Home

Sequence Genotyping HLA-DRB1

1. Preparation of controls AlleleSEQR HLA DRB1 SBT DNA from samples whose genoptypes have been previously confirmed by DNA sequence analysis are used as positive controls in this assay The control DNA is stored in a 1 5ml microcentrifuge tube and stored at a concentration of 20ng ul Two pl of control DNA is used in each PCR reaction The control DNA is labeled with a unique identification number and a number indicating the date and operator who prepared the sample The control DNA is stored at 20C in a clean laboratory in which no amplified DNA is present HLA DRB SSP PCR Sequencing DNA from samples whose genoptypes have been previously confirmed by DNA sequencing and sequencing analysis are used as positive controls in this assay The control DNA is stored in a 1 5ml microcentrifuge tube and stored at a concentration of 200ng pl Two ul of control DNA is used in each set of PCR reactions The control DNA is labeled with a unique identification number and a number indicating the date and operator who prepared the sample The control DNA is stored at 20C in a clean laboratory in which no amplified DNA is present Human Identification Control DNA of a known Genotype and a Green I Allelic Ladder are supplied in the AmpF STR Green I PCR Amplification Kit at a set concentration The control DNA is stored at 4C in a clean laboratory and the Allelic Ladder is stored at 4C in a dirty laboratory where amplified DNA is in use
2. 12 13 14 Remove the comb wash the plates and load the comb as described in the ABI PRISM 377 DNA Sequencer Users Manual Prepare a sufficient quantity of electrophoresis buffer to fill both anodal and cathodal chambers by diluting 10X TBE stock for sequencing with deionizd water to 1X Mount the gel cassette onto the sequencing apparatus and prepare the gel for the sequence run according to the 377 DNA Sequencers Users Manuals instructions Open a new sample sheet in the 377 96 Data Collection Software and input sample names to be run on the gel Save the sample sheet and open a new sample run in the 377 96 Data Collection Software and open the new sample sheet that was just created in the previous step To assure plates and gel are clean perform a plate check using the Plate Check module Pre warm the acrylamide gel by running the PRE RUN module Prepare the samples for the sequence run by re suspending the dried down samples in 4ul of a 5 1 ratio of Hi Di formamide and blue dextran EDTA loading dye for example 5ul of the Hi Di formamide combined with lul of the blue dextran EDTA loading dye Vortex the samples and centrifuge briefly Denature the samples by heating the samples at 95 5C for 2 minutes Stop the PRE RUN when the temperature reaches 50C and rinse out the top of the gel with 1 XTBE buffer Load 1 5ul of the denatured samples on the gel The odd lanes should be loaded first then run in for 1 minute before the even l
3. 18 Transfer or Referral of Specimens Procedures for Specimen Accountability Sy lS Sie BS IW W G2 IN IN me eS S e le le e WS 100 100 NIN INUID ID ID ID ID IS MR IB BH BH lslslsls and Tracking 10 19 References 11 20 Appendix A Puregene Method for DNA Isolation from Whole Blood and Cell Culture using the Puregene Genomic DNA Isolation Kit 12 21 Appendix B Human Identification with the Short Tandem Repeat Loci using the AmpF STR Green I PCR Amplification Kit 16 22 Appendix C Identification of the Amelogenin and THO1 markers 18 23 Appendix D Sequence Based Typing of HLA DRB1 using the AlleleSEQR HLA DRB1 Sequence Based Typing SBT Kit 21 24 Appendix E Geontyping of HLA DRB1 using the HLA DRB BigDye Terminator Sequencing Based Kit 25 25 Table 1 HLA DRB sample worksheet 31 26 Table 2 HLA DRB Comparison Table 32 1 Summary of Test Principle and Clinical Relevance Type diabetes mellitus is a chronic autoimmune disease that involves a T cell mediated destruction of the pancreatic beta cells the body s sole source for insulin 1 This disorder is the most common chronic disease among children and young adults 2 Complications include kidney failure blindness amputations nerve damage as well as an increased risk for heart attacks and strokes 3 Type diabetes has been shown to involve a genetic comp
4. 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 32
5. 94C 1 min 59C 1min 72C 1min 1 cycle 60C 45min hold at 25C store the amplified products protected from light at 2 6C for short periods and at 15 to 25C for longer periods Preparing samples for Genescan using the 310 Genetic Analyzer 1 oY Depp Clean the machine out and prepare the 310 Genetic Analyzer for running GeneScan using Performance Optimized Polymer 4 POP 4 Follow instructions described in the ABI PRISM 310 Genetic Analyzer User s Manual Open a new GeneScan sample sheet in the 310 Data Collection Software Fill in the sample names and mark the red box as the standard Save the sample sheet Open up a new injection list and open the sample sheet that was just created and select Genescan 350 ROX as the internal lane standard Calculate and combine the necessary amounts of Hi Di formamide and GeneScan 350 ROX Internal Lane Standard in a 1 5 ml microcentrifuge tube Remember to include in the sample number the positive control and a Green I Allelic Ladder that is supplied in the kit Number of samples 2 x 24 ul of Hi Di formamide Number of samples 2 x 1 0 ul of genescan 350 ROX size standard Aliquot 25 ul of the Hi Di formamide genescan 350 ROX mixture into 0 3ml Genetic Analyzer tubes Add 1 0ul of AmpFI STR Green I PCR Product or 1 0 ul of AmpF STR Green I Allelic Ladder per tube and mix by pipetting up and down Seal each tube with a septum Denature each sample at 95C for 3 minutes and chill th
6. Add appropriate volume of the Cell Lysis Solution to the cells and pipette up and down to lyse the cells Incubation is usually not required however if cell clumps are visible incubate at 37 C until the solution is homogenous and no clumps are detected hat DE NOTE The samples are stable in the cell lysis solution for at least 18 months at room temperature B RNase Treatment 1 Add appropriate volume of RNaseA Solution to the cell lysate solutions in the Falcon tubes 2 Mix by inverting the tube 25 times and then incubate at 37 C for 60 minutes C Protein Precipitation 1 Cool samples at room temperature 2 Add appropriate volume of the Protein Precipitation Solution to the cell lysate solutions 3 Vortex for 20 seconds 4 Centrifuge at 2 000 x g for 12 minutes The precipitated proteins should form a tight dark brown pellet If the protein pellet is diffuse repeat step 3 followed by incubation on ice for 5 minutes and then repeat step 4 D DNA Precipitation 1 Pour the supernatant containing the DNA leaving the protein pellet behind into a clean 50 ml tube containing appropriate volume of 100 isopropanol Add 16 7 ul of glycogen solution per 10 ml of isopropanol to increase the DNA yield Mix the sample by inverting the tubes gently 50 times until the white threads of DNA form a visible clump Centrifuge at 2 000 x g for 20 minutes Pour off supernatant and drain the tubes on a clean absorbent paper Add appropriate volume
7. Applied Biosystems Foster City CA ABI PRISM 377 DNA sequencer Applied Biosystems Rainin pipettors Rainin Emeryville CA Stratalinker 2400 UV Crosslinker Stratagene La Jolla CA Vortex Genie Diagger Lincolnshire IL Heating block Computer and software for analysis with GeneScan and Genotyper Software Applied Biosystems Labeling Label all reagents and aliquots of reagents with the reagent name concentration date prepared and appropriate expiration date Labels are created using computer label making system Label View Pro and Eltron printer Reagent Preparation 10X TBE for sequencing Final concentration grams L 890mM Tris Base Trizma Base 108g 890mM Boric Acid 55g 20mM Disodium EDTA 7 44g Add deionized water to a final volume of 1000mL mix thoroughly and filter through lt 0 45mm membrane Store at room temperature and do not use if precipitate forms For 1X TBE for sequencing dilute 150mL of the 10X TBE stock and bring the volume up to 1 5L PCR Amplification 1 Record ID of samples to be typed and assign an internal ID number to each sample 2 Label all processing MicroAmp 8 Strip Reaction Tubes 0 2ml tubes with the internal ID number and place them into a MicroAmp 96 Well Tray Retainer There will be a positive and negative control tubes as well 18 COON Place the MicroAmp tubes Tray and a 1 5ml microcentrifuge tube into the Stratalinker Stratagene and UV crosslink twice at 120 joules 1200
8. at the end of each day B Reagent Preparation 3M Sodium Acetate pH 4 6 Final concentration grams 500mL 3M Sodium Acetate 204 12 grams Adjust the pH of the solution to pH4 6 then bring up the volume to 500mL and filter through a lt 0 45um membrane 21 C PCR Amplification 1 2 a Record ID of samples to be typed and assign an internal ID number to each sample there will be one reaction per sample being typed Label all processing MicroAmp 8 Strip Reaction Tubes 0 2ml tubes with the internal ID number and place them into a MicroAmp 96 Well Tray Retainer Place the MicroAmp tubes tray and 0 5ml microcentrifuge tubes to be used into the Stratalinker Stratagene and UV crosslink twice at 120 joules 1200 on LED display to sterilize the tubes prior to use to avoid contamination Calculate the number of reactions to be typed including the controls and prepare the PCR Taq Mix according to the table below Number of Volume of Volume of Reactions PCR Pre Mix AmpliTaq Gold 10 80 ul lul 20 160 ul 2 ul 50 400 ul 5 ul To each of the strip reaction tubes add 8 ul of PCR Taq Mix Add 2 ul of sterile water to the negative control tube and to the remaining reactions add 2 ul of Genomic DNA 20 ng ul to each reaction tube Place the MicroAmp Caps on the tubes and seal tightly Place the tubes in the thermal cycler Geneamp PCR System 9700 and program the following conditions into the machine and st
