MethylMiner™ Methylated DNA Enrichment Kit
Contents
1. To elute captured CpG methylated DNA into distinct fractions start with the lowest NaCl concentration Elution Buffer e g 200 mM NaCl Follow this with the next higher NaCl concentration e g 350 mM NaCl Continue this process in order until all the desired fractions have been collected Immediately after removing the non captured DNA from the beads Removing Non Captured DNA from the Beads Step 7 page 21 follow the protocol below to elute the captured DNA as a single fraction using the High Salt Elution Buffer 1 For lt 1 ug of input DNA Resuspend the beads in 200 ul of the High Salt Elution Buffer 2000 mM NaCl provided in the kit For gt 1 43 25 ug of input DNA Resuspend the beads in 400 pl of the High Salt Elution Buffer 2000 mM NaCl provided in the kit Incubate the beads on a rotating mixer for 3 minutes Place the tube on the magnetic rack for 1 minute to concentrate all of the beads on the inner wall of the tube With the tube in place on the magnetic rack remove the liquid with a pipette without touching the beads with the pipette tip and save it ina clean DNase free microcentrifuge tube Store this sample on ice For lt 1 ug of input DNA Repeat Steps 1 4 once collecting the second sample in a different tube Pool these two elution samples the total volume will be 400 ul Store the pooled sample on ice For gt 1 ug 25 ug of input DNA Repeat Steps 1 4 twice collecting each sample in a differen2. We recommend testing a few different fractionation schemes to determine what works best for your particular workflow number of samples to analyze and downstream applications The following table shows an example of a series of Elution Buffers and the appropriate ratios of Low Salt and High Salt Buffers to prepare them Example Multi Fraction Elution Series Elution Buffer Fraction from first to last NaCl Concentration Percent Low Salt Buffer Percent High Salt Buffer Non captured DNA supernatant 160 mM NaCl 1X Bind Wash Buffer alone Non captured DNA wash 160 mM NaCl 1X Bind Wash Buffer alone Elution 1 200 mM 90 10 Elution 2 350 mM 82 5 17 5 Elution 3 450 mM 77 5 22 5 Elution 4 600 mM 70 30 Elution 5 1000 mM 50 50 Elution 6 2000 mM 0 100 Preparing Each Buffer for a Multi Fraction Elution Series 20 For each capture reaction prepare 1 400 ul of each elution buffer desired 20 more than is minimally needed For example 1 400 ul of the Elution 3 buffer is composed of a mixture of 1 085 ul 77 5 of 1 400 ul of Low Salt Elution Buffer and 315 ul 22 576 of 1 400 ul of High Salt Elution Buffer Removing the Non Captured DNA Introduction Materials Needed Important Removing Non Captured DNA from the Beads In this step you collect the non captured DNA from the bead solution In addition to the kit components you will nee
3. M 280 Streptavidin with the MBD Biotin Protein Do not add DNA in this step 1 For each microgram ug of input DNA add 7 ul 3 5 ug of MBD Biotin Protein to a 1 7 ml DNase free microcentrifuge tube For input DNA amounts less than 1 ug use 7 ul of MBD Biotin Protein 2 If starting with lt 1 ug of input DNA Add 1X Bind Wash Buffer to the protein to a final volume of 100 ul If starting with gt 1 ug 10 ug of input DNA Add 1X Bind Wash Buffer to the protein to a final volume of 200 ul If starting with gt 10 ug 25 ug of input DNA Add 1X Bind Wash Buffer to the protein to a final volume of 500 ul 3 Transfer the diluted MBD Biotin Protein to the tube of resuspended beads from Step 8 Initial Bead Wash previous page total volume 200 750 ul 4 Mixthe bead protein mixture on a rotating mixer at room temperature for 1 hour then proceed to Wash the MBD beads next page After mixing the beads and protein for 1 hour follow the steps below to wash the coupled MBD beads 1 Place the tube containing the MBD beads on a magnetic rack for 1 minute to concentrate the beads on the inner wall of the tube 2 With the tube in place on the magnetic rack remove the liquid with a pipette without touching the beads with the pipette tip and discard the liquid See Removing Liquid from Dynabeads page 14 for detailed instructions Always avoid touching the beads with the pipette tip 3 Resuspend the beads with 100 250 ul of
4. R 2008 Highly integrated single base resolution maps of the epigenome in Arabidopsis Cell 133 523 536 Rauch T and Pfeifer G P 2005 Methylated CpG island recovery assay a new technique for the rapid detection of methylated CpG islands in cancer Lab Invest 85 1172 1180 Schilling E and Rehli M 2007 Global comparative analysis of tissue specific promoter CpG methylation Genomics 90 314 323 Weber M Davies J J Wittig D Oakeley E J Haase M Lam W L and Sch beler D 2005 Chromosome wide and promoter specific analyses identify sites of differential DNA methylation in normal and transformed human cells Nat Genet 37 853 862 Zilberman D and Henikoff S 2007 Genome wide analysis of DNA methylation patterns Development 134 3959 3965 2009 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 32 Notes Notes invitrogen Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech supportainvitrogen com For country specific contact information visit our web site at www invitrogen com
5. Read through the entire protocol and then scale accordingly depending on the number and size of your capture reactions In this step you wash the Dynabeads M 280 Streptavidin prior to coupling them with the MBD Biotin Protein 1 Resuspend the stock of Dynabeads M 280 Streptavidin by gently pipetting up and down to obtain a homogenous suspension Never mix the beads by vortexing 2 For each microgram ug of input DNA add 10 ul of beads to a 1 7 ml DNase free microcentrifuge tube For input amounts of 5 ng to 1 ug add 10 ul of beads 3 For bead volumes 100 ul Bring the volume up to 100 ul with 1X Bind Wash Buffer Mix by gentle pipetting do not mix by vortexing For bead volumes gt 100 ul Proceed to Step 4 4 Place the tube s on a magnetic rack for 1 minute to concentrate all of the beads on the inner wall of the tube 5 With the tube in place on the magnetic rack remove the liquid with a pipette without touching the beads with the pipette tip Discard the liquid 6 Remove the tube from the magnetic rack 7 Add an equal volume 100 250 ul of 1X Bind Wash Buffer to the beads and resuspend by pipetting gently up and down 8 Repeat Steps 4 7 once more and then proceed to Coupling the MBD Biotin Protein to the Beads next page Continued on next page 15 Preparing the Beads Continued Coupling the MBD Biotin Protein to the Beads Wash the MBD beads 16 In this step you couple the Dynabeads
