a right arrow PgUp key e This key moves the cursor quicker by step of 4 making in one press the same move as if the Up Arrow key had been used 4 times PgDw key e This key moves the cursor quicker by step of 4 making in one press the same move as if the Down Arrow key had been used 4 times NOTE when the cursor is on an internal node the name of this node is displayed up left of the tree This name refers to the taxon which contains all the downstream nodes and leaves IIl 3 1 2 Adding a sister group The F2 key creates a new internal node between the node the cursor is on and its mother node or upstream node The new node is created with the minimal distance apart the two branches For example if the current node is the leaf Aves the display changes from Mammalia Aves Mammalia Chelonia Crocodilia Aves to by F2 and 43 MUST user s manual Version 1 0 Apr 03 of new node Archosauria f new group Crocodilia and if the current name is the internal node Archosauria the display changes from Archosauria Mammalia Chelonia Crocodilia Aves to Diapsida Mammalia Chelonia Crocodilia Aves
104. nce sequence The suppression of the current character is done using the key Suppr that of the preceding character with Backspace In the case of deletions the suppressed characters also appear on a red background It is possible to insert a fragment of sequence using the Ins key following the same procedure as in ENTRYSEQ that is two independent acquisitions of the segment to be added and the possibility of inversion at the end of the acquisition Modifications to the ensemble of the sequence You can also acquire the sequence anew independently using F6 the program will make the same comparison as in ENTRYSEQ Finally it is possible e to invert the sequence using Shift F1 e to obtain the complementary DNA sequence with Shift F2 e to transform the T s into U s with Shift F3 e to transform the U s into T s with Shift F4 The final three options being obviously available for sequences of nucleic acids not of proteins For all the preceding cases the modifications are included in the reference sequence and the characters changed do not appear against red Validation or cancellation of modifications Once all modifications have been made validate your work with F5 since the program will request this confirmation of modifications before passing to the next phase You can then enter a comment on the operations performed Even if no comment is entered a second F5 validation is necessary 32 MUST user s manual Version 1 0
105. ned sequence files 11 7 4 Modification of sequence Visualisation of the sequence In the center of the screen the sequence is displayed twice The first display in white is the reference sequence that is the sequence presently archived which makes the modifications evident The second in yellow is the zone of acquisition it is in this sequence that modifications can be made The cursor is positioned on this second sequence and you have no access to the first one Movement along the sequence If you want to modify the sequence you can move within it in order to find the zone s to be modified either by using the displacement arrows or by searching for a subsequence with F2 In this case you must then give the subsequence and the program will seek it to the right of the current position and if it is found place you at its beginning 31 MUST user s manual Version 1 0 Apr 03 F3 lets you repeat the search for the same motif to the right of the current position and F4 to the left Replacement insertion or deletion of characters The modifications are done in insertion mode to the left of the current cursor position To replace a character you must therefore delete the former character then insert the new one or vice versa All replacements are visualised in the reference sequence by displaying the former character on a red background In the case of an insertion of character an empty red space is inserted in the refere
106. nt directory You choose a file by validating Return the active file in yellow If 68 MUST user s manual Version 1 0 Apr 03 the format is not good for the program in particular the FITCH format a message will alert you window then displays information on the file of sequences and on the matrix you must confirm the choice with Return The principal advantage of the NEIGHBOR JOINING method is its extreme rapidity The program generates a file containing a parenthesised tree This file has the same name as that containing the matrix but with the extension ARB To visualise the tree you must pass through the TREEPLOT program see chapter III 9 To do so use F2 which gives access to a list of programs and choose the option TREEPLOT lll 8 The NJBOOT program This program calculates a consensus tree of the major regroupings according to the bootstrap algorithm with the tree being constructed by the NEIGHBOR JOINING method The main advantage of NJBOOT is its speed Ill 8 1 Format of entry file This file with an NJB extension is created by NET or JACKMONO It consists of e a commentary retracing the different steps leading to creation of the file e aline of numbers number of species length of the sequence type of sequence number of random samplings type of distance e the list of the species and the sequences Example Sequences extracted from 18SAA ALI of the 20 July 1992 at 15 hours 4 File TOTO NET cre
107. ntain the files of aligned sequences prepared by the program AFAS see below The directory PIERRE MUST DATA must contain the files with the names of species and groups the files of films the files of boundaries and the files of species list see below The directory PIERRE SEQ must contain the files of aligned sequences see below Suppose that the directories P ERRE and MAR E are created directly in the root of disk C when Pierre wants to work he initialises MUST by typing in DOS SET MUST C PIERRE and the software MUST will work with the data in the directory C PIERRE It s the same process for Marie who initialises the variable MUST by SET MUST C MARIE 11 4 2 Creation of a new working directory During the installation an initial work directory is automatically created Afterwards if Jean creates his work environment without using the installation program SETMUST he has to create his own network for example J these steps EAN in the directory D USER by following 1 Put himself in the directory from which one creates the new network in our example the directory D US T ER E 2 create the work directory by the command DOS makedir 3 create the ensemble of the arborescence using the following commands md JEAN cd JEAN md SEQ md MUST cd MUST md ALI md DATA MUST user s manual Ve
108. of couples of species To trace the graph one uses a plan in which each axis represents the distances for a matrix Each species couple is positioned within the plan by placing respectively the values of the two distances on the two axes The comparison of the matrices is done by visual evaluation of a cloud of points The regression line is displayed in yellow You can refine the comparison by playing with the following options displayed in menu form below the graph Choice of species of first group Choice of species of second group Display of the pairs of species You can display the information associated with each matrix using the F2 and F3 keys 111 11 2 Visualisation of the species couples When Display of the pairs of species is activated the list of species couples is displayed with the percentages Each percentage represents the distance which separates the point considered perpendicularly from the regression line calculated as a percentage of the longest distance You can move within the list using the vertical arrows and PgUp PgDw Home and End It is thus possible to identify each point because of the green spot which appears when a species couple is activated Escape returns you to the preceding menu This option is very useful in spotting which species couples correspond to abnormal points 111 11 3 Choice of species It is also possible to visualise the distribution of one or several