9. each sequencing reaction 4 Vortex the reaction tubes well Incomplete mixing will result in poor quality sequence data 5 Centrifuge at 2000 x g for 30 minutes 6 Remove the supernatant by inverting the tray onto a paper towel and centrifuging at 500 x g for 30 seconds 7 8 9 1 N Add 50 ul of 80 EtOH to each of the sequencing reactions Centrifuge at 2000 x g for 5 minutes Remove the supernatant by inverting the tray onto a paper towel and centrifuging at 500 x g for 30 seconds 0 Store the reactions in the freezer if you are not going to proceed with sequencing at this time Sequencing using the 3100 Genetic Analyzer See the previous page for instructions on preparing and loading samples on the 3100 Genetic Analyzer Analysis of data from the 3100 Genetic Analyzer See the previous page for instructions on analyzing data obtained from the 3100 Genetic Analyzer 24 Appendix E Genotyping of HLA DRB1 using the HLA DRB BigDye Terminator Sequencing Based Typing Kit Materials HLA DRB BigDye Terminator Sequencing Based Typing Kit catalog 4305213 Applied Biosystems 1 5 and 0 5 ml microfuge tubes Marsh Biomedical Products Inc Rochester NY MicroAmp 8 Strip Reaction Tubes 0 2ml catalog N801 0580 Applied Biosystems MicroAmp Caps 8 caps strip catalog N801 0535 Applied Biosystems MicroAmp 96 Well Tray Retainer Sets catalog 403081 Applied Biosystems MicroAmp Full Plate Cover catalog N801 0500 Applied Biosystems Rai
10. into double stranded DNA and will fluoresce when visualized on a UV transilluminator EtBr is a potential carcinogen and extreme caution should be taken when working with this chemical Observe all safety precautions such as wearing a lab coat fresh gloves and protective eye wear HiDi Formamide HiDi Formamide is used in small amounts within the laboratory to resuspend DNA for automated sequencing also found in Template Suppression Reagent Formamide is a teratogen which can affect development Always exhibit extreme caution while in contact with formamide and observe all safety precautions such as wearing a lab coat fresh gloves and protective eyewear Note women who are or plan to become pregnant should not work with formamide due to its adverse effects on fetal development Performance Optimized Polymer 4 and 6 POP 4 POP 6 These polymers are used within the automated sequencers and acts as a medium through which the DNA samples are transported through capillaries Both of these polymers contain high amounts of urea which is a potential mutagen and has been shown to have reproductive and tumorigenic effects Observe all safety precautions such as wearing a lab coat fresh gloves and protective eyewear Acrylamide Acrylamide is used to pour the large sequencing gel used on the Applied Biosystems 377 DNA Sequencer Acrylamide is a poison neurotoxin irritant carcinogen and possible teratogen The effects of this chemical are
11. major genetic risk The genetic complexity of the DRB region of the human major histocompatibility complex MHC has required development of molecular typing techniques with increasing levels of resolution Methods such as Sequence Specific Primer Polymerase Chain Reaction SSP PCR are not always able to discriminate among the 288 alleles recognized alleles at DRB1 To address this need a system that combines a low resolution SSP PCR followed by a high resolution allele typing using automated DNA sequencing was developed Since the low resolution SSP PCRs are based on allele group specific motifs in the first hypervariable region of exon 2 the following allele groups and genes are amplified with the eleven specific PCR mixes provided DR1 DR2 DR3 11 6 DR4 DR7 amp DR8 12 DR9 DR10 DRB3 DRB4 and DRBS The positive amplification reactions from the SSP PCR are used as sequencing templates to generate the high resolution allele typing information Although the PCR and sequencing protocols enable direct sequencing with no PCR purification steps this method is time consuming and has the possibility of sample mix ups To address this need a single tube PCR that amplifies exon 2 of all the allele groups was developed by Forensic Analytical The AlleleSEQR DRB1 PCR is a single tube reaction that amplifies exon 2 of all allele groups which makes it possible to eliminate the agarose gel step common to most other DRB assays based on a preliminary SSP PCR typ
12. of the Amelogenin and THO1 Markers 1 Ifless than 2 or more than 4 peaks appear on the electropherogram repeat the fragment analysis If the fragment analysis appears to be the same repeat the experiment from the beginning 2 Ifthe GeneScan 350 ROX Internal Lane standard does not show up on the electropherogram repeat the fragment analysis 3 If there is no low blue signal compared to the internal lane standard on the electropherogram check the concentration of the DNA again and repeat the experiment 12 Limitations of Method interfering substances and conditions This method is not labor intensive as compared to other non automated methods using manual sequencing and analysis However it requires expensive instrumentation and thus is not widely used Adequate precautions must be taken to prevent the introduction of foreign DNA into the PCR reactions The following guidelines should be followed Wear a clean laboratory coat and fresh gloves when preparing samples or reagents for PCR amplification Changing gloves often is instrumental in preventing cross contamination and should be done often Open and close all sample tubes carefully top avoid reagent or sample splashes Use positive displacement or air displacement pipettors with filter plugged tips Change tips after each use 13 Reference Ranges Normal Values Type 1 diabetes mellitus is a chronic autoimmune disease that involves a T cell mediated destruction of the pancreatic b
13. wrap and place into the microwave to melt the agarose to go into solution Once the solution is cool enough to touch around 60c pour the solution into the electrofast gel apparatus and wait for at least 30 minutes to cool Combine 7 5ul of each PCR amplification mixture with 3ul of the Orange G gel loading dye in a microtiter plate Combine 48hl of the Low DNA Mass Ladder and 12hl of the Orange G gel loading dye in a microcentrifuge tube Load 10hl of the PCR loading dye mixture on the 2 agarose gel as well as Sul of the Low DNA Mass Ladder loading dye mixture Run the gel in 1XTBE at 80 volts for 30 45 minutes Stain the gel in an Ethidium Bromide 1 XTBE solution for 5 minutes then de stain the gel in 1XTBE for 10 minutes Photograph the gel and record the results Record the samples that have a positive band on the sample worksheet provided Table 1 and attach the picture of the gel Cycle Sequencing 1 Figure out how many sequencing reactions are going to be run There will be a forward and reverse sequencing reaction for each band that was recorded from the gel for DRB1 DRB3 DRB4 and DRBS do no need to be sequenced if there are 2 positive bands for DRB1 If there is only 1 positive band for DRB1 and DRB3 is has a positive band DRB3 should be sequenced since the DRB1 1130 allele amplifies in the DRB3 tube Record ID of samples to be sequenced and assign another internal ID number to each sample For example 1 10 for the sample num
14. 20ul of HiDi Formamide in the MicroAmp 96 well reaction plate and cover the plate with a MicroAmp Full Plate Cover Heat samples in the Geneamp PCR System 9700 thermal cycler at 95 C for 3 minutes then remove and chill on ice for 2 minutes Replace the Plate Cover with the 96 well plate septa Create a new sample sheet in the ABI PRISM 3100 sequencing software and appropriately label all samples according to the method described in the ABI PRISM 3100 Genetic Analyzer s Users Manual Use the filter set that corresponds to the ET terminators for the run Place the sample tray into the 3100 Genetic Analyzer Link the sample sheet to the corresponding plate Run the 3100 Genetic Analyzer according to manufacture s instructions Analyze The sequence can also be run on the ABI 310 Genetic Analyzer or the ABI 377 DNA Sequencer Analysis of data from the 3100 Genetic Analyzer 1 2 3 Once the run is complete analyze the sequence data using the Sequence Analysis software with the DT3700POP6 ET mob file Determine the genotype from the sequence data using the MatchTools and MTNavigator Software Input all data into the database See the user s manual for the 3100 Genetic Analyzer 3100 Collection Software Sequence Analysis Software MatchTools and MTNavigator software for operation and usage of the 3100 Genetic Analyzer and the software 23 Group Specific Sequencing GSS following Sequence Based Typing of HLA DRB1 Th
15. 77 DNA sequencer Applied Biosystems Foster City CA MicroAmp 96 well reaction plate catalog N8010560 Applied Biosystems 96 well plate septa catalog 4315933 Applied Biosystems 3100 POP 6 polymer catalog 4316357 Applied Biosystems Performance Optimized Polymer 6 POP 6 Applied Biosystems Stratalinker 2400 UV Crosslinker Stratagene La Jolla CA Rainin pipettors Rainin Emeryville CA Electrofast Advanced Biotechnologies through Marsh Biomedical Products Inc Boekel Orbital Rocker Boekel Scientific Inc Feasterville PA Balance Incubator Power Pak 300 Power Supply BioRad Hercules CA Computer software for analysis with Sequencing Analysis Match Tools MTNavigator GeneScan and Genotyper Applied Biosystems Heating block IEC Multi Centrifuge with Double Deep Microplate Rotor Forma Scientific Inc Marietta OH Savant Vacuum centrifuge Forma Scientific Inc Marietta OH Vortexer Genie Diagger Licolnshire IL Alpha Imager documentation System Alpha Innotech San Leandro CA 1XTBE 10x TBE from Gibco BRL Rockville MD 10X TBE Trizma Base Boric Acid EDTA for Sequencing deionized water microwave flasks and beakers plastic wrap Orange G gel loading dye Orange G Ficoll 400 EDTA Hi Di Formamide catalog 4311320 Applied Biosystems blue dextran EDTA loading dye Applied Biosystems Ultra pure agarose Gibco BRL Rockville MD Long Ranger Singel Packs catalog 50691 FMC BioProduct
16. 8 Strip Reaction Tubes 0 2ml tubes with the internal ID number and place them into a MicroAmp 96 Well Tray Retainer There will be a positive and negative control tube as well 3 Place the MicroAmp tubes Tray and a 1 5ml microcentrifuge tube into the Stratalinker Stratagene and UV crosslink twice at 120 joules 1200 on LED display to sterilize the tubes prior to use to avoid contamination 4 Make a master mix of the following contents in a 1 5ml microcentrifuge tube All reagents are supplied in the AmpFISTR Green I PCR Amplification Kit number of samples x 10 5 ul of AmpF STR PCR reaction Mix number of samples x 0 5 ul of AmpliTaq Gold DNA Polymerase number of samples x 5 5 ul of AmpFISTR Green I Primer number of samples x 9 9 ul of deionized water Mix by vortexing 6 Dispense 24 ul of the master mix into each of the MicroAmp Reaction Tubes 16 To each of the tubes containing master mix pipet ul of Genomic DNA at a concentration of 25 ng ul For the Positive Control tube add 1 ul 25ng of Control DNA to the tube and for the Negative control tube add 1 ul of 1xTE buffer Note The final volume for the PCR is 25ul Place the MicroAmp Caps on the tubes and seal tightly Place the Tubes in the thermal cycler Geneamp PCR System 9700 and program the following conditions into the machine and start the run under the reaction volume of 25ul refer to the Geneamp PCR System 9700 Users Manual for details 1 cycle 95C 11min 27 cycles