6. 1X Bind Wash Buffer the same volume used in Initial Bead Wash Step 7 previous page 4 Mix the beads on a rotating mixer at room temperature for 5 minutes 5 Repeat steps 1 4 two more times 6 Place the tube on the magnetic rack for 1 minute to concentrate all of the beads on the inner wall of the tube 7 With the tube in place on the magnetic rack remove the liquid with a pipette and discard the liquid 8 Resuspend the beads in the same volume of 1X Bind Wash Buffer as used above in Step 3 The beads are now ready for methylated DNA capture Incubating MBD Beads with Fragmented DNA Introduction In this step you capture the fragmented methylated DNA on the MBD beads Materials Needed The following materials are supplied by the user e Fragmented DNA in DNase free water TE buffer or other low ionic strength neutral pH buffer e 17 ml DNase free microcentrifuge tubes e Pipettes and DNase free pipette tips e DNase free water e Rotating mixer e Ice Fragmented DNA DNA must be fragmented to an average size of less than 1 000 bp and should be in DNase free water TE buffer or other low ionic strength neutral pH buffer For input amounts greater than 1 ug the fragmented DNA should be at a concentration of 25 ng yl or higher The fragment size should be appropriate for your downstream analysis For example DNA fragmented to an average length of 100 200 bp is suitable for fragment library construction for short
7. 5X Wash Bind Buffer Note Be sure to use 5X buffer in this step not 1X buffer Add gt 10 25 ug of fragmented sample DNA at a concentration of 25 ng ul to the tube added volume will be 400 1000 ul Bring the volume to 1 250 ul with DNase free water Transfer the DNA Buffer mixture to the tube containing the MBD beads trom Wash the MBD beads page 16 Step 8 Mix the MBD beads with the DNA on a rotating mixer for 1 hour at room temperature alternatively you can mix overnight at 4 C If you will be eluting in a stepwise gradient of increasing NaCl concentration prepare the buffers while the beads are mixing by proceeding to Preparing Buffers for a Step wise Elution Series next page Otherwise continue to Removing the Non Captured DNA page 21 The following control reaction uses 1 ug of K 562 DNA supplied in the kit Note that the K 562 DNA is already fragmented 1 To a clean 1 7 ml DNase free microcentrifuge tube add 20 ul of 5X Wash Bind Buffer Note Be sure to use 5X buffer in this step not 1X buffer Thaw and briefly vortex the K 562 DNA 50 ug ml provided in the kit and add 20 ul 1 ug to the tube Add 1 ul of the diluted Methylated DNA control 10 pg ul and 1 ul of the diluted Non Methylated DNA control 10 pg ul to the tube Bring the final volume to 100 ul with DNase free water Transfer the DNA mixture to the tube containing the MBD beads from Wash the MBD beads page 16 Step 8 Mix
8. DNA method in elution MBD Biotin Protein efficiently fraction but DNA is detected in unbound fraction DNA target does not Verify the CpG methylation status of your target contain sufficient sequence by a bisulfite sequencing method Refer amounts of CpG to our website at www invitrogen com epigenetics methylation for available products and methods Kit components or Perform a control reaction with the control DNA procedure may have included in the kit followed by PCR based been compromised detection as described on pages 26 27 capture reaction failed 28 Accessory Products Additional Additional products are available separately from Invitrogen Ordering Products information is provided below For more information visit our website at www invitrogen com or contact Technical Support page 29 Product MethylCode Bisulfite Conversion Kit MECOV 50 PureLink Genomic DNA Mini Kit 10 preps K1820 00 50 preps K1820 01 250 preps K1820 02 PureLink Genomic Plant DNA Purification Kit 50 preps K1830 01 Quant iT dsDNA Assay Kit Broad Range 2 100 ng 1000 assays Q 33130 Quant iT dsDNA Assay Kit High Sensitivity 0 27100 ng 1000 assays Q 33120 Quant iT PicoGreen dsDNA Assay Kit 2000 assays P7589 E Gel 2 General Purpose Agarose Gels 18 gels G5018 02 E Gel 4 High Resolution Agarose 18 gels G5018 04 E Gel 2 with SYBR Safe Starter pack with base G6206 02 18 gels G5218 02 TrackIt 50 bp DNA Lad
9. a spectrophotometer blanked against 10 mM Tris HCI pH 7 5 8 5 2 Calculate the amount of DNA using the formula DNA ug Aos x 50 ug 1 Azo x 1 ml x dilution factor x total sample vol ml For DNA A2 1 for a 50 pg ml solution measured in a cuvette with an optical path length of 1 cm Quant iT dsDNA Assay Kits Quant iT dsDNA Assay Kits provide a rapid sensitive and specific method for dsDNA quantitation with minimal interference from RNA protein single stranded DNA primers or other common contaminants that affect UV absorbance Each kit contains a state of the art quantitation reagent and a pre made buffer to allow fluorescent DNA quantitation using standard fluorescent microplate TM readers fluorometers or the Qubit Fluorometer DNA may be fragmented using your method of choice DNA must be fragmented to an average size of less than 1 000 bp and should be in DNase free water TE buffer or another low ionic strength neutral pH buffer The fragment size should be appropriate for your downstream analysis For example DNA fragmented to an average length of 250 bp is suitable for assay by real time quantitative PCR qPCR Similarly DNA fragmented to an average length of 100 200 bp is suitable for fragment library construction for short read high throughput sequencing To determine the size distribution of the DNA perform gel electrophoresis on an agarose gel 13 Preparing the Beads Intro
