pEF6/V5-His-TOPO TA Cloning manual
Contents
1. gt 12 000 x g for 1 minute and discard the flow through Place the column back into the Wash Tube Procedure continued on next page Continued on next page Purifying PCR Products continued Using the PureLink Quick Gel Extraction Kit continued Low Melt Agarose Method Note Procedure continued from previous page o 10 11 12 13 Add 700 uL of Wash Buffer W9 with ethanol add 96 100 ethanol to the Wash Buffer according to instructions on the label of the bottle to the column and incubate it at room temperature for 5 minutes Centrifuge the column at gt 12 000 x g for 1 minute Discard the flow through Centrifuge the column at gt 12 000 x g for 1 minute to remove any residual buffer Place the column into a 1 5 mL Recovery Tube Add 50 pL warm 65 70 C TE Buffer to the center of the cartridge Incubate the column at room temperature for 1 minute Centrifuge the column at gt 12 000 x g for 2 minutes The Recovery Tube contains the purified DNA Store the DNA at 20 C Discard the column Use 4 pL of the purified DNA for the TOPO Cloning reaction If you prefer to use low melt agarose use the procedure below Note that the gel purification results in a dilution of your PCR product and a potential loss of cloning efficiency 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer Visualize the band of interest and exc2. C 1 Streak the original colony out on an LB agar plate containing 50 100 pg mL ampicillin Incubate the plate at 37 C overnight 2 Isolate a single colony and inoculate into 1 2 mL of LB containing 50 100 pg mL ampicillin Grow the cells until the culture reaches stationary phase ODeo 1 2 Mix 0 85 mL of the culture with 0 15 mL of sterile glycerol and transfer the mix to a cryovial 5 Store the glycerol stocks at 80 C Optimizing the TOPO Cloning Reaction Faster Subcloning More Transformants Cloning Dilute PCR Products The high efficiency of TOPO Cloning technology allows you to streamline the cloning process If you routinely clone PCR products and wish to speed up the process consider the following Incubate the TOPO Cloning reaction for only 30 seconds instead of 5 minutes You may not obtain the highest number of colonies but with the high efficiency of TOPO Cloning most of the transformants will contain your insert After adding 2 pL of the TOPO Cloning reaction to chemically competent cells incubate the reaction on ice for only 5 minutes Increasing the incubation time to 30 minutes does not significantly improve the transformation efficiency If you are TOPO Cloning large PCR products toxic genes or cloning a pool of PCR products you may need more transformants to obtain the clones you want To increase the number of colonies Incubate the salt supplemented TOPO
3. Mizushima and Nagata 1990 used in the pEF6 V5 His TOPO vector Features are marked as described in Uetsuki et al 1989 m 5 end of human EF 1a promoter 461 GGAGTGCCTC GTGAGGCTCC GGTGCCCGTC AGTGGGCAGA GCGCACATCG CCCACAGTCC 24 521 CCGAGAAGTT GGGGGGAGGG GTCGGCAATT GAACCGGTGC CTAGAGAAGG TGGCGCGGGG 581 TAAACTGGGA AAGTGATGTC GTGTACTGGC TCCGCCTTTT TCCCGAGGGT GGGGGAGAAC TATA box Start of Transcription 641 CGTATATAAG TGCAGTAGTC GCCGTGAACG TTCTTTTTCG CAACGGGTTT GCCGCCAGAA Exon I r end of Intron 1 701 CACAGGTAAG TGCCGTGTGT GGTTCCCGCG GGCCTGGCCT CITTACGGGT TATGGCCCTT 761 GCGTGCCTTG AATTACTTCC ACCTGGCTGC AGTACGTGAT TCTTGATCCC GAGCTTCGGG 821 TTGGAAGTGG GTGGGAGAGT TCGAGGCCTT GCGCTTAAGG AGCCCCTTCG CCTCGTGCTT 881 GAGTTGAGGC CTGGCCTGGG CGCTGGGGCC GCCGCGTGCG AATCTGGTGG CACCTTCGCG 941 CCTGTCTCGC TGCTTTCGAT AAGTCTCTAG CCATTTAAAA TTTTTGATGA CCTGCTGCGA 1001 CGCTTTTTTT CTGGCAAGAT AGTCTTGTAA ATGCGGGCCA AGATCTGCAC ACTGGTATTT Sp 1 B 1061 CGGTTTTTGG GGCCGCGGGC_GGCGACGGGG CCCGTGCGTC CCAGCGCACA TGTTCGGCEA Sp 1 1121 GGCGGGGECT GCGAGCGCGG CCACCGAGAA TCGGACGGGG GTAGTCTCAA GCTGGCCGGC Sp 1 Sp 1 1181 CTGCTCTGGT GCCTGGCCTC GCGCCGCCGT GTATEGCCCC GCCCIGGGCG GCAAGGCTGG 1241 CCCGGTCGGC ACCAGTTGCG TGAGCGGAAA GATGGCCGCT TCCCGGCCCT GCTGCAGGGA Sp 1 1301 GCTCAAAATG GAGGACGCGG CGCTCGGGAG AGCGGGCGGG TGAGTCACCC ACACAAAGGA Ap 1 1361 AAAGGGCCTT TCCGTCCTCA GCCGTCGCTT CATGIGACTC_GACGGAGTAC CGGGCGCCGT 1421 CCAGGCACCT CGATTAGT