17. Identification of Amelogenin and THO1 Markers An in house control DNA of a known genotype and an in house allelic ladder are prepared at a set concentration The in house control DNA is stored at 20C in a clean laboratory and the in house allelic ladder is stored at 4C in a dirty laboratory where amplified DNA is in use 11 Remedial Action if calibration or QC systems fail to meet acceptable criteria There are several potential possibilities in a failed test To determine the cause of failure the analyst and the supervisor must use their scientific knowledge in solving the problem All the pre PCR reagents should be kept in small aliquots and the preparatory area should be kept clean at all times Positive displacement pipettes or pipette tips that contain a fiber plug are used to decrease risk of contamination Gloves are changed frequently and analysts never work with amplified DNA before working with genomic DNA samples AlleleSEQR HLA DRB1 SBT 1 2 3 If any of the control DNA samples give an unexpected genotype repeat the experiment If a given sample fails to sequence repeat the test on that sample in the next run If again no sequence is seen re isolate the DNA from either cryopreserved cells or the immortalized cell line If a sample fails to amplify it is likely due to one of the following reasons 1 incorrect thermal cycler program 2 interruption during the PCR run 3 an error in the PCR rea
18. Persons using assistive technology may not be able to fully access information in this file For assistance e mail niddk cr imsweb com Include the Web site and filename in your message Sequence Based Typing of the HLA DRB 1 gene Table of Contents Page number Summary of Test Principle and Clinical Relevance Safety Precautions Computerization Data System Management Specimen collection Storage and Handling Procedures Procedures for Microscopic Examination Criteria for Specimen Rejection Preparation of Reagents Calibrators standards Controls and All Other Materials Equipment and Instrumentation Reagents Reagent preparation Standards Controls Equipment and materials Instrumentation 7 Calibration and Calibration verification Procedures 8 Procedure Operating Instructions Calculations Interpretation of Results a Procedure b Calculation c Interpretation of Results 9 Reportable Range of Results 10 Quality Control QC Procedures a Quality Control Principles b Preparation of Quality Control Materials 11 Remedial Action if Calibration or QC Systems fail to meet acceptable criteria 12 Limitation of Method Interfering Substance and Conditions 13 Reference Ranges normal values 14 Critical Call Results 15 Specimen Storage and Handling During Testing 16 Alternate Methods for Performing Test or Storing Specimens if Test System Fails 17 Test Result Reporting System Protocol for Reporting Critical Calls if applicable
19. Remove the BLACK clip and mix the contents of the compartments by hand thoroughly but gently for 1 minute Place the pack on an orbital shaker for 5 minutes at medium speed Mix by hand thoroughly but gently for 1 minute Place the pack on an orbital shaker for 5 minutes at medium speed NOTE Do not over mix This may interfere with gel polymerization ii Gel Casting NOTE The following steps must be completed without delay 1 2x 3 Remove only the RED clip and mix the contents of the compartment well by hand for 1 minute Remove the WHITE clip to expose the filter to gel solution Hold the pack so the contents drain into the filter end Fold the pack in half at the indicated line 28 7 Hold the pack with the cut mark at the top and cut the corner within the space marked CUT To avoid introducing bubbles cut a large enough hole in the pouch to allow steady flow of the solution through the filter into a beaker Avoid introducing air into solution after mixing Cast gel and insert comb according to your standard procedure Once the gel is polymerized 30 minutes place paper towels soaked in electrophoresis buffer over the ends of the plates and then cover with plastic wrap This will prevent moisture loss as the polymerization process continues Allow 2 hours for complete gel polymerization B Preparing for Electrophoresis I 2 xao 10 Ice the samples immediately for 2 minutes and keep on ice until ready to use
20. Tissue Antigens 1992 40 229 43 Marsh S G amp Bodmer J G HLA class II nucleotide sequences 1992 Hum Immunol 1992 35 1 17 Marsh S G amp Bodmer J G HLA class II nucleotide sequences 1992 Eur J Immunogenet 1993 20 47 79 Marsh S G amp Bodmer J G HLA Class II nucleotide sequences 1992 Immunobiology 1993 187 102 65 Marsh S G amp Bodmer J G HLA class II nucleotide sequences 1992 Immunogenetics 1993 37 79 94 Marsh S G amp Bodmer J G HLA class II region nucleotide sequences 1994 published erratum appears in Eur J Immunogenet 1995 Apr 22 2 225 8 Eur J Immunogenet 1994 21 519 51 Marsh S G amp Bodmer J G HLA class II region nucleotide sequences 1995 Tissue Antigens 1995 46 258 80 Marsh S G amp Bodmer J G HLA class II region nucleotide sequences Eur J Immunogenet 1995 22 225 526a 527b Pugliese A et al HLA DQB1 0602 is associated with dominant protection from diabetes even among islet cell antibody positive first degree relatives of patients with IDDM Diabetes 1995 44 608 13 Caillat Zucman S et al Age dependent HLA genetic heterogeneity of type 1 insulin dependent diabetes mellitus Journal of Clinical Investigation 1992 90 2242 50 Cucca F et al The distribution of DR4 haplotypes in Sardinia suggests a primary association of type I diabetes with DRB1 and DQB1 loci Human Immunology 1995 43 301 8 Erlich H A et al HLA class II alleles and suscepti
21. alitative and interpretations are based on the software programs MatchTools and MTNavigator which work together to assign alleles and to allow manual review or editing of the sequencing data Genotypes are entered into the database according to standard HLA nomenclature SSP PCR and Sequencing The positive amplification reactions from the SSP PCR are used as sequencing templates to generate the high resolution allele typing information The PCR and sequencing protocols enable direct sequencing with no purification steps The design of the amplification primers allows sequencing of both strands from 6 a single amplification fragment The BigDye terminator cycle sequencing chemistry has been optimized for ease of use and high throughput The results obtained are qualitative and interpretations are based on the software programs MatchTools and MTNavigator which work together to assign alleles and to allow manual review or editing of the sequencing data Genotypes are entered into the database according to standard HLA nomenclature Human Identification The AmpF STR Green I PCR Amplification Kit amplifies the THO1 TPOX CSF1PO short tandem repeat loci In addition primers included in the AmpF STR Green I Primer set amplify the Amelogenin locus which can be used for gender determination The amplified product is run on an ABI PRISM instrument and the collected multicolor fluorescent data is analyzed using GeneScan Analysis Software The Genotype
22. and place a septum on the tube Create a new sample sheet in the ABI PRISM 310 sequencing software and appropriately label all samples according to the method described in the ABI PRISM 310 Genetic Analyzer s Users Manual Import the sample sheet into the injection list and make appropriate adjustments Place the tubes septum into the 310 loading tray Run the 310 Genetic Analyzer using the POP 6 Rapid E 1ml module Analyze Genotype Determination For the 377 DNA Sequencer l 2 3 4 Once the run is completed track the lanes on the gel using the 377 Collection Software Once the tracking is complete analyze the raw sequencing data using the Sequencing Analysis Software Once the raw data is extracted determine the genotype from the sequence data using the MatchTools and MT Navigator Software Input all data into the database See the user s manual for the 377 DNA Sequencer 377 Collection Software Sequence Analysis Software MatchTools and MTNavigator software for operation and usage of the 377 DNA Sequencer and the software For the 310 and 3100 Genetic Analyzer 1 Once the run is complete analyze the sequence data using the Sequence Analysis software with the dye primer set 310 HLA DRB DBT and 350 basepair caller for the 310 Genetic Analyzer and DT3700POP6 ET mob file for the 3100 Genetic Analyzer Determine the genotype from the sequence data using the MatchTools and MTNavigator Software Inpu
23. anes are loaded Cancel the PRE RUN and change the module to the 377 HLA DRB DBT module and start the run The run will take 4 hours Sequencing using the 3100 Genetic Analyzer Preparing and Loading Samples on the 3100 Genetic Analyzer 1 FY 0 Oy Mi Resuspend the dried down sample in 20ul of HiDi Formamide in the MicroAmp 96 well reaction plate and cover the plate with a MicroAmp Heat samples in the Geneamp PCR System 9700 thermal cycler at 95 C for 2 minutes then remove and chill on ice for 2 minutes Replace the Plate Cover with a 96 well plate septae Create a new sample sheet in the ABI PRISM 3100 sequencing software and appropriately label all samples according to the method described in the ABI PRISM 3100 Genetic Analyzer s Users Manual Place the sample tray into the 3100 Genetic Analyzer Link the sample sheet to the corresponding plate Run the 3100 Genetic Analyzer according to manufacture s instructions Analyze 29 Sequencing using the 310 Genetic Analyzer Preparing and loading samples on the 310 Genetic Analyzer Den elo Resuspend the dried down sample in 25 ul of TSR Template Suppression Reagent Vortex and spin the sample plate in a micro centrifuge Heat samples at 95 C for 2 minutes Chill on ice for 2 minutes Vortex and spin the samples again in a micro centrifuge and place back on ice Transfer the sample resuspended in TSR to an appropriately labeled 0 Sml Genetic Analyzer tube