10. bp 50 bp Appendix Troubleshooting No or poor DNA Yield is too low to Use a more sensitive method to quantitate DNA detection by detect by e g a Quant iT Assay or PCR qPCR spectrophotometry of spectrophotometry the unbound or elution fraction s Interference from Clean up DNA by ethanol precipitation elution buffer components No or poor DNA target PCR conditions are Optimize PCR conditions for your target sequence detection by PCR based sub optimal method in unbound Average DNA Design PCR primers to complement average DNA and or elution s f tsi f tDNA toal an fragment size is smaller fragment size or Iragment DNA to a larger rac than expected amplicon average size to suit your amplicon size size DNA is degraded Take proper precautions to maintain a nuclease free environment Some or all of the DNA Repeat the experiment using 2 ul of glycogen sample was lost during during ethanol precipitation to obtain a more cleanup by ethanol visible pellet precipitation DNA is highly Elute DNA with a high ionic strength buffer either methylated and did not the High Salt Buffer 2000 mM NaCl provided in elute from the MBD the kit or a 50 50 mixture of this buffer with 5 M beads NaCl to yield an elution buffer containing 3 5 M NaCl No or poor DNA target DNA is denatured and Maintain the double stranded nature of the DNA detection by PCR based is not captured by MBD biotin will not bind single stranded
11. read high throughput sequencing DNA fragmented to an average length of 250 bp is suitable for assay by qPCR In general for PCR based assays the average fragment length should exceed the length of the sequence s to be amplified Control DNA The MethylMiner kit includes two sets of synthetic duplex DNAs labeled Methylated DNA and Non Methylated DNA two PCR primer sets specific for the duplexes and one tube of pre fragmented K 562 DNA for use as controls Each synthetic duplex is 80 bp long and is provided at a concentration of 1 ng yl See page 6 for each sequence e The Methylated DNA control sequence has 8 fully methylated CpG dinucleotides distributed along its length and is used as a positive control The Non Methylated DNA control sequence has 9 non methylated CpG dinucleotides along its length and is used as a negative control To validate the use of the kit spike 10 pg of each duplex DNA diluted as below into a control sample of 1 ug of the K 562 DNA then perform the capture reaction elute and detect by PCR or qPCR using the PCR primer sets that are specific for each duplex Diluting the Immediately before use dilute 1 ul of each control duplex provided in the kit Control Duplexes Methylated DNA or Non Methylated DNA in 99 ul of DNase free water to obtain a concentration of 10 pg ul Always make a fresh dilution Do not store synthetic duplexes at a concentration below 1 ng ul Continued on next page
12. 17 Incubating MBD Beads with Fragmented DNA Continued Note Input DNA Amounts Capture Reaction 5 ng 1 ug Input DNA Capture Reaction gt 1 ug 10 Hg Input DNA 18 We recommend using the control DNA duplexes in an external control reaction with the K 562 DNA provided in the kit Although the primer sets provided for the control DNA are designed to be alien to human and mouse genomes and to the sequences that comprise NCBI s non redundant DNA sequence database as of September 2008 we do not currently recommend spiking the duplexes into actual test samples Fragmented human DNA from cultured K 562 cells has been demonstrated to be suitable for use with the control duplexes We have also successfully tested the duplexes with fragmented DNA from MCF 7 cells Different protocols are provided depending on the amount of input DNA you are starting with 5 ng 1 ug gt 1 ug 10 ug or gt 10 ug 25 ug A separate protocol is also provided for a control reaction using 1 ug of K 562 DNA 1 Toaclean 1 7 ml DNase free microcentrifuge tube add 20 ul of 5X Wash Bind Buffer Note Be sure to use 5X buffer in this step not 1X buffer 2 Add 5 ng 1 ug of fragmented sample DNA to the tube added volume should be lt 80 ul Bring the final volume to 100 ul with DNase free water 4 Transfer the DNA Buffer mixture to the tube containing the MBD beads trom Wash the MBD beads page 16 Step 8 5 Mixthe MBD beads with th
13. 5 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDS Certificate of Analysis Limited Warranty 30 Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accor
14. Invitrogen MethylMiner Methylated DNA Enrichment Kit For the enrichment of fragmented DNA based on the degree of methylation Catalog no ME10025 Revision date 9 September 2009 Manual part no A11129 MAN0000719 Table of Contents Kit Contents and Storage iie e seas e He e EHE Hee Fes EH ER Ee ede ERE HH deje tido isos 5 Materials Supplied by the User itio i tee iet it dearer ated 7 Overview Of the System RN 8 Metodo LEE US DM E MM EM ES 11 Scale f REACH ONS 4c is noe debe idt ft ee e Ie I HER EIE nee T etr 11 BlutioniStrategies a gate tied eue aod dae da dB ee 12 DNA Isolation and Fragmentation sse tenente tnter tenente 13 Preparing the Beads senen be teiten betert de iodo per 14 Incubating MBD Beads with Fragmented DNA rneserevevenenrrnrnrnrnenevsvsrsrrrvevereverenensrnrsrsrnenenensrsrsrnenenenensr 17 Preparing Buffers for a Multi Fraction Elution Series sse 20 Removing the Non Captured DNA sss tenente trennen tenere 21 El ting the Gaptured DINA iier eeu t ee a d e RU tee ant 22 Ethanol Precipitation ceret eter ir here eet e re kin laan sere ie Pea een 25 Downstream Analysis teinte den cei nde a deor tlie ee tes 26 ADDON A pe MS 28 Troubleshooting nass nenn ln te eedem eite ed E t e e tede 28 Accessory Products ua reete tied e etin ete ER ete et e Hla ene aste LE e tre TN 29 Technical Supporto eee teet ee sea e dide 30 Purchaser Notification e
