Home

BaseSpace Onsite User Guide - Support

Contents

1. Active Storage Archive Storage Deleted Items Total Active Storage Storage Use By Owners Type State Project Owner Last Modifie Storage Status Size Sample Complete DefaultPr Admin User a month a Active 193 3 GB Mm Archive or Backup Analysis To archive or backup an analysis perform the following 1 Under Storage go to the Archive Storage tab 2 Select the analysis 3 Click Archive 4 A dialog box appears asking you if you want to keep the data in active storage Ifyou keep the data in active storage you can keep working with the analysis while making a backup in the archive Ifyou do not keep the analysis in active storage the data are archived and you cannot work with the analysis in BaseSpace Onsite You can always move it back to active storage as described in Restore Analysis From Archive on page 78 Maximum speed for archiving is 25 Mb s so it does not interfere with other BaseSpace Onsite tasks Restore Analysis From Archive To restore an analysis from archive to active status perform the following 1 Under Storage go to the Archive Storage tab 2 Select the analysis 3 Click Unarchive If there is sufficient free space BaseSpace Onsite restores the analysis If there is not enough space BaseSpace Onsite displays an error message gg NOTE a You cannot restore an archived item that has been deleted and purged fromBaseSpace Onsite Set Up Archive Location To set up an archive location p
2. Each read has passed filter The uploader rejects any upload session containing files that do not meet the requirements If a file is rejected a message is provided This message states why the upload failed and what to do to remedy the problem Transfer Owner What is it A method to hand control of data over to a collaborator or customer BaseSpace Onsite v2 0 System Guide 6 7 y suo soedseseg snN oL MoH 68 When to use it If you want to give control of your data to a collaborator You can only transfer data to collaborators who have an account on the same BaseSpace Onsite When to use it If items from a project are in the trash you cannot transfer ownership of the project How to use it 1 Select the project or run you want to transfer Project a Click the Projects icon b Click the desired project c Click the Transfer Owner button Run a Click the Runs icon b Click the desired run c Click the More button and then select the Transfer Ownership option 2 Enter new owner email and an optional message in the Transfer Ownership dialog box 3 Click Continue Delete Items You can delete items in a 2 step process 1 Move the item to trash 2 Clean up the trash The actions that can be performed are described in the following topics Delete Run on page 68 Delete Project on page 69 Delete Analysis on page 70 Delete Sample on page 70 Empty Trash on page 71 Restore Trash on page 71 Delete Run What
3. Power supply number Power supply number Power supply number Chassis Back Panel Board Chassis Back Panel Board Processor number C Processor number C BaseSpace Onsite v2 0 System Guide Message Fan number 5 is functioning The number C AC power supply is no longer available The number C AC power supply has just been connected The number C AC power supply has recovered from failure The number C AC power supply has detected a failure The number C AC power supply has recovered from a predictive failure The number C AC power supply has detected a predictive failure The number C AC power supply has been lost The number C AC power supply has been restored The number C AC power supply has resolved the configuration error for a vendor mismatch The number C AC power supply has detected a configuration error for a vendor mismatch The number C AC power supply has resolved the configuration error for a revision mismatch The number C AC power supply has detected a configuration error for a revision mismatch The number C AC power supply has resolved the configuration error for a missing processor The number C AC power supply has detected a configuration error for a missing processor The number C AC power supply has resolved an unexpected configuration error The number C AC power supply has detected an unexpected configuration error The panel board in the back of the chassis has changed
4. Use this option of you want to share your run easily with collaborators Use this option if you want to be able to control who has access to the run Why to use it Use this option if you want to be able to control who has access to the run How to use it 1 Click the Runs icon 2 Click the desired run 3 Click the Share button E2 Share 4 In the Share Settings dialog box enter the collaborators email address and click the Invite button iy NOTE The invitation email address must match your BaseSpace Onsite login email address or else your collaborator is not able to view the project 5 4 Click the Save Settings button i NOTE Runs and projects have separate permissions If you share a run the project associated with that run is not shared automatically meaning samples and app results are not accessible to collaborators of the run Project and Sample Management 64 The following topics describe how to manage projects and samples in BaseSpace Onsite Edit Project Details What is it The way to edit project details When to use it Use this option when you want to change details regarding the project such as the description or project name Why to use it Use this option if you have to edit the project name or description How to use it 1 Click the Projects icon Part 15049148 Rev E 2 Click the desired project 3 Click the Edit Project button 4 Change project details in the Edit Project dialog
5. Explore and isolate key variants Categorize variants and determine biological impact How to use it Launch the VariantStudio app the following way 1 Click the Apps button Ei 2 Select the VariantStudio app from the list and click Launch 3 Select the project you want to run the app on You can only select projects you own 4 Click Continue BaseSpace Onsite v2 0 System Guide af S1ISUE soedseseg snN OL MOH 5 If you use the app for the first time install VariantStudio a Click the Install VariantStudio button b Run the setup exe file Your web browser can ask you to save the file first After the download has completed double click the setup file c Ifyou are prompted with a security warning click Install 6 Click the Launch VariantStudio The VariantStudio application opens on your desktop with the requested project loaded For instructions on how to run VariantStudio see the VariantStudio User Guide Enrichment v2 1 Apps Adapter Trimming BWA Enrichment v2 1 and Isaac Enrichment v2 1 Apps do not support adapter trimming in this BaseSpace Onsite release Here are some notes on the use of these apps NextSeq You do not need to use adapter trimming for NextSeq data in any of the secondary analysis apps Adapter trimming is performed automatically in FASTQ generation based on the library prep kit type selected during run setup in the Prep Tab workflow HiSeq You can go back to the uploaded run and requeue FASTQ genera
6. INFO The possible entries in the INFO column e AD Entry of the form X Y where X is the number of reference calls Y the number of alternate calls e CD A flag indicating that the SNP occurs within the coding region of at least one RefGene entry e DP The depth number of base calls aligned to this position e GI A comma separated list of gene IDs read from RefGene e NL Noise level an estimate of base calling noise at this position e TI A comma separated list of transcript IDs read from RefGene e SB Strand bias at this position e VF Variant frequency The number of reads supporting the alternate allele POS The 1 based position of this variant in the reference chromosome The convention for VCF files is that for SNPs this base is the reference base with the variant For indels or deletions this base is the reference base immediately before the variant Variants are in order of position QUAL A Phred scaled quality score assigned by the variant caller Higher scores indicate higher confidence in the variant and lower probability of errors For a quality score of Q the estimated probability of an error is 10 Q 10 For example the set of Q30 calls has a 0 1 error rate Many variant callers assign quality scores based on their statistical models which are high relative to the error rate observed in practice REF The reference genotype For example a deletion of a single T can read reference TT and alternate T
7. Illumina has no obligation to defend indemnify or hold harmless Purchaser for any Illumina Infringement Claim to the extent such infringement arises from i the use of this Product in any manner or for any purpose outside the scope of research use purposes ii the use of this Product in any manner not in accordance with its Specifications its Documentation the rights expressly granted to Purchaser hereunder or any breach by Purchaser of these terms and conditions iii the use of this Product in combination with any other products materials or services not supplied by Illumina iv the use of this Product to perform any assay or other process not supplied by Illumina or v Illumina s compliance with specifications or instructions for this Product furnished by or on behalf of Purchaser each of i v is referred to as an Excluded Claim Indemnification by Purchaser Purchaser shall defend indemnify and hold harmless Illumina its affiliates their non affiliate collaborators and development partners that contributed to the development of this Product and their respective officers directors representatives and employees against any claims liabilities damages fines penalties causes of action and losses of any and every kind including without limitation personal injury or death claims and infringement of a third party s intellectual property rights resulting from relating to or arising out of i Purchaser s breach of any
8. Inc All rights reserved If your NextSeq sequencing system and BaseSpace do not connect properly check the following Make sure that you have a stable connection of at least 10 Mbps upload speed from the NextSeq From the Manage Instrument screen select System Configuration to access a series of screens that configure the connection to BaseSpace Onsite Log in to BaseSpace Onsite when setting up the run on the NextSeq sequencing system NOTE When you bookmark the BaseSpace Onsite location in your browser make sure to bookmark the Dashboard page after logging on Do not bookmark the Login page Manage Users On the Users page you see a list of current BaseSpace Onsite accounts and their roles You can sort the users by the column headers To set up a new user click Add User and fill out the form 80 Part 15049148 Rev E Add New User Username Email Confirm Username Email First Name Last Name Role Cancel The new user gets an email with a link to set up a new password If the user does not get an email the user can go to the BaseSpace Onsite logon page and click Forgot Password to resend the email If you did not configure SMTP during install be aware of the following points You enter the password for the new user BaseSpace Onsite does not enforce usernames to be in the form of an email which can cause a problem with HiSeq integration Make sure to enforce that all users create a username in t
9. Isaac Enrichment v2 1 BWA Whole Genome Sequencing v1 BWA Enrichment v1 0 BWA Enrichment v2 1 Tumor Normal v1 0 TopHat Alignment v1 non multi launch version Cufflinks Assembly and Differential Expression v1 TruSeq Amplicon v1 1 TruSeq Long Reads v1 1 TruSeq Phasing v1 1 Amplicon DS v1 1 16S Metagenomics v1 0 8 Part 15049148 Rev E BaseSpace Onsite v2 0 System Guide For documentation see support illumina com sequencing sequencing_ software basespace documentation ilmn VariantStudio Illumina VariantStudio enables you to view annotation information for variants and transcripts and filter to the variants of interest in one easy to use application See Run the VariantStudio App on page 47 for instructions on launching this app and the BaseSpace VariantStudio User Guide for instructions for using the software application IGV Illumina has generated an app with the Integrative Genomics Viewer IGV of the Broad Institute for visualizing your sequence data in great detail See Launch the IGV App on page 46 for instructions for using this app Third party Apps Currently BaseSpace Onsite provides SPAdes Genome Assembler 3 0 and Novoalign Generic DNA pipeline For more information see the SPAdes or Novoalign App page on the Apps tab UOIONPOANU How Dol Start Make sure to have a compatible desktop computer BaseSpace Onsite v2 0 is compatible with IE 9 or higher Chrome 39 or higher Firefox 35 or higher and Safari 10 9 o
10. Project Toolbar The Project Toolbar provides the following actions Launch app run apps on your sample Clicking the app name leads to a page with more information about launching that app including access permissions See also Analyze Samples Further on page 45 Download Project download all files in a project Share project manage sharing a project with a particular collaborator See also Share a Project Using the Email Option on page 62 Get link forward the sharing link to any number of collaborators See also Share a Project with Get Link on page 61 Edit project edit the name and description of the project See also Edit Project Details on page 64 Transfer Owner hand control of data over to a collaborator or customer See also Transfer Owner on page 67 Options that are not available for the particular analysis or sample are grayed out If you have selected samples in the Samples pane you can perform additional actions Copy to copy samples from this project to another See also Copy Samples on page 66 Combine combine samples See also Combine Samples on page 65 i NOTE The app session states are defined as follows State Description Running The app is processing or uploading data Complete Processing and file upload has finished and the data are now available to use Aborted This AppResult or Sample has been aborted and cannot be resumed Needs Cannot continue without user intervention Attention Analyses Page The
11. b do not apply if the Documentation or Specifications for this Product state otherwise Purchaser agrees not to nor authorize any third party to engage in any of the following activities i disassemble reverse engineer reverse compile or reverse assemble the Product ii separate extract or isolate components of this Product or subject this Product or components thereof to any analysis not expressly authorized in this Product s Documentation iii gain access to or attempt to determine the methods of operation of this Product or iv transfer to a third party or grant a sublicense to any Software or any third party software Purchaser further agrees that the contents of and methods of operation of this Product are proprietary to Illumina and this Product contains or embodies trade secrets of Illumina The conditions and restrictions found in these terms and conditions are bargained for conditions of sale and therefore control the sale of and use of this Product by Purchaser Limited Liability TO THE EXTENT PERMITTED BY LAW IN NO EVENT SHALL ILLUMINA OR ITS SUPPLIERS BE LIABLE TO PURCHASER OR ANY THIRD PARTY FOR COSTS OF PROCUREMENT OF SUBSTITUTE PRODUCTS OR SERVICES LOST PROFITS DATA OR BUSINESS OR FOR ANY INDIRECT SPECIAL INCIDENTAL EXEMPLARY CONSEQUENTIAL OR PUNITIVE DAMAGES OF ANY KIND ARISING OUT OF OR IN CONNECTION WITH WITHOUT LIMITATION THE SALE OF THIS PRODUCT ITS USE ILLUMINA S PERFORMANCE HEREUNDER OR ANY OF THESE TERMS
12. collectively referred to as a run A run contains log files instrument health data run metrics sample sheet and base call information bcl files The base call information is demultiplexed in BaseSpace Onsite to create the samples used in secondary analysis Samples are analyzed by launching BaseSpace Onsite apps BaseSpace Onsite apps are processing software and routines that interact with BaseSpace Onsite data through the API The result files from an app session are stored in an analysis Analyses are created to record every time an app is launched For example when a resequencing app executes alignment and variant calling an analysis is created that contains the app results for each sample App results generally contain BAM and VCF files but they can also contain other file types App results can also be used as inputs to apps Finally projects are simple containers that store samples and analyses BaseSpace Onsite v2 0 System Guide T Figure 1 BaseSpace Onsite Data Model Runs Sequencing Sequencing Monitor and check the quality of your Run Run Sy Run x boss boob bo amp lt Samples Samples w Projects am ee Project your data 3 au Amplicon Resequencing Amplicon Resequencing Apps App result App result App result App result BaseSpace Onsite Apps BaseSpace Onsite provides the following apps Ilumina Core Apps for analysis of your samples Isaac Whole Genome Sequencing v2 Isaac Enrichment v1 0
13. restarting The hardware monitor has detected a timer interrupt The system cover has been opened The system cover has been closed The system has been unplugged from the network The system network connection has been restored The front panel board has detected a critical interrupt error The system board has detected a timeout The system board has recovered from a timeout There was a PEF Action detected Status Error OK Sse UILUPY Error Error Error Error Error Error Error OK Error Error Error Error Error Error OK Error OK Error Error OK Error 85 Error Code Item ID Item Name Message Status SB System Board The system board has detected that the power button has OK been pressed SB System Board The system board has detected that the reset button has OK been pressed VR Voltage Watchdog The voltage sensor has detected that the voltage is not Error within normal range VR Voltage Watchdog The voltage sensor has detected that the voltage is back OK within normal range F_ C Fan number C The fans are no longer redundant due to fan number C Error failing F_ C Fan number C The fans are no longer redundant due to fan number C Error failing F_ C Fan number C The fans are no longer redundant due to fan number C Error failing F_ C Fan number C The fans are no longer redundant due to fan number C Error failing F_ Fan number C The fans are no longer redundant due to f
14. 2 options Easy fix edit the sample sheet in the sample sheet editor BaseSpace Onsite keeps validating the sample sheet as you edit any remaining issues are displayed above the sample sheet editor More complex change use Illumina Experiment Manager IEM a If you have not installed IEM yet click the Illumina Experiment Manager IEM link and install IEM b Open IEM c Import the original sample sheet from your system in IEM and edit it or generate a new sample sheet See the Illumina Experiment Manager User Guide for instructions d Copy and paste the sample sheet into the Sample Sheet Editor in BaseSpace Onsite BaseSpace Onsite validates the sample sheet any issues are displayed above the sample sheet editor 3 When you are done editing and the sample sheet is valid click the Queue Analysis button and BaseSpace Onsite starts analyzing the run using the new sample sheet You can only resubmit a sample sheet and requeue the run one time L NOTE A If your edits result in an invalid sample sheet the Queue Analysis button is not available You can return to the original using the Load Original button BaseSpace Onsite v2 0 System Guide Fi 3 91ISUGD eoedseseg esp OL MOH 74 Common Sample Sheet Fixes If a sample sheet is invalid it could be because the genome path is not set up correctly This situation is indicated through the Genome Path Unknown Genome warning as in the example The paths of the standard BaseS