24. anin pipette tips with filters Rainin Instrument Co Emeryville CA Sterile individually wrapped transfer pipettes Racks for centrifuge tubes and blood tubes bleach after each use Equipment PipetAid Drummond Daigger Lincolnshire Qiagen Sigma centrifuge Sigma Co St Louis Dispensett III volume dispenser for reagents Daigger Lincolnshire IL Boekel Orbital Rocker Boekel Scientific Inc 13 Labeling Label all reagents and aliquots of reagents with the reagent name concentration date prepared and appropriate expiration date Labels are created using a computer label making system Label View Pro and an Eltron printer Preparation of reagents NOTE prepare all reagents and aliquots in clean lab and record the date reagents were opened Purification Protocol Record the ID of samples to be extracted and assign a temporary ID number to each for example 1 10 Label all processing tubes and columns with the temporary ID number NOTE use universal precautions when working with blood and perform all steps in a biological safety cabinet to avoid contamination or exposure to biological agents within the blood NOTE for appropriate amounts of reagents see table after section E A Cell Lysis Add appropriate cell volume to a 50 ml Falcon tube Spin in a centrifuge at 2 000 x g for 5 minutes Remove the supernatant leaving behind the white pellet and a small volume of liquid Vortex each tube to resuspend cells
25. art the run refer to the Geneamp PCR System 9700 Users Manual for details l cycle 95C for 10 min 36 cycles 96C for 20 sec 60C for 30 sec 72C for 3 min Hold at 4C after amplification store PCR products at 2 6C until needed D Purifying the PCR Amplicons Exo Sap 1 2 3 E Cycl 1 2 3 Prepare a fresh 1 1 mixture of Exonuclease I Exo and Shrimp Alkaline Phosphatase Sap You will need 0 5ul of each enzyme per reaction Exo and Sap are provided in the AlleleSEQR HLA DRB1 SBT kit Add 1 ul of the Exo Sap mixture to each of the reaction tubes Cover the tubes with strip caps and place them in the thermal cycler Geneamp PCR system 9700 and program the following conditions into the machine and start the run 37C for 15 min 80C for 15min Hold at 4C until ready to use e Sequencing Dilute each PCR amplicon by adding 2 volumes of sterile water to 1 volume PCR product in a separate tube Label the MicroAmp 96 well reaction plate with internal ID numbers There will be a Forward F Reverse R and Codon 86 reaction tube per PCR amplicon To the F tube for each sample add 8ul of the Forward sequencing mix To the R tube for each sample add 8ul of the Reverse sequencing mix To the Codon 86 tube for each sample add 8 ul of the Codon 86 sequencing mix All mixes are supplied in the AlleleSEQR HLA DRB1 SBT kit To each of the forward reverse and codon 86 tubes per sample add 2ul of the appropriate diluted Exo Sap t
26. ber and F or R for forward and reverse reactions so there will be tubes labeled 1F IR 2F 2R etc Label all MicroAmp 8 Strip Reaction Tubes with the internal ID number and place them into a MicroAmp 96 Well Tray Retainer In the F tubes add 8ul of the forward ready reaction mix and to the R tubes add 8ul of the reverse ready reaction mix both mixes are supplied in the HLA DRB BigDye Terminator Sequencing Based Typing kit In a separate 0 5ml microcentrifuge tube dilute the PCR product 1 3 in DNA Diluent Buffer supplied in the kit for example 2ul of the PCR product in 6ul of the diluent buffer mix well To each of the forward and reverse tubes per sample add 2ul of the diluted PCR product and mix well 2T Seal the tubes with the MicroAmp Strip caps tightly Set up a control reaction for sequencing of pGEM DNA all components are supplied in the Dye Terminator Cycle Sequencing Ready Reaction Kit Combine pGEM control reaction as the following lul of pGEM 10 30ng ul 4ul of M13 primer 3 2pmol ul 8hl of terminator ready mix 7ul of water Place the tubes tray in the thermal cycler Geneamp PCR system 9700 and run under the following conditions for the reaction volume of 10ul refer to the Geneamp PCR system 9700 Users Manual for details l cycle 96C for 10 sec 20 cycles 96C for 10 sec 50C for 10 sec 60C for 2 min hold at 4C until ready to proceed with the cleanup of the sequencing reactions F Clean up of Cycle Sequencing Reacti
27. bes 0 2ml catalog N801 0580 Applied Biosystems MicroAmp Caps 8 caps strip catalog N801 0535 Applied Biosystems MicroAMp 96 Well Tray Retainer catalog 403081 Applied Biosystems 0 5ml Genetic Analyzer sample tubes and septum catalog 401957 and 401956 Applied Biosystems Rainin pipet tips Rainin Emeryville CA 1 5ml microfuge tubes Marsh Biomedical Products Rochester NY 1xTE 10mM Tris HCl 0 1mM EDTA pH 8 0 Hi Di formamide catalolg 4311320 Applied Biosystems GeneScan 350 ROX Internal Lane Size Standard catalog 401735 Applied Biosystems Foster City CA 10x Genetic Analyzer Buffer with EDTA catalog 402824 Applied Biosystems Performance Optimized Polymer 4 POP 4 Applied Biosystems Equipment Geneamp PCR System 9700 Applied Biosystems Foster City CA ABI PRISM 310 DNA sequencer Applied Biosystems Rainin pipettors Rainin Emeryville CA Stratalinker 2400 UV Crosslinker Stratagene La Jolla CA Vortex Genie Diagger Lincolnshire IL Heating block Computer and software for analysis with GeneScan and Genotyper Software Applied Biosystems Labeling Label all reagents and aliquots of reagents with the reagent name concentration date prepared and appropriate expiration date Labels are created using computer label making system Label View Pro and Eltron printer PCR Amplification 1 Record ID of samples to be typed and assign an internal ID number to each sample Label all processing MicroAmp
28. bility and resistance to insulin dependent diabetes mellitus in Mexican American families Nature Genetics 1993 3 358 64 Marsh S HLA Informatics Group Anthony Nolan Bone Marrow Trust http www anthonynolan com HIG index html 2000 Marsh S G E Parham P amp Barber L D The HLA Facts Book San Diego Academic Press 2000 11 Appendix A Puregene Method for DNA Isolation from Whole Blood for PCR Using the Puregene Genomic DNA Isolation Kit Materials Puregene DNA Extraction Kit catalog D 50K Gentra Systems Minneapolis MN 70 ethanol 100 isopropanol glycogen Gentra Systems 50 ml Falcon centrifuge tubes Rainin pipet tips with filters Rainin Instrument Co Emeryville CA Sterile individually wrapped transfer pipets Racks for 50ml centrifuge tubes bleach after each use Equipment PipetAid Drummond Daigger Lincolnshire IL Qiagen Sigma centrifuge Qiagen Inc Chatsworth CA Dispensett III volume dispenser for reagents Daigger Lincolnshire IL Incubator Boekel Orbital Rocker Boekel Scientific Inc Feasterville PA Labeling Label all reagents and aliquots of reagents with the reagent name concentration date prepared and appropriate expiration date Labels are created using computer label making system Label View Pro and Eltron printer Preparation of reagents NOTE prepare all reagents and aliquots in clean lab also be sure to record date reagents opened Purification Protocol Rec
29. ble glass plates and spacers in the cassette following the method described in the ABI PRISM 377 DNA Sequencer Users Manual Have the Long Ranger Singel pack at room temperature Remove the BLACK clip and mix the contents of the compartments by hand thoroughly but gently for 1 minute Place the pack on an orbital shaker for 5 minutes at medium speed Mix by hand thoroughly but gently for 1 minute Place the pack on an orbital shaker for 5 minutes at medium speed NOTE Do not over mix This may interfere with gel polymerization ii Gel Casting NOTE The following steps must be completed without delay ea ee Remove only the RED clip and mix the contents of the compartment well by hand for 1 minute Remove the WHITE clip to expose the filter to gel solution Hold the pack so the contents drain into the filter end Fold the pack in half at the indicated line Hold the pack with the cut mark at the top and cut the corner within the space marked CUT To avoid introducing bubbles cut a large enough hole in the pouch to allow steady flow of the solution through the filter into a beaker Avoid introducing air into solution after mixing Cast gel and insert comb according to your standard procedure Once the gel is polymerized 30 minutes place paper towels soaked in electrophoresis buffer over the ends of the plates and then cover with plastic wrap This will prevent moisture loss as the polymerization process continues Allow 2 hours for c
30. ction mixture i e failure to add key component to tubes HLA DRB SSP PCR Sequencing 1 If more than 2 bands in the SSP PCR reactions for DRB1 turns out to be positive the results of all reactions are disregarded due to possible contamination Carefully clean the PCR preparatory space and repeat the experiment 2 Ifany of the control DNA samples give an unexpected genotype repeat the experiment 3 Ifa given sample fails to amplify repeat the test on that sample in the next run If again no amplification is seen recheck reread the DNA concentration and repeat the test If the sample still fails re isolate the DNA from the immortalized cell line 4 Ifall samples including the ALL control tube fails to amplify it is likely due to one of the following reasons 1 incorrect thermal cycler program 2 interruption during the PCR run 3 an error in the PCR reaction mixture i e failure to add key component to tubes Human Identification 1 Ifless than 4 or more than 8 peaks appear on the electropherogram repeat the fragment analysis If the fragment analysis appears to be the same repeat the experiment from the beginning 2 Ifthe GeneScan 350 ROX Internal Lane standard does not show up on the electropherogram repeat the fragment analysis 3 If there is no low green signal compared to the internal lane standard on the electropherogram check the concentration of the DNA again and repeat the experiment Identification