15. Place the microcentrifuge tube containing the beads in a magnetic rack and allow to stand for at least 1 minute During this time the beads will concentrate as a pellet along the inner surface of the tube wall 2 Open the microcentrifuge tube without displacing it from the rack or disturbing the bead pellet and carefully extract the liquid volume with a pipette tip without touching the bead pellet 3 After the liquid has been removed remove the tube from the rack and quickly and gently resuspend the beads with the volume of appropriate solution Do not allow the beads dry out Add the next solution within 1 minute Continued on next page Preparing the Beads Continued Bead Volume Prepare 1X Bind Wash Buffer Initial Bead Wash For each microgram ug of input DNA use 10 ul of Dynabeads M 280 Streptavidin and 3 5 ug 7 ul of MBD Biotin Protein For input amounts of less than 1 ug i e 5 ng to 1 ug use 10 ul of beads and 7 ul of protein The reaction size can be scaled up to 25 ug of input DNA In general it is expected that more than one reaction will be carried out simultaneously so multiple tubes are usually handled in parallel throughout the workflow Prepare 1X Bind Wash Buffer by diluting 1 part of 5X Bind Wash Buffer with 4 parts of DNase free water For example for each 5 ng 1 ug capture reaction prepare 1 8 ml of 1X Bind Wash Buffer by diluting 360 ul of 5X Bind Wash Buffer with 1 44 ml of DNase free water
16. Scale of Reactions Reaction Scale and Number of Reactions per Kit Reaction Scale and Downstream Applications TM The MethylMiner kit is designed to provide reagents for the enrichment of methylated DNA from up to 25 micrograms of fragmented double stranded input DNA If you are starting with 5 ng to 1 ug of input DNA per reaction the kit provides sufficient reagents for 25 separate capture reactions However the reagents and protocol are fully scalable you can use as much as 25 ug of input DNA in a single reaction Each capture reaction uses 10 pl of beads per microgram of input DNA The protocol in this manual provides separate volumes and guidelines for the capture and elution of methylated DNA from the following input ranges e 5ng to 1 pg of input DNA 25 capture reactions per kit e gt l pg to 10 pg of input DNA 2 22 capture reactions per kit e gt 10 pg to 25 ug of input DNA 1 2 capture reactions per kit For downstream analyses like PCR and qPCR as little as 5 ng of input DNA can be used For applications that require larger amounts of methylated DNA such as library construction for high throughput sequencing or amplification and labeling for microarray analysis starting amounts of 10 25 ug of fragmented input DNA are most appropriate though in some cases as little as 1 ug can be used Typical total yields of mammalian CpG methylated DNA are 3 20 of the input mass of DNA or 0 3 5 0 ug when starting with 10 25 p
17. accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com 31 References Cross S H Charlton J A Nan X and Bird A P 1994 Purification of CpG islands using a methylated DNA binding column Nat Genet 6 236 244 Fraga M F Ballestar E Montoya G Taysavang P Wade P A and Esteller M 2003 The affinity of different MBD proteins for a specific methylated locus depends on their intrinsic binding properties Nucleic Acids Res 31 1765 1774 Gebhard C Schwarzfischer L Pham T H Andreesen R Mackensen A and Rehli M 2006 Rapid and sensitive detection of CpG methylation using methyl binding MB PCR Nucl Acids Res 34 e82 Gebhard C Schwarzfischer L Pham T H Schilling E Klug M Andreesen R and Rehli M 2006 Genome wide profiling of CpG methylation identifies novel targets of aberrant hypermethylation in myeloid leukemia Cancer Research 66 6118 6128 Jacinto F V Ballestar E and Esteller M 2008 Methyl DNA immunoprecipitation MeDIP Hunting down the DNA methylome Biotechniques 44 35 37 39 passim Lister R O Malley R C Tonti Filippini J Gregory B D Berry C C Millar A H and Ecker J
18. ck catalog no 123 20D Rotating mixer for end over end rotation of tubes containing the Dynabeads during binding and wash steps Vortex mixer 1 7 ml DNase free microcentrifuge tubes Pipettes and DNase free pipette tips DNase free water 3 M Sodium Acetate pH 5 2 100 ethanol 70 ethanol Overview of the System Overview of the MethylMiner Kit Advantages of the System The MethylMiner Methylated DNA Enrichment Kit is designed for the enrichment and fractionation of methylated double stranded DNA dsDNA based on the degree of methylation Methylated DNA is isolated from fragmented whole genomic DNA 5 ng 25 ug via binding to the methyl CpG binding domain of human MBD2 protein which is coupled to paramagnetic Dynabeads M 280 Streptavidin via a biotin linker The methylated fragments can then be eluted as a single enriched population with a 2000 mM NaCl elution buffer or into distinct subpopulations based on the degree of methylation by increasing the NaCl concentration of the elution buffer from 200 mM to 2000 mM in a stepwise gradient In a stepwise gradient elution the lower salt fractions contain fragments with fewer methyl groups while higher salt fractions contain more highly methylated DNA The high affinity of MethylMiner MBD Biotin Protein for CpG methylated DNA provides greater sensitivity than antibody binding while the use of Dynabeads provides for a simplified streamlined workflow The kit provides ma