15. AND CONDITIONS HOWEVER ARISING OR CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE ILLUMINA S TOTAL AND CUMULATIVE LIABILITY TO PURCHASER OR ANY THIRD PARTY ARISING OUT OF OR IN CONNECTION WITH THESE TERMS AND CONDITIONS INCLUDING WITHOUT LIMITATION THIS PRODUCT INCLUDING USE THEREOF AND ILLUMINA S PERFORMANCE HEREUNDER WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE SHALL IN NO EVENT EXCEED THE AMOUNT PAID TO ILLUMINA FOR THIS PRODUCT Limitations on Illumina Provided Warranties TO THE EXTENT PERMITTED BY LAW AND SUBJECT TO THE EXPRESS PRODUCT WARRANTY MADE HEREIN ILLUMINA MAKES NO AND EXPRESSLY DISCLAIMS ALL WARRANTIES EXPRESS IMPLIED OR STATUTORY WITH RESPECT TO THIS PRODUCT INCLUDING WITHOUT LIMITATION ANY IMPLIED WARRANTY OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE NONINFRINGEMENT OR ARISING FROM COURSE OF PERFORMANCE DEALING USAGE OR TRADE WITHOUT LIMITING THE GENERALITY OF THE FOREGOING ILLUMINA MAKES NO CLAIM REPRESENTATION OR WARRANTY OF ANY KIND AS TO THE UTILITY OF THIS PRODUCT FOR PURCHASER S INTENDED USES Product Warranty All warranties are personal to the Purchaser and may not be transferred or assigned to a third party including an affiliate of Purchaser All warranties are facility specific and do not transfer if the Product is moved to another facility of Purchaser unless Illumina conducts such mo
16. About page provides a download containing the licenses for third party software components Manage Alarms on the Settings Page If there are problems with the hard drive BaseSpace Onsite sounds a loud alarm The Disable Alarm button on the Settings page allows you to turn off a current alarm See Replace Hard Drive on page 83 to continue x CAUTION Do not disable the alarm and ignore the warning Failure could lead to irretrievable data loss Replacement Procedures 82 You have received a spare hard drive and power supply module with the instrument If needed you can perform the replacement without calling Illumina using the instructions in this section To order more use the following part numbers Part Nomenclature Part Number Power Supply PSU 750W 1U CRPS 80PLUS PLATINUM 105355 Hard drive Hard Drive 2 TB SATA 6GB S 15049450S Part 15049148 Rev E Replace Power Supply Module 1 Remove the power cord from the power supply 2 Press the green and black tab and slide the power supply out Figure 13 Slide Power Supply Out 3 Push the new power supply into the slot and make sure that it is seated properly Figure 14 Reseat Power Supply 4 Attach the power cord to the power supply Replace Hard Drive 1 Lift the green tab on hard drive tray and then pull out the drive Figure 15 Lift Tab BaseSpace Onsite v2 0 System Guide 8 3 SYSE UILUDY Figure 16 Pull Drive Out 2 Remove the 3 screws on each
17. Click the Prep Libraries button in the top navigation bar Prep Libraries On the Prep Libraries page you assign indexes to biological samples based on the indexes available in the library preparation chosen Every used well or tube contains a separate library Best practice is to set up the libraries in BaseSpace Onsite first then you export a file of your library settings and use that to pipet the biological samples into the proper wells or tubes BaseSpace Onsite v2 0 System Guide A T y suo soedseseg snN oL MoH 28 ay NOTE f If you do not want to use indexed sequencing you stillhave to assign your biological sample to an index Only when you set up your sequencing run you specify that you do not sequence the index 1 Select the library prep type BaseSpace Onsite now automatically assigns indexes to wells or tubes depending on the format of the library prep type Figure 9 Tube Set Up for Single Index Library Preparation Kit 4 A001 4 A002 4 4003 4 A004 4 A005 4 A006 4 4007 4 A008 4 4009 4 A010 4 A014 4 A015 4 A016 4 A018 4 A019 4 A020 4 A021 4 A022 4 A023 4 4025 4 A027 Figure 10 Plate Set Up for Dual Index Library Preparation Kit 4 D701 4 D702 4 D703 4 D705 4 D706 4 D707 4 D708 4 D709 4 D710 4 D712 4 D501 4 D502 4 D503 4 D504 4 D505 4 D506 2 Enter the plate ID The ID has to be unique 3 Click the Auto Prep button to fill the p
18. How to use it The QScore Heatmap shows plots that allow you to view the QScore by cycle These plots have the following features The color bars to the right of each chart indicate the values that the colors represent The charts are displayed with tailored scaling the scale is always 0 to 100 of maximum value The symbol in the top right hand corner toggles the plot between pane view and full screen view You can expand a chart by clicking the expand button 2 View Run Samples List What is it The Run Samples List contains a list of all the samples in the run When to use it Use this option when you want to see a list of all the samples in the run Use this option when you want to navigate to details regarding a specific sample Why to use it Use this option if you want a quick way to view all the samples in a Run Use this option when you want to see more detail regarding your samples such as genome name sample or FASTQ files How to use it 1 Click the Runs icon 2 Click the desired run 3 There are 2 methods to go to the Run Samples List From the Runs Overview page click the Samples link From the Runs Overview page click the Samples icon from the left navigation menu 6 You can now click a sample to see the sample overview for more information see Sample Overview Page on page 23 Part 15049148 Rev E View Run Summary What is it The Run Summary page has the overall statistics about the run W
19. SAMPLE The sample column gives the values specified in the FORMAT column One MAXGT sample column is provided for the normal genotyping assuming the reference For reference a second column is provided for genotyping assuming the site is polymorphic See the Starling documentation for more details z NOTE i Variant files for Isaac also contain off target variant calls with filter FASTQ Files What is it BaseSpace Onsite converts bcl files into FASTQ files which contain base call and quality information for all reads passing filtering When to use it FASTQ files can be used as sequence input for alignment and other secondary analysis software When not to use it Do not use it with tools that are not compatible with the FASTQ format How to use it BaseSpace Onsite automatically generates FASTQ files in sample sheet driven workflow apps Other apps that perform alignment and variant calling also automatically use FASTQ files BaseSpace Onsite v2 0 System Guide D T y suo soedseseg snN oL MoH 58 Naming FASTO files are named with the sample name and the sample number which is a numeric assignment based on the order that the sample is listed in the sample sheet Example Data Intensities BaseCalls SampleName_S1_L001_R1_001 fastq gz SampleName The sample name provided in the sample sheet If a sample name is not provided the file name includes the sample ID which is a required field in the sample sheet an
20. To Use BaseSpace Onsite The following topics describe how to run different functions in BaseSpace Onsite View Files and Results on page 34 Analyze Samples Further on page 45 Download Files on page 48 Project and Sample Management on page 64 Search for Runs Projects Samples Files and Apps on page 75 Prepare a NextSeq Run What is it You can prepare NextSeq runs through the BaseSpace Onsite Prep tab which organizes samples libraries pools and run in a single environment You do not prepare HiSeq runs though BaseSpace Onsite When to use it Use this option if you want to prepare a sequencing run on a NextSeq instrument and have the data stream seamlessly to BaseSpace Onsite Do not use it to prepare sequencing runs for other instruments If you do have a NextSeq sequencing system but do not want to use BaseSpace Onsite you can also start a run straight on the instrument Why to use it Preparing a run in the Prep tab moves the data and analysis seamlessly to BaseSpace Onsite Using the Prep tab means BaseSpace Onsite is your single stop solution for sequencing management storage and analysis How to use it 1 Log in to BaseSpace Onsite If it is your first time logging in accept the user agreement 2 Click the Prep icon A 3 Set up a NextSeq run on the Prep Tab in 4 consecutive steps a Biological Samples Contains information about the samples that are going to be sequenced You can create samples import sa
21. files get added to the sample list and you can identify the new files by date oo N A oO A WO N Part 15049148 Rev E TIP f If you do not want to identify the samples by date you can also rename the sample_ID or assign the new FASTQ files to a new project in the Prep tab Search for Runs Projects Samples Files and Apps What is it The Search function allows you to find runs projects samples files and apps When to use it When you want to do a quick search for something Why to use it Use if there are a many runs and you want a quick way to search How to use it 1 Click the search icon a 2 Type in the run project or sample name in the search field and hit enter 3 Select the desired run project sample file or app in the search results You can also filter the search results by these categories using the drop down list at the right of the results page BaseSpace Onsite v2 0 System Guide T D y suo soedsSeseg snN oL MoH Admin Tasks The admin of BaseSpace Onsite has the following tasks Manage analysis notifications storage users system health planned runs software updates and alarms using the Admin Panel See Manage BaseSpace Onsite on page 76 for instructions Replace hard drive or power supply See Replacement Procedures on page 82 In addition BaseSpace Onsite sends an email alert if there is an issue with your system Error Codes on page 84 provides a list of possible codes and descript
22. have been error rated using PhiX starting at cycle 1 The percentage that aligned to the PhiX genome The calculated error rate as determined by the PhiX alignment Subsequent columns display the error rate for cycles 1 35 1 75 and 1 100 The average of the A channel intensity measured at the first cycle averaged over filtered clusters The corresponding intensity statistic at cycle 20 as a percentage of that value at the first cycle 100 x Intensity at cycle 20 Intensity at cycle 1 View the Project Sample List What is it The Project Sample List contains the list of samples in a project When to use it Use this option when you want to see a list of all the samples in the project Use this option when you want to navigate to details regarding a specific sample Why to use it This option is an easy way to get to the details page of a sample Part 15049148 Rev E How to use it 1 Click the Projects icon 2 Click the desired project 3 Click the Samples link from the left navigation menu You can now click a sample to see the sample overview for more information see Sample Overview Page on page 23 View the Analyses List What is it The Analyses List contains a list of app sessions in a project When to use it Use this option when you want to navigate to details regarding a specific app session Why to use it This option is an easy way to get to the details of a particular app session How
23. in slot C Disk at slot C is no longer online Error HD_ C Disk in slot C Disk at slot C is back online OK HD_ C Disk in slot C Disk at slot C is no longer working HD_ C Disk in slot C Disk at slot C is no functioning correctly again LV_ B Logical volume B with The logical volume at B size C D is not currently active Error capacity C D 88 Part 15049148 Rev E Technical Assistance For technical assistance contact Illumina Technical Support Table 2 Ilumina General Contact Information Website www llumina com Email techsupport illumina com Table 3 Illumina Customer Support Telephone Numbers Region Contact Number Region Contact Number North America 1 800 809 4566 Italy 800 874909 Australia 1 800 775 688 Netherlands 0800 0223859 Austria 0800 296575 New Zealand 0800 451 650 Belgium 0800 81102 Norway 800 16836 Denmark 80882346 Spain 900 812168 Finland 0800 918363 Sweden 020790181 France 0800 911850 Switzerland 0800 563118 Germany 0800 180 8994 United Kingdom 0800 917 0041 Ireland 1 800 812949 Other countries 44 1799 534000 Safety Data Sheets Safety data sheets SDSs are available on the Illumina website at support illumina com sds html Product Documentation Product documentation in PDF is available for download from the Illumina website Go to support illumina com select a product then click Documentation amp Literature BaseSpace Onsite v2 0 System Guide SOUEISISSY EIIUUOS Illumina San
24. in the Run Details area It contains links to the Overview Run Samples List Charts Run Summary Indexing OC Run Settings and Files pages Run Samples List The samples list allows you to sort the samples in your run based on sample ID app date created and project If you want to look at a sample app result or project in detail click the links to get to the following pages BaseSpace Onsite v2 0 System Guide 2 1 9IeNalUu JOST SUSUE eoedSeseg Sample Overview Page on page 23 Analyses Page on page 23 Project Overview Page on page 22 In addition there is a Side Navigation ribbon which provides easy navigation in the Run Details area It contains links to the Overview Run Samples List Charts Run Summary Indexing QC Run Settings and Files pages Projects Tab 22 The Projects button opens a list of your projects You can sort the list by name last update or owner Clicking a project provides access to the app results and samples within that project Fe Projects You manage the projects by using the buttons above the list New Project Generate a new project See also Set Up a New Project on page 65 Edit project Edit the name and description of the project See also Edit Project Details on page 64 Share Project Manage sharing a project with a particular collaborator See also Share a Project Using the Email Option on page 62 Get Link Forward the sharing link to any number of collaborators Se
25. is run in the lane this chart is not available The estimated percentage of molecules in a cluster for which sequencing falls behind phasing or jumps ahead prephasing the current cycle within a read The percentage of reads from clusters in each tile that aligned to the PhiX genome The percentage of reads that align perfectly as determined by a spiked in PhiX control sample If no PhiX control sample is run in the lane this chart is all gray The intensity corrected for cross talk between the color channels by the matrix estimation and phasing and prephasing The intensity for the called base The signal to noise ratio is calculated as mean called intensity divided by standard deviation of noncalled intensities Note the variable scales used on these different parameters Data By Cycle Plot What is it The Data by Cycle plot shows the progression of quality metrics during a run as a line graph BaseSpace Onsite v2 0 System Guide 37 y suo soedseseg snN oL MoH Data By Cycle A0172 All Lanes All Bases Show intensity a 2 When to use it Use the Data By Cycle Plot to judge the progression of quality metrics during a run on a cycle by cycle basis When not to use it Do not use the Data By Cycle Plot to look at downstream analysis metrics or aggregate analysis for a whole lane regardless of cycle How to use it The Data by Cycle plots allow you to follow the progression of
26. key to indicate the extent of the record Even though the record can span multiple bases only the first base is provided in the REF field to reduce file size The following is a simplified segment of a gVCF file describing a segment of nonvariant calls starting with an A on chromosome 1 from position 51845 to 51862 INFO lt ID END Number 1 Type Integer Description End position of the variant described in this record gt CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA19238chr1 51845 A PASS END 51862 Any field provided for a block of sites such as read depth using the DP key shows the minimum value that is observed among all sites encompassed by the block Each sample value shown for the block such as the depth DP is restricted to a range where the maximum value is within 30 or 3 of the minimum For example for sample value range x y y lt xtmax 3 x 0 3 This range restriction applies to each of the sample values printed in the final block record Indel Regions Sites that are filled in inside deletions have additional changes All deletions Sites inside any deletion are marked with the deletion filters in addition to any filters that have already been applied to the site Sites inside deletions cannot have a genotype or alternate allele quality score higher than the corresponding value from the enclosing indel Heterozygous deletions Sites inside heterozygous deletions are altere
27. not required BaseSpace Onsite automatically generates FASTQ files when the sequencing run is complete iy NOTE You can connect as many instruments as you have BaseSpace Onsite nodes installed up to a maximum of 6 View Files and Results 34 The following topics describe how to view files and results in BaseSpace Onsite View Files from a Run What is it BaseSpace Onsite gives you an option to view your run files or download them individually When to use it Use this option if you want to view individual files You can also download these files locally How to use it 1 Click the Runs icon 2 Click the desired run 3 From the Run Overview Page select the Files icon from the left navigation menu D 4 Select the desired file to view See BaseSpace Onsite Files on page 50 for a description of the available files View Indexing QC Page What is it The Indexing QC page lists count information for indexes used in the run The Indexing QC is only available if the run is an index run Part 15049148 Rev E When to use it Use this option when you want to access indexing QC results Why to use it You can see unexpected results for a sample with a particular index and have to troubleshoot what happened You can also use it to confirm that all indexed samples were represented properly How to use it 1 Click the Runs icon 2 Click the desired run 3 There are 2 methods to go to the Indexing QC page From
28. of these terms and conditions ii Purchaser s use of this Product outside of the scope of research use purposes iii any use of this Product not in accordance with this Product s Specifications or Documentation or iv any Excluded Claim Conditions to Indemnification Obligations The parties indemnification obligations are conditioned upon the party seeking indemnification i promptly notifying the other party in writing of such claim or action ii giving the other party exclusive control and authority over the defense and settlement of such claim or action iii not admitting infringement of any intellectual property right without prior written consent of the other party iv not entering into any settlement or compromise of any such claim or action without the other party s prior written consent and v providing reasonable assistance to the other party in the defense of the claim or action provided that the party reimburses the indemnified party for its reasonable out of pocket expenses incurred in providing such assistance Third Party Goods and Indemnification Illumina has no indemnification obligations with respect to any goods originating from a third party and supplied to Purchaser Third party goods are those that are labeled or branded with a third party s name Purchaser s indemnification rights if any with respect to third party goods shall be pursuant to the original manufacturer s or licensor s indemnity Upon written request Ill
29. selected For more information about these actions see Pool Libraries on page 31 Planned Runs When you click the Planned Runs tab you see the Planned Runs list which shows all planned runs you have created on your account Figure 7 Planned Runs List Biological Samples Planned Runs gt PLANNED RUNS Experiment Name Platform Cycles Date Modified 4 Status Brain_1231 NextSeq 15010101150 37 seconds ago Ready to Sequence You can sort the list by clicking the column headers or click a run to see or edit its properties For more information about these actions see Plan Runs on page 32 The runs can have the following states Ready to Sequence the run can be started from the NextSeq sequencing system Planning the run does not show up on the NextSeq sequencing system because it is still in the planning stage BaseSpace Onsite v2 0 System Guide 1 Q iy NOTE If you want to select multiple runs e Select multiple checkboxes e Click anywhere on a planned run row while holding Ctrl button to add to a selection e Click anywhere on a planned run row while holding Shift button to select all runs in between e Click the checkbox next Experiment Name to select all planned runs on the current page The box next to the Planned Runs header tracks the total number of runs and how many are selected Click X next to the selection count to clear the current selection When sequencing on a run starts the run is removed au