31. ctrofast Advanced Biotechnologies through Marsh Biomedical Products Inc Balance Power Pak 300 Power Supply BioRad Hercules CA Computer software for analysis with Sequencing Analysis MatchTools and MTNavigator Applied Biosystems Heating block IEC Multi Centrifuge with Double Deep Microplate Rotor Forma Scientific Inc Marietta OH Savant Vacuum centrifuge Forma Scientific Inc Marietta OH Vortexer Genie Diagger Licolnshire IL Alpha Imager documentation System Alpha Innotech San Leandro CA 25 Labeling Label all reagents and aliquots of reagents with the reagent name concentration date prepared and appropriate expiration date Labels are created using computer label making system Label View Pro and Eltron printer Procedures A General PCR practices 1 Wear a new disposable laboratory coat and new gloves when preparing samples or reagents for PCR amplification 2 Change gloves frequently 3 Maintain separate areas and dedicated equipment and supplies for sample preparation PCR setup and amplification analysis 4 Open and close all sample tubes carefully to avoid reagent or sample splashes 5 Use air displacement pipettors with filter plugged tips Change tips after each use 6 Clean the general area using 10 bleach solution and rinse with deionized water Cover lab benches with clean sheet of disposable absorbent pad and remove at the end of each day B Reagent Preparation 10X TBE for sequencing O
32. cumulative so always use it with the upmost caution Observe all safety precautions such as wearing a lab coat fresh gloves and protective eyewear Computerization Data System Management Integrity of specimen data generated by this method is maintained by proofreading all transcribed data by the analyst All data is copied to a CD R for transfer to a Microsoft Access database created to store all raw data generated in the GoKinD study Only authorized personnel from the Molecular Biology Branch as determined by the supervisor have access to this database Analyzed genotype results are recorded by the analyst in a Microsoft Access database located on CDC s LAN and only authorized personnel from the Molecular Biology Branch as determined by the supervisor have access to the data 4 Specimen Collection Storage and Handling Procedures Criteria for Specimen Rejection a Specimen collection Whole blood obtained with EDTA as an anticoagulant may be used All 10 mls of the venous blood collected will be processed for DNA Specimen storage Blood samples which have been processed by the Puregene method through the cell lysis step see appendix A can be stored at room temperature for up to 18 months Extracted DNA can be stored at 20C indefinitely until assayed Freeze Thaw effect Repeated freeze thaws may cause slight fragmentation of DNA However the size DNA targeted for amplification is very small lt 400bp and there is no
33. documented deleterious effect of freeze thaw on this test Procedure For Microscopic Examination Criteria for Rejection of Inadequately prepared slides Not applicable for this procedure 6 Preparation of Reagents Calibrators standards Controls and All Other Materials a Reagents The Puregene DNA Isolation Kit Gentra systems contains Red Blood Cell Lysis Solution RBC Lysis Solution Cell Lysis Solution RNase solution Protein Precipitation Solution and DNA Hydration Solution All reagents except for the RNase solution are stable at room temperature until the manufacture s specified expiration date The RNase solution is stable at 4C until the manufacture s specified expiration date The AlleleSEQR HLA DRB1 SBT Kit is stored at 20C until the manufacture s specified expiration date Check the expiration date before each use and discard the kit after the expiration date The HLA DRB kit is stored at 4C until the manufacture s specified expiration date Check the expiration date before each use and discard the kit after the expiration date The HotStarTaq Master Mix is stored at 20C until the manufature s specified expiration date Check the expiration date before each use and discard the kit after the expiration date The Dye Terminator Cycle Sequencing Ready Reaction Kit which contains the reagents for the control reaction for cycle sequencing and sequencing may be stored at 20C until the manufacture s specified e
34. e Group Specific Sequencing protocol is used to clarify a subset of genotypic ambiguities that remain following analysis of the Allele SEQR HLA DRB1 Sequence Based Typing kit Note In the Group Specific Sequencing Protocol the GSS Gr3 group will sequence most of the 03 11 13 and 14 alleles and the GSS Gr4 group will sequence most of the 04 alleles If there is a combination of 2 alleles in the same subgroup this protocol will not clarify either of those ambiguities Cycle Sequencing 1 Dilute the PCR amplicon to be sequenced by adding 2 volumes of sterile water to 1 volume PCR product in a separate tube 2 Label the MicroAmp 96 well reaction plate with internal ID numbers Add 8ul of the appropriate GSS mix to the wells 3 Add 2 ul of the appropriate diluted Exo Sap treated PCR product and mix well 4 Seal the tubes with the MicroAmp Strip caps tightly Place the tubes tray in the thermal cycler GeneAmp PCR system 9700 and run under the following conditions refer to the GeneAmp PCR system 9700 Users Manual for details 25 cycles 96C for 20 sec 60C for 2 min hold at 4C until ready to proceed Clean up of Cycle Sequencing Reaction 1 Add lul of NaOAc EDTA buffer included in the AlleleSEQR HLA DRB SBT kit to each sequencing reaction Prepare a mixture of Et OH NaOAc by adding 20 ul of 3M NaOAc pH4 6 per mL of absolute ethanol 1 mL of this mixture is sufficient for 40 reactions 3 Add 25 ul of EtOH NaOAc prepared in step 2 to
35. e tubes for 3 minutes in an ice water bath Place the tubes in the sampler tray of the 310 Genetic Analyzer and start the GeneScan run 0 The GeneScan data is analyzed by the Genotyper Software and can be incorporated directly into a database 17 Appendix C Identification of the Amelogenin sex and TH01 Markers This method will be used as Quality Control for samples other than Trio samples Materials HotStarTaq Master Mix Kit catalog 203443 Qiagen Valencia CA MicroAmp 8 Strip Reaction Tubes 0 2ml catalog N801 0580 Applied Biosystems MicroAmp Caps 8 caps strip catalog N801 0535 Applied Biosystems MicroAMp 96 Well Tray Retainer catalog 403081 Applied Biosystems Rainin pipet tips Rainin Emeryville CA 1 5ml microfuge tubes Marsh Biomedical Products Rochester NY 10X TBE Trizma Base Boric Acid EDTA for Sequencing GeneScan 350 ROX Internal Lane Size Standard catalog 401735 Applied Biosystems Hi Di Formamide catalog 4311320 Applied Biosystems blue dextran EDTA loading dye Appled Biosystems Long Ranger Singel Packs catalog 50691 FMC BioProducts Rockland ME beakers deionized water The following oligonucleotides Obtained from the CDC Biotechnology Core Facility FAM AmeloF primer 5 FAM CCCTGGGCTCTGTAAAGAATAGTG 3 AmeloR primer 5 ATCAGAGCTTAAACTGGGAAGCTG 3 THOIF primer 5 ATTCAAAGGGTATCTGGGCTCTGG 3 FAM THOI1R primer 5 FAM GTGGGCTGAAAAGCTCCCGATTAT 3 Equipment Geneamp PCR System 9700
36. econds 4 Centrifuge at 2 000 x g for 11 minutes The precipitated proteins should form a tight dark brown pellet If the protein pellet is not tight repeat step 3 followed by incubating on ice for 5 minutes and then repeat step D DNA Precipitation 1 Pour the supernatant containing the DNA leaving the protein pellet behind into a clean 50mL tube containing 10mL 100 isopropanol Add 16 7 ul glycogen solution per 10mL isopropanol to increase DNA yield Mix the sample by inverting gently 50 times until the white threads of DNA form a visible clump Centrifuge at 2 000 x g for 4 minutes Pour off supernatant and drain tube on a clean absorbent paper Add 10ml 70 ethanol and invert tube several times to wash the DNA pellet Centrifuge at 2 000 x g for 2 min Carefully pour off ethanol Allow to air dry 10 15 minutes co ww E DNA Hydration 1 Add lmL DNA Hydration Solution 2 Rehydrate DNA by incubating at 65 C for 1 hour and place on Boekle orbital rocker at room temperatutre for seven days Tap tube periodically to aid in dispersing DNA 3 For storage sample may be centrifuged briefly and then transferred to a 1 5ml tube Store at 4 C or at 20 C for long term storage of DNA Puregene Method for DNA Isolation from Cell Culture for PCR Using the Puregene Genomic DNA Isolation Kit Materials Puregene DNA Extraction Kit catalog D 50K Gentra Systems Minneapolis 70 ethanol 100 isopropanol 50 ml Falcon centrifuge tubes R
37. eta cells the body s sole source for insulin 1 Type 1 diabetes has been shown to involve a genetic component and an environmental component 4 The genes that are known to play a role in the genetic susceptibility include those in the Human Leukocyte Antigen HLA complex on chromosome 6p21 and the insulin gene on chromosome 11p15 5 The role of the HLA region in type 1 diabetes was discovered in the 1970s by both association studies and affect sib pair studies 6 8 The DR3 and DR4 haplotypes which consist of specific combinations of the class II genes DQAI DQBI1 and DRBI have been implicated in disease susceptibility and the DR2 haplotype has been 9 associated with disease protection as determined by serotyping 9 12 These class II HLA genes are highly polymorphic and molecular genetic analysis has identified certain alleles with protection or susceptibility to type 1 diabetes 12 26 The assay described below involves genotyping the HLA DRBI gene Various genotypes of the DRB1 gene are present within the population There are 304 known alleles for the DRB1 gene as of January 2001 30 The frequencies for a number of these 304 alleles within various populations can be found in the HLA Facts Book 31 14 Critical Call Results Panic Values Not applicable in this particular assay 15 Specimen storage and Handling during testing The blood specimens will arrive at the laboratory partially processed in 50ml Falcon tube
38. ication reactions Methods instructions that specify how the instrument should heat or cool samples in a PCR thermal profile are programmed and stored in the instrument software The Geneamp PCR System 9700 combines integrated instrument design and thin walled 0 2ml MicroAmp Reaction Tubes to offer greater speed oil free operation lower reaction volumes and unsurpassed cycle time reproducibility 7 Calibration and Calibration Verification Procedures The ABI PRISM 377 DNA Sequencer ABI PRISM 310 Genetic Analyzer and ABI PRISM 3100 Genetic Analyzer are calibrated by the manufacturer and annual preventative maintenance is performed by the manufacturer s authorized service representative The genotyping assays are qualitative tests There are a number of possible genotypes in the test population If the in house sequence does not give the correct genotype the test is repeated 8 Procedure Operating Instructions Calculations Interpretation of Results a Procedure see Appendix A B C and D for DNA extraction Human Identification AlleleSEQR HLA DRB SBT and SSP PCR and Sequencing b Calculations Not Applicable c Interpretation of results AlleleSEQR HLA DRB1 SBT The AlleleSEQR DRB1 PCR is a single tube reaction that amplifies exon 2 of all allele groups except DRB1 0814 This design makes it possible to eliminate the agarose gel step common to most other DRB assays based on a preliminary SSP PCR typing The results obtained are qu