19. d downstream applications or store the DNA at 20 C or below until further use 25 Downstream Analysis Types of Analysis The recovered DNA in each fraction is largely double stranded and is ready for analysis by e Cloning and Sanger sequencing e Bisulfite conversion followed by PCR amplification cloning and sequencing The MethylCode Bisulfite Conversion Kit is available separately from Invitrogen see page 29 for ordering information e Methylation sensitive assays e Locus detection by endpoint PCR e Locus detection and quantification by real time PCR e Library construction for high throughput sequencing e Amplification and labeling for microarray based profiling Expected You should observe the following results for the control reaction based on Endpoint PCR and detection by endpoint PCR or qPCR using the PCR primer sets specific for each qPCR Results control DNA duplex oe gt e The Non Methylated DNA duplex will not be captured by the beads i e ontrols gt 70 will remain in the supernatant e The Methylated DNA duplex will be tightly bound by the beads and require a high ionic strength elution buffer e g NaCl at 1000 mM to release gt 70 from the beads Example qPCR The percent recovery in the graph below was determined by qPCR The elution Results for a pattern as determined by 27 cycles of PCR is shown in the 4 agarose gel Control Reaction imag
20. d the following 1X Bind Wash Buffer Magnet or magnetic rack Rotating mixer 1 7 ml DNase free microcentrifuge tubes Pipettes and DNase free pipette tips DNase free water Ice Prepared Elution Buffers Be sure to have your elution buffer s prepared and ready to add to the beads before you perform the protocol below After performing the final wash step immediately proceed to Eluting the Captured DNA starting on page 18 and add elution buffer to prevent the beads from drying out After mixing the DNA and MBD beads Methylated DNA Capture pages 18 19 place the tube on the magnetic rack for 1 minute to concentrate all of the beads on the inner wall of the tube With the tube in place on the magnetic rack remove the supernatant liquid with a pipette without touching the beads with the pipette tip and save it in a clean DNase free microcentrifuge tube This saved supernatant is the non captured DNA supernatant fraction Store this sample on ice Add 200 ul of 1X Bind Wash Buffer to the beads to wash the beads of residual non captured DNA Mix the beads on a rotating mixer for 3 minutes Place the tube on the magnetic rack for 1 minute to concentrate all of the beads on the inner wall of the tube With the tube in place on the magnetic rack remove the liquid with a pipette without touching the beads with the pipette tip and save it ina clean DNase free microcentrifuge tube This saved liquid is a non captured DNA wash frac
21. dance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Limited Use Label License No 5 Invitrogen Technology The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its com
22. der 100 applications 10488 043 EXPRESS SYBR GreenER qPCR Supermix Universal 200 rxns 11784 200 1000 rxns 11784 01K EXPRESS qPCR Supermix Universal 200 rxns 11785 200 1000 rxns 11785 01K Platinum PCR SuperMix High Fidelity 100 rxns 12532 016 500 rxns 12532 024 UltraPure DEPC treated Water 4 x 100 ml 750024 1L 750023 UltraPure DNase RNase Free Distilled Water 10 x 500 ml 10977 023 Applied Applied Biosystems has a wide range of industry standard instruments Biosystems reagents and other products for real time PCR Visit their website at Products for Real www appliedbiosystems com Time PCR 29 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAOs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 95
23. duction Materials Needed Important Note Resuspending Dynabeads Removing Liquid from Dynabeads 14 In this step you couple the MBD Biotin Protein to the Dynabeads M 280 Streptavidin The following materials are supplied by the user e 1X Bind Wash Buffer prepared from 5X Bind Wash Buffer see next page e 17 ml DNase free microcentrifuge tubes e Pipettes and DNase free pipette tips e Magnet or magnetic rack e g DynaMag 2 or DynaMag Spin Magnetic Rack recommended see page 29 for ordering information e Rotating mixer Always keep the following in mind when working with Dynabeads e Never mix Dynabeads by vortexing as this will damage the beads e Never freeze Dynabeads as this will damage the beads e When removing liquid from Dynabeads avoid touching the beads with the pipette tip This will disturb the bead pellet e Donot allow the beads to dry out Resuspend the beads within 1 minute of removing any liquid from them Before proceeding we recommend reading through the entire protocol to determine the volumes of beads and 1X Bind Wash Buffer you will need for the number and size of reactions you are performing To resuspend Dynabeads use gentle up and down pipetting while taking care to avoid creating air bubbles Never mix the beads by vortexing After resuspension mix the beads by gently inverting the tube using continuous slow rotation To remove liquid from Dynabeads 1
24. e DNA on a rotating mixer for 1 hour at room temperature alternatively you can mix overnight at 4 C If you will be eluting in a stepwise gradient of increasing NaCl concentration prepare the buffers while the beads are mixing by proceeding to Preparing Buffers for a Step wise Elution Series page 20 Otherwise continue to Removing the Non Captured DNA page 21 1 Toaclean 1 7 ml DNase free microcentrifuge tube add 100 ul of 5X Wash Bind Buffer Note Be sure to use 5X buffer in this step not 1X buffer 2 Add gt 1 10 ug of fragmented sample DNA at a concentration of 25 ng ul to the tube added volume will be 40 400 pl 3 Bring the final volume to 500 ul with DNase free water Transfer the DNA buffer mixture to the tube containing the MBD beads trom Wash the MBD beads page 16 Step 8 5 Mix the MBD beads with the DNA on a rotating mixer for 1 hour at room temperature alternatively you can mix overnight at 4 C If you will be eluting in a stepwise gradient of increasing NaCl concentration prepare the buffers while the beads are mixing by proceeding to Preparing Buffers for a Step wise Elution Series page 20 Otherwise continue to Removing the Non Captured DNA page 21 Continued on next page Incubating MBD Beads with Fragmented DNA Continued Capture Reaction gt 10 ug 25 ug Input DNA Control Capture Reaction with 1 ug of K 562 DNA To a clean 1 7 ml DNase free microcentrifuge tube add 250 ul of