4. a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therape
5. are listed below Note that the kit does not contain Taq polymerase Store at 20 C Item Composition Amount pEF6 V5 His TOPO 10 ng uL plasmid DNA in 20 pL 50 glycerol 50 mM Tris HCl pH 7 4 at 25 C 1mM EDTA 2mM DTT 0 1 Triton X 100 100 pg mL BSA 30 uM phenol red 10X PCR Buffer 100 mM Tris HCl pH 8 3 at 42 C 100 pL 500 mM KCI 25 mM MgCl 0 01 gelatin dNTP Mix 12 5 mM dATP 10 pL 12 5 mM dCTP 12 5 mM dGTP 12 5 mM dTTP neutralized at pH 8 0 in water Salt Solution 1 2 M NaCl 50 pL 0 06 M MgCl T7 Promoter Primer 0 1 pg pL in TE Buffer pH 8 0 20 uL BGH Reverse Primer 0 1 pg pL in TE Buffer pH 8 0 20 uL Control PCR Template 0 05 ug pL in TE Buffer pH 8 0 10 pL Control PCR Primers 0 1 ug pL each in TE Buffer pH 8 0 10 pL Sterile Water 1 mL Expression Control Plasmid 0 5 ug pL in TE Buffer pH 8 0 10 pL pEF6 V5 His TOPO lacZ TE buffer pH 8 0 10 mM Tris HCl 1 mM EDTA pH 8 0 Continued on next page Kit Contents continued One Shot Reagents Sequencing Primers Genotype of TOP10 Cells The table below describes the items included in the One Shot TOP10 Chemically Competent E coli kit Store at 80 C Item Composition Amount SOC Medium 2 Tryptone 6 mL may be stored atroom 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose TOP10 cells 21 x 50 uL pUC19 Control DNA 10 pg uL in 5
6. theory these tags could be used to identify and isolate a fusion membrane protein after denaturing the VLP however the MembranePro Functional Protein Expression System does not support using the tags for extraction and purification Continued on next page Designing PCR Primers continued TOPO Cloning The diagram below is supplied to help you design the appropriate PCR primers Site of pEF6 to correctly clone and express your PCR product Restriction sites are labeled to V5 His TOPO indicate the actual cleavage site The vector is supplied linearized between base 1561 1621 1681 1741 1790 1841 1892 pair 1 760 and 1 761 This is the TOPO Cloning site For a map and a description of the features of pEF6 V5 His TOPOS refer to the Appendix pages 25 26 The complete sequence of pEF6 V5 His TOPO is available for downloading at www invitrogen com or by contacting Technical Support see page 32 TTGGAATTTG CCCTTTTTGA GTTTGGATCT TGGTTCATTC TCAAGCCTCA GACAGTGGTT 3 end of hEF 1a Intron 1 T7 promoter priming site CAAAGTTTTT TICTTCCATT TCAGGTGTCG TGAGGAATTA GCTTGGTACT AATACGACTC 5 end of hEF 1a Exon 2 Asp7181 kon BamH Spe l ACTATAGGGA GACCCAAGCT GGCTAGGTAA GCTTGGTACC GAGCTCGGAT CCACTAGTCC BstX EcoR V BstX AGTGTGGTGG NEEN Re GGC AAT TCT GCA GAT ATC CAG CAC AGT TTAACGGGARII TTC CCG TTA AGA CGT CTA TAG GTC GTG TCA Lys Gly Asn Ser Ala Asp Ile Gln His Ser Not Xba Gec Gcc CGC T
7. you may use the Anti V5 Antibodies or the Anti His C term Antibodies available from Invitrogen see page 31 for ordering information or an antibody to your protein of interest To detect the fusion protein by Western blot prepare a cell lysate from the transfected cells A sample protocol is provided below Other protocols may also be suitable Refer to Antibodies A Laboratory Manual Harlow and Lane 1988 for additional information We recommend that you perform a time course to optimize the expression of your fusion protein e g 24 48 72 hours etc after transfection To lyse cells 1 Wash the cell monolayers 10 cells once with phosphate buffered saline PBS see page 30 for ordering information 2 Scrape the cells into 1 mL of PBS and centrifuge them at 1 500 x g for 5 minutes to pellet Discard the supernatant 3 Resuspend the cell pellet in 50 uL of Cell Lysis Buffer see Appendix page 29 for a recipe Other cell lysis buffers are also suitable 4 Incubate the cell suspension at 37 C for 10 minutes to lyse the cells Note If degradation of your protein is a potential problem you may prefer to lyse the cells at room temperature or on ice 5 Centrifuge the cell lysate at 10 000 x g for 10 minutes to pellet nuclei and transfer the supernatant to a fresh tube Assay the lysate for protein concentration Note Do not use protein assays utilizing Coomassie Blue or other dyes NP 40 interferes with the binding of the