39. ing This design greatly enhances throughput and efficiency as well as eliminating the possibility of sample mix ups Three custom sequencing mixes Forward Reverse and a primer specific for the GTG motif of Codon 86 are provided The Codon 86 sequencing data minimizes the number of ambiguities that are encountered in DRB typing The AllelSEQR DRB1 assay will be used as the primary assay for DRB1 genotyping however the Applied Biosystems assay will be used in cases where it can resolve ambiguities The final step in the analysis procedure is to perform the allele assignment using MatchTools Software and MTNavigator Software These programs work together to assign alleles and to allow manual review or editing of the sequence data 2 Safety Precautions Standard safety precautions should be observed including wearing safety glasses a lab coat and gloves during the preparation of blood specimens Follow Universal Precautions when handling all blood and blood products Vaccination for hepatitis B is strongly encouraged Laboratory items exposed to blood or blood products should be disposed of or decontaminated in compliance with guidelines from the Office of Health and Safety CDC Any mutagen or toxigenic organic solution used in this genotyping process is listed below 2 3 Ethidium Bromide EtBr Ethidium Bromide is used to visualize double stranded DNA that has been separated by size on an agarose acrylamide gel matrix The EtBr intercolates
40. itus Lancet 1974 2 1153 Nerup J et al HL A antigens and diabetes mellitus Lancet 1974 2 864 866 Tiwari J L amp Terasaki P I HLA and disease New York Springer 1985 Thomson G HLA disease associations models for insulin dependent diabetes mellitus and the study of complex human genetic disorders Review 83 refs Annual Review of Genetics 1988 22 31 50 Svejgaard A Platz P amp Ryder L P Insulin dependent diabetes mellitus in Histocompatiblity testing 1980 ed Terasaki P 638 656 University of California Press Los Angeles and Berkeley 1980 Noble J A et al The role of HLA class II genes in insulin dependent diabetes mellitus molecular analysis of 180 Caucasian multiplex families Am J Hum Genet 1996 59 1134 48 Marsh S G amp Bodmer J G HLA class II nucleotide sequences 1991 Eur J Immunogenet 1991 18 291 310 Marsh S G amp Bodmer J G HLA class II nucleotide sequences 1991 published erratum appears in Immunobiology 1993 Jan 187 1 2 102 3 Immunobiology 1991 182 369 403 Marsh S G amp Bodmer J G HLA class II nucleotide sequences 1991 Tissue Antigens 1991 37 181 9 Marsh S G amp Bodmer J G HLA class II nucleotide sequences 1991 published erratum appears in Immunogenetics 1993 37 2 79 94 Immunogenetics 1991 33 321 34 Marsh S G amp Bodmer J G HLA class II nucleotide sequences 1992 published erratum appears in Tissue Antigens 1992 Nov 40 5 229
41. mpliTaq Gold DNA polymerase 5U l to the 40ul genomic DNA template 10ng pl and mix well by vortexing 6 To each of the strip reaction tubes labeled 1 12 add 10hl of the allele group specific PCR mix supplied in the HLA DRB BigDye Terminator Sequencing Based Typing Kit For example 26 ee Tube number PCR mix Tube number PCR mix Tube number PCR mix 1 DRBIGI 5 DRB1G7 9 DRB3 2 DRB1G2 6 DRB1G8 12 10 DRB4 3 DRB1G3 11 6 7 DRB1G9 11 DRB5 4 DRB1G4 8 DRB1G10 12 All To each of the 12 tubes with the allele specific PCR mix add 2 Shl of the genomic DNA template AmpliTaq Gold DNA Polymerase mixture and mix up and down with a pipettor For example add 2 Shl of mixture A to each of the 12 tubes 1 12 to create A1 A12 Place the MicroAmp Caps on the tubes and seal tightly Place the tubes in the thermal cycler Geneamp PCR System 9700 and program the following conditions into the machine and start the run under the reaction volume of 12 1 refer to the Geneamp PCR System 9700 Users Manual for details l cycle 95C for 10 min 36 cycles 96C for 20 sec 65C for 30 sec 72C for 30 sec l cycle 99C for 10 min Hold at 4C after amplification store PCR products at 2 6C until needed D Gel Electrophoresis E 1 Prepare a 2 agarose gel containing 1X TBE buffer Measure 1 6 grams of ultra pure grade agarose and place it in a 250ml flask with 80mls of 1xTBE buffer Cover the flask with plastic
42. nin pipett tips Rainin Emeryville CA Dye Ex 96 kit Qiagen Inc Chatsworth CA Microtiter plate MicroAmp 96 well reaction plate catalog N8010560 Applied Biosystems 96 well plate septa catalog 4315933 Applied Biosystems 1XTBE 10x TBE from Gibco BRL Rockville MD 10X TBE Trizma Base Boric Acid EDTA for Sequencing deionized water Orange G gel loading dye Orange G Ficoll 400 EDTA Hi Di Formamide catalog 4311320 Applied Biosystems blue dextran EDTA loading dye Appled Biosystems Dye Terminator Cycle Sequencing Ready Reaction Kit Applied Biosystems Ultra pure agarose Gibco BRL Rockville MD Long Ranger Singel Packs catalog 50691 FMC BioProducts Rockland ME Ethidium Bromide Ameresco Solon OH Low DNA Mass Ladder cat 10068 013 Gibco BRL Rockville MD 10x Genetic Analyzer Buffer with EDTA catalog 402824 Applied Biosystems 3100 POP 6 polymer catalog 4316357 AppliedBiosystems Performance Optimized Polymer 6 POP 6 Applied Biosystems flasks beakers microwave plastic wrap Equipment Finnpette Biocontrol Pipettor with Multi channel module Lab Systems through Marsh Biomedical Products Inc Geneamp PCR System 9700 Applied Biosystems ABI PRISM 377 DNA sequencer Applied Biosystems ABI PRISM 3100 Genetic Analyzer Applied Biosystems ABI PRISM 310 Genetic Analyzer Applied Biosystems Stratalinker 2400 UV Crosslinker Stratagene La Jolla CA Rainin pipettors Rainin Emeryville CA Ele
43. ns It is recommended that records be maintained for 2 years including related QC data and that duplicate records should be kept in electronic or hard copy format Only numerical identifiers patient participant ID will be available 10 References 1 2 3 oon So 12 13 Marsh S G amp Bodmer J G HLA class II nucleotide sequences 1991 Hum Immunol 1991 31 207 27 15 16 17 18 25 26 2 28 29 30 31 Eisenbarth G S Type I diabetes mellitus A chronic autoimmune disease Review 81 refs New England Journal of Medicine 1986 314 1360 8 LaPorte R amp Cruickshanks K Incidence and risk factors for insulin dependent diabetes in Diabetes in America eds MI H amp RF H NIH publication no 85 1468 National Diabetes Data Group 1985 Juvenile Diabetes Foundation International General Diabetes Facts www jdf org publications diabetesfacts html 1999 Todd J A From genome to aetiology in a multifactorial disease type 1 diabetes Bioessays 1998 21 164 74 She J X amp Marron M P Genetic susceptibility factors in type 1 diabetes linkage disequilibrium and functional analyses Curr Opin Immunol 1998 10 682 9 Singal D P amp Blajchman M A Histocompatibility HL A antigens lymphocytotoxic antibodies and tissue antibodies in patients with diabetes mellitus Diabetes 1973 22 429 432 Cudworth A G amp Woodrow J C Letter HL A antigens and diabetes mell
44. of 70 ethanol and invert the tubes several times to wash the pellet Centrifuge at 2 000 x g for 12 minutes Carefully pour off the ethanol Allow to air dry for 10 15 minutes en A 14 E DNA Hydration 1 Add appropriate volume of DNA Hydration Solution 2 Rehydrate DNA by incubating at 65 C for 1 hour and place on Boekel orbital rocker for 7 days at room temperature 3 For storage samples may be centrifuged briefly and then transferred to an appropriate tube Store the DNA samples at 4 C or at 20 C for long term storage Number 100 0 5 1 0 3 5 30 50 60 90 100 Cells 10 000 Million Million Million Million Million Cell Lysis 0 06 0 15 0 6 6 0 10 15 ml Rnase A 0 50 0 75 3 0 30 50 70 ul Protein 0 02 0 033 0 20 2 0 3 3 5 0 Precipitation ml 100 0 06 0 15 0 6 6 0 10 15 Isopropanol ml 70 0 06 0 15 0 6 6 0 10 15 Ethanol ml DNA 10 10 60 500 750 1000 Hydration ul 15 Appendix B Human Identification with the Short Tandem Repeat Loci using the AmpF STR Green I PCR Amplification Kit This method will be used for Quality Control for Trio samples Materials AmpFISTR Green I PCR Amplification Kit catalog 402902 Applied Biosystems Foster City CA AmpF STR Green I PCR Amplification Kit User s Manual catalog 402944 Applied Biosystems Performance Optimized Polymer 4 POP 4 catalog 402838 Applied Biosystems MicroAmp 8 Strip Reaction Tu
45. omplete gel polymerization 19 B Preparing for Electrophoresis 1 2 3 Remove the comb wash the plates and load the comb as described in the ABI PRISM 377 DNA Sequencer Users Manual Prepare a sufficient quantity of electrophoresis buffer to fill both anodal and cathodal chambers by diluting 10X TBE stock for sequencing with deionizd water to 1X Mount the gel cassette onto the sequencing apparatus and prepare the gel for the sequence run according to the 377 DNA Sequencers Users Manuals instructions Open a new GeneScan sample sheet in the 377 96 Data Collection Software and input sample names to be run on the gel Save the sample sheet and open a new GeneScan sample run in the 377 96 Data Collection Software and open the new sample sheet that was just created in the previous step To assure plates and gel are clean perform a plate check using the Plate Check module Pre warm the acrylamide gel by running the GS PR 36A 2400 module Prepare the samples for the GeneScan run by combining 1 5 ul of PCR product and 1 0 ul of GeneScan Rox 350 with 5 ul of a 5 1 ratio of Hi Di formamide and blue dextran EDTA loading dye for example Sul of the Hi Di formamide combined with lul of the blue dextran EDTA loading dye Vortex the samples and centrifuge briefly Denature the samples by heating the samples at 95 5C for 2 minutes Ice the samples immediately for 2 minutes and keep on ice until ready to use Stop the PRE RUN when