25. er reete sanken nn ah het eere hin 31 References a ar M OR TR 32 Kit Contents and Storage Kit Components Sufficient components are provided for the enrichment of methylated DNA from and Storage up to 25 micrograms of fragmented input DNA If you are starting with 5 ng to 1 ug of input DNA per reaction the kit provides reagents for 25 separate capture reactions See Reaction Scale and Number of Reactions per Kit page 11 Dynabeads M 280 Streptavidin 250 ul Wet ice 4 C Do not freeze Low Salt Elution Buffer contains no NaCl 2x 50 ml High Salt Elution Buffer 2000 mM NaCl 2 x 50 ml MBD Biotin Protein 0 5 mg ml 200 pl Glycogen 20 ug ul 200 pl 20 C Primers for Non Methylated Controls 100 uM each 20 ul Dry ice 20 C primer forward and reverse supplied as a mix Primers for Methylated Controls 100 uM each primer 20 ul Dry ice 20 C forward and reverse supplied as a mix Methylated DNA nel K 30 DNA 80 pg m 100 Product The Certificate of Analysis provides detailed quality control information for Qualification each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box Continued on next page Kit Contents and Storage Continued Control DNA Below are the sequences for the Methylated and Non Methylated DNA control Sequences duplexes and associated primer
26. es Recovery of Methylated and Non Methylated DNA 10 pg each control duplex diluted into 1 ug sheared K562 120 100 80 60 40 20 0 ra am Y Unbound 200 mM 450 mM 600 mM 1000 mM Z Methylated B Non Methylated Continued on next page 26 Downstream Analysis Continued Example Endpoint One microliter each of input unbound and eluted DNA 1 60th of ethanol PCR Results fora precipitation reaction from a control reaction were subjected to 27 cycles of Control Reaction PCR with Platinum PCR SuperMix High Fidelity Catalog no 12532 016 and the appropriate primer mix Twenty percent 10 ul of each reaction was loaded onto E Gel 4 High Resolution Agarose Gels Catalog no G018 04 in parallel with a 50 bp DNA Ladder Catalog no 10416 014 The lanes are as follows 1 RON DON ON 50 bp ladder Fragmented K 562 human genomic DNA Mix of Non Methylated and Methylated DNA Input DNA K 562 DNA mix of Non Methylated and Methylated DNA Non captured unbound DNA fraction 200 mM NaCl elution fraction 450 mM NaCl elution fraction 600 mM NaCl elution fraction 1000 mM NaCl elution fraction Thermocycling conditions were Non Methylated Methylated Step 1 94 C for 2 min Step 2 94 C for 15 sec Step 3 55 C for 15 sec Step 4 68 C for 30 sec Step 5 Repeat steps 2 4 for 26 times Step 6 68 C for 5 min Step 7 4 C hold 1 2 3 4 5 6 7 8 9 100 bp 50 bp 100
27. g In many cases the preferred elution strategy for downstream analysis will be a single fraction with the High Salt Elution Buffer 2000 mM NaCl provided in the kit However multiple fractions are also possible see Elution Strategies next page For example with MCF 7 cells a human breast cancer derived cell line we have observed that after washing approximately equal masses of different populations of captured DNA can be eluted from MBD beads by successive elutions with a buffer containing 500 mM NaCl followed by a buffer containing 1000 mM NaCl 11 Elution Strategies Elution Strategies 12 TM One flexible feature of the MethylMiner kit is the different elution strategies that can be used with it A single elution with High Salt Elution Buffer that contains 2000 mM NaCl This will elute 70 90 of the mass of CpG methylated dsDNA that is captured The eluted DNA can be directly precipitated with ethanol resuspended in the buffer of choice and used in most downstream analysis workflows Note that antibody based capture methods are not compatible with this elution strategy A multi fraction elution with a step wise series of buffers of increasing NaCl concentration CpG methylated DNA elutes from the beads as a function of the number of methylation sites per molecule and ionic strength higher salt concentrations release dsDNA molecules that have greater amounts of CpG methylation To elute the DNA into distinct populati
28. g 350 mM NaCl in the example table on page 20 Incubate the beads on a rotating mixer for 3 minutes Place the tube on the magnetic rack for 1 minute to concentrate all of the beads on the inner wall of the tube With the tube in place on the magnetic rack remove the liquid with a pipette without touching the beads with the pipette tip and save it in a clean DNase free microcentrifuge tube Label this tube Elution 2a and store on ice Repeat Steps 6 9 once collecting second sample in a different tube Pool the two elution samples Elution 2a and 2b into one tube and label the tube Elution 2 the total volume will be 400 ul Store this sample on ice Repeat Steps 6 10 using each successively higher NaCl concentration buffer and numbering the collected samples accordingly Elution 3 4 etc until all elutions have been completed Proceed to Ethanol Precipitation page 25 Continued on next page 23 Eluting the Captured DNA Continued Multi Fraction Use the following protocol if you started with gt 1 25 ug input DNA Elution Immediately after removing the non captured DNA from the beads Removing gt 1 25 ug Input Non Captured DNA from the Beads Step 7 page 21 elute the captured DNA DNA as multiple fractions with step wise increases in NaCl concentration as follows 1 Resuspend the beads in 400 ul of the lowest NaCl concentration Elution 10 11 Buffer that you have prepared e g 200 mM NaCl in t