109. oint corresponding to the current file is visualised as a green point Display of mean values For each value of site number this option displays the mean Value of the bootstraps This mean is seen as a yellow point Printout on a matrix printer The graph can be printed according to several options The launching of a printout displays in the upper frame the present configuration stored in the file MUST DATA COMP BOO SYS Using the central menu you can modify one or several options 86 e Choice of e Choice of e Change in e Choice of MUST user s manual Version 1 0 Apr 03 f the X and Y values printing The program will take the minimal and maximal values to limit the axes in addition it divides the X axis in 3 equal parts and the Y axis in 4 equal parts This often results in decimal values During printing it can thus be useful to have different values than those displayed on the screen the mean values printing the size of the squares 15 is a good standard value the frame printing in addition to equal partitioning of X and Y axes an upper horizontal line and a vertical line can be printed so that the graph is enclosed in a frame e Change in the type of printer the choice offered only permits you to dictate the number of pins of the printer e Redirection of the output printer the printout can be directed towards a matrix printer or the file COMP_BOO OUT
110. om the rubric Free Commentaries the other fields will assume a default value if you do not assign one or E for Quality of the sequence For the fields Molecule and Domain F2 will give you the list of existing databases You choose the active base in yellow using Return If you wish to create a new type of molecule simply fill in the fields Molecule and Domain a window will appear proposing the following three options This database does not exist in the unit lt MUST gt to choose from the list of existing database to correct the name you just have entered to create this new database You should go to the third option and validate with Return ll 4 3 Identifier To fill the field Identifier you can again use the F2 key which will display the list of species contained in one of the files with the extension NAME in the lt MUST gt MUST DATA directory This file is obligatory It contains the list of names of species which you use as well as their group names cf below This file can have a large number of lines 1600 maximum according to the following format lt genus name gt lt species name gt lt various characteristics gt lt group name gt EXAMPLE Mus musculus Rodentia Xenopus laevis_17 Lissamphibia Species names must be in alphabetical order in the file if necessary use the DOS command SORT to alphabetise All new species archived must have its name in this file When there a
111. on the architecture must be reconstructed either in renaming the files with the BAK extension for example by the DOS command rename ESPECE BAK ESPECE LST or in writing the files yourself to recuperate the proper format for this you must use an editor which permits a save in ASCII format ATTENTION It is important to note that the files lt MUST gt MUST TYPEi SEQj contain all the information necessary to define the sequence present in the file All these files are write protected In addition each time a MUST program modifies a file it renames the former file by giving it the extension BAK for example TYPEMOL BAK ESPECE BAK or SEQ12 BAk then it writes the new file 1 9 2 File descriptions In the directory lt MUST gt MUST the file TYPEMOL LST contains on the first line the number of types of molecules then a line following with lt Molecule 0 gt then a line with lt Domain 0 gt etc For example 2 number of types 288 Molecule 0 GT Domain 0 288 Molecule 1 15 MUST user s manual Version 1 0 Apr 03 D1 Domain 1 The order in which the types of molecules are listed is fundamental since it determines in which directory the corresponding sequences are located this is the directory lt MUST gt MUST TYPEi i being the molecule order number For example the sequences for 28S C1 are in the directory lt MUST gt MUST TYPEO Cd
112. or two purposes first to search for the films corresponding to a species when one wishes to verify the sequence and secondly to aid in the search for sources of experimental problems For example to determine the possible causes of a problem one can easily determine which probe was used between two given dates or which method of extracting DNA or RNA was used for a given sequence The name or number of each film must be indicated for example GL34 and the date given on which the sequence was produced We advise that when a gel is reexposed in autoradiography the same code be given to the film with an R or RR added for example GL34R and GL34RR Then you can archive up to 16 groups of four lanes each by filling in the following fields Species name Ext Technique Prim Mi Myxine glutinosa 3 Qu g32P C2 C w O with the following remarks e Species name which should be in a file containing the names of species in the directory lt MUST gt MUST DATA see above e Ext field containing the extraction number for the species one can extract DNA or RNA more than once for a single species and the products may not all be of the same quality e Prim field indicating the name of the primer i e probe or primer with which one has sequenced e Mi field indicating the length of migration for this sample S gt Short L gt Long TL gt Very Long TT gt Very very long etc e Q quality of the ensemble of four lanes det
113. ors check each program for specifics but you will find the following colors in all programs e bright yellow active datum e light blue keys to use to continue through the program e white label characterising a datum MUST user s manual Version 1 0 Apr 03 e light green datum properly so called e red window title l 7 Printing results 1 7 1 Matrix printers Many programs have printout options In most cases the printout is in text mode workable on the majority of matrix printers Certain non matrix printers can also do the job However in the present version printouts in graphic mode require the use of a printer with 8 9 or 24 pins REMARK Because of the diversity of printing codes used by the manufacturers even with a pin printer we can t guarantee that you will be able to print out graphics MUST has no special error management to indicate lack of a printer When the computer is not connected to a printer a DOS error message comparable to the following will appear surimposed on the screen check your DOS manual to resolve the problem Erreur d criture criture sur unit PRN Abort Retry Ignore Fail The programs can redirect this printout toward a file called lt program name gt OUT thus the program VERISEQ would route to VERISEQ OUT This possibility offers three major advantages e especially to economise paper since quite often one reads a printout only once and throws it out e to mod