30. side of the carrier then remove the old drive from the carrier Figure 17 Remove Drive From Carrier 3 Attach the new drive to the carrier 4 Insert the new drive into the bay and make sure the tray latches closed The new drive is automatically rebuilt 5 Go to the Settings page in the Admin Panel and click Enable Alarm Error Codes If there is an issue with your system BaseSpace Onsite sends an email alert The possible codes and descriptions are listed in this topic to help you troubleshoot Error Code tat Item ID Item Name Message Status Pwr_Unit_ Power Unit Status The power unit has detected a shutdown Error Status Pwr_Unit_ Power Unit Status The power unit has detected that the system has been OK Status turned on Pwr_Unit_ Power Unit Status The power unit has detected a loss of AC power Error Status Pwr_Unit_ Power Unit Status The power unit has detected that the AC power has been OK Status restored Pwr_Unit_ Power Unit Status The power unit has detected a soft power failure Error Status Pwr_Unit_ Power Unit Status The power unit has recovered from a soft power failure OK Status 84 Part 15049148 Rev E Error Code Item ID Pwr_Unit_ Status Pwr_Unit_ Status PU_ C PULSE PU_ C PU_ C PU_ C PU_ C PU_ C PU_ C IPMI IPMI IPMI IPMI IPMI Phy_Sec Phy_Sec Phy_Sec Phy_Sec FPB SMI SMI SE Item Name Power Unit Status Power Unit Status Power
31. 6 HighREFREP Indel contains an allele that occurs in a homopolymer or dinucleotide track with a reference repeat greater than 8 HighDepth Locus depth is greater than 3x the mean chromosome depth INFO Additional information INFO fields are encoded as a semicolon separated series of short keys with optional values in the format lt key gt lt data gt data gVCF files use the following values END End position of the region described in this record BLOCKAVG_min30p3a nonvariant site block All sites in a block are constrained to be nonvariant have the same filter value and have all sample values in range x y y lt max x 3 x 1 3 All printed site block sample values are the minimum observed in the region spanned by the block SNVSB SNV site strand bias SNVHPOL SNV contextual homopolymer length CIGAR CIGAR alignment for each alternate indel allele RU Smallest repeating sequence unit extended or contracted in the indel allele relative to the reference If longer than 20 bases RUs are not reported REFREP Number of times RU is repeated in reference IDREP Number of times RU is repeated in indel allele Part 15049148 Rev E FORMAT Format of the sample field FORMAT specifies the data types and order of the subfields gVCF files use the following values GT Genotype GQ Genotype Quality GQX Minimum of Genotype quality assuming variant position Genotype quality assuming nonvariant position DP F
32. A T C or G character Length from 1 to 20 characters 8 Fill out the Index1Sequences and Index2Sequences sections the following way For Single Index with or without None 1 to 100 Index 1 names For each Index 1 name an associated Index 1 sequence For Dual Index with or without None and Single Index 1 to 100 Index 1 names For each Index 1 name an associated Index 1 sequence 1 to 100 Index 2 names For each Index 2 name an associated Index 2 sequence Each index name meets the following criteria Unique within the file Length from 1 to 8 characters alphanumeric hyphen or underscore characters Each index sequence meets the following criteria Sequence of A T C or G characters Length from 1 to 20 characters All index sequence lengths Read 1 and Read 2 are equal Index 1 sequences are unique within the file set of Index 1 sequences Index 2 sequences are unique within the file set of Index 2 sequences 9 Ifthe supported indexing strategy specifies Single Index you can set up Default Layout By Well the following way Each well unique from A01 to H12 For each well an associated index name exists in the specified Index1Sequences section 10 If the supported indexing strategy specifies Single Index or Dual Index you can set up Default Layout By Column the following way Each column number unique from 1 to 12 For each column an associated index name exists in the specified Index1Sequences section 11 If the supported indexing strategy
33. Analyses page provides access to the results for that app session There is a general information pane to the left and several graphs depending on the app run Sample Overview Page The Sample Overview page provides 2 panes BaseSpace Onsite v2 0 System Guide 2 3 SORL9 U JOST SUSUE eoedSeseg Apps Tab The Sample Details pane gives a summary of the run with a links to launch a custom BaseSpace Onsite app on your sample Clicking the app name leads to a page with more information about that app including access permissions Running apps can incur a charge The Files pane gives a list of files associated with that sample You can either look at all FASTQ files or look at files specific for an app session See also View Files and Results on page 34 You can also download selected files see Download Multiple FASTQ Files on page 49 The Apps button leads to the Apps page which provides an overview of the custom BaseSpace Onsite apps that you can run 24 pi a Apps Clicking the app name leads to a page with more information about that app including a link to the developer and their app support contact details Clicking the Launch button Senen leads you through the launch pages which allow you to set up the app session Specify parameters like the project sample or output folder used by the app depending on the app and accept access permissions You can search for apps using Search Bad Part 15049148 Rev E How
34. BaseSpace Onsite v2 0 system Guide For Research Use Only Not for use in diagnostic procedures Introduction 7 How Do Start 10 BaseSpace Onsite User Interface 14 How To Use BaseSpace Onsite 25 Admin Tasks 76 Technical Assistance See ee ie an ee e Tr ee gf Pi To a vesae ee i a Me aK uam ve ILLUMINA PROPRIETARY i u m N na Part 15049148 Rev E May 2015 This document and its contents are proprietary to Illumina Inc and its affiliates Illumina and are intended solely for the contractual use of its customer in connection with the use of the product s described herein and for no other purpose This document and its contents shall not be used or distributed for any other purpose and or otherwise communicated disclosed or reproduced in any way whatsoever without the prior written consent of Illumina Illumina does not convey any license under its patent trademark copyright or common law rights nor similar rights of any third parties by this document The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order to ensure the proper and safe use of the product s described herein All of the contents of this document must be fully read and understood prior to using such product s FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT S INJURY TO PERSONS INC
35. Diego California 92122 U S A 1 800 809 ILMN 4566 1 858 202 4566 outside North America techsupport illumina com www illumina com Part 15049148 Rev E
36. IGV The BaseSpace Onsite file browser shows data in BaseSpace Onsite that is available for viewing in IGV The directory structure shown is according to how data are organized in BaseSpace Onsite A project is the highest level directory and it contains one or more AppResults If an AppResult was the result of analyzing a single sample then the sample name is appended to the AppResult name Each AppResult contains zero or more files The file browser shows alignment BAM and variant VCF files and if produced BED GTF and BEDGRAPH files Double click a file to load it as an IGV track First load VCF files before BAM files because read tracks can take up an entire IGV screen which requires scrolling to see variants Additional Reference Genomes IGV contains several installed reference genomes Homo sapiens Human hg19 Mus musculus Mouse mm9 Saccharomyces cerevisiae S cerevisiae sacCer2 Arabidopsis thaliana A thaliana TAIR10 Run the VariantStudio App What is it The Ilumina VariantStudio data analysis software application enables researchers to identify and classify disease relevant variants quickly and then communicate significant findings in concise and actionable reports This application provides an intuitive framework for nonexpert users It offers Flexible filtering options Streamlined variant classification Rapid and rich annotations Customizable reporting When to use it Use VariantStudio if you want to
37. LUDING TO USERS OR OTHERS AND DAMAGE TO OTHER PROPERTY ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT S DESCRIBED HEREIN INCLUDING PARTS THEREOF OR SOFTWARE 2015 Illumina Inc All rights reserved Illumina 24sure BaseSpace BeadArray BlueFish BlueFuse BlueGnome cBot CSPro CytoChip DesignStudio Epicentre GAIIx Genetic Energy Genome Analyzer GenomeStudio GoldenGate HiScan HiSeq HiSeq X Infinium iScan iSelect MiSeq NeoPrep Nextera NextBio NextSeq Powered by Illumina SeqMonitor SureMDA TruGenome TruSeq TruSight Understand Your Genome UYG VeraCode verifi VeriSeq the pumpkin orange color and the streaming bases design are trademarks of Illumina Inc and or its affiliate s in the U S and or other countries All other names logos and other trademarks are the property of their respective owners Read Before Using this Product This Product and its use and disposition is subject to the following terms and conditions If Purchaser does not agree to these terms and conditions then Purchaser is not authorized by Illumina to use this Product and Purchaser must not use this Product 1 Definitions Application Specific IP means Illumina owned or controlled intellectual property rights that pertain to this Product and use thereof only with regard to specific field s or specific application s Application Specific IP excludes all Illumina owned or controlled intellect
38. TQ files with unaligned reads SAV Data containing files describing the set up of the run and InterOp files For more information about file types see BaseSpace Onsite Files on page 50 When to use it Use this option when you want to download a packaged zipped file for Variant Aligned Unaligned or SAV data Do not use if you only want individual files Why to use it If you want to download for Variant Aligned Unaligned or SAV data in a neatly packaged file versus downloading the files one by one How to use it 1 Click the Runs icon 2 Click the desired run 3 Click the Download Run button 4 Select the desired data option BaseSpace Onsite Files BaseSpace Onsite uses and produces various files See the topics in this section for details BAM Files What is it The Sequence Alignment Map SAM format is a generic alignment format for storing read alignments against reference sequences supporting short and long reads up to 128 Mb produced by different sequencing platforms SAM is a text format file that is human readable The Binary Alignment Map BAM keeps the same information as SAM but in a compressed binary format that is only machine readable When to use it Allows you to see alignments Use it for direct interpretation or as a starting point for further analysis with downstream analysis tools that are compatible with BAM BAM files are suitable for viewing with an external viewer such as IGV or th
39. There are multiple types of notifications Runs Run in progress Run completed Run error Collaborators Collaborator joined a project run of which you are a member Collaborator invited you to a project run optionally collaborator has included a personal message Collaborator recommended an App Collaborator accepted your offer to transfer ownership Collaborator offered to transfer ownership to you Analyses by you Analysis in progress Analysis completed Analysis error Analyses by collaborators Analysis in progress Analysis completed Analysis error Uploads additions or deletions to from a project of which you are a member By you By a collaborator iy NOTE If you did not configure SMTP during install all notifications show up on the dashboard No notifications are sent through email Runs Pane The bottom left pane of the BaseSpace Onsite dashboard shows the 3 most recent runs and is updated automatically Clicking the Runs pane opens the Runs tab Clicking a run opens the Runs tab with the run loaded For more information see Runs Tab on page 20 Projects Pane The bottom middle pane of the BaseSpace Onsite dashboard shows the 3 most recent projects The folder icon indicates the sharing status of the project if it shows several people By the project is shared Clicking the Projects pane opens the Projects tab Clicking a project opens the Projects tab with the project loaded For more information see Projects Tab on
40. With this method you can delete all items in the trash from BaseSpace Onsite permanently When to use it When you want to delete an item permanently from BaseSpace Onsite When not to use it Do no use this action if you do not want to delete all items in the trash permanently How to use it 1 Click View Trash view Trasn W B 2 Click Empty Trash Empty Trash 3 Click Confirm The items are now ready to be purged from BaseSpace Onsite by the adminPurge Deleted Items on page 79 Restore Trash What is it After you have deleted an item it is present in the Trash if you are the owner of that item With this method you can restore an item from the trash to its original location When to use it When you want to restore an item in the trash to its original location BaseSpace Onsite v2 0 System Guide 71 y suo soedseseg snN oL MoH When not to use it Do no use this action if you do not want to delete an item in the trash permanently How to use it 1 Click View Trash view Trash W 2 Select the items you want to restore 2 3 Click Restore Trash The item is now restored to its original location Restored items keep all their original attributes except for the share recipients Fix Sample Sheet Re Run Workflow What is it The Fix Sample Sheet page lets you correct errors in your sample sheet for HiSeq runs or set up a new analysis to requeue When to use it To fix errors in the sample
41. a collaborator but still keep a copy yourself When you have assigned a sample to the wrong project How to use it 1 Click the Projects icon 2 Click the desired project 3 Click the Samples link from the left navigation menu 4 Select the checkboxes of the samples you want to combine 5 Click the Copy button 6 Select the new project in the drop down list 7 Click the Copy button Upload Files What is it A method to upload files such as VCF FASTQ or manifest files to BaseSpace Onsite When to use it Some apps need additional files generated outside of BaseSpace Onsite Some apps provide downstream analysis for results generated outside of BaseSpace Onsite How to use it 1 Click the Projects icon 2 Go to the project you want to add the file to iy NOTE You can only upload files to projects you own 3 Click Import 4 Select the import file type Part 15049148 Rev E 5 Select the file to upload in one of 2 ways Drag and drop the file in the Drag and Drop box Browse to the file through the select file link and click Open 6 BaseSpace Onsite now uploads the file to your project 7 Type in the analysis name in the Name of analysis box 8 Optional Associate the file you are importing with the samples used as inputs By making this association the analysis is listed on the sample detail page You can also locate these uploaded files later by navigating to one of the samples 9 Click Complete Im
42. ame_S vcf where is the sample number determined by ordering in the sample sheet The header of the VCF file describes the tags used in the remainder of the file and has the column header fileformat VCFv4 1 fileDate 20120317 source SequenceAnalysisReport vshost exe reference phasing none INFO lt ID DP Number 1 Type Integer Description Total Depth gt BaseSpace Onsite v2 0 System Guide D D y suo soedseseg snN oL MoH INFO lt ID TI Number Type String Description Transcript ID gt INFO lt ID GI Number Type String Description Gene ID gt INFO lt ID CD Number 0 Type Flag Description Coding Region gt FILTER lt ID q20 Description Quality below 20 gt FORMAT lt ID GT Number 1 Type String Description Genotype gt FORMAT lt ID GOQ Number 1 Type Integer Description Genotype Quality gt CHROM POS ID REF ALT QUAL FILTER INFO FORMAT SAMPLI Ea A sample line of the VCF file with the data that is used to populate each column described chr22 16285888 rs76548004 T C 17 d15 q20 DP 11 TI NM_ 001136213 GI POTEH CD GT GQ 1 0 17 Setting ALT CHROM FILTER FORMAT ID 56 Description The alleles that differ from the reference read For example an insertion of a single T could show reference A and alternate AT The chromosome of the reference genome Chromosomes appear in the same order as the reference FASTA file generall
43. an either share data at a run or project level via an email invitation or through a hyperlink With the email invitation option only the accounts with the specified email 6 O Part 15049148 Rev E can view shared data Sharing via a hyperlink option allows anyone with access to the hyperlink to be able to view the shared data as long as the hyperlink is still active You can only share data to collaborators who have an account on the same BaseSpace Onsite Sharing is for read only access If you want a collaborator to have write access see Transfer Owner on page 67 NOTE Runs and projects have separate permissions If you share a run the project associated with that run is not shared automatically meaning samples and app results are not accessible to collaborators of the run The following topics describe how to share Share a Project with Get Link What is it Sharing using the Get Link option allows you to share a project or a run with any collaborator who is in your company and has an account on the BaseSpace Onsite system The hyperlink can be turned on or off by setting the activate or deactivate option Anyone who previously accepted the link still has access to the run even though the link is deactivated z NOTE 7 If you want more control use the email share option where you can specify who can view the project Share a Project Using the Email Option on page 62 When to use it Use this option when you do not wan
44. an number C Error failing F_ C Fan number C The fans are no longer redundant due to fan number C Error failing F_ C Fan number C The fans are no longer redundant due to fan number C Error failing F_ C Fan number C The fans are redundant again OK TEMP System Board The system board temperature has exceeded the normal Error Temperature range TEMP System Board The system board temperature is back within normal OK Temperature range BMC_FW BMC Firmware Health The BMC board has detected a sensor failure Error F1 Fan 1 Fan number 1 is not functioning Error F1 Fan 1 Fan number 1 is functioning OK F2 Fan 2 Fan number 2 is not functioning Error F2 Fan 2 Fan number 2 is functioning OK F3 Fan 3 Fan number 3 is not functioning Error E3 Fan 3 Fan number 3 is functioning OK F4 Fan 4 Fan number 4 is not functioning Error F4 Fan 4 Fan number 4 is functioning OK F5 Fan 5 Fan number 5 is not functioning Error 86 Part 15049148 Rev E Error Code Item ID ES PS_ C PS_ C PS_ C PS C PS_ C PS_ C PS_ C PS_ C PS_ C PS_ C PS_ C PS_ C PS_ C PS_ C PS_ C PS_ C CBPB CBPB P_ C P_ C Item Name Fan 5 Power supply number Power supply number Power supply number Power supply number Power supply number Power supply number Power supply number Power supply number Power supply number Power supply number Power supply number Power supply number Power supply number