8. 1760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
9. 5826 complementary strand Continued on next page 20 pEF6 V5 His TOPO Vector continued Features of pEF6 V5 His TOPO pEF6 V5 His TOPO 5 840 bp contains the following elements All features have been functionally tested Feature Benefit Human elongation factor la hEF 1a promoter Permits overexpression of your recombinant protein in a broad range of mammalian cell types Goldman et al 1996 Mizushima and Nagata 1990 T7 promoter priming site Allows for in vitro transcription in the sense orientation and sequencing through the insert TOPO Cloning site Allows insertion of your PCR product in frame with the C terminal V5 epitope and polyhistidine 6xHis tag V5 epitope Allows detection of the fusion protein with the Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Anti V5 Antibody or the Anti V5 HRP Antibody Southern et al 1991 see page 31 for ordering information C terminal polyhistidine 6x His tag Permits purification of your fusion protein on metal chelating resins i e ProBond In addition the C terminal polyhistidine tag is the epitope for the Anti His C term Antibody and the Anti His C term HRP Antibody Lindner et al 1997 see page 31 for ordering information BGH reverse priming site Permits sequencing through the insert Bovine growth hormone Efficient transcription termination and BGH polyadenylation poly
10. binding domain encoded by the polyhistidine tag allows simple easy purification of your recombinant protein by Immobilized Metal Affinity Chromatography IMAC using Invitrogen s ProBond Resin see below To purify proteins expressed using pEF6 V5 His TOPOS the ProBond Purification System is available separately Additional ProBond resin is available in bulk See the table below for ordering information Product Amount Cat no TM ProBond Purification System 6 purifications K850 01 includes six 2 mL precharged prepacked Pro resin columns and buffers for native and denaturing purification ProBond Purification System with Anti V5 1 Kit K854 01 HRP Antibody ProBond Metal Binding Resin precharged 50 mL R801 01 resin provided as a 50 slurry in 20 ethanol 150 mL R801 15 Purification Columns 50 columns R640 50 10 mL polypropylene columns 31 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes SDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com
11. dye with the protein 6 Add SDS PAGE sample buffer to the lysate to a final concentration of 1X and heat the sample at 70 C for 5 minutes 7 Load 20 ug of the lysate onto an SDS PAGE gel and electrophorese Use the appropriate percentage of acrylamide to resolve your fusion protein The C terminal peptide containing the V5 epitope and the polyhistidine 6xHis tag adds approximately 5 kDa to the size of your protein You need 5 x 10 to 1 x 10 transfected cells for purifying your protein on a 2 mL ProBond column or other metal chelating column Refer to the manufacturer s instructions before attempting to purify your fusion protein To prepare the cells for lysis refer to the protocol on page 16 Creating Stable Cell Lines Introduction Determining Antibiotic Sensitivity Possible Sites for Linearization After you have established that your construct can be expressed in the mammalian cell line of choice you may wish to generate a stable cell line that overexpresses your protein of interest The pEF6 V5 His TOPO vector contains the blasticidin resistance gene bsd to allow the selection of stable cell lines using blasticidin Kimura et al 1994 For more information about blasticidin refer to the Appendix page 23 To successfully generate a stable cell line expressing your protein of interest you need to determine the minimum concentration of blasticidin required to kill your untransfected host ce