114. print the aligned sequences with all the modifications which were done Species will be printed in the order they were selected 1st species of the 1st ensemble 2nd species of the 1st ensemble 1st species of the 274 ensemble etc and not in the way they are displayed on the screen When you press the F7 key 2 frames are displayed the upper frame displays the printing parameters the lower frame gives the choice to print the file using the parameters displayed in the upper frame or to modify individually each of these parameters The following menu Printing of sequences Change of number of blocs Change ength of identifiers Choice b gt printing of the positions Choice replacement of characters by a dash O O oi O Change of printer type allows you to modify e the number of nucleotides per block e the length of identifiers which are always printed in italic e the printing of the positions displayed vertically above the sequences e the replacement of nucleotides by dashes e the printer type 53 MUST user s manual Version 1 0 Apr 03 REMARKS As on the screen the displayed positions are the real positions inside the file and not the positions in the alignment of a sub ensemble of species in which the deletions due to others species have disappeared F7 does not print the consensus sequences Ill 4 5 Writing the sequences in a file The key
115. problems of weighing and coding for the parsimony method Gaps are represented by stars or by dollar signs When you are choosing the boundaries it can be useful to quickly remove such regions With the F5 key you can selectively eliminate sites as a function of one of three possibilities described above the following menu offers you to choose the type of elimination Elimination of non sequenced sites for all the species X Elimination of sites containing gaps Elimination of sites containing undetermined characters RYMWSKVHDBN X 58 MUST user s manual Version 1 0 Apr 03 The program computes for each position the species frequency which corresponds to the chosen type of elimination and then indicates the number of positions for which this frequency is equal or superior to several threshold values of frequency 0 1 2 3 4 5 10 25 50 75 and 99 If you choose the value 0 you will keep the sites only where no species fulfils the chosen option If you choose a non null value all positions with a value strictly superior to the threshold value will be eliminated from the analysis and signalled in red as if they have been eliminated by the parentheses IIl 6 2 4 Elimination of regions by entering the boundary values Using F7 you can acquire the boundaries by giving the beginning and end values of the intervals to be eliminated The subsequent display shows cases with the values superior and inferio
116. ps will not allow you to put back already eliminated sites into action see below how to recover these positions Closing the parenthesis will exit this elimination mode and you will be able to move again within the sequences without eliminating any region If you eliminated a region you want now to put back into analysis you just need to put the cursor onto any position of this region and press on the Ins key You can also eliminate or put back the positions one by one the key eliminates the current position from the analysis and the key puts back into analysis a previously eliminated position With F6 you can cancel the chosen boundaries and put back all the positions into analysis However F6 will not exit the elimination mode To exit this mode you always need to close the parenthesis IIl 6 2 3 Eliminating sites as a function of the rate of non sequenced species of missequenced characters or of gaps It happens quite often that the available sequences for a pool of species have not the same length or are not determined with the same accuracy These regions can be ticklish for phylogenetic analysis in particular for the methods of distances The accepted symbols to indicate a non existing sequence are the blanks or spaces the question marks and the X A whole list of characters symbolises the poorly determined sites RYMWSKVHDBN X Gaps are often present in regions which are difficult to align They also pose
117. r of the positions of each eliminated interval To create a new case use the Ins key which will had a case to the left of the current case number in yellow When you are at the final case use the Right arrow to create another case at the end of the list You can delete a case using the Del key When moving from left to right the values must be strictly incremental It is not possible to exit this menu if this condition is not respected unless there is only one case and the two values are equal to zero it is then considered that the user does not wish to eliminate this region F7 returns you to the display of sequences IIl 6 2 5 Saving chosen boundaries Usually once you have chosen the boundaries for analysis the same boundaries will be used for many other analyses It is often useful to save the chosen boundaries on hard disk so you do not have to redefine them every time With F3 you can save these boundaries in a file and with F2 you can choose a file of boundaries and load it If you want to work on another computer with these files you have to know that they have an extension BOR and are located in the directory lt MUST gt MUST DATA I11 6 2 6 Display options F8 switches the display of the histograms of site variability criteria see III 6 3 With F9 you can display either the four criteria or only one of them At the left of the histograms two numbers indicate the lowest and highest values for each indice If one criteria
118. r steps ci ri 0 ak 2 3 4 5 6 7 8 92 TO Al L2 I3 AA AS eG ATS T8 1 2 2 2 3 1 2 1 2 1 1 1 3 2 1 2 1 1 1 100 50 50 50 66 100 50 100 50 100 100 100 66 50 100 50 100 100 100 100 0 0 0 0 100 0 100 50 100 100 100 50 0 100 O 100 100 100 Ci 19 20 21 22 23 2 2 1 1 2 50 100 100 100 50 0 100 100 100 0 tree 1 length 38 ci 71 ri 64 character steps ci ri 0 1 2 3 4 5 6 7 8 9 I0 AT T2 33 414 AS T6 A7 18 1 2 2 2 3 1 2 1 2 1 1 1 3 2 1 2 1 1 1 100 50 50 50 66 100 50 100 50 100 100 100 66 50 100 50 100 100 100 100 0 0 0 0 100 O 100 50 100 100 100 50 0 100 O 100 100 100 19 20 24 227 23 2 2 1 i 2 50 100 100 100 50 0 100 100 100 0 tree 2 length 38 ci 71 ri 64 character steps ci ri 0 ak 2 3 4 5 6 7 8 9 AO AL 12 gt I3 T4 aS T6 7 18 1 2 2 2 3 1 2 1 2 il 1 al 3 2 1 2 1 1 1 100 50 50 50 66 100 50 100 50 100 100 100 66 50 100 50 100 100 100 100 0 0 0 O 100 0 100 50 100 100 100 50 0 100 0 100 100 100 19 20 21 22 23 2 2 1 il 2 50 100 100 100 50 0 100 100 100 0 best fits character steps ci ri 0 1 2 3 4 5 6 7 8 9 TO AT T2 13 T4 15 to 17 T8 1 2 2 2 3 1 2 1 2 1 1 1 3 2 1 2 1 1 1 100 50 50 50 66 100 50 100 50 100 100 100 66 50 100 50 100 100 100 100 0 0 0 0 100 O 100 50 100 100 100 50 0 100 O 100 100 100 19 20 21 22 23 2 2 1 1 2 50 100 100 100 50 12 MUST user s manual Version 1 0 Apr 03 0 100 100 100 0 worst fits character steps ci ri 0 1 2 3 4 5 6 7 8 O TO AT 12 T3 Dale Se LG TA T8 1 2 2 2 3 1 2 1 2 1 1 1 3 2 1