45. ane Density The density of clusters in thousands per mm detected by image analysis 1 standard deviation BaseSpace Onsite v2 0 System Guide A 3 y suo soedseseg snN oL MOH 44 Clusters PF Phas Prephas Reads Reads PF Q gt 30 Yield Cycles Err Rated Aligned Error Rate Intensity Cycle 1 Intensity Cycle 20 The percentage of clusters passing filtering 1 standard deviation The value used by RTA for the percentage of molecules in a cluster for which sequencing falls behind phasing or jumps ahead prephasing the current cycle within a read For MiSeq and NextSeq RTA generates phasing and prephasing estimates empirically for every cycle The value displayed here is therefore not used in the actual phasing prephasing calculations but is an aggregate value determined from the first 25 cycles For most applications the value reported is very close to the value that is applied For low diversity samples or samples with unbalanced base composition the reported value can diverge from the values being applied because the value changes from cycle to cycle The number of clusters in millions The number of clusters in millions passing filtering The percentage of bases with a quality score of 30 or higher respectively This chart is generated after the 25 cycle and the values represent the current cycle The number of bases sequenced which passed filter The number of cycles that
46. box 5 Click Save Set Up a New Project What is it A method to set up a new project When to use it When you want to analyze a sample in the context of 2 different projects When you want to transfer ownership of samples to a collaborator but still keep a copy yourself When you want to split a project into multiple projects How to use it 1 Click the Projects icon 2 Click New Project link in the top left corner 3 Enter a new name and description 4 Click the Create button To copy samples into the new project seeCopy Samples on page 66 Combine Samples What is it A method to combine merge samples When to use it To merge the data from 2 or more different sequencing runs on the same sample The samples can only merge if they have the same read lengths When not to use it You cannot combine samples that do not have the same read lengths How to use it 1 Click the Projects icon Click the desired project Click the Samples link from the left navigation menu A WO N Select the checkboxes of the samples you want to combine BaseSpace Onsite v2 0 System Guide 6 D suo soedseseg snN oL MoH 66 5 Click the Combine button 6 Click the Combine button in the pop up screen Copy Samples What is it A method to copy samples from one project to another When to use it When you want to analyze a sample in the context of 2 different projects When you want to transfer ownership of a sample to
47. braries from multiple plates use the Plate drop down menu to specify the plate 2 NOTE You can also merge pools the following way e Click the Save amp Continue Later This selection takes you to the Pools list with the recently created plate at the top of the list e Select the checkboxes in the Pools list e Click the Merge Pools button in the top navigation bar 5 Click the Plan Run button Plan Runs On the Planned Runs page you can set up the parameters for the sequencing run on your NextSeq instrument 3 2 Part 15049148 Rev E Biological Samples ibraries ols Planned Runs PLAN RUN Run Information Name Brain_1231 Reagent Barcode aa1497 Use Custom Primer R1 M R2 F Index E Re Hyb Enter Cycles sn Pe uo9 Single Read Paired End Read 1 Cycles Read 2 Cycles Review Indexing D Override default indexing scheme Single Index Dual Index No Index Index 1 Cycles Index 2 Cycles OL Pool ID Pool 1231 Library Prep TruSeqLT Save amp Continue Later Sequence 1 Enter a name for your planned run 2 Optional Enter the reagent barcode you plan to use which links a reagent kit to this run 3 Make sure that the rehyb checkbox is not selected Currently there is no supported rehyb workflow available for NextSeq 4 Fill out the Enter Cycles section Single vs paired end Number of cycles per read 5 Verify the Review Indexes section for the indexing strategy For indexing
48. cal Samples on page 27 Libraries When you click the Libraries tab you see the Libraries list which shows all available plates or tubes with libraries you have created on your account You can sort the list by clicking the column headers or click a plate to see its properties and associated libraries Figure 5 Libraries List Biological Samples Import Pool Libraries LIBRARIES iseleted X 7 Plate Tube ID Library Prep of Libraries Modified On Owner Validation Test 6353615054 TruSeqLT 1 Jun 17 2014 Admin User Exome_NextSeq_9plex Platel Nextera Rapid Capture 9 Jun 17 2014 Admin User RNASeq_NextSeq_Splex Plat TruSeqLT 8 Apr 16 2014 Admin User This page provides the following actions to prepare your analysis Click a plate then click the Edit button to edit its properties or libraries Select one or more plates or tubes and move to Pool Libraries Import libraries and associate them to new biological samples at the same time When going through the Import workflow you can also download a template import CSV file See Import Samples and Libraries on page 31 for more information NOTE If you want to select multiple libraries e Select multiple checkboxes e Click anywhere on a library row while holding Ctrl button to add to a selection e Click anywhere on a library row while holding Shift button to select all libraries in between e Click the checkbox next to Plate Tube ID to select all samples on the curre
49. cations where reference genotype calls must be determined at the same stringency as variant genotypes ie An assertion that a site is homozygous reference at GQX gt 30 is made assuming the site is variant An assertion that a site is a non reference genotype at GQX gt 30 is made assuming the site is nonvariant Section Descriptions The gVCF file contains the following sections Meta information lines start with and contain metadata config information and define the values that the INFO FILTER and FORMAT fields can have The header line starts with and names the fields that the data lines use These fields are CHROM POS ID REF ALT QUAL FILTER INFO FORMAT followed by one or more sample columns Data lines that contain information about one or more positions in the genome If you extract the variant lines from a gVCF file you produce a conventional variant VCF file Field Descriptions The fixed fields CHROM POS ID REF ALT QUAL are defined in the VCF 4 1 standard provided by the 1000 Genomes Project The fields ID INFO FORMAT and sample are described in the meta information CHROM Chromosome an identifier from the reference genome or an angle bracketed ID String lt ID gt pointing to a contig POS Position The reference position with the first base having position 1 Positions are sorted numerically in increasing order within each reference sequence CHROM There can be multiple records with the
50. count Figure 4 Biological Samples List Biological Samples Libraries D gt Import Prep Libraries BIOLOGICAL SAMPLES 1selected x 2 Sample ID Name Species Project Modified Onv Libraries Brain_1232 Brain_1232_ME Homo sapiens BrainSamples Dec 24 2013 al Brain_1231 Brain_1231_CE Homo sapiens BrainSamples Dec 24 2013 1 If you want information about the samples you can perform the following Sort the list by clicking the column headers Click a sample to go to the sample page This page provides the following actions to prepare your analysis BaseSpace Onsite v2 0 System Guide 1 BG 18 Create a sample Import new samples Select a sample and edit its properties Select one or more samples and continue with Prep Libraries 2 NOTE You can select multiple samples by using one of the following methods e Select multiple checkboxes e Click anywhere on a sample row while holding Ctrl button to add to a selection e Click anywhere on a sample row while holding Shift button to select all samples in between e Click the checkbox next to Plate Tube ID to select all samples on the current page The box next to the Biological Samples header tracks the total number of samples and how many are selected Click X next to the selection count to clear the current selection For more information about these actions see Create New Biological Samples on page 26 Import Biological Samples on page 26 and Use Existing Biologi
51. d must be unique S1 The sample number based on the order that samples are listed in the sample sheet starting with 1 In this example S1 indicates that this sample is the first sample listed in the sample sheet j NOTE Reads that cannot be assigned to any sample are written to a FASTQ file for sample number 0 and excluded from downstream analysis L001 The lane number R1 The read In this example R1 means Read 1 For a paired end run there is at least one file with R2 in the file name for Read 2 When generated index reads are I1 or I2 001 The last segment is always 001 Compression FASTQ files are saved compressed in the GNU zip format an open source file compression program indicated by the gz file extension Format Each entry in a FASTQ file consists of four lines Sequence identifier Sequence Quality score identifier line consisting only of a Quality score lt instrument gt lt run number gt lt flowcell ID gt lt lane gt lt tile gt lt x pos gt lt y pos gt lt read gt lt is filtered gt lt control number gt lt index gt The following table describes the elements Element Requirements Description Each sequence identifier line starts with lt instrument gt Characters allowed Instrument ID a z A Z 0 9 and underscore lt run number gt Numerical Run number on instrument lt flowcell Characters allowed 1D gt a z A Z 0 9 lt lane gt Numerical Lane number l
52. d to have haploid genotype entries e g 0 instead of 0 0 1 instead of 1 1 Heterozygous SNV calls inside heterozygous deletions are marked with the SiteConflict filter and their genotype is unchanged Homozygous deletions Homozygous reference and no call sites inside homozygous deletions have genotype Sites inside homozygous deletions that have a non reference genotype are marked with a SiteConflict filter and their genotype is unchanged wu Site and genotype quality are set to The described modifications reflect the notion that the site confidence is bound within the enclosing indel confidence Part 15049148 Rev E On occasion the variant caller produces multiple overlapping indel calls that cannot be resolved into 2 haplotypes If this case all indels and sites in the region of the overlap are marked with the IndelConflict filter Genotype Quality for Variant and Nonvariant Sites The gVCF file uses an adapted version of genotype quality for variant and nonvariant site filtration This value is associated with the key GOX The GQX value is intended to represent the minimum of Phred genotype quality assuming the site is variant Phred genotype quality assuming the site is nonvariant The reason for using this value is to allow a single value to be used as the primary quality filter for both variant and nonvariant sites Filtering on this value corresponds to a conservative assumption appropriate for appli
53. download FASTQ files per sample Why to use it If you only want to download several FASTQ files for a sample it saves you time because you are not downloading all the other files How to use it 1 Click the Runs icon or Projects icon Click the desired run or project Click the desired sample in the Samples pane In the Files pane select the checkboxes for the desired FASTQ files Click the Download Selected button nH oO FF WD N The BaseSpace Onsite Downloader is not signed which leads to the following warnings A Windows popup appears when trying to install the setup exe Choose Run anyway to install the BaseSpace Onsite Downloader Antivirus software can flag the file make sure that you allow this file to be installed The BaseSpace Onsite Downloader guides you through the download process and starts the download of the files to the desired location Download Run File Package What is it BaseSpace Onsite allows you to download data as a package individually or as a group of FASTQ files This topic describes how to download a package of files in a run BaseSpace Onsite v2 0 System Guide A Q y suo soedseseg snN O MoH 00 The packages available depend on your workflow packages that are grayed out are not available for download There are 4 types of data packages Variant Data containing VCF files with variant calls Aligned Data containing BAM files with aligned reads Unaligned Data containing FAS
54. e UCSC Genome Browser Part 15049148 Rev E When not to use it Do not use it with tools that are not compatible with the BAM format Do not use with applications that cannot handle large files as BAM files can get large depending on the application and data How to use it If you use an app in BaseSpace that uses BAM files as input the app locates the file when launched If using BAM files in other tools download the file to use it in the external tool Detailed Description Go to samtools sourceforge net SAM1 pdf to see the exact SAM specification gVCF Files What is it This application also produces the Genome Variant Call Format file gVCF gVCF was developed to store sequencing information for both variant and nonvariant positions which is required for human clinical applications gVCF is a set of conventions applied to the standard variant call format VCF 4 1 as documented by the 1000 Genomes Project These conventions allow representation of genotype annotation and other information across all sites in the genome in a compact format Typical human whole genome sequencing results expressed in gVCF with annotation are less than 1 Gbyte or about 1 100 the size of the BAM file used for variant calling If you are performing targeted sequencing gVCF is also an appropriate choice to represent and compress the results gVCE is a text file format stored as a gzip compressed file genome vcf gz Compression is furt
55. e also Share a Project with Get Link on page 61 Transfer Owner Hand control of data over to a collaborator or customer See also Transfer Owner on page 67 Move to Trash Delete a project This button is visible if a project is selected See also Delete Project on page 69 View Trash view the deleted items in the trash so you can restore them or empty the trash See also Delete Items on page 68 J NOTE Runs and projects have separate permissions If you share a project you do not share the runs contained within the project Project Overview Page The Project Overview page provides access to 3 panes with information about the project The About tab gives you summary information about the project owner shared status date created and collaborators The Analyses tab gives a list of all the App Sessions in the project This tab can be sorted based on analysis name last modified date created status or application Part 15049148 Rev E used to generate the analysis Clicking the analysis links to the app results for that sample see Analyses Page on page 23 for more information The Samples tab gives a list of all the samples in the project Clicking a sample links to the page for that sample see Sample Overview Page on page 23 for more information Selecting the samples allows you to launch it in an app copy to a different project or combine with another result 2 NOTE You can access these panes through the left navigation bar
56. entation state otherwise or g is the transfer to a third party of or sub licensing of Software or any third party software All Software whether provided separately installed on or embedded in a Product is licensed to Purchaser and not sold Except as expressly stated in this Section no right or license under any of Illumina s intellectual property rights is or are granted expressly by implication or by estoppel Purchaser is solely responsible for determining whether Purchaser has all intellectual property rights that are necessary for Purchaser s intended uses of this Product including without limitation any rights from third parties or rights to Application Specific IP Illumina makes no guarantee or warranty that purchaser s specific intended uses will not infringe the intellectual property rights of a third party or Application Specific IP Regulatory This Product has not been approved cleared or licensed by the United States Food and Drug Administration or any other regulatory entity whether foreign or domestic for any specific intended use whether research commercial diagnostic or otherwise This Product is labeled For Research Use Only Purchaser must ensure it has any regulatory approvals that are necessary for Purchaser s intended uses of this Product Unauthorized Uses Purchaser agrees a to use each Consumable only one time and b to use only Illumina consumables reagents with Illumina Hardware The limitations in a
57. epair or replace non conforming Product that it confirms is covered by this warranty Repaired or replaced Consumables come with a 30 day warranty Hardware may be repaired or replaced with functionally equivalent reconditioned or new Hardware or components if only a component of Hardware is non conforming If the Hardware is replaced in its entirety the warranty period for the replacement is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever is shorter If only a component is being repaired or replaced the warranty period for such component is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever ends later The preceding states Purchaser s sole remedy and Illumina s sole obligations under the warranty provided hereunder Third Party Goods and Warranty Illumina has no warranty obligations with respect to any goods originating from a third party and supplied to Purchaser hereunder Third party goods are those that are labeled or branded with a third party s name The warranty for third party goods if any is provided by the original manufacturer Upon written request Illumina will attempt to pass through any such warranty to Purchaser Indemnification a Infringement Indemnification by Illumina Subject to these terms and conditions including without limitation the Exclusions to Illumina s Indemnification Obligations Section 9 b below the C
58. erform the following Part 15049148 Rev E 1 Under Storage go to the Archive Storage tab 2 Click Mount 3 Fill out the form You can set up 1 archive location per BaseSpace Onsite system Restore Deleted Item To restore a deleted item to active status perform the following 1 Under Storage go to the Deleted Items tab 2 Select the analysis 3 Click Unarchive If there is sufficient free space BaseSpace Onsite restores the item If there is not enough space BaseSpace Onsite displays an error message Purge Deleted Items To purge deleted items from BaseSpace Onsite permanently perform the following 1 Under Storage go to the Deleted Items tab 2 Click Purge This action removes all items in the trash from BaseSpace Onsite permanently Storage Check BaseSpace Onsite has limited storage capacity and checks the free space available before uploading a run or starting an app The necessary space is then reserved until the process completes If there is not enough space you see an error message and the run or app does not start If the space check fails before starting FASTQ generation the run gets into Needs Attention state To manage available space see Archive or Backup Analysis on page 78 BaseSpace Onsite v2 0 System Guide T Q SYSE UILUPY Figure 12 BaseSpace Onsite Log On BaseSpace ONSITE illumina Username Email Password Forgot password Change password illumina 2014 Illumina
59. ex1Na Index1Sec Index2Nai Index2Sequence TestSamp SampleNe Phix Testimpor DNA A01 N701 TAAGGCG 501 TAGATCGC TestSamp SampleNe Phix Testimpor DNA B01 N701 TAAGGCG 502 CTCTCTAT Click the Choose File button Browse to the import file and click Open Click Import oN A OF When finished do one of the following If you only want to select the newly created samples click the Pool Libraries button Continue with Pool Libraries on page 31 If you want to select other libraries click the Save amp Continue Later This selection takes you back to the Libraries list with the recently created sample at the top of the list Pool Libraries The Pool Libraries page allows you to pool samples and sequence them in the same run using the same analysis parameters 1 Fill out the first pool ID Pool ID has to be unique 2 If needed you can create additional pools on the right by clicking the Add Pool button and filling out the pool IDs BaseSpace Onsite v2 0 System Guide 31 y suo soedseseg snN oL MoH Colors of the wells correspond to the colors of the pools You can hover over the wells to see the library IDs 3 Drag and drop individual samples from their well on the plate to a pool You can multiselect by holding Shift To multiselect on Firefox or Internet Explorer 9 click the well twice POOL LIBRARIES Notes Clear All Add Pool Pool 1232 sn peyuo9 4 If you want to pool li