46. on 1 2 3 8 9 Add 10ul of water to each of the cycle sequencing reaction tubes This is to bring the sample volume up so that it is easer to work with for the clean up procedure Take the DyeEx 96 plate out of the bag and remove the tape sheets from the top and bottom of the DyeEx 96 plate When handling the DyeEx 96 plate ensure that it remains horizontal Place the DyeEx 96 plate on the top of the collection plate provided in the kit and centrifuge for 3 minutes at 1000 x g Discard the flow through Carefully place the DyeEx 96 plate on an appropriate elution plate MicroAmp 96 well reaction plate with a suitable adaptor Slowly apply the cycle sequencing samples 20ul to the gel bed of each well Centrifuge for 3 minutes at 1000 x g Dry the samples in a vacuum centrifuge until dry about 20 minutes Make sure that you do not over dry the samples Store the dried down samples in the freezer 20c until ready to proceed to the sequencing run Note Automated Sequencing can be performed on the Applied Biosystems 310 Genetic Analyzer 377 DNA Sequencer or 3100 Genetic Analyzer Sequencing using the 377 DNA Sequencer A Gel Preparation and casting using the Long Ranger Singel Pack i Gel Preparation 1 2 3 4 5 6 Assemble glass plates and spacers in the cassette following the method described in the ABI PRISM 377 DNA Sequencer Users Manual Have the Long Ranger Singel pack at room temperature
47. on LED display to sterilize the tubes prior to use to avoid contamination Make a master mix of the following content in a 1 Sml microcentrifuge tube of samples x 12 5 ul of HotStarTaq Master Mix of samples x 1 0 ul of FAM AmeloF primer 3 6 pmol ul of samples x 1 0 ul of AmeloR primer 3 6 pmol ul of samples x 1 0 ul of THOIF primer 8 pmol ul of samples x 1 0 ul of FAM THOI1R primer 8 pmol ul of samples x 7 5 ul of water Mix by Vortexing Dispense 24 ul of the master mix into each of the MicroAmp Reaction Tubes To each of the tubes containing master mix pipet ul of Genomic DNA of a 25ng ul concentration To the Positive Control tube add 1 ul of the selected control and to the Negative control tube add 1 ul of water Note The final volume for the PCR is 25 ul Place the MicroAmp Caps on the tubes and seal tightly Place the Tubes in the thermal cycler Geneamp PCR System 9700 and program the following conditions into the machine and start the run under the reaction volume of 25ul refer to the Geneamp PCR System 9700 Users Manual for details 1 cycle 95C 10min 27 cycles 94C 45sec 60C 45sec 72C 1min 1 cycle 60C 45min hold at 4C store the amplified products protected from light at 2 6C for short periods and at 15 to 25C for longer periods GeneScan using the 377 DNA Sequencer A Gel Preparation and casting using the Long Ranger Singel Pack i Gel Preparation 1 2 3 4 s 6 Assem
48. onent and an environmental component 4 Thus an environmental trigger in a susceptible genetic background results in type 1 diabetes development This genetic component is the earliest predictor of type 1 diabetes and may eventually allow prediction in the prenatal phase leading to early prevention and or treatment The genes that are known to play a role in the genetic susceptibility include those in the Human Leukocyte Antigen HLA complex on chromosome 6p21 and the insulin gene on chromosome 11p15 5 The role of the HLA region in type 1 diabetes was discovered in the 1970s by both association studies and affected sib pair studies 6 8 The DR3 and DR4 haplotypes which consist of specific combinations of the class II genes DQA1 DQB1 and DRB1 have been implicated in disease susceptibility and the DR2 haplotype has been associated with disease protection as determined by serotyping 9 12 These class II HLA genes are highly polymorphic and molecular genetic analysis has identified certain alleles with protection or susceptibility to type 1 diabetes 12 26 The assay described below involves genotyping the HLA DRB1 gene Previous studies have found that DRB1 alleles 0301 0401 0402 0404 and 0405 are predisposing for type 1 diabetes and the DRB1 alleles 1501and 0701have a protective effect 12 27 29 This study will allow confirmation of these results as well as allow the minor genetic risk factors to be identified by controlling for the
49. ontrol of previously genotyped DNA as well as ano DNA negative control is included For the fragment analysis using the Green I kit a Green I Allelic Ladder is always run with the samples For fragment analysis of Amelogenin and THO1 an inhouse internal allelic ladder is always run with the samples e Equipment and Materials Puregene DNA Isolation Kit catalog D 50K Gentra Systems Minneapolis MN 70 ethanol ethanol 100 isopropanol isopropanol glycogen Gentra Systems 50 ml Falcon centrifuge tubes Rainin pipet tips with filters Rainin Instrument Co Emeryville CA Sterile individually wrapped transfer pipets Racks for 50ml centrifuge tubes bleach after each use PipetAid Drummond Daigger Lincolnshire IL Qiagen Sigma centrifuge Qiagen Inc Chatsworth CA Dispensett III volume dispenser for reagents Daigger Lincolnshire IL Nitrile Gloves HLA DRB BigDye Terminator Sequencing Based Typing Kit catalog 4305213 Applied Biosystems 1 5 and 0 5 ml microfuge tubes Marsh Biomedical Products Inc Rochester NY MicroAmp 8 Strip Reaction Tubes 0 2ml catalog N801 0580 Applied Biosystems MicroAmp Caps 8 caps strip catalog N801 0535 Applied Biosystems MicroAmp 96 Well Tray Retainer Sets catalog 403081 Applied Biosystems Microtiter plate Finnpette Biocontrol Pipettor with Multi channel module Lab Systems Marsh Biomedical Products Inc Geneamp PCR System 9700 Applied Biosystems ABI PRISM 3
50. ord ID of samples to be extracted and assign a temporary ID number to each for example 1 10 Label all processing tubes and columns with the temporary ID number NOTE use universal precautions when working with blood and perform all steps in a biological safety cabinet to avoid contamination or exposure to biological agents within the blood A Cell Lysis Label 50mL falcon tubes appropriately and fill each with 30mL Red Blood Cell Lysis solution RBC Add 10mL whole blood to appropriately labeled falcon tube containing the RBC lysis solution Invert to mix and incubate 10 minutes at room temperature Invert at least once during incubation Centrifuge at 2 000 x g for 10 minutes Remove supernatant leaving behind white pellet and about 200 400 ml of liquid Vortex tube to resuspend cells Add 10mL Cell Lysis Solution to cells and pipet up and down to lyse cells Usually no incubation is required however if cell clumps are visible incubate at 37 C until solution is homogenous and no clumps are detected Pa Bilas tn ce Note samples are stable in cell lysis solution for at least 18 months at room temperature 12 B RNase Treatment 1 Add 50 ul RNase A Solution to cell lysate solution in falcon tube 2 Mix by inverting the tube 25 times and incubate at 37 C for 15 60 minutes C Protein Precipitation 1 Cool sample to room temperature 2 Add 3 33mL Protein Precipitation Solution to cell lysate solution 3 Vortex for 20 s
51. r Software converts fragment sizes to genotypes which can then be uploaded into a database The AmpFISTR Green I Kit is used for quality control for the trio samples Identification of Amelogenin and THO1 Markers This PCR based method amplifies the Amelogenin locus and the THO short tandem repeat loci These markers are used for quality control purposes for samples that are not trios 9 Reportable Range of Results Not applicable See item 7 for details 10 Quality Control QC Procedures a Quality Control Principles The type I diabetes genotyping method described in this protocol has been well established in the Division of Environmental Health and Laboratory Sciences These methods have proven to be accurate precise and reliable Reliability of test results should be monitored by routine use of positive controls of known genotypes for both the AlleleSEQR HLA DRBI sequence based typing SSP PCR and sequencing step for the DRB SSP PCR sequencing assay as well as for the microsatellites assay AlleleSEQR HLA DRB1 SBT A tun is considered to be out of control if 1 The reactions sequenced produces an un readable electropherogram for the Forward or Reverse sequence reaction due to machine malfunction or operator error HLA DRB SSP PCR and sequencing A tun is considered to be out of control if 1 There are more than 2 positive PCR products for DRB1 2 The band patterns do not match one of the possible combination
52. range G Loading Dye Final concentration grams L Final concentration grams 100mL 890mM Tris Base Trizma Base 108g 15 Ficoll 400 15g 100mL 890mM Boric Acid 55g 25mM EDTA pH 8 Sul of 0 5M EDTA pH 8 20mM Disodium EDTA 7 44g 0 25 Orange G 0 25g 100mL Add deionized water to a final volume of 1000mL Add deionized water to a final volume of 100mL mix thoroughly and filter through a lt 0 45um mix thoroughly with a little heat and filter through membrane a 0 45mm membrane Store at room temperature Store at room temperature Do not use if precipitate forms For 1X TBE for sequencing dilute 150mL of the 10X TBE stock and bring the volume up to 1 5L C PCR Amplification SSP PCR 1 Record ID of samples to be typed and assign an internal ID numbers to each sample for example A1 12 B1 12 where A refers to the sample ID and 1 12 refers to the tube number there will be 12 reaction tubes per individual being typed 2 Label all processing MicroAmp 8 Strip Reaction Tubes 0 2ml tubes with the internal ID number and place them into a MicroAmp 96 Well Tray Retainer 3 Place the MicroAmp tubes Tray and 0 5ml microcentrifuge tubes to be used into the Stratalinker Stratagene and UV crosslink twice at 120 joules 1200 on LED display to sterilize the tubes prior to use to avoid contamination 4 Pipet 40ul of Genomic DNA at a concentration of 10ng hl into the 0 5ml microcentrifuge tubes that have been labeled appropriately 5 Add 1 0ul of A
53. reated PCR product and mix well 22 S 6 Seal the tubes with the MicroAmp Strip caps tightly Place the tubes tray in the thermal cycler GeneAmp PCR system 9700 and run under the following conditions refer to the GeneAmp PCR system 9700 Users Manual for details 25 cycles 96C for 20 sec 60C for 2 min hold at 4C until ready to proceed F Clean up of Cycle Sequencing Reaction 1 N Sore Wik Add lul of NaOAc EDTA buffer included in the AlleleSEQR HLA DRB SBT kit to each sequencing reaction Prepare a mixture of EtOH NaOAc by adding 20 ul of 3M NaOAc pH4 6 per mL of absolute ethanol 1 mL of this mixture is sufficient for 40 reactions Add 25 ul of EtOH NaOAc prepared in step 2 to each sequencing reaction Vortex the reaction tubes well Incomplete mixing will result in poor quality sequence data Centrifuge at 2000 x g for 30 minutes Remove the supernatant by inverting the tray onto a paper towel and centrifuging at 500 x g for 30 seconds Add 50 ul of 80 EtOH to each of the sequencing reactions Centrifuge at 2000 x g for 5 minutes Remove the supernatant by inverting the tray onto a paper towel and centrifuging at 500 x g for 30 seconds 0 Store the reactions in the freezer if you are not going to proceed with sequencing at this time Sequencing using the 3100 Genetic Analyzer Preparing and Loading Samples on the 3100 Genetic Analyzer 1 2 aS DNA Resuspend the cycle sequencing reactions in