119. r the name of the species file It should be noted that this type of file must be in the directory lt MUST gt MUST DATA and have the extension NOM Since the program MAKETREE can build several systematic frames you need to be able to change of frame To choose a frame F3 will access to the list of the existing systematic frames Species will place themselves in the frame as a function of their associated group name in the file containing the species names With F4 you can change this file by choosing the current file yellow color or by creating a new file with Create D You must give the name of the file without its path and its extension thus if the full name of the file is D MUST DATA INSECTS NOM you must write only INSECTS 111 4 3 Choosing the species Once you chose the file of aligned sequences the systematic frame is displayed To the right of the screen are displayed values by the side of each leaf name or internal node e 0 means that there is no species either in this node or in the daughter sub tree e x y x is the number of selected species y indicates the number of species which belong to the ensemble node its daughter sub tree Ill 4 3 1 Choosing the species one by one Obtaining the list of species To select one species i e Mus musculus you just need to move on the leaf which contains it here Rodentia and to press on Return All species of this group are then displayed i e Mus musculu
120. re several users you may create several files of this type For example the software is furnished with the file GENERAL NOM in the lt MUST gt MUST DATA directory 21 MUST user s manual Version 1 0 Apr 03 The list of species classified alphabetically is displayed when you type F2 Typing the first letter of the species name sought displays a shortened list of all species whose names begin with that letter F2 returns you to the complete list If you wish to rename or discard a file of this type you must use DOS commands Also if you want to remove a species from the file correct spelling errors or change group names it is necessary to use a text editor However you can add new species to the files Simply put the desired name in the Identifier field and validate The menu which follows will display This species is not in the file lt MUST gt MUST DATA GENERAL NO e to choose from the list of species in file lt MUST DATA GENERAL NOM e to change the file containing the species names e to integrate this species in the file lt MUST gt MUST DATA GENERAL NOM You validate the third option then enter the group name of the new species The program searches the lt MUST gt MUST DATA AFAS REF file for the name of the active systematic frame see below and constructs a list of all the group names in that systematic frame Then you choose the name you want from that list
121. rectly You need a printer with 8 9 or 24 pins connected to your computer If no printer is connected you exit directly from TREEPLOT with a DOS error message You gain access to the choice of printer in the following menu of options Printing of diagram Change of paper size Change of type of printer Change of scale Choice of line thickness It is thus possible to choose the type of paper used 80 or 132 columns the line thickness and the horizontal scale The default scale is that which permits the use of the entire width of the sheet of paper To give a larger scale will diminish the size of the tree Ill 10 4 1 Postscript printers Using the key combination Shift F5 It is possible to obtain a print file in Postscript format This file contains the tree Many options are available in the following menu Printing of diagram Choice of the name of file Choice of the margin Choice of character size Choice of line spacing Choice of line thickness Change of type of drawing Change of print of BE Change of style Change of scale The name of the output file is by default the name of the initial file chosen in TREEPLOT with the extension PS It is always possible to modify this name especially if the Postscript print file already exists since in this case TREEPLOT crashes the first file The margins
122. red by parsimony or with a difference matrix paleontological dates less quickly evolving molecules transversions versus transitions see for example Philippe et al 1993 or Leclerc et al in prep 1 1 2 5 Concatenation of files of aligned sequences For the large biological molecules rRNAs in particular the manipulation of entire sequences is difficult since the text editors generally available on a computer are ill adapted for the task of managing in user friendly fashion long chains of characters up to 5000 in these cases Moreover biological molecules are very often composed of domains evolving at different rates when one is interested in a wide spectrum of species there are domains where one can align all the representatives and others where only certain groups can be aligned It is preferable to subdivide the sequences into such domains one can then regroup species in blocks for which the regions are alignable In this way sequences of homogeneous variability are no longer punctuated by fictive deletions generally arising from insertions in distant species Thus you work on the alignment with files of aligned sequences containing a maximum of homologous sites and can reconstruct all or part of the molecule studied to build phylogenies The program AFAS lets you concatenate files of aligned sequences It can also be used to reunite the domains cited above or different molecules 18S 28S 5 8S 1 1 2 6 Critical an
123. ree sense lepine 24 Il 5 The EMBL progra M 25888 tie te Le i CO un Rives 25 Il 5 1 FOMACEMBL 252 ne A ee eee 25 I1 5 2 Acquisition of characteristic sequence fields 26 Il 5 3 Choice of sequence portions 26 Il 6 Other extraction programs ceeeeeeeeceeeeeeeeecneeeaeeeeaeeeeeeeeeeeeeeeeeees 27 Il 6 1 The SPLITEMB and SPLITGEN programs 27 Il 6 2 The EMBLCUT program 28 Il 6 3 The GENBANK program 00 ccceeeceeeceeeeeceeeeeeeeeeeeeeeeeees 28 Il 6 4 The GENCUT program 29 Il 6 5 The SWISS program 29 Il 6 6 Programme NBRF 30 Il 7 The MODIFSEQ program um rien demandent 31 Il 7 1 Sequence recognition 31 Il 7 2 Change of molecule type 31 ll 7 3 Rubric modification nettement 31 Il 7 4 Modification Of sequence 31 Il 7 5 Modifications in the files of aligned sequences 0000000 33 Il 8 The VERIF SEO programs im un tt Lee rate 33 Il 9 The INTEGSEQ program eeeeeeeeeeeeaaaeaaaeeeaeeeeeeeeeeeeeees 34 Il 10 The INTEGAEL program nr taie ten caenidobleast 34 11 11 Management of the database cccseceeeeeeneeeeceeeeeeeeeeeeeeeetees 35 11 11 1 The INFOBANK program eeeeeeeeeeetteeeeeeeeeeeeeeeeeeees 35 11 11 2 The DELBANK program
124. respect to the first position of the sequence Choice of the criteria boundaries Once you have chosen the criteria a window for the acquisition of the boundaries is displayed On the first line are displayed the values of the boundaries the maximal and minimal values non modifiable are displayed in dark blue You can change the limit values within the range of the extremal values erasing the displayed value with Backspace and typing in the new value You can go from one boundary to the other with the horizontal arrows Once you have chosen the boundaries you can move with the vertical arrows to select an action you validate the current action in yellow color with Return e remove all the sites which are not included in the interval e put back the sites which were previously removed using this criteria Overall elimination of sites With the Shift F2 key combination you can remove from the sequences all the non informative sites for parsimony e g all the sites for which PRESENT2 equals 1 With the Shift F3 key combination you can remove from the sequences all the constant sites e g all the sites for which PRESENT1 equals 1 Saving the value of the criteria With the F7 key you can save the values of the different criteria for each selected position in a file with the extension POS The option Minimal nb of steps corresponds to the value PRESENT1 1 The files which are obtained can be compared with the files which