60. g applied depends on the current Q table See the white paper Reducing Whole Genome Data Storage Footprint for more information available from www illumina com Quality Scores Encoding In FASTQ files quality scores are encoded into a compact form which uses only 1 byte per quality value In this encoding the quality score is represented as the character with an ASCII code equal to its value 33 The following table demonstrates the relationship between the encoding character its ASCII code and the quality score represented BaseSpace Onsite v2 0 System Guide D Q y suo soedseseg snN oL MoH Table 1 ASCII Characters Encoding Q scores 0 40 Symbol ASCII Code Q Score Symbol ASCII Code Q Score 33 0 6 54 21 i 34 1 7 55 22 35 2 8 56 23 36 3 9 57 24 37 4 58 25 amp 38 5 59 26 i 39 6 lt 60 27 40 7 61 28 41 8 gt 62 29 g 42 9 63 30 43 10 64 31 P 44 11 A 65 32 45 12 B 66 33 46 13 C 67 34 47 14 D 68 35 0 48 15 E 69 36 1 49 16 E 70 37 2 50 17 G 71 38 3 51 18 H 72 39 4 52 19 I 73 40 5 53 20 Health Runs What is it A user can choose whether to send anonymous system health information to Illumina Health runs help Illumina diagnose issues and improve our products The information consists of InterOp files and log files and is not tied to any user account This option is on by default Share Data Data in BaseSpace Onsite can be shared with collaborators in a couple of different ways You c
61. h DNA or RNA Part 15049148 Rev E Figure 8 Import Sample Template Header I FileVersic Data SamplelD Name Species Project NucleicAcid TestSamp SampleA Phix Project_A DNA RealSamp SampleB Phix Project_B RNA Click the Choose File button Browse to the import file and click Open Click Import o N A OF When finished do one of the following If you only want to select the newly created samples click the Next Prep Libraries button Continue with Prep Libraries on page 27 If you want to select multiple samples click the Save amp Continue Later This selection takes you back to the Biological Samples list with the recently created sample at the top of the list Continue with Use Existing Biological Samples on page 27 Use Existing Biological Samples The Biological Samples list shows all available samples that you have created on your account Biological Samples Libraries ls Planned Runs Py gt Create Import Prep Libraries BIOLOGICAL SAMPLES Sample ID Name Species Project Modified Onv Libraries E Brain_1232 Brain_1232_ME Homo sapiens BrainSamples Dec 24 2013 at Brain_1231 Brain_1231_CE Homo sapiens BrainSamples Dec 24 2013 1 1 To select existing samples do one of the following in the Biological Samples list Select the checkboxes Click the sample If you want to select multiple samples hold the Ctrl button Select all samples by selecting the checkbox next to the SamplelD header 2
62. he date the Upgraded Components are installed Upgraded Components do not extend the warranty for the Hardware unless the upgrade was conducted by Illumina at Illumina s facilities in which case the upgraded Hardware shipped to Purchaser comes with a Base Hardware Warranty Exclusions from Warranty Coverage The foregoing warranties do not apply to the extent a non conformance is due to i abuse misuse neglect negligence accident improper storage or use contrary to the Documentation or Specifications ii improper handling installation maintenance or repair other than if performed by Ilumina s personnel iii unauthorized alterations iv Force Majeure events or v use with a third party s good not provided by Illumina unless the Product s Documentation or Specifications expressly state such third party s good is for use with the Product Procedure for Warranty Coverage In order to be eligible for repair or replacement under this warranty Purchaser must i promptly contact Illumina s support department to report the non conformance ii cooperate with Illumina in confirming or diagnosing the non conformance and iii return this Product transportation charges prepaid to Illumina following Illumina s instructions or if agreed by Illumina and Purchaser grant Illumina s authorized repair personnel access to this Product in order to confirm the non conformance and make repairs Sole Remedy under Warranty Illumina will at its option r
63. he User Agreement Blog leads to the blog blog basespace illumina com Check out for the latest news updates and developments and subscribe to updates 9IeNaJU JOSA SUSUE eoedSeseg MyAccount MyAccount provides access to the Settings and Transfer History pages Settings Transfer History Settings On the Settings page you can edit your notifications settings edit your profile or update your profile picture Transfer History The Transfer History page allows you to review projects or runs that have been transferred See Transfer Owner on page 67 for more information Admin Panel The Admin Panel allows you to manage analysis notifications storage users system health planned runs software updates and alarms See Admin Tasks on page 76 for a description NOTE i You need administrator privileges to see and work in the admin panel Dashboard Tab After login the first tab you see is the dashboard The dashboard provides access to notifications your latest runs projects and app results The dashboard is always accessible in BaseSpace Onsite from the top ribbon selector Dashboard BaseSpace Onsite v2 0 System Guide 1 D 16 J NOTE If a run or project is not showing on BaseSpace Onsite it is possible your data has not been sent to BaseSpace Onsite Set the BaseSpace Onsite option on your sequencing instrument see the instrument user guide Notifications Shows notifications most recent first
64. he format of an email If you enable the SMTP support after using BaseSpace Onsite without SMTP support all users that are logged in have to log out and then log back in If not they do not receive notifications by email or on the dashboard Monitor System Health On the System Health page you see the BaseSpace Onsite system health alerts You can sort the alerts by the column headers Many sensors are monitored for health in the BaseSpace Onsite server If a sensor indicates a failure BaseSpace Onsite sends an alert to the administrator When you receive an alert contact Illumina Support to diagnose the error and if necessary arrange a site visit to correct the problem Some of these errors such as a failure of a disk drive or one of the power supplies you can resolve See Replacement Procedures on page 82 for instructions Illumina Support can also guide you through the process of replacing the faulty component If you want to remove an alert select the alert and click Dismiss Unlock Planned Runs On the Planned Runs page you see the runs that are currently planned You can sort the runs by the column headers The sequencing system locks planned runs when they are selected In rare instances the sequencing system leaves the run in locked state without starting the run These runs must be manually unlocked to access again Unlocking runs allows the users to edit the run in the Prep tab and makes the run available for selectio
65. hen to use it Use this option when you want to view information about the run such as percent alignment cycles and densities Why to use it Use this option if you want a quick breakdown of the statistics for a particular run How to use it 1 Click the Runs icon 2 Click the desired run 3 There are 2 methods to go to the Run Summary From the Run Overview Page select Run Summary button From the Run Overview Page select the Run Summary icon from the left navigation menu imi The following metrics are displayed in the top table split out by read and total Level The sequencing read level Yield Total The number of bases sequenced which is updated as the run progresses Projected Total Yield The projected number of bases expected to be sequenced at the end of the run Aligned The percentage of the sample that aligned to the PhiX genome which is determined for each level or read independently Error Rate The calculated error rate of the reads that aligned to PhiX Intensity Cycle 1 The average of the A channel intensity measured at the first cycle averaged over filtered clusters For the NextSeq 500 System the red channel is used Q gt 30 The percentage of bases with a quality score of 30 or higher respectively This chart is generated after the 251 cycle and the values represent the current cycle The following metrics are available in the Read tables split out by lane Tiles The number of tiles per l
66. her achieved by joining contiguous nonvariant regions with similar properties into single block VCF records To maximize the utility of gVCF especially for high stringency applications the properties of the compressed blocks are conservative Block properties like depth and genotype quality reflect the minimum of any site in the block The gVCF file can be indexed creating a tbi file and used with existing VCF tools such as tabix and IGV making it convenient both for direct interpretation and as a starting point for further analysis For more information see sites google com site gvcftools home about gvcf When to use it Use it for direct interpretation or as a starting point for further analysis with downstream analysis that is compatible with gVCF such as tabix and IGV When not to use it Do not use it with tools that are not compatible with the gVCF format How to use it Apps that use gVCF files find it when kicked off and directed to the sample If using gVCE files in other tools download the file to use it in the outside tool BaseSpace Onsite v2 0 System Guide 5 S1ISUE soedseseg snN oL MOH 52 Detailed Description The following conventions are used in the variant caller gVCF files Samples per File There is only one sample per gVCF file Nonvariant Blocks Using END Key Contiguous nonvariant segments of the genome can be represented as single records in gVCF These records use the standard END INFO
67. icate that the HiSeq is connected to BaseSpace Onsite and data files are being transferred Getting Shared Data If you receive a link to shared data in BaseSpace Onsite click the link Use your BaseSpace Onsite account to log on the first time you visit you are asked to accept the BaseSpace Onsite agreement After that you are ready to run BaseSpace Onsite For a new account ask your local administrator to set one up If someone shared data with you you see a notification stating so Figure 3 BaseSpace OnsiteNotification Window BaseSpace SH u Dashboard GA NOTIFICATIONS Load More Notifications The shared data show up in your project list Now you can use the BaseSpace Onsite tools to look at and download the data For information about how to run tasks see How To Use BaseSpace Onsite on page 25 NOTE The owner of the data can disable the sharing feature at any time NOTE When you bookmark the BaseSpace Onsite location in your browser make sure to bookmark the Dashboard page after logging on Do not bookmark the Login page BaseSpace Onsite v2 0 System Guide 1 3 HES OG MOH BaseSpace Onsite User Interface The BaseSpace Onsite user interface UI has 4 tabs that allow you to access and use your data In addition there are several common interface elements that enable general tasks This section describes the various aspects of the BaseSpace Onsite UI Common Elements on page 14 Dashboard Tab o
68. if a run is selected See also Delete Project on page 69 View Trash view the deleted items in the trash so you can restore them or empty the trash See also Delete Items on page 68 i NOTE Runs and projects have separate permissions If you share a project you do not share the runs contained within the project Run Overview Page The Run Overview page provides 5 panes The Run Details pane gives a summary of the run with links to view files and download and share options For more information see Share Data on page 60 View Files and Results on page 34 or Download Files on page 48 The Samples pane gives a list of all the app results in the run the associated projects and the number of samples in that analysis This pane provides access to the following pages Samples list see Run Samples List on page 21 Sample Details page see Sample Overview Page on page 23 App Results page see Analyses Page on page 23 Project Overview page see Project Overview Page on page 22 The Charts pane shows an intensity by cycle chart Clicking the header takes you to the Charts page which contains 5 charts with run metrics The Run Summary pane shows tables with basic data quality metrics Clicking the header takes you to the Run Summary page The Indexing QC pane lists count information for indexes used in the run Clicking the header takes you to the Indexing QC page In addition there is a Side Navigation ribbon which provides easy navigation
69. iltered base call depth used for site genotyping DPF Base calls filtered from input before site genotyping AD Allelic depths for the ref and alt alleles in the order listed For indels this value only includes reads that confidently support each allele posterior probability 0 999 or higher that read contains indicated allele vs all other intersecting indel alleles DPI Read depth associated with indel taken from the site preceding the indel SAMPLE Sample fields as defined by the header VCF Files What is it VCF is a text file format that contains information about variants found at specific positions in a reference genome The file format consists of meta information lines a header line and then data lines Each data line contains information about a single variant When to use it Use it for direct interpretation or as a starting point for further analysis with downstream analysis that is compatible with VCF such as IGV or the UCSC Genome Browser When not to use it Do not use it with tools that are not compatible with the VCF format NOTE i Windows recognizes VCF files as an Outlook contact file Do not open VCF files in Outlook How to use it If you use an app in BaseSpace that uses VCF files as input the app locates the file when launched If using VCF files in other tools download the file to use it in the external tool Detailed Description The file naming convention for VCF files is as follows SampleN
70. ing Make sure that you have a stable connection of at least 10 Mbps upload speed from the NextSeq From the Manage Instrument screen select System Configuration to access a series of screens that configure the connection to BaseSpace Onsite Log in to BaseSpace Onsite when setting up the run on the NextSeq sequencing system a NOTE When you bookmark the BaseSpace Onsite location in your browser make sure to bookmark the Dashboard page after logging on Do not bookmark the Login page Using BaseSpace Onsite with HiSeq BaseSpace Onsite Connectivity The HiSeq features an option to send instrument health and sequencing data to BaseSpace Onsite in real time to streamline both instrument quality control and analysis Real time monitoring of runs enables fast troubleshooting Free alignment and variant calling provide many easy to use workflows that tailor analysis for diverse biological applications When you set up the run on the HiSeq select the option to log in to BaseSpace Onsite If you have a problem with the data upload between HiSeq and BaseSpace Onsite see HiSeg Connection on page 12 BaseSpace Onsite v2 0 System Guide 1 1 HEYS OG MOH NOTE Raw data from the run is also stored on the instrument or in the location of the output folder that you specified in the Storage screen BaseSpace Onsite has limited storage capacity and checks the free space available before uploading a run If there is not enough available s
71. ion of mean values for a given parameter across all tiles in a given lane The red line indicates the median tile value for the parameter displayed Blue boxes are for raw clusters green boxes for clusters passing filter The box outlines the interquartile range the middle 50 of the data for the tiles analyzed for the data point The error bars delineate the minimum and maximum without outliers The outliers are the values that are more than 1 5 times the interquartile range below the 25 percentile or more than 1 5 times the interquartile range above the 75 percentile Outliers are indicated as dots You can monitor the following quality metrics with this plot The density of clusters for each tile in thousands per mm The number of clusters for each tile in millions The estimated percentage of molecules in a cluster for which sequencing falls behind phasing or jumps ahead prephasing the current cycle within a read The percentage of reads from clusters in each tile that aligned to the Phix genome You can expand a chart by clicking the expand button 2 QScore Heatmap What is it A heatmap of the Q scores QScore Heatmap A0172 All Lanes 50 100 150 200 250 300 BaseSpace Onsite v2 0 System Guide A y suo soedseseg snN oL MOH 42 When to use it For a quick overview of the Q scores over the cycles When not to use it Do not use the QScore Heatmap to look at metrics other than quality scores
72. ions to help you troubleshoot Manage BaseSpace Onsite 76 The Account drop down list provides access to the Admin Panel My Account Trash Terms Admin Panel Blog Sign out The Admin Panel allows you to manage analysis notifications storage users system health planned runs software updates and alarms 2 NOTE You need admin privileges to see and work in the admin panel You can reach these options through the side navigation panel Analysis Storage Users System Health Planned Runs Updates Logs About Settings Manage Analysis On the Analysis page you see the analyses that are currently running and the analyses that are queued You can sort the analyses by the column headers You can manage the analyses the following way Select an active analysis and click Stop to stop the analysis Part 15049148 Rev E Select a queued analysis and click Remove to remove the analysis from the queue Click Settings to set the administrator notifications you get through email Analysis Management Settings Alerts Notifications App Aborted 2 App Needs Attention z More than following number of apps queued Cancel Apply Manage Storage The Storage page contains 3 tabs L The Active Storage tab provides an overview of the total amount of active storage used and free and the storage by user Active samples runs and analyses are stored on the BaseSpace Onsite system and can be used for a
73. is it A method to delete runs When to use it To move the project out of your Runs list into the trash When a run is in the trash it can be permanently deleted from BaseSpace Onsite Part 15049148 Rev E When not to use it Do no use this action if you want to archive a run How to use it 1 Click the Runs icon 2 Click the desired run x 3 Click the Move to Trash button 4 If there are analyses or samples associated with this run BaseSpace Onsite asks if you want to delete those analyses and samples too Select checkbox if you want to delete the associated items 5 Click Confirm If you are the owner of the run the run now appears in the trash You can permanently delete the run from trash by emptying all items in the trash see Empty Trash on page 71 You can also restore the run to its original location see Restore Trash on page 71 Deleting a run has the following additional features If you received the run as a share the deleted run does not appear in the trash If you want to restore a run shared with you click the previously sent share link or contact the owner Runs cannot be removed if they are in a nonterminal state for example running uploading or analyzing Delete Project What is it A method to delete a project When to use it To move the project out of your Projects list into the trash When a project is in the trash it can be permanently deleted from BaseSpace Onsite When not to use