29. he example table on page 20 Incubate the beads on a rotating mixer for 3 minutes Place the tube on the magnetic rack for 1 minute to concentrate all of the beads on the inner wall of the tube With the tube in place on the magnetic rack remove the liquid with a pipette without touching the beads with the pipette tip and save it ina clean DNase free microcentrifuge tube Label this tube Elution 1a and store on ice Repeat Steps 1 4 twice collecting each sample in a different tube Label these tubes Elution 1b and Elution 1c and place on ice Resuspend the beads in 400 pl of the next higher NaCl concentration Elution Buffer that you have prepared e g 350 mM NaCl in the example table on page 20 Incubate the beads on a rotating mixer for 3 minutes Place the tube on the magnetic rack for 1 minute to concentrate all of the beads on the inner wall of the tube With the tube in place on the magnetic rack remove the liquid with a pipette without touching the beads with the pipette tip and save it in a clean DNase free microcentrifuge tube Label this tube Elution 2a and store on ice Repeat Steps 6 9 twice collecting each sample in a different tube Label these tubes Elution 2b and Elution 2c and place on ice Repeat Steps 6 10 using each successively higher NaCl concentration buffer and numbering the collected samples accordingly Elution 3a 3b 3c 4a 4b 4c etc until all elutions have been comp
30. leted Proceed to Ethanol Precipitation page 25 24 Ethanol Precipitation Introduction Materials Needed DNA Cleanup and Concentration by Ethanol Precipitation In this step you clean up the DNA from all non captured wash and elution fractions via ethanol precipitation In addition to the kit components you will need the following E GT E OS A gt 11 3 M Sodium Acetate pH 5 2 100 ethanol 70 ethanol Ice To each non captured wash and elution fraction from the previous steps add the following components 1 ul Glycogen 20 ug ul included in kit 1 10th sample volume of 3 M sodium acetate pH 5 2 e g 40 ul per 400 ul of sample 2 sample volumes of 100 ethanol e g 800 ul per 400 ul of sample Mix well and incubate at 80 C for at least 2 hours Centrifuge the tube for 15 minutes 212 000 x g at 4 C or room temperature Carefully discard the supernatant without disturbing the pellet Add 500 ul of cold 70 ethanol Centrifuge the tube for 5 minutes 212 000 x g at 4 C or room temperature Carefully discard the supernatant without disturbing the pellet Repeat Steps 6 7 once and remove any remaining residual supernatant Air dry the pellet for 5 minutes do not completely dry the pellet Resuspend the DNA pellet in 60 ul of DNase free water or other appropriate volume of buffer or water as needed for specific downstream applications Place the DNA on ice and proceed to any desire
31. ons based on the degree of methylation you can generate a series of elution buffers of increasing NaCl concentration The Low Salt Buffer and High Salt Buffer are mixed at differing ratios as described in the protocol to create buffers containing from 200 to 2000 mM NaCl This capacity to easily fractionate the CpG methylated DNA into sub populations is another feature that antibody based methods lack Each elution protocol is provided in Eluting the Captured DNA page 22 DNA Isolation and Fragmentation Isolating Genomic DNA Important General Handling of DNA DNA Yield DNA Fragmentation DNA Length TM Isolate DNA using your method of choice The PureLink Genomic DNA Mini Kit is a complete kit for the isolation of genomic DNA See page 29 for ordering information A wide range of ChargeSwitch Genomic DNA purification kits is also available from Invitrogen Be careful to preserve the double stranded nature of the DNA MBD Biotin Protein will not effectively bind single stranded DNA When handling DNA use sterile conditions to ensure that no DNases are introduced All equipment that comes into contact with DNA should be sterile and DNase free including pipette tips microcentrifuge tubes and pipettes Be sure pipette barrels are clean and treated with ethanol TM DNA yield can be estimated by UV absorbance at 260 nm or using Quant iT dsDNA Assay Kits UV Absorbance 1 Measure the A of the solution using
32. ou can perform e Asingle elution with undiluted High Salt Elution Buffer containing 2000 mM NaCl e A series of step wise elutions with buffers containing successively greater NaCl concentrations which will fractionate the DNA based on the degree of methylation These options are illustrated in the figure below CH CH Genomic DNA fragments CH 5 ng to 25 ug CH CH 2 CH ee Fe CH CH 3 Capture CpG methylated dsDNA on beads CH C as H CH Cs CH Streptavidin Dynabeads Fractionate CoG methylated OR dsDNA with steps of increasing NaCl Elute CoG methylated dsDNA as a single fraction with 2 M NaCl CH CH CH CH CH CH LL LL CH CH Analyze DNA bisulfite conversion by PCR qPCR sequencing microarrays or other assays Continued on next page 9 Overview of the System Continued System Workflow Diagram 10 Wash Dynabeads Y Bind MBD Biotin to beads Y Wash MBD beads Isolate and fragment dsDNA using method of choice Prepare controls Incubate MBD beads with fragmented dsDNA y Prepare elution buffers v Remove non captured DNA Single high salt elution Multi fraction elution with step wise NaCl gradient Ethanol precipitation Y Downstream analysis Methods
33. ponents for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to
34. s Methylated DNA Control Duplex 5 GCTATACAGGGMGTGTTAAMGATATAAMGTTTTGGCTMGACCAGTGACMGGACTCTMGTTCCTACCAGMGCAAMGCCCCC 3 3 CGATATGTCCCGMACAATTGMTATATTGMAAAACCGAGMTGGTCACTGGMCTGAGAGMAAGGATGGTCGMGTTGMGGGGG 5 M 5 methyl C Methylated CpG dinucleotides are shaded in gray Primer sequences are underlined Amplified product length 65 bp Non Methylated DNA Control Duplex 5 GGCCCGGCGGTCGCCACACCAATTCGTTACTCAGGGACGTTACCACGGCTACTATCGTCGCAATTCAGTCAGGGATCTCG 3 3 CCGGGCCGCCAGCGGTGTGGTTAAGCAATGAGTCCCTGCAATGGTGCCGATGATAGCAGCGTTAAGTCAGTCCCTAGAGC 5 Non methylated CpG dinucleotides are shaded in gray Primer sequences are underlined Amplified product length 69 bp Forward Primer for Methylated DNA Control 22 bases 5 ACA GGG CGT GTT AAC GAT ATA A 3 Reverse Primer for Methylated DNA Control 20 bases 5 CGC TGG TAG GAA CGA GAG TC 3 Forward Primer for Non Methylated DNA Control 24 bases 5 GTC GCC ACA CCA ATT CGT TAC TCA 3 Reverse Primer for Non Methylated DNA Control 24 bases 5 AGA TCC CTG ACT GAA TTG CGA CGA 3 Materials Supplied by the User Materials Supplied In addition to the kit components you should have the following items on by the User hand before using this kit Ordering information for Invitrogen products listed below is provided on page 29 Magnet or magnetic rack e g the DynaMag 2 catalog no 123 21D or DynaMag Spin Magnetic Ra