125. result from the programs AFT_PHYL et AFT_HEN which give the number of steps of a site in a tree see Chapters III 9 2 and III 9 4 A more detailed description is given Chapter III 6 6 60 MUST user s manual Version 1 0 Apr 03 Ill 6 4 Formatting of sequences IIl 6 4 1 General comments Several programs outside the MUST package are able to treat sequences These programs require quite often a particular format of the sequences To use of these programs with sequences acquired through MUST NET gives the possibility to create sequence files with the appropriate format This option can also be used to get printing formats To choose the write format of your sequences use the F4 key which displays the following list of formats HYLIP format ENN forma UP 2 forma DE 3 forma EDUCSE forma UKIM format format ET format JBOOT format ithout the deletions for bootstrap A A m Q aoaaa When a line ends with an arrow the choice of a sub format is required To each format is associated a file having a proper extension see the possible extensions in the list of the files of MUST paragraph l 8 6 This extension is automatically added to the name of the file A name is proposed for each output file This name is composed as follows e the sequence filename to which is added an ordering number e the or
126. rsion 1 0 Apr 03 4 if they already exist copy his own files into the directories D USER JEAN MUST ALI D USER JEAN MUST DATA and D USER JEAN SEQ The sub directories TYPEO TYPEy are created by the software For a description of the files to copy consult chapters 1 8 3 1 8 4 et 1 8 6 l 5 General keyboard coding We will first present the keys you will use the most often in giving their general function Return validates a choice in a menu or signals the finish of a chain of characters Escape return to preceding menu or exit from the program normally or prematurely F1 access to HELP screen when there is one F2 access to lists of aid in acquiring data or the list of programs F5 validates the entry or the choices made on the current screen Pgup Pgdn Home and End all these keys permit you to move around in the menus Ctrl and Ctrl lt let you move quickly REMARK It occurs although rarely that the keys do not have the capabilities we mention above l 6 Color code As a general rule the color of a window is characteristic of its type e red window warning of a dangerous action demanding confirmation destruction exit from program etc e fuchsia help window e green menu a menu line ending with an arrow calls a submenu e blue question needing a response at least a confirmation e white list files species etc The text of certain windows may use other col
127. s Rattus norvegicus and Mesocricetus auratus If you press on Return while the current node is an internal node the displayed list of species consists of species which belong to this node as well as to all the nodes of the daughter sub tree For example if you are on the node Archosauria the species which have Archosauria Crocodilia et Aves as a group name will be displayed To select Mus musculus you can activate the node Mammalia but it will not be very convenient if you 48 MUST user s manual Version 1 0 Apr 03 have very large numbers of Mammalian species In that case it would be better to activate the leaf Rodentia Display of the species The list of the species is displayed in alphabetical order The value to the right of each species name represent the length of this sequence expressed as percent of the largest sequence length added blanks at the beginning and the end of the sequence in order to compensate the non sequenced portions are excluded You can thus know the sequence length which is available Selecting species Press on Return will select the current species yellow color Preceding its name a number will be displayed which represents the ordering number in the list of the selected species for example if Mus musculus is the 12 selected species the number 12 will precede this species To cancel the selection of a species press once more on Return while the species is the current one and the orderin
128. s extracted the list of cut files CUT is presented in menu form with the choice of current file in yellow by using Return A confirmation of the choice with file description is requested The program then searches for all similarities between the genes and the different reference sequences of conserved domains For each reference sequence a list of the 20 best matches is displayed in decreasing order of similarity lt position in the gene gt lt number of similarities gt The name and length of the reference sequence is displayed above each list In order to avoid possible domain straddling the program proposes only similarities which start after the end of the preceding domain This is applicable once the terminal position of the preceding domain has already been validated One can establish the upper limit beyond which no similarity should be taken into account by using F2 This is an useful trick if one knows the exact position of the next limit or the approximate length of the domain A display of similarities is proposed for fine determination of the position to be taken into account in cutting the gene The current similarity is shown in yellow when Return is depressed Under the reference sequence the portion of the gene concerned is displayed with identical characters shown as dashes It is then possible to choose the exact position where the gene should be cut using the horizontal arrows to move the cursor along the
129. s to recognise the sequence Thus in the files of aligned sequences which must have an ALI extension and be in the lt MUST gt SEQ directory the first two lines have to be lt Molecule gt lt Domain gt The remainder of the file is a repetition of the motif gt lt genus name gt lt species name gt _ lt various characteristics gt lt Corresponding sequence gt It is sufficient to put an at the beginning of a line for it to be considered as a commentary except for the first two lines These constraints must be respected in constructing files in order to have good correspondence with the database see the file C1 ALI on the diskette Figure 1 indicates the existing programs and the information transfers they handle Now we will go into detail on the usage of each program Il 2 The USEB Program This program lets you call the ensemble of database management programs using a rolling menu you don t need to know the names of the programs These different programs are presented below An aid describing each program is available by using F1 17 MUST user s manual Version 1 0 Apr 03 Figure 1 Schematic flowchart of the management of raw sequences USEB 18 MUST user s manual Version 1 0 Apr 03 ll 3 The ENTRYSEQ Program REMARK If you have computer tools for the reading and interpretation of films this program is of no interest In that case save your sequence in an ASCII file and use the pro