74. it Do no use this action if you want to archive a project How to use it 1 Click the Projects icon 2 Click the desired project D 3 Click the Move to Trash button 4 Click Confirm If you are the owner of the project the project now appears in the trash You can permanently delete it from trash by emptying all items in the trash see Empty Trash on page 71 You can also restore the project to its original location see Restore Trash on page 21 BaseSpace Onsite v2 0 System Guide 6 Q y suo soedseseg snN oL MoH 70 If you received the project as a share the deleted project does not appear in the trash If you want to restore a project shared with you click the previously sent share link or contact the owner Delete Analysis What is it A method to delete an analysis result When to use it To move the analysis out of your Analysis Results list into the trash When an analysis is in the trash the analysis can be permanently deleted from BaseSpace Onsite When not to use it Do no use this action if you want to archive an analysis result How to use it 1 Click the Projects icon 2 Click the desired project 3 Select the analysis results to be deleted D 4 Click the Move to Trash button 5 Click Confirm The analysis is now in the trash You can permanently delete the analysis from BaseSpace Onsite by emptying all items in the trash see Empty Trash on page 71 You can also restore the analysis to i
75. it is set according to the index library prep type chosen previously If you choose to override this default indexing scheme you are required to select the Index type Single Dual or No Index Make sure that you enter the number of index cycles accordingly If you have selected multiple libraries you cannot specify No Index BaseSpace Onsite automatically checks if the indexes chosen all start with 2 Gs if so it warns you to change your index strategy 6 Verify the pool that is included in the planned run 7 When your settings are complete choose one of these options to continue BaseSpace Onsite v2 0 System Guide 3 3 S1ISUE soedSeseg snN oL MOH Click the Sequence button which opens the Planned Runs list and sets the state of the recently planned run to Ready to Sequence Click the Save amp Continue Later button which opens the Planned Runs list and sets the state of the recently planned run to Planning M NOTE A planned run must be in the Ready to Sequence state in order for it to show up in the Planned Runs list in the control software on the instrument 8 Ifyou want to change a planned run to the Ready to Sequence state select the planned run from the list Click the Sequence arrow link in the top navigation bar on the Planned Runs list page Your run now shows up in the Planned Runs list in the control software on your NextSeq sequencing system Complete the run from your sequencing instrument A sample sheet is
76. late or tubes automatically with all samples listed J NOTE You can also manually drag the samples to wells or tubes 1 Select one or more samples To multiselect hold Shift To multiselect on Firefox or Internet Explorer 9 click the well twice Drag selected samples to a position Check whether the indexes have been assigned to the proper samples Hovering over a position reveals the sample that is assigned to that position You can drag samples from position to position oO N 4 Save a file of your library settings by clicking the Download CSV button Use this file in the lab to indicate which biological samples get pipetted into specific wells 5 When finished do one of the following gt If you want to select the new plate or tubes click the Pool Libraries button Continue with Pool Libraries on page 31 Part 15049148 Rev E If you want to select multiple library preps or plates do the following a Click the Save amp Continue Later This selection takes you to the Libraries list with the recently created set up at the top of the list b Select the checkboxes in the Libraries list c Click the Pool Libraries button in the top navigation bar 2 NOTE If one of your samples is not assigned to a project you cannot continue Select the 5 sample click the Set Project button and assign it to a project You can also Set Project generate a new project Set Up Custom Library Prep Kit When you have selected your biol
77. les then the missing value is used QUAL Phred scaled quality score for the assertion made in ALT ie 10log_10 probability call in ALT is wrong If ALT is no variant this score is 10log_10 p variant If ALT is not this score is 10log_10 p no variant High QUAL scores indicate high confidence calls Although traditionally people use integer Phred scores this field is permitted to be a floating point to enable higher resolution for low confidence calls if desired If unknown the missing value is specified Numeric FILTER PASS if this position has passed all filters ie a call is made at this position Otherwise if the site has not passed all filters a semicolon separated list of codes for filters that fail gVCF files use the following values PASS position has passed all filters IndelConflict Locus is in region with conflicting indel calls SiteConflict Site genotype conflicts with proximal indel call which is typically a heterozygous SNV call made inside a heterozygous deletion LowGQx Locus GQX minimum of Genotype quality assuming variant position Genotype quality assuming nonvariant position is less than 30 or not present HighDPFRatio The fraction of base calls filtered out at a site is greater than 0 3 HighSNVSB SNV strand bias value SNVSB exceeds 10 High strand bias indicates a potential high false positive rate for SNVs HighSNVHPOL SNV contextual homopolymer length GNVHPOL exceeds
78. lity filter are included These plots have the following features You can select the displayed read and cycle through the drop down lists The symbol in the top right hand corner toggles the plot between pane view and full screen view The QScore is based on the Phred scale The following list shows Q scores and the corresponding chance that the base call is wrong Q10 10 chance of wrong base call Q20 1 chance of wrong base call Q30 0 1 chance of wrong base call Q40 0 01 chance of wrong base call You can slide the threshold set at gt Q30 by default to examine the proportion of bases at or above any particular Q score When using Q score binning this plot reflects the subset of Q scores used Data by Lane Plot What is it The Data by Lane plots allow you to view quality metrics per lane Data By Lane A0172 Read 1 Show Denas al os x E E 2 v m Qa o v 3 Oo When to use it Use the Data By Lane Plot to judge the difference in quality metrics between lanes When not to use it Do not use the Data By Lane Plot to look at alignment or variant calling analysis metrics Part 15049148 Rev E How to use it The Data by Lane plots have the following features You can select the displayed metric through the drop down lists The symbol in the top right hand corner toggles the plot between pane view and full screen view The plots share several characteristics The plots show the distribut
79. ll active Do not use this option if you want to confine the list of who has access to this run Why to use it This option is an easy way to share a link without having to specify email and setting permissions How to use it 1 Click the Runs icon 2 Click the desired run 3 Click the More button and select the Get Link option Get Link 4 Click the Activate button 5 Copy the URL to share with collaborators The link is active until the Deactivate option is selected The path to deactivate a sharing link is similar 1 Navigate to the run 2 Click the Get Link button 3 Click the Deactivate button j NOTE Runs and projects have separate permissions If you share a run the project associated with that run is not shared automatically meaning samples and app results are not accessible to collaborators of the run Share a Run Using the Email Option What is it Sharing using the Share option allows you to share a project or run with a specified collaborator via an email link Specified collaborators receive an email with a link to the project or run and only that person can view the corresponding data a NOTE The email option allows greater control over who can view your data The Get Link options gives anyone access to your data as long as the link is left activated See Share a Run with Get Link on page 62 for more information BaseSpace Onsite v2 0 System Guide 6 3 y suo soedsSeseg snN oL MOH When to use it
80. lumina branded software e g Hardware operating software data analysis software All Software is licensed and not sold and may be subject to additional terms found in the Software s end user license agreement Specifications means Illumina s written specifications for this Product in effect on the date that the Product ships from Illumina 2 Research Use Only Rights Subject to these terms and conditions and unless otherwise agreed upon in writing by an officer of Illumina Purchaser is granted only a non exclusive non transferable personal non sublicensable right under Illumina s Core IP in existence on the date that this Product ships from Illumina solely to use this Product in Purchaser s facility for Purchaser s internal research purposes which includes research services provided to third parties and solely in accordance with this Product s Documentation but specifically excluding any use that a would require rights or a license from Illumina to Application Specific IP b is a re use of a previously used Consumable c is the disassembling reverse engineering reverse compiling or reverse assembling of this Product d is the separation extraction or isolation of components of this Product or other unauthorized analysis of this Product e gains access to or determines the methods of operation of this Product f is the use of non Illumina reagent consumables with Illumina s Hardware does not apply if the Specifications or Docum
81. mples or use existing samples for instructions see one of the following topics Create New Biological Samples on page 26 Import Biological Samples on page 26 Use Existing Biological Samples on page 27 b Libraries Consists of biological samples that are prepped and contain adapters Each library usually derives from a single biological sample though biological samples can be used in multiple libraries See Libraries on page 18 You can also import biological samples and libraries in one step see Import Samples and Libraries on page 31 BaseSpace Onsite v2 0 System Guide 2 D y suo soedseseg snN oL MoH 26 c Pools Consists of groups of libraries that share analysis parameters Pools can consist of one or multiple libraries See Pools on page 19 d Planned Runs Contains pools that run with the same analysis parameters on the same machine at the same time Planned runs can consist of one or multiple pools See Planned Runs on page 19 Create New Biological Samples If you want to create a new biological sample do the following Kon Be NOTE Use the import function to create several new samples see Import Biological Samples on page 26 Click the Prep icon l Click Biological Samples Click the Create button Fill out the required fields Sample ID Name and Nucleic Acid type NOTE Sample ID and sample name can only exist of alphanumeric characters dash or underscore Sample ID has to be unique and short
82. n on other sequencing systems Unlocking also frees up the reserved run storage space on the BaseSpace Onsite system BaseSpace Onsite v2 0 System Guide 81 SYSE UIWIPW To unlock a run select the planned run and click Unlock Updates In general to update the server software perform the following 1 Plug the external USB drive with the software update into the BaseSpace Onsite head node server 2 Go to the Updates page 3 Click Detect Drive The Updates wizard now leads you through the update System Logs The System Logs page provides a download of the log files You can download all log files or packages that contain the system state log files active analysis log files or delete log files If an issue arises with your BaseSpace Onsite Illumina support uses these files to troubleshoot your system To speed up troubleshooting download the appropriate package before calling lumina support LOGS The BaseSpace Onsite system has been tested extensively to ensure its reliable operation However in the event that the BaseSpace Onsite system should experience any technical difficulties Illumina support may request that the administrative user downloads specific log files to help diagnose the technical issue Please note that these log files are for Illumina support use only Download All Logs Download System State Download Active Download Delete Logs Log Analysis Logs About Page Licenses The
83. n page 15 Runs Tab on page 20 Projects Tab on page 22 Apps Tab on page 24 Common Elements There are several common UI elements that are shared between all BaseSpace Onsite pages and which enable general tasks Toolbar Contact us button Bottom links Toolbar The BaseSpace Onsite toolbar elements are listed in the table Icon Element Description Dashboard See Dashboard Tab on page 15 Tab oard Prep Tab See Prep Tab on page 17 This tab is used to set up a NextSeq run Runs Tab See Runs Tab on page 20 Projects See Projects Tab on page 22 Tab Apps Tab See Apps Tab on page 24 Support The BaseSpace Onsite Support page provides access to the Page BaseSpace Onsite Knowledge Base User Guide and Illumina Technical Support Access to this information requires that your computer is connected to the internet The Search box allows you to find runs projects samples files Search or apps For more information see Search for Runs Projects Samples Files and Apps on page 75 1 A Part 15049148 Rev E Icon Element Description e MyAccount See MyAccount on page 15 e Terms leads to the User Agreement e Admin Panel only available if you have admin privileges See Admin Panel on page 15 e Blog leads to the blog Check out for the latest news developments and updates e Sign out Bottom Links The bottom links provide access to more information Help online help Terms leads to t
84. n the lane this chart is all gray Corrected Intensity The intensity corrected for cross talk between the color channels by the matrix estimation and phasing and prephasing Called Intensity The intensity for the called base Signal to Noise The signal to noise ratio is calculated as mean called intensity divided by standard deviation of noncalled intensities You can expand a chart by clicking the expand button 2 QScore Distribution What is it The QScore Distribution Plot shows a bar graph that allows you to view the number of bases by quality score The quality score is cumulative for current cycle and previous cycles and only bases from reads that pass the quality filter are included QScore Distribution 40172 all Lanes All Reads All Cycles Read gt Q30 All Reads A 1 65 GB Cycle Up To 90 81 All Cycles 5 2 Se T gt e _ em in sill 7 2 25 Q Score When to use it Use it to judge the QScore distribution for a run which is an excellent indicator for run performance When not to use it Do not use the QScore Distribution Plot to look at metrics other than quality scores BaseSpace Onsite v2 0 System Guide 3 Q y suo soedseseg snN oL MoH 40 How to use it The QScore Distribution pane shows plots that allow you to view the number of reads by quality score The quality score is cumulative for current cycle and previous cycles and only reads that pass the qua
85. nalysis At the bottom you see the list of active samples runs and analyses stored you can sort this list by clicking the column headers Any changes that add or remove data usually take 3 5 minutes to be reflected in the pie chart Active samples runs and analyses are stored on the BaseSpace Onsite system and can be used for analysis NOTE If there are many merged samples and copied samples on the system the usage per user values are overestimated in the Storage Use By Owners pie chart The Total Active Storage is not affected The Archive Storage tab provides an overview of the archived analyses Archived samples runs and analyses are stored on the archive system and cannot be used for analysis on BaseSpace Onsite without restoring At the bottom you see the list of archived samples runs and analyses you can sort this list by clicking the column headers The Deleted Items tab provides an overview of the items that have been deleted At the bottom you see the list of deleted samples runs and analyses you can sort this list by clicking the column headers You can restore these items to active storage or purge them from BaseSpace Onsite which deletes them permanently NOTE Illumina highly recommends that you set up an archive location BaseSpace Onsite v2 0 System Guide Fe SYSE UIWIPW 18 STORAGE Data volumes displayed are not in real time Changes in data sizes may take several minutes to be reflected here
86. nformation Launch the IGV App What is it The Integrative Genomics Viewer IGV of the Broad Institute is a fully featured genome browser that allows you to visualize your sequence data in great detail Ilumina has modified IGV to display alignment and variant data from BaseSpace Onsite BAM and VCF files When to use it IGV enables you to perform variant analysis after launching Resequencing or Amplicon workflows in BaseSpace Onsite IGV is run on a project which is the highest level directory and contains one or more AppResults IGV retains all its native functions including loading data from your local computer Why to use it To visualize your sequence data in greater detail How to use it NOTE f Make sure that the Java Runtime Environment is installed on the computer in order for IGV to work properly Download Java here java com en Run the IGV App the following way 1 Click the Projects icon 2 Click desired project 3 Click the Launch Apps button and select the IGV application from the drop down list 4 Select the Accept button 5 Depending on your browser it asks you to open or save the jnlp file For Internet Explorer click the Open button For Chrome click the Keep button and then click file to open For Firefox select the Open with Java TM Web Start Launcher default option The IGV App opens on your desktop with the requested project loaded Part 15049148 Rev E BaseSpace Onsite Data in
87. nt page e Use the import function The box next to the Libraries header tracks the total number of libraries and how many are selected Click X next to the selection count to clear the current selection For more information about these actions see Prep Libraries on page 27When prepping a library you can also create a custom library kit see Set Up Custom Library Prep Kit on page 29 Part 15049148 Rev E Pools When you click the Pools tab you see the Pools list which shows all available pools of libraries you have created on your account You can sort the list by clicking the column headers or click a pool to see its properties and associated libraries Figure 6 Pools List Biological Samples Is Planned Runs o gt gt gt Plan Run POOLS Pool ID of Libraries Date Modified v Pool 1231 1 minute ago Pool_1232 1 minute ago This page provides the following actions to prepare your analysis Click a pool then click the Edit button to edit the notes Select a pool and move to Plan Run iy NOTE You can also merge pools the following way e Click the Save amp Continue Later which takes you to the Pools list with the recently created plate at the top of the list e Select the checkboxes in the Pools list Click the Merge Pools button in the top navigation bar SOBL9 U JOST SUISUE eoedSeseg The box next to the Pools header tracks the total number of pools and how many are