54. s Rockland ME Ethidium Bromide Ameresco Solon OH Low DNA Mass Ladder cat 10068 013 Gibco BRL Rockville MD 5 Dye Terminator Cycle Sequencing Ready Reaction Kit Applied Biosystems Foster City CA Sequencing Capillaries 47cm x 50um Applied Biosystems Foster City CA AmpF STR Green I PCR Amplification Kit catalog 402902 Applied Biosystems AmpF STR Green I PCR Amplification Kit User s Manual catalog 402944 Applied Biosystems Performance Optimized Polymer 4 POP 4 catalog 402838 Applied Biosystems 0 5ml Genetic Analyzer sample tubes and septum catalog 401957 and 401956 Applied Biosystems ABI PRISM 310 Genetic Analyzer Applied Biosystems ABI PRISM 3100 Genetic Analyzer Applied Biosystems 1xTE 10mM Tris HCl 0 1mM EDTA pH 8 0 GeneScan 350 ROX Internal Lane Size Standard catalog 401735 Applied Biosystems 10x Genetic Analyzer Buffer with EDTA catalog 402824 Applied Biosystems f Instrumentation The ABI PRISM 377 DNA Sequencer ABI PRISM 310 Genetic Analyzer and ABI PRISM 3100 Genetic Analyzer can be used for both fragment analysis as well as for sequencing applications All instruments utilize electrophoresis laser excitation and detection via a charged coupled device CCD camera which provides simultaneous detection of all four colors from a single sample run The GeneAmp PCR System 9700 is an automated thermal cycler with interchangeable sample blocks used to carry out PCR amplif
55. s The partially processed blood is at the cell lysis stage of the Puregene protocol and are stable for 18 months at room temperature see appendix A Fully precessed DNA can be stored at 20C indefinitely Prior to testing thaw DNA completely to room temperature for 10 30 minutes 16 Alternative methods for performing test or storing specimens if test system fails When a test fails it is usually due to one reasons mentioned previously in item 10 If the automated sequencer fails prior to a run use another instrument that is located in Biotechnology Core Facility Scientific Resource Program or CDC and have the failed one repaired immediately by the manufacturer If the instrument fails during a run the entire test must be repeated promptly 17 Test Result Reporting Systems Protocol for reporting critical calls if applicable Each allele is reported according to standard HLA nomenclature 30 Results are proofread and entered into a common database by the analyst and given to the supervisor to review After review of run data supervisor forwards the final report to the Molecular Biology Branch Chief and DLS division director for final approval After approval report is forwarded to requestor Critical calls are not applicable 18 Transfer or Referral of Specimens Procedures for Specimen Accountability and Tracking Standard record keeping means including the use of Excel and or Access database software should be used to track specime
56. s in the HLA DRB Comparison Table Table 2 3 There is no positive band for the ALL tube or no bands at all 4 The positive control the in house control DNA sample produces a false positive or false negative band 5 The reactions sequenced produces an un readable electropherogram due to machine malfunction or operator error If the run is declared out of control both the SSP PCR as well as the automated sequencing is repeated immediately Human Idenfication A tun is considered to be out of control if 1 The electropherogram for the fragment analysis contains less than 4 or greater than 8 peaks 2 The GeneScan 350 ROX Internal Lane standard does not show up on the electropherogram or 3 The signal is too weak on the electropherogram 7 If the run is declared out of control the fragment analysis should be repeated If the run is out of control again the PCR as well as the fragment analysis is repeated Idenfication of Amelogenin and THO1 Markers A tun is considered to be out of control if 1 The electropherogram for the fragment analysis contains less than 2 or greater than 4 peaks 2 The GeneScan 350 ROX Internal Lane standard does not show up on the electropherogram or 3 The signal is too weak on the electropherogram If the run is declared out of control the fragment analysis should be repeated If the run is out of control again the PCR as well as the fragment analysis is repeated
57. systems Absolute ethanol 80 ethanol Equipment Finnpette Biocontrol Pipettor with Multi channel module Lab Systems through Marsh Biomedical Products Inc Geneamp PCR System 9700 Applied Biosystems ABI PRISM 3100 Genetic Analyzer Applied Biosystems Stratalinker 2400 UV Crosslinker Stratagene La Jolla CA Rainin pipettors Rainin Emeryville CA Balance Computer software for analysis with Sequencing Analysis MatchTools and MTNavigator Applied Biosystems IEC Multi Centrifuge with Double Deep Microplate Rotor Forma Scientific Inc Marietta OH Vortexer Genie Diagger Licolnshire IL Labeling Label all reagents and aliquots of reagents with the reagent name concentration date prepared and appropriate expiration date Labels are created using computer label making system Label View Pro and Eltron printer Procedures A General PCR practices 1 Wear a new disposable laboratory coat and new gloves when preparing samples or reagents for PCR amplification 2 Change gloves frequently 3 Maintain separate areas and dedicated equipment and supplies for sample preparation PCR setup and amplification analysis 4 Open and close all sample tubes carefully to avoid reagent or sample splashes 5 Use air displacement pipettors with filter plugged tips Change tips after each use 6 Clean the general area using 10 bleach solution and rinse with deionized water Cover lab benches with clean sheet of disposable absorbent pad and remove
58. t all data into the database See the user s manual for the 310 3100 Genetic Analyzer 310 3100 Collection Software Sequence Analysis Software MatchTools and MTNavigator software for operation and usage of the 310 3100 Genetic Analyzer and the software 30 Table 1 HLA DRB sample worksheet HLA DRB Typing Results using the BigDye Terminator Sequencing Based Typing Kit Applied Biosystems Instructions Enter the ID number of the sample tested under the column Sample name Place a positive mark in the appropriate boxes if there is a band present on the agarose gel Sample DRB1 DRB1 DRB1 DRB1 DRB1 DRB1 DRB1 DRB1 DRB3 DRB4 DRB5 ALL Name Gl G2 G3 11 6 G4 G7 G8 12 G9 G10 Date of PCR Reaction Thermal Cycler 9700 Date of agarose gel run Thermal Cycler circle 1 2 3 4 5 6 7 8 Date of Cycle Sequencing Reaction Date of DyeEx clean up Date Analyzed Instrument used to Sequence circle 377 3100 310 Date of Sequence Run Date entered into Access database Attach photographs of the agarose gels below 31 Table 2 HLA DRB Comparison Table Possible DRB Combinations Gl G2 G3 11 6 G4 G7 G8 12 G9 G10 DRB3 DRB4 DRB5 l 2 3
59. the temperature reaches 50C and rinse out the top of the gel with 1XTBE buffer Load 1 8ul of the denatured samples on the gel The odd lanes should be loaded first then run in for 1 minute before the even lanes are loaded Cancel the PRE RUN and change the module to the GS Run 36A 2400 module and start the run The run will take 2 5 hours Analyze the Results using the GeneScan Analysis and Genotyper Software 20 Appendix D Sequence Based typing of HLA DRB1 using the AlleleSEQR HLA DRB1 Sequence Based Typing SBT Kit Materials AlleleSEQR HLA DRB1 Sequence Based Typing Kit catalog R7000 Forensic Analytical Hayward CA Group Specific Sequencing Primers Gr3 and G4 Forensic Analytical Hayward CA 1 5 and 0 5 ml microfuge tubes Marsh Biomedical Products Inc Rochester NY MicroAmp 8 Strip Reaction Tubes 0 2ml catalog N801 0580 Applied Biosystems MicroAmp Caps 8 caps strip catalog N801 0535 Applied Biosystems MicroAmp 96 Well Tray Retainer Sets catalog 403081 Applied Biosystems MicroAmp Full Plate Cover catalog N801 0500 Applied Biosystems Rainin pipett tips Rainin Emeryville CA MicroAmp 96 well reaction plate catalog N8010560 Applied Biosystems 96 well plate septa catalog 4315933 Applied Biosystems deionized water Hi Di Formamide catalog 4311320 Applied Biosystems 10x Genetic Analyzer Buffer with EDTA catalog 402824 Applied Biosystems 3100 POP 6 polymer catalog 4316357 Applied Bio
60. xpiration date Discard after expiration date The Terminator Ready Reaction Mix is light sensitive and should be stored without exposure to light The AmpFISTR Green I PCR Amplification Kit is stored at 4C until the manufacture s specified expiration date Check the expiration date before each use and discard the kit after the expiration date The HiDi Formamide is aliquoted into separate tubes and stored at 20C b Preparation of Reagents See Appendix A B C D and E c Standards These are qualitative assays and calibration standards are not used See part 7 d Controls AlleleSEQR HLA DRB1 SBT In each set of PCR and subsequent sequencing reactions an in house control DNA as well as control DNA supplied in the kit is tested These control DNAs have been previously genotyped by sequencing analysis The positive DNA control supplied in the kit is used as a control to test the chemistries for PCR as well as for sequencing SSP PCR and Sequencing In each set of PCR reactions and subsequent sequencing reaction an in house control DNA is tested This control DNA has been previously genotyped by sequencing analysis Other internal controls for the SSP PCR and sequencing are the ALL tube for the SSP PCR and pGEM for sequencing This ALL reaction tube should always have a positive PCR band and pGEM has been previously sequenced and is used as a control for sequencing chemistries Human Identification In each set of PCR reactions a positive c

Sequence Genotyping HLA-DRB1

Contents

Download Pdf Manuals

Related Search

Related Contents