130. s which are already archived and if you validate one of these lists by pressing Return the screen will display the name and the title which were given during a previous archiving as well as the number of species and the date and hour of this archiving At this step it is possible to validate unvalidate your choice but you can also rename the list with F2 or delete it with Del It is wise to delete quite often old unused lists in order to avoid confusion If some species are present in the list and not in the file of aligned sequences ED will issue a warning If you work on several computers you can transfer the files containing the lists of species These files are in the directory lt MUST gt MUST DATA and have a LIS extension 111 4 3 6 Other functions The two last functions are the deselection of the whole current list of chosen species with F10 and the possibility to go directly on a sub tree with F4 50 MUST user s manual Version 1 0 Apr 03 REMARK Once you are in the stage of choosing the species if you want to change the frame or the file NOM you must come back with Shift F1 to the selection window for the file of aligned sequences changing of sequence file Thus you will loose the species previously selected Ill 4 4 Sequence alignment Ill 4 4 1 Display and movement Once you chose the species you access with F3 to the aligned sequences ED displays the 14 first characters of the species name then the 60 first
131. se files must not be destroyed However the sys files created by MAKETREE can be destroyed by this same program 1 8 2 MUST MUST TYPEMOL LST Contains the list of databases All the programs called by USEB This file is destroyed through the program DELBANK 1 8 3 MUST MUSTIALI Files Descriptions Software Files of aligned sequences prepared by AFAS CAFAS and DAFAS AFAS Information associated with the AFAS CAFAS and DAFAS corresponding ALI file These files can be deleted through the program DAFAS The ALI and INF files function in pairs If you wish to copy a file of sequences prepared on another machine or another directory you must also copy the corresponding information file 11 MUST user s manual Version 1 0 Apr 03 1 8 4 MUST MUST DATA Software AFAS REF Contains the name of the active AFAS ED JACKMONO and systematic frame for AFAS et ED and SHAREGAP that of the active file specifying the correspondence between species name and group name Contains the information on archived FILM films Files of boundaries generated by NET NET Lists of species generated by CAFAS CAFAS and ED and ED Contains the correspondences between SAVESEQ EMBL FILM ED species names and Group names MODIFSEQ SHAREGAP and AFAS Contains the configuration for COMP_BOO COMP_MAT COMP_BOO COMP_MAT ED ED MONO_HIS NET and MONO_HIS NET and TREEPLOT TREEPLOT The BOR
132. t of the data base onto a diskette another directory or another disk It is possible to save e the entire base e one or several types of molecule e all the base starting from a specific date The program will ask the identity of the unit to which you wish to save the material It transfers the data saved in the SAVEBANK file on that unit for example the file A SAVEBANK If the file already exists that is if the data base has already been saved on that unit SAVEBANK proposes e to add the new sequences saved to the end of those already present e to destroy the old material by writing over it with the new sequences If the SAVEBANK file is larger than the available space on the unit there are only two possibilities e save only part of the material on the space available e use the DOS command BACKUP s lt MUST gt MUST A REMARK We strongly advise that the entire base be saved regularly at least once each six months and that the data added after the last complete save be saved much more frequently such as on a weekly schedule WARNING The correct functioning of the computer s internal clock must be verified regularly in order to properly use this program The SAVEBANK and LOADBANK programs use the machine s clock to determine if a sequence being saved is anterior to the sequence contained in the base It is also necessary for the clocks of all computers used to be approximately synchronous
133. table summarises the number of sites per enzyme ATTENTION The file crashes each time RESTRIC is launched Example Ses SERRE ECO RTL HS SaSSSSessSs5 gt Prorocentrum micans position 101 GAAUUC gt Sinapis alba position 121 GAAUUC TAAR RTR easier sS HCO RV SSS RSS cheese gt Tetrahymena pyriformis position 86 GAUAUC gt Tetrahymena thermophila position 190 GAUAUC gt Drosophila melanogaster position 155 GAUAUC FRERES See Sma I Xma I Ava I gt Arabidopsis thaliana position 238 CCCGGG gt Herdmania momus position 157 CCCGGG gt Xenopus laevis position 197 CCCGGG gt Xenopus borealis position 200 CCCGGG gt Homo sapiens position 163 CCCGGG gt Pan troglodytes position 163 CCCGGG gt Rattus norvegicus position 163 CCCGGG SSSR SSeS NOG Less esse ss Sane Hind III Sie ae Sa re gt Caenorhabditis elegans position 34 AAGCUU RESUME gt Eco RI lt 2 gt Eco RV 0 gt Sma I Xma I Ava I 7 gt Not I 0 gt Hind III S i 92 MUST user s manual Version 1 0 Apr 03 111 12 8 The SHAREGAP program This program is complementary to ED in facilitating the determination of deletions common to several species It serves the following purposes e The suppression of deletions common to the ensemble of species presence of a gap or a blank at a given site
134. te It asks the disk drive where to find the diskettes for installation Then it asks in which unit MUST should be installed This unit will be referred to as lt MUSTEXE gt For example MUST can be installed on the root directory of a disk or on a subdirectory the unit lt MUSTEXE gt will then be called respectively C or C TOTO depending on whether it is installed on the root directory of disk C or on the directory TOTO Finally the program will ask for the first work unit of MUST that is the unit containing the files of the first user cf chapter l 4 This unit will take the name lt MUST gt MUST user s manual Version 1 0 Apr 03 The work directory can be the same as the installation directory but we do not recommend this Once the files are installed the user must initialise three global variables of the DOS environment in AUTOEXEC BAT This file is automatically modified The old file is saved under the name AUTOEXEXC BAK The new AUTOEXEC BAT must contain the following three lines PATH PATHS lt MUSTEXE gt MUSTEXE SET MUST lt MUST gt SET MUSTEXE lt MUSTEXE gt For example if lt MUSTEXE gt is equal to C and lt MUST gt to C PIERRE AUTOEXEC BAT will contain the following lines PATH SPATHS C MUSTEXE SET MUSTEXE C SET MUST C PIERRE where PATHS is the path described in
135. ters The result is also given as a table printed out or written into NET OUT see IIl 6 7 6 There is no sorting possibility for this option IIl 6 7 6 Printing Type of printer The outputs from NET are intended for matrix printers It is possible to get an output for another type of printer But in this case no formatting is guaranteed condensed characters italic All printing is done in ASCII with a page jump at the end of printing Redirection towards a file The standard output is done on a printer But the output can be redirected towards a file named NET OUT This option lets you work on a computer not connected to a printer or modify the output of the program when it s not exactly what you wanted NET offers several possibilities for printing Sequences matrices When the output is redirected towards the file NET OUT the Successive impressions are concatenated in the file However the file is reset to zero at each new session Likewise each time the output is redirected from the printer towards the file or vice versa the file is reinitialised The output file contains the following characters for the control of printing e beginning and end of writing in condensed mode aligned sequences tables of frequences of characters e beginning and end of writing in italic identifiers lll 7 THE NJ PROGRAM The principal window displays a list of files of matrices MAT extension accessible in the curre