88. ogical samples you can set up a custom library prep kit the following way 1 When prepping a library select Custom Library Prep Kit in the Library Prep Kit dropdown menu Biological Samples Libraries PREP LIBRARIES Library Prep Kit Custom Library Prep Kit The Custom Library Prep Kit Definition page opens Custom Library Prep Kit Name of your new kit Supported Read Types Single Read Paired End Supported Indexing Strategy None Single Index i Dual Index Default Read Cycles Read 1 Cycles Read 2 Cycles Import the indexes following this template No file chosen Cancel Create New Kit 2 Fill out the name of the custom prep It has the following requirements Unique for your account Characters only alphanumeric hyphen underscores and spaces accepted Less than or equal to 50 characters 3 Select at least 1 of the supported read types 4 Select at least 1 of the indexing strategies Only selecting None is not allowed 5 Fill out the default number of cycles BaseSpace Onsite v2 0 System Guide 2 Q y suo soedseseg snN O MoH 6 Click template to download the index definition file template 7 Fill out the Settings section the following way For single read only no adapter blank or 1 adapter sequence for Read 1 For paired end no adapter blank or 2 adapter sequences 1 for Read 1 and 1 for Read 2 Each adapter sequence meets the following criteria Sequence of
89. onditions to Indemnification Obligations Section 9 d below Illumina shall i defend indemnify and hold harmless Purchaser against any third party claim or action alleging that this Product when used for research use purposes in accordance with these terms and conditions and in accordance with this Product s Documentation and Specifications infringes the valid and enforceable intellectual property rights of a third party and ii pay all settlements entered into and all final judgments and costs including reasonable attorneys fees awarded against Purchaser in connection with such infringement claim If this Product or any part thereof becomes or in Ilumina s opinion may become the subject of an infringement claim Illumina shall have the right at its option to A procure for Purchaser the right to continue using this Product B modify or replace this Product with a substantially equivalent non infringing substitute or C require the return of this Product and terminate the rights license and any other permissions provided to Purchaser with respect this Product and refund to Purchaser the depreciated value as shown in Purchaser s official records of the returned Product at the time of such return provided that no refund will be given for used up or expired Consumables This Section states the entire liability of Ilumina for any infringement of third party intellectual property rights Exclusions to Illumina Indemnification Obligations
90. or the following quality metrics with this chart Part 15049148 Rev E Intensity FWHM Base Q gt 20 Q gt 30 Median Q Score Density Density PF Clusters Clusters PF Error Rate Phasing Prephasing Aligned Perfect Reads Corrected Intensity Called Intensity Signal to Noise This chart shows the intensity by color and cycle of the 90 percentile of the data for each tile The average full width of clusters at half maximum in pixels Used to display focus quality The percentage of clusters for which the selected base A C T or G has been called The percentage of bases with a quality score of gt 20 or gt 30 respectively These charts are generated after the 25 cycle and the values represent the current scored cycle The median Q Score for each tile over all bases for the current cycle These charts are generated after the 25 cycle This plot is best used to examine the Q scores of your run as it progresses Bear in mind that the Q30 plot can give an over simplified view due to its reliance on a single threshold The density of clusters for each tile in thousands per mm The density of clusters passing filter for each tile in thousands per mm The number of clusters for each tile in millions The number of clusters passing filter for each tile in millions The calculated error rate as determined by a spiked in PhiX control sample If no PhiX control sample
91. pace you see an error message see Storage Check on page 79 for more information BaseSpace Onsite automatically disconnects from the HiSeq at the end of the run or when all base calling files have finished uploading If the internet connection is interrupted analysis files continue uploading after the connection is restored from the point when the interruption occurred When the last base call file is uploaded to BaseSpace Onsite secondary analysis of your data begins For information about how to run tasks see How To Use BaseSpace Onsite on page 25 HiSeq Connection If the HiSeq data are not uploaded to BaseSpace Onsite check the following things 1 Check whether you have HCS version 2 2 68 or later If not upgrade your HCS 2 Make sure that you have a stable internet connection of at least 10 Mbps upload speed from the HiSeq 3 During run configuration the Integration screen on the HiSeq enables you to define where your run data are output and stored Perform the following a Select BaseSpace Onsite b Select Storage and Analysis Sends run data to BaseSpace for remote monitoring and secondary analysis A sample sheet is required with this option RUN CONFIGURATION PRE RUN SETUP INITIATE RUN Storage p FlowCell Setup Advanced p Recipe sampiesheet p Reagents gt Rd Please enter Email O None BaseSpace BaseSpace Onsite Storage and Analysis Run Monitoring Only Enter your BaseSpace Onsite account Email Passwo
92. pace Onsite genomes have to conform to the following relative paths Arabidopsis thaliana NCBI build9 1 Sequence WholeGenomeFASTA Bos_taurus Ensembl UMD3 1 Sequence WholeGenomeFASTA Escherichia coli K 12 DH10B NCBI 2008 03 17 Sequence WholeGenomeFASTA Homo _sapiens UCSC hg19 Sequence WholeGenomeFASTA Mus_musculus UCSC mm9 Sequence WholeGenomeFASTA PhiX Illumina RTA Sequence WholeGenomeFASTA Rattus norvegicus UCSC rn4 Sequence WholeGenomeFASTA Saccharomyces cerevisiae UCSC sacCer2 Sequence WholeGenomeFASTA Staphylococcus aureus _NCTC_8325 NCBI 2006 02 13 Sequence WholeGenomeFASTA Fix indexes In the Prep Tab What is it You can correct errors in your indexes through the Prep tab and regenerate the FASTQ files When to use it To change indexes and regenerate FASTQ files for samples that have already been sequenced When not to use it For runs that are not set up with the Prep tab For runs where the wrong library prep kit was selected in the Prep tab How to use it 1 Go to the run with the wrong indexes Click the Run Settings button in the navigation task pane Go to the bottom of the page and click the pool Click the Plate ID of the plate Click Edit Correct the index in the dropdown menu Go to the affected run In the More dropdown menu select Generate FASTQ Files BaseSpace Onsite now starts regenerating the FASTQ files with the corrected indexes The new FASTQ
93. page 22 Part 15049148 Rev E App Results Pane The right bottom pane of the BaseSpace Onsite dashboard shows the most recent app results Clicking an app result provides charts relevant for the app used in the Projects tab For more information see Analyses Page on page 23 Prep Tab The Prep tab enables you to set up a sequencing run on the NextSeq sequencing system Prep This tab is only available for NextSeq sequencing systems Other sequencing instruments use a sample sheet to provide sample information to BaseSpace SOBL9 U JOST SUISUE eoedSeseg The Prep Tab sets up a run in 4 steps Biological Samples Contains information about the samples that are going to be sequenced See Biological Samples on page 17 Libraries Consists of biological samples that are prepped and contain adapters Each library usually derives from a single biological sample though biological samples can be used in multiple libraries See Libraries on page 18 Pools Consists of groups of libraries that share analysis parameters Pools can consist of one or multiple libraries See Pools on page 19 Planned Runs Contains pools that run with the same analysis parameters on the same machine at the same time Planned runs can consist of one or multiple pools See Planned Runs on page 19 Biological Samples When you click the Biological Samples tab you see the Biological Samples list which shows all available samples you have created on your ac
94. port FASTQ File Upload Requirements The FASTO file is a text format file used to represent sequences Each record has 4 lines The 4 lines of data are an identifier read descriptor the sequence and the quality scores For a detailed description of the FASTQ format see FASTQ Files on page 57 Make sure the FASTQ file adheres to the following upload requirements The uploader only supports gzipped FASTQ files generated on Illumina instruments The name of the FASTQ files conforms to the following convention SampleName SampleNumber Lane Read FlowCellIndex fastq gz For example SampleName S1 L001 R1 001 fastq gz SampleName S1 L001 R2 001 fastq gz The read descriptor in the FASTQ files conforms to the following convention Instrument RunID FlowCellID Lane Tile X Y ReadNum FilterFlag 0 SampleNumber For example a Read 1 descriptor could look like this line M00900 62 000000000 A2CYG 1 1101 18016 2491 1 N 0 13 And the corresponding Read 2 would have a 2 in the ReadNum field M00900 62 000000000 A2CYG 1 1101 18016 2491 2 N 0 13 Quality considerations The number of base calls for each read equals the number of quality scores The number of entries for Read 1 equals the number of entries for Read 2 The uploader determines whether files are paired end based on matching file names in which the only difference is the ReadNum For paired end reads the descriptor must match for every entry for both reads 1 and 2
95. quality metrics during a run These plots have the following features You can select the displayed metric and base through the drop down lists The symbol in the top right hand corner toggles the plot between pane view and full screen view You can monitor the following quality metrics with this plot Intensity This chart shows the intensity by color and cycle of the 90 percentile of the data for each tile FWHM The average full width of clusters at half maximum in pixels Used to display focus quality Base The percentage of clusters for which the selected base A C T or G has been called Q gt 20 Q gt 30 The percentage of bases with a quality score of gt 20 or gt 30 respectively These charts are generated after the 25 cycle and the values represent the current scored cycle Part 15049148 Rev E Median Q Score The median Q Score for each tile over all bases for th current cycle These charts are generated after the 25 cycle This plot is best used to examine the Q scores of your run as it progresses Bear in mind that the Q30 plot can give an over simplified view due to its reliance on a single threshold Error Rate The calculated error rate as determined by a spiked in PhiX control sample If no PhiX control sample is run in the lane this chart is not available Perfect Reads The percentage of reads that align perfectly as determined by a spiked in PhiX control sample If no PhiX control sample is run i
96. r higher Hardware requirements for these browsers can be found on the developer s website A PC running Windows 7 or greater is required to access the BaseSpace Onsite See the following topics to get started with BaseSpace Onsite Using BaseSpace Onsite with NextSeq on page 10 Using BaseSpace Onsite with HiSeq on page 11 Getting Shared Data on page 13 Using BaseSpace Onsite with NextSeq BaseSpace Onsite is the Illumina analysis local environment BaseSpace Onsite facilitates your experiments on the NextSeq system in 2 different ways BaseSpace Onsite helps to organize your samples and experiments and preps runs for NextSeq BaseSpace Onsite stores and analyzes your run data providing the following benefits Enables browser based data management and analysis Provides tools for institute wide collaboration and sharing Eliminates the need to manage your own storage and computing solutions BaseSpace Onsite has limited storage capacity and checks the free space available before uploading a run If there is not enough available space you see an error message see Storage Check on page 79 for more information 1 O Part 15049148 Rev E Figure 2 BaseSpace Onsite Log On BaseSpace ONSITE illumina Password Forgot password Change password illumina e ecr2 7 e eer at OS tt 2014 Illumina Inc All rights reserved If your NextSeq sequencing system and BaseSpace do not connect properly check the follow
97. rd IF you do nat have an acc Check with your administrator to sec if BaseSpace supports the analysis that you want to perform c Enter your BaseSpace Onsite account information d Go to the Storage screen and specify the storage options RUN CONFIGURATION PRE RUN SETUP INITIATE RUN Integration gt Storage Flow Cell Setup gt Advanced gt Recipe gt Sample Sheet gt Reagents gt Rd Specify a valid output folder You are uploading data to BaseSpace Onsite Save to an output folder SPECIFY NETWORK PATH Zip BCL files Bin QScores 56 reduction in storage space Save auxiliary files Save All Thumbnails vy 4 If BaseSpace Onsite is not available open Windows Services and start or restart Illumina BaseSpace Onsite Broker e Click the Windows Start button f Right click Computer select Manage g On the left under Services and Applications choose Services Part 15049148 Rev E h Scroll down the list to find Ilumina BaseSpace Broker i Right click Illumina BaseSpace Broker and do one of the following Click Start if this option is not grayed out If the Start option is grayed out click Restart The service starts or closes then restarts j Close the Computer Management window E NOTE f To use BaseSpace Onsite you have to load a sample sheet at the start of your run For more information see the HiSeq User Guide When you begin your sequencing run on the HiSeq the BaseSpace Onsite icon changes to ind
98. same POS Telomeres are indicated by using positions 0 or N 1 where N is the length of the corresponding chromosome or contig ID Semi colon separated list of unique identifiers where available If this ID is a dbSNP variant it is encouraged to use the rs number No identifier is present in more than one data record If there is no identifier available then the missing value is used REF Reference bases A C G T N there can be multiple bases The value in the POS field refers to the position of the first base in the string For simple insertions and deletions in which either the REF or one of the ALT alleles would otherwise be null empty the REF and ALT strings include the base before the event This modification is reflected in the POS field The exception is when the event occurs at position 1 on the contig in which case they include the base after the event If any of BaseSpace Onsite v2 0 System Guide D 3 S1ISUE soedseseg snN oL MOH 54 the ALT alleles is a symbolic allele an angle bracketed ID String lt ID gt the padding base is required In that case POS denotes the coordinate of the base preceding the polymorphism ALT Comma separated list of alternate non reference alleles called on at least one of the samples Options are Base strings made up of the bases A C G T N Angle bracketed ID String lt ID gt Break end replacement string as described in the section on break ends If there are no alternative alle
99. sample name can be more descriptive to provide a human readable identifier Optional Fill out the Organism species field Optional Fill out the Project fields You can also generate a new project A project is optional here but required later because the output data gets stored to the project When finished do one of the following If you only want to select the newly created sample click the Next Prep Libraries button Continue with Prep Libraries on page 27 If you want to select multiple samples click the Save amp Continue Later This selection takes you back to the Biological Samples list with the recently created sample at the top of the list Continue with Use Existing Biological Samples on page 27 Import Biological Samples If you want to import new biological samples do the following BR U Ne Click the Prep icon A Click Biological Samples Click the Import button If you have not generated an import file yet click the template link fill out the samples and be aware of the following when filling out the template User Sample ID and sample name can only exist of alphanumeric characters dash or underscore Sample ID has to be unique and short sample name can be more descriptive to provide a human readable identifier The Organism species field is optional The Project field is optional but a project is required later because the output data gets stored to the project Fill out the Nucleic Acid column wit
100. sheet To change analysis parameters To change indexing details Why to use it Errors in the sample sheet can prevent BaseSpace Onsite from processing a run This option allows BaseSpace Onsite to finish the analysis The first analysis was suboptimal You can resubmit the sample sheet and requeue the run with new analysis parameters one time The index settings for samples were wrong This option allows you to correct the settings 2 NOTE You can only submit a corrected sample sheet and requeue the run one time How to use it 1 You can reach the Fix Sample Sheet page 2 ways A run can have a Needs Attention state Open the run and click the Fix Sample Sheet link Needs Attention sample sheet needs attention Fix Sample Sheet Part 15049148 Rev E Go to a run select the More drop down list and then select Fix Sample Sheet Get link Transfer Ownership E Fix Sample Sheet The Fix Sample Sheet page opens If BaseSpace Onsite has detected an error it shows the issue above the black sample sheet editor Fix Sample Sheet Please enter a new sample sheet or load the original to edit it You may generate a new Sample Sheet using Illumina Experiment Manager Load Original ueue Analysis Sample sheet is invalid Genome Path sample_1 Unknown Genome Genome Path sample_2 Unknown Genome Genome Path sample_5 Unknown Genome Sample Sheet Editor 2 Depending on the complexity of the change you have
101. sily with collaborators Use this option if you want to be able to control who has access to the projects Why to use it Use this option if you want to be able to control who has access to the project How to use it 1 Click the Projects icon Click the desired project Click Share Project AeA WO N In the Share Settings dialog box enter the collaborators email address and click the Invite button NOTE i The invitation email address must match your BaseSpace Onsite login email address or else your collaborator is not able to view the project 5 4 Click Save Settings Share a Run with Get Link What is it Sharing using the Get Link option allows you to share a run with any collaborator who has access to the link The hyperlink can be turned on or off by setting the activate or deactivate option Anyone can access the project or run when the link is activated Furthermore anyone who previously accepted the link still has access to the run even though the link is deactivated Part 15049148 Rev E Sharing runs with the Get Link option is similar to sharing projects with the Get Link option z NOTE i If you want more control use the email share option where you can specify who can view the project Share a Run Using the Email Option on page 63 When to use it Use this option when you do not want to assign the run to a specific person This share link can be forwarded to many other collaborators while the link is sti
102. specifies Dual Index you can set up Default Layout By Row the following way Each row letter unique from A to H For each row an associated index name exists in the specified Index2Sequences section 12 Click the Choose csv File button to select and upload your custom index file 13 Click Create New Kit to complete the process Your custom library prep has been added to the library kit drop down 30 Part 15049148 Rev E Import Samples and Libraries You can import libraries and associate them to new biological samples at the same time the following way 1 Click the Prep icon l 2 Click Libraries 3 Click the Import button 4 If you have not generated an import file yet click the template link fill out the samples and be aware of the following when filling out the template User Sample ID and sample name can only exist of alphanumeric characters dash or underscore Sample ID has to be unique and short sample name can be more descriptive to provide a human readable identifier The Species field is optional The Project field is optional but if you do not specify it here set it later because the output data gets stored to the project Fill out the Nucleic Acid column with DNA or RNA Figure 11 Import Sample Template Header l FileVersic 1 LibraryPre Nextera XT Container Plate96 Container TestPlate4385 Notes This is a test plate for importing libraries Data SamplelD Name Species Project NucleicAc Well Ind