35. t tube This ensures complete gt 95 elution of the DNA that can be eluted at this ionic strength Store each sample on ice Proceed to Ethanol Precipitation page 25 Continued on next page Eluting the Captured DNA Continued Multi Fraction Use the following protocol if you started with lt 1 ug input DNA Elution Immediately after removing the non captured DNA from the beads Removing lt 1 ug Input DNA Non Captured DNA from the Beads Step 7 page 21 elute the captured DNA as multiple fractions with step wise increases in NaCl concentration as follows 1 10 11 Resuspend the beads in 200 ul of the lowest NaCl concentration Elution Buffer that you have prepared e g 200 mM NaCl in the example table on page 20 Incubate the beads on a rotating mixer for 3 minutes Place the tube on the magnetic rack for 1 minute to concentrate all of the beads on the inner wall of the tube With the tube in place on the magnetic rack remove the liquid with a pipette without touching the beads with the pipette tip and save it ina clean DNase free microcentrifuge tube Label this tube Elution 1a and store on ice Repeat Steps 1 4 once collecting the second sample in a different tube Pool these two elution samples Elution 1a and 1b into one tube and label the tube Elution 1 the total volume will be 400 pl Resuspend the beads in 200 pl of the next higher NaCl concentration Elution Buffer that you have prepared e
36. terials for 25 affinity based separations when starting with 5 ng 1 pg of fragmented genomic input DNA and is scalable up to a single separatation using 25 ug of input DNA The methlyated DNA may be eluted into as many as 8 fractions per separation With only minor processing the methylated dsDNA is ready for downstream analysis by a variety of methods including endpoint and real time PCR assays bisulfite conversion followed by amplification cloning and sequencing direct sequencing library preparation for high throughput sequencing labeling for DNA microarray analysis and methylation sensitive restriction enzyme based assays TM e High affinity binding of the MethylMiner MBD Biotin Protein provides greater sensitivity than antibody based methods e Use of MBD biotin allows fractionation of the sample based on CpG methylation density allowing you to better focus on regions of interest e Capture of dsDNA facilitates ligation of double stranded adaptors for high throughput sequencing e Different elution methods support a wide range of downstream applications e Simple streamlined protocol can yield enriched fractions in less than 4 hours e High quality reagents and materials such as Dynabeads ensure consistent results Continued on next page Overview of the System Continued Experimental MethylMiner allows for different elution strategies depending on your Illustration preferred workflow and downstream application Y
37. the MBD beads with the DNA on a rotating mixer for 1 hour at room temperature alternatively you can mix overnight at 4 C If you will be eluting in a stepwise gradient of increasing NaCl concentration prepare the buffers while the beads are mixing by proceeding to Preparing Buffers for a Step wise Elution Series next page Otherwise continue to Removing the Non Captured DNA page 21 19 Preparing Buffers for a Multi Fraction Elution Series Step wise Elution Buffers CpG Methylated DNA that has been captured on the MBD beads can be eluted from the beads in a single or multiple fractions as described in Elution Strategies on page 12 To elute the CpG methylated DNA as a single fraction use the undiluted High Salt Elution Buffer 2000 mM NaCl To fractionate the CpG methylated DNA into distinct populations based on the number of methylation sites per molecule you can use a step wise elution with a series of buffers of increasing NaCl concentration Two stock buffers are provided to prepare such a series of buffers e Low Salt Elution Buffer contains no NaCl 0 mM e High Salt Elution Buffer contains 2000 mM NaCl These two stock buffers differ only in their NaCl concentrations To achieve any desired concentration of NaCl up to 2000 mM simply mix the two buffers in the appropriate ratio In practice buffers ranging from 200 mM NaCl to 2000 mM NaCl work best since the Bind Wash buffer contains approximately 160 mM NaCl
38. tion Store this sample on ice For capture reactions of lt 1 ug of input DNA Repeat steps 3 6 once more to obtain two wash fractions in total Store each sample on ice For capture reactions of gt 1 ug 25 ug input DNA Repeat steps 3 6 three more times to obtain four wash fractions in total Store each sample on ice Important After collecting the final wash fraction immediately proceed to Eluting the Captured DNA starting on page 18 and resuspend the beads in elution buffer to prevent the beads from drying out Pool the first and second wash fractions together and label Wash A If applicable pool the third and fourth wash fractions and label Wash B Note Pooling the wash fractions is not mandatory but is suggested as a matter of convenience prior to ethanol precipitation 21 Eluting the Captured DNA Introduction Materials Needed Note Single Fraction Elution with 2000 mM NaCl 22 This section provides protocols for eluting with NaCl either as a single fraction or multiple fractions In addition to the kit components you will need the following Prepared Elution Buffers Magnet or magnetic rack Rotating mixer 1 7 ml DNase free microcentrifuge tubes Pipettes and DNase free pipette tips DNase free water For x1 ug input DNA perform each NaCl elution at each ionic strength twice to ensure complete 29576 removal of DNA from beads For gt 1 ug input DNA perform each elution three times
Download Pdf Manuals
Related Search