136. test distance You move within the list by using the vertical arrows PgUp PgDw Home and End You can identify each point because of the green indicator which appears when a pair of species is activated Escape returns you to the preceding menu Writing the differences into a file The program will request the name of the file in which the differences will be stored commentary is facultative The file will have a POS extension The study of these differences permits you among other things to measure the homoplasy that is the difference between the number of steps and the minimal number of steps Writing the values of comparison into a file Since the values of position are discrete values many pairs will be displayed at the same place on the graph Thus it is interesting to know how the number of points for each 90 MUST user s manual Version 1 0 Apr 03 index value or number of steps The print option lets you output this result in table form according to one or both of the axes 111 12 7 The RESTRIC program 111 12 7 1 Utilisation This program lets you determine which restriction sites are present along sequences contained in a file of aligned sequences ALI extension There are two ways to use this program e To search for all the restriction sites in all the sequences of the file of aligned sequences for a given group of restriction enzymes The group of restriction enzymes is defined in the file ENZYME RES e To
137. tggagctga ggctctgact aggatgttga ccacctaccc tcagaccaag 121 acctacttce cccacttcga ccetttcgect ggctctgacc aggtccgtgg ccatggcaag 181 aaggtgttgg gtgccttggg caacgcggtg aagnnngtgg ataacctgag ccaggccatg 241 gctgagctga gcaacctgca tgcctacaac ctgcgtgttg accccgtcaa tttcaagctg 301 ttgtcgcagt gcatccagtg cgtgcggcta gtacacatgg gcaaagatta cacccctgaa 361 gtgcatgctg ccttcgacaa gttcctgtct gcecgtgtctg ctgtgctgge tgagaagtac 421 agataa ll 6 4 The GENCUT program This archives sequences from the GENBANK cutting the gene into several domains The sequence of interest must be in a file formatted for GENBANK and in a cut file corresponding to molecule type The cut file format CUT is described in paragraph II 5 1 The usage of GENCUT is two step e S equence extraction comparable to that in GENBANK e determination of the limits of conserved domains as for SAVECUT cf Il 5 2 11 6 5 The SWISS program This archives SWISS PROT sequences The sequence of interest must be in a file formatted as described below There must not be more than one sequence in this file REMA RK Many programs for sequence extraction from sequence banks concatenate all the sequences extracted into the same file Thus it is necessary to split the primary extraction file into as many files as there are sequences The SPLITEMB program will do this job for sequences pulled from SWISS PROT see II 6 1 29 MUST user s manual Version 1 0 Apr 03
138. the former AUTOEXEC BAT For MUST to function it is necessary to execute the batch AUTOEXEC BAT or restart your computer using the key combination Ctrl Alt Del REMARK You may check that the DOS global variables MUST MUSTEXE and PATH have correctly been assigned by using the DOS command SET You should obtain an output close to this following especially for the bold lines COMSPEC C COMMAND COM PROMPT p g PATH C MUSTEXE C C5 BIN C BIN C DOS C EXCEL C WINDOWS C NORTON C C5 BINB TEMP C WINDOWS TEMP MUSTEXE C MUST C WINDIR C WINDOWS l 4 Work directories 1 4 1 Working with several users Let s go back to the global variables MUSTEXE and MUST The variable MUSTEXE indicates which unit contains the software MUST This variable must ABSOLUTELY remain the same as that you used with SETMUST In contrast the variable MUST can be changed It indicates the unit containing the files used Take the case of two users Pierre and Marie who wish to work totally independent of one another For this it is necessary that each user has his own work units thus in the case of Pierre and Marie one must have the following arborescence MUST user s manual Version 1 0 Apr 03 MUST my SEQ MUST q SEQ The directory PIERRE MUST ALI ALI DATA TYPEO TYPE1 TYPE2 TYPEX TYPEy ALI DATA TYPEO TYPE1 TYPE2 TYPEX TYPEy will co
139. thin a menu and submenu The first line of the menu activates printout using the options displayed in the upper frame Printing in Postscript Printing of diagram Choice of the name of file Choice of the number of diagrams per page Choice X title Choice Y title Choice of printing of the diagonal Change in the shape of the point In choosing the number of diagrams per page one also defines the unit size of the diagrams The program calculates the dimensions for a diagram in function of this option in order to optimise the use of the page The legends of the axes will be centered in the length of the corresponding axis You activate the printing into the file by the command Printing of diagram If the chosen file already contains print commands for diagrams the new diagram will be organised like the preceding ones Printing on a pin printer 82 MUST user s manual Version 1 0 Apr 03 Printing of diagram Printing of the criteria only Choice of the X and Y values printing Change in the size of squares Choice of the frame printing Change in the type of printer Redirection of the output printer The printing of the diagram also includes printing of the commentaries associated with each file as well as the diverse criteria used to make the comparison 111 12 Diverse programs
140. type The format of this file CUT is described below 11 5 1 Cut file format For each conserved domain in the molecule the file contains two sequence fragments corresponding to the domain limits These fragments serve as references to determine the beginning and end of the domain in the new gene However if the gene begins with a conserved domain the sequence corresponding to the start of the domain is not given the program begins the domain at the level of the first character In the same manner if a gene ends with a conserved domain the end sequence of that domain is not described and the program pursues the final domain to the last character of the gene The cut files for the 28S RNA are furnished with the software These three files 28S ARCH CUT for Archebacteria 28S EUBA CUT for Eubacteria and 28S EUKA CUT for Eukaryota are in the directory lt MUST gt MUST DATA The file should have the following format Name of molecule 28S Name of domain Cl Begin 23 MUST user s manual Version 1 0 Apr 03 End GAACGCGGUACAGCCCAAACCGAAUC Name of domain C2 Name of domain C12 Begin AGUACGAGAGGAAC End GCAUCUAAGCUCGAAACC Il 5 2 Using SAVECUT The first phase of utilisation of SAVECUT is identical to that of SAVESEQ The only difference is at the level of sequence determination the keywords Molecule and Domain are not requested only the dentifier must be specified After the sequence i