103. stem Guide 3 D y suo soedseseg snN oL MoH 36 View Run Charts What is it The Charts page shows charts with run metrics When to use it Use this option when you want to view charts such as Flow Cell Data By Cycle Data By Lane QScore Distribution and QScore Heatmap Why to use it Use this option if you want access to these various charts How to use it 1 Click the Runs icon 2 Click the desired run 3 There are 2 methods to go to the Charts page From the Run Overview page click the Charts link From the Run Overview page click the Charts icon from the left navigation menu Flow Cell Chart What is it The Flow Cell Chart shows color coded graphical quality metrics per tile for the entire flow cell When to use it Use the Flow Cell Chart to judge local differences per cycle per lane or per read in sequencing metrics on a flow cell It is also an easy way to see the Q30 metric which is an excellent single metric to judge a run When not to use it Do not use the Flow Cell Chart to look at downstream analysis metrics How to use it The Flow Cell Chart has the following features You can select the displayed metric surface cycle and base through the drop down lists The color bar to the right of the chart indicates the values that the colors represent The chart is displayed with tailored scaling by default Tiles that have not been measured or are not monitored are gray You can monit
104. supply unit number C Power supply unit number C Power supply unit number C Power supply unit number C Power supply unit number C Power supply unit number C Power supply unit number C Power supply unit number C IPMI Watchdog IPMI Watchdog IPMI Watchdog IPMI Watchdog IPMI Watchdog Physical Security Physical Security Physical Security Physical Security Front Panel Board System Board Timeout System Board Timeout System Event BaseSpace Onsite v2 0 System Guide Message The power unit has detected an unexpected failure The power unit has recovered from an unexpected failure The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is no longer redundant due to power unit number C failing The power supply is redundant again The hardware monitor has detected an expired timer The hardware monitor has detected hard reset of the system The hardware monitor has detected that the system is shutting down The hardware monitor has detected that the system is
105. t tile gt Numerical Tile number lt x_pos gt Numerical X coordinate of cluster lt y_ pos gt Numerical Y coordinate of cluster lt read gt Numerical Read number 1 can be single read or Read 2 of paired end Part 15049148 Rev E Element Requirements Description lt is YorN Y if the read is filtered did not pass N otherwise filtered gt lt control Numerical 0 when none of the control bits are on otherwise number gt it is an even number lt index gt Restricted characters Index of the read A T G C N An example of a valid entry is as follows note the space preceding the read number element SIM 1 FCX 1 15 6329 1045 1 N 0 ATCCGA TCGCACTCAACGCCCTGCATATGACAAGACAGAATC lt gt gt lt 9 AAAAAAAAAAIE lt lt lt lt lt 72 Quality Scores A quality score or Q score expresses an error probability In particular it serves as a convenient and compact way to communicate very small error probabilities Given an assertion A the quality score Q A expresses the probability that A is not true P A according to the relationship Q A 10 log P A where P A is the estimated probability of an assertion A being wrong The relationship between the quality score and error probability is demonstrated with the following table Quality score Q Error probability P A A 10 0 1 20 0 01 30 0 001 2 NOTE On the systems we currently support Q scores are automatically binned The specific binnin
106. t to assign the project to a specific person This share link can be forwarded to many other collaborators while the link is still active Do not use this option if you want to confine the list of who has access to this project Why to use it If you want an easy way to share a link without the hassle of adding specific people by email and setting permissions How to use it 1 Click the Projects icon Click the desired project Click the Get Link button Click the Activate button a A WwW N Copy the URL to share with collaborators BaseSpace Onsite v2 0 System Guide 61 y suo soedseseg snN oL MOH 62 The link is active until the Deactivate option is selected The path to deactivate a sharing link is similar 1 Navigate to the shared item 2 Click the Get Link button 3 Click the Deactivate button Share a Project Using the Email Option What is it Sharing using the Share option allows you to share a Project or Run with a specified collaborator via an email link The specified collaborators receive an email with a link to the Project or Run and only that person can view the corresponding data iy NOTE The email option allows greater control over who can view your data Sharing using the Get Link options gives anyone access to your data as long as the link is left activated For more information see Share a Project with Get Link on page 61 When to use it Use this option of you want to share your project ea
107. the Run Overview page click the Indexing QC link From the Run Overview page click the Indexing QC icon from the left navigation menu Y You can select the displayed lane through the drop down list The first table provides an overall summary of the indexing performance for that lane including Total Reads The total number of reads for this lane PF Reads The total number of passing filter reads for this lane Reads Identified PF The total fraction of passing filter reads assigned to an index CV The coefficient of variation for the number of counts across all indexes Min The lowest representation for any index Max The highest representation for any index Further information is provided regarding the frequency of individual indexes in both table and graph form The table contains several columns including Index Number A unique number assigned to each index by BaseSpace Onsite for display purposes Sample ID The sample ID assigned to an index in the sample sheet Project The project assigned to an index in the sample sheet Index 1 17 The sequence for the first Index Read Index 2 15 The sequence for the second Index Read Reads Identified PF The number of reads only includes Passing Filter reads mapped to this index This information is also displayed in graphical form In the graphical display indexes are ordered according to the unique Index Number assigned by BaseSpace Onsite BaseSpace Onsite v2 0 Sy
108. tion by fixing the sample sheet a Add adapter sequences to the Settings subsection in the sample sheet b Requeue the analysis For more information see Fix Sample Sheet Re Run Workflow on page 72 MiSeq you can only upload MiSeq FASTQ files through BaseSpace Onsite Import Trim the adapters from the FASTQ files before import Download Files 48 The following topics describe how to download files in BaseSpace Onsite Download Individual Files What is it BaseSpace Onsite allows you to download data as a package individually or as a group of FASTQ files This topic describes how to download individual files with the file browser When to use it Use this option when you want to download individual files and do not need all files for a run sample project or analysis Why to use it If you only want to download individual files it saves you time because you are not downloading all the other files How to use it 1 Click the Runs icon or Projects icon Part 15049148 Rev E 2 Navigate to the file you want to download 3 Click the file 4 Click the Download button BaseSpace Onsite now downloads the files to the desired location Download Multiple FASTQ Files What is it BaseSpace Onsite allows you to download data as a package individually or as a group of FASTQ files This topic describes how to download a group of FASTQ files with the downloader When to use it Use this option when you want to
109. to being offline The panel board in the back of the chassis is back online The processor number C has exceeded the normal range The processor number C is back within the normal range Status OK Error OK OK Error OK Error Error OK OK Error OK Error OK Error OK Error Error OK Error OK 87 Syse ulupy Error Code Item ID Item Name Message Status P_ C Processor number C The processor number C has been detected OK II BIC Processor number C The processor number C is not being detected OK P_ERR_ C Processor number C The processor number C has detected a digital state error Error digital state error P_ERR_ C Processor number C The processor number C has recovered from a digital OK digital state error state error P_TEMP_ C System temperature The system temperature has exceeded its threshold Error P_TEMP_ C System temperature The system temperature is back within normal operating OK range PS_FAN_ C Power Supply Fan C The power supply fan number C has failed Error PS_FAN_ C Power Supply Fan C The power supply fan number C has been restored OK M_ C Memory Sensor The thermal sensor at memory location C has exceeded its Error number C threshold M_ C Memory Sensor The thermal sensor at memory location C is back within OK number C normal range HD_ C Disk in slot C Disk rebuild in progress at slot C Error HD_ C Disk in slot C Disk rebuild at slot C has completed OK HD_ C Disk
110. to use it 1 Click the Projects icon 2 Click the desired project You can now click an Analysis to see the results for more information see Analyses Page on page 23 Analyze Samples Further The following topics describe how to analyze samples further in BaseSpace Onsite Launch Apps on page 45 Launch the IGV App on page 46 Run the VariantStudio App on page 47 Launch Apps What is it You can launch apps that perform additional analysis visualization or annotation of data When to use it When you want to run an Illumina provided app on your samples How to use it 1 There are 2 ways to start an app BaseSpace Onsite v2 0 System Guide A D suo veds seg snN O MoH 46 Navigate to the project sample or analysis that you want to run the app on click the Launch Apps button and select the desired app from the drop down list Go to the Apps button select the desired app from the list and click Launch If you are running BWA Enrichment v2 1 or Isaac Enrichment v2 1 make sure to read Enrichment v2 1 Apps Adapter Trimming on page 48 2 Read the End User License Agreement and permissions and click Accept if you are ok with them The app now guides you through the start up process BaseSpace Onsite has limited storage capacity and checks the free space available before starting an app If there is not enough available space BaseSpace Onsite displays an error message see Storage Check on page 79 for more i
111. tomatically from the Planned Runs list Runs Tab The Runs button leads to the runs list which allows you to sort your runs based on experiment name state workflow created date machine and owner 20 The following run states are possible blue boxes indicate final states Running Instrument is running i Uploading BaseSpace waiting for data i Pending Analysis BaseSpace getting ready to analyze Needs Attention BaseSpace needs attention Analyzing BaseSpace is working Y Complete BaseSpace finished lt Paused Instrument run paused xN Stopped Instrument run stopped by user or by fault Failed BaseSpace analysis failed If you want to look at a run in detail click the name to view metrics in more detail For more information see Run Overview Page on page 21 You manage the runs by using the buttons above the list Share Manage sharing a run with a particular collaborator See also Share a Run Using the Email Option on page 63 Get Link Forward the sharing link to any number of collaborators See also Share a Run with Get Link on page 62 Download Run Download files from this run See also Download Run File Package on page 49 Part 15049148 Rev E Transfer Owner Hand control of data over to a collaborator or customer This button is visible if a run is selected See also Transfer Owner on page 67 Move to Trash Delete a project This button is visible
112. ts original location see Restore Trash on page 71 Deleting an analysis has the following additional features You cannot delete an analysis that is in a nonterminal state for example pending execution or running Deleting an analysis from a project that is in ownership transfer can cause a delay until the transfer has completed Delete Sample What is it A method to delete a sample When to use it To move the sample out of your Samples list into the trash When a sample is in the trash the sample can be permanently deleted from BaseSpace Onsite When not to use it Do no use this action if you want to archive a sample How to use it 1 Click the Projects icon Part 15049148 Rev E 2 Click the desired project 3 Click the Samples tab on the left navigation bar 4 Select the samples to be deleted 5 Click the Move to Trash button 6 Click Confirm The sample is now in the trash You can permanently delete the sample from BaseSpace Onsite by emptying all items in the trash see Empty Trash on page 71 You can also restore the analysis to its original location see Restore Trash on page 71 If you received the sample as a share the deleted sample does not appear in the trash If you want to restore a sample shared with you click the previously sent share link or contact the owner Empty Trash What is it After you have deleted an item it is present in the Trash if you are the owner of that item
113. ual property that cover aspects or features of this Product or use thereof that are common to this Product in all possible applications and all possible fields of use the Core IP Application Specific IP and Core IP are separate non overlapping subsets of all Illumina owned or controlled intellectual property By way of non limiting example Illumina intellectual property rights for specific diagnostic methods for specific forensic methods or for specific nucleic acid biomarkers sequences or combinations of biomarkers or sequences are examples of Application Specific IP Consumable s means Illumina branded reagents and consumable items that are intended by Illumina for use with and are to be consumed through the use of Hardware Documentation means Illumina s user manual for this Product including without limitation package inserts and any other documentation that accompany this Product or that are referenced by the Product or in the packaging for the Product in effect on the date of shipment from Illumina Documentation includes this document Hardware means Illumina branded instruments accessories or peripherals Illumina means Illumina Inc or an Illumina affiliate as applicable Product means the product that this document accompanies e g Hardware Consumables or Software Purchaser is the person or entity that rightfully and legally acquires this Product from Illumina or an Illumina authorized dealer Software means Il
114. umina will attempt to pass through such indemnity if any to Purchaser Part 15049148 15049148 15049148 15049148 15049148 Description of Change Minor changes for final launch Supporting BaseSpace Onsite v2 0 using BaseSpace version 3 14 Added log package descriptions Added descriptions for the following features e Prep tab library import e Upload VCF file e Custom library e VariantStudio app Initial Release Introduction The BaseSpace Onsite System is a genomics analysis platform that is a directly integrated end to end solution for the HiSeq 2500 sequencing system with HCS version 2 2 68 or later and the NextSeq BaseSpace Onsite has the following features UOIONPOANU You can prepare a NextSeq run on the BaseSpace Onsite Prep Tab and then start that run from your instrument The instrument seamlessly pushes the base call bel files and associated files to BaseSpace Onsite for automatic analysis and storage There is no need for a manual and time consuming data transfer step the data are already in the BaseSpace Onsite The BaseSpace Onsite System provides a mechanism to share data with others and easily scale storage and computing needs The BaseSpace Onsite System runs locally no need to connect to the cloud For more information about BaseSpace Onsite see the BaseSpace Onsite System Data Sheet Workflow Model Processing a flow cell on a sequencing instrument produces various files
115. ve a Warranty for Consumables Illumina warrants that Consumables other than custom Consumables will conform to their Specifications until the later of i 3 months from the date of shipment from Illumina and ii any expiration date or the end of the shelf life pre printed on such Consumable by Illumina but in no event later than 12 months from the date of shipment With respect to custom Consumables i e Consumables made to specifications or designs made by Purchaser or provided to Illumina by or on behalf of Purchaser Illumina only warrants that the custom Consumables will be made and tested in accordance with Illumina s standard manufacturing and quality control processes Illumina makes no warranty that custom Consumables will work as intended by Purchaser or for Purchaser s intended uses Warranty for Hardware Illumina warrants that Hardware other than Upgraded Components will conform to its Specifications for a period of 12 months after its shipment date from Illumina unless the Hardware includes Illumina provided installation in which case the warranty period begins on the date of installation or 30 days after the date it was delivered whichever occurs first Base Hardware Warranty Upgraded Components means Illumina provided components modifications or enhancements to Hardware that was previously acquired by Purchaser Illumina warrants that Upgraded Components will conform to their Specifications for a period of 90 days from t
116. y karyotype order If all filters are passed the PASS is written The possible filters are as follows e q20 The variant score is less than 20 Configurable using the VariantFilterQuality Cutoff setting in the config file e r8 For an Indel the number of repeats in the reference of a 1 or 2 base repeat is greater than 8 Configurable using the IndelRepeatFilterCutoff setting in the config file The format column lists fields separated by colons for example GT GQ The list of fields provided depends on the variant caller used The available fields are as follow AD Entry of the form X Y where X is the number of reference calls Y the number of alternate calls GQ Genotype quality GT Genotype 0 corresponds to the reference base 1 corresponds to the first entry in the ALT column 2 corresponds to the second entry in the ALT column etc The indicates that there is no phasing information NL Noise level an estimate of base calling noise at this position SB Strand bias at this position Larger negative values indicate more bias values near zero indicate little strand bias VF Variant frequency The percentage of reads supporting the alternate allele The rs number for the SNP obtained from dbSNP If there are multiple rs numbers at this location the list is semi colon delimited If no dbSNP entry exists at this position the missing value is used Part 15049148 Rev E Setting Description

Download Pdf Manuals

Related Search

Related Contents

LG ST3210K  FS－1260、FS－1270シリーズ 税率変更（5％→8％）の設定操作    13.Manual operation - SEM Waterbehandeling BV    HD STB with PVR Review  GX200 2+4 Service Manual - Red-D    Thermotec Vertical User Manual  LL-S242A-W LL-P202V  

Copyright © All rights reserved. Failed to retrieve file