141. udogene The 26 MUST user s manual Version 1 0 Apr 03 program allows the selection of this fragment even if it is not continuous in the genome since it offers the possibility of concatenating several fragments To perform this extraction e Choose the sequence portions in the list furnished by the EMBL bank with Return An ordering number for concatenation appears to the left of each line selected e Create a new portion by tapping F3 the limits of this selection are then demanded the portion is automatically selected e If necessary correct your choice by tapping Return on a previously selected line The selection is removed and the order of concatenation corrected e Validate your choice using F5 Using the following menu you can then transform the DNA sequence Leave the DNA sequence intact Replace T s with U s Take the complementary DNA Take the complementary RNA Translate the complementary into protein Translate into protein For example in the above file if you wish to select only the sequence coding for beta globulin simply select the line containing the keyword CDS the number 1 appears to the left of that line and the choice is validated using F5 Once the material is saved the program displays as in SAVESEQ the corresponding list of aligned sequence files After you have added the new sequence to the files you choose you can either extract another sequence from the same f
142. uicker AFAS reads only once the whole file and CAFAS reads only the required sequences So if your alignment is good for a file it is better to use AFAS and CAFAS rather than ED to choose the species lll 5 2 Preparing the files AFAS AFAS is mainly used to concatenate sequences from different files Since these files can contain different species AFAS offers two concatenation modes e F4 intersection only the species which are present in all the selected files are kept 54 MUST user s manual Version 1 0 Apr 03 e F5 union keeps any species present in one of the selected files blank sequences are set in the case a species is not present in one or several files However AFAS can also prepare an only one file formatted for CAFAS by pressing the F3 key if several files are selected the program will transform them one after another The files of aligned sequences are selected by pressing the Return key The order of the files in the selection displayed to the left of the files is kept as the order of the concatenated sequences You can change e the systematic frame with F6 e the file containing the names of the groups with F7 You finally choose the transformation mode for the selected files F3 F4 F5 The name of the prepared file maximum of 8 characters the user s name and the title are then prompted for The program archives also the date and the hour of the operation Within each leaf group of the
143. uild the tree consists in adding a sister group at the current node internal or terminal This operation is described in the following chapter Modification of a tree IlIl 3 1 Modification of a tree The list of the existing systematic frames is displayed the current tree yellow is selected by pressing the Return key The date of the last modification is displayed along with a choice of actions e Return to confirm the choice e Escape to come back to the screen of systematic frames e Del to destroy the systematic frame e Ins to copy the systematic frame IIl 3 1 1 Moving in a tree Moving can be done using the arrow keys with the following meanings Down Arrow key e f the cursor is on an internal node it will go to the downstream daughter node i e one down right move without interval or on the leaf if the cursor was on a terminal node e If the cursor is on a leaf it will go to the following leaf or to the first leaf of the tree if the cursor was on the last leaf 42 MUST user s manual Version 1 0 Apr 03 Up Arrow key e If the cursor is on an internal node it will go to the upstream daughter node i e one up right move without interval or on the leaf if the cursor was on a terminal node e If the cursor is on a leaf it will go to the preceding leaf or to the last leaf of the tree if the cursor was on the first leaf Left Arrow key e f the cursor is on an internal node it will go to the preceding inter
144. was selected on the main window two arrows indicate the limit values of the chosen boundaries A line of upper case i I specifies the sites eliminated by the selection of one or several criteria this display does not differentiate the criteria This line is located above the histograms of the criteria or at the bottom of the screen in case these histograms are not displayed To the left of this line the current character position is displayed in yellow color This position is expressed as an absolute value for the whole species ensemble of the file Since the shared gaps are not displayed the values of the current position do not follow a linear increase some values are absent 59 MUST user s manual Version 1 0 Apr 03 F10 allows you to choose the type of display of the identifier see III 6 7 2 Finally with F4 you can change the order of species for instance in order to put side by side two species you are interested in cf III 6 6 1 I11 6 3 Use of the criteria Four different criteria can be used to eliminate sites The F3 key displays the list of the available criteria e PRESENT1 number of characters present on 1 site if PRESENT1 1 then the site is constant e PRESENT2 number of characters present at least twice on 1 site if PRESENT2 1 then the site is non informative for the parsimony e KHI2 index of variability e CODON localisation of the site within its codon codons are determined with
145. y of these functions F7 Moves the tree up F8 moves the tree down F9 affichage des commentaires associ s au fichier Shift F1 loads a few data file Shift F2 lengthens all branches leading to species such that all species are shown at the same level The branch lengths return to normal if you reroot the tree because the program modifies only the X coordinates of the leaves WARNING the calculation of matrices of patristic distance does take this modification into account Shift F3 Writes the tree into a file formatted for PHYLIP REMARK There is a version for EGA screens and a version for VGA screens with more species displayed on the screen Please contact the author to obtain an EGA version program lll 11 The COMP_MAT program The user may need to know quickly whether two molecules give the same phylogenetic information without going through tree construction which is long difficult and requires many operations This can be done by direct comparison of the values contained in the matrices of distances The module represents the values graphically for comparison 111 11 1 Method of comparison used Choose two files of matrices using two successive Return validations on the active file These files with a MAT extension are created by the NET and TREEPLOT programs The program takes the intersections of the species and produces all the possible 80 MUST user s manual Version 1 0 Apr 03 combinations

Download Pdf Manuals

Related Search

Related Contents

See full specification - Product Care Product Care  Depliant Faeton EECA - Site des professionnels du permis de  ÉDUTHÈQUE - Ministère de l`éducation nationale  SLICE PRO SIM (Gen2.5) User`s Manual  

Copyright © All rights reserved. Failed to retrieve file