12. mM Tris HCL0 5mM 50 uL EDTA pH 8 The table below provides the sequence and pmoles of the T7 Promoter primer and the BGH Reverse primer Two micrograms of each primer are supplied Primer Sequence pMoles Supplied T7 Promoter 5 TAATACGACTCACTATAGGG 3 328 BGH Reverse 5 TAGAAGGCACAGTCGAGG 3 358 Use this strain for general cloning of PCR products in pEF6 V5 His TOPO Note that this strain cannot be used for single strand rescue of DNA F mcrA A mrr hsdRMS mcrBC O80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL Str endA1 nupG vii Methods Description of the System System Overview How It Works The pEF6 V5 His TOPO TA Expression Kit provides a highly efficient 5 minute one step cloning strategy TOPO Cloning for the direct insertion of Taq polymerase amplified PCR products into a plasmid vector for high level expression in mammalian cells No ligase post PCR procedures or PCR primers containing specific sequences are required Once cloned analyzed and transfected into a mammalian host cell line the PCR product can be constitutively expressed The plasmid vector pEF6 V5 His TOPO is supplied linearized with e Single 3 thymidine T overhangs for TA Cloning e Topoisomerase covalently bound to the vector this is referred to as activated vector Taq polymerase has a nontemplate dependent terminal transferase activity that adds a single deoxyadenosine A to t
13. visible Proceed to the Control TOPO Cloning Reactions next page Continued on next page 17 pEF6 V5 His TOPO TA Cloning Control Reactions continued Control TOPO Using the control PCR product produced on the previous page and the pEF6 V5 Cloning Reactions His TOPO vector set up two 6 uL TOPO Cloning reactions as described below Expected Results Transformation Control 18 1 Set up the control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Sterile Water 4 uL 3 uL Salt Solution or Dilute Salt Lut Lut Solution Control PCR Product 1uL pEF6 V5 His TOPOS vector Lut Lut 2 Incubate the reactions at room temperature for 5 minutes and place them on ice 3 Transform 2 uL of each reaction into One Shot TOP10 chemically competent or electrocompetent E coli see page 8 4 Spread 10 50 uL of each transformation mix onto LB plates containing 50 100 pg mL ampicillin and X Gal see page 28 Plate two different volumes to ensure that at least one plate has well spaced colonies For plating small volumes add 20 pL of SOC to assure even spreading Note No IPTG is required 5 Incubate the plates overnight at 37 C The Vector PCR Insert reaction should produce hundreds of colonies Greater than 90 of these will be blue and contain the 500 bp insert The Vector Only reaction should yield very few colonies lt 10 of the number of colo
14. with a stop codon the PCR product may be expressed as a native protein Continued on next page Description of the System continued Experimental The flow chart below outlines the experimental steps necessary to clone and express Outline your PCR product Determine strategy for PCR Produce PCR product TOPO Cloning Reaction Mix together PCR product and pEF6 V5 His TOPO at room temperature Select and analyze colonies Incubate 5 minutes Transform into TOP10 E coli cells Prepare purified plasmid for transfection into mammalian cells Transfect mammalian cell line and assay for expression of PCR product Designing PCR Primers Designing Your PCR Primers Note The cloning of a PCR product into a pEF6 V5 His TOPO vector is a rapid and efficient process However to ensure proper expression of your recombinant protein it is important to pay attention to the general considerations outlined below e Design of PCR primers to clone your PCR product of interest is critical for expression The pEF6 V5 His TOPO vector is a C terminal fusion vector that does not contain an ATG initiation codon If there is no ATG start codon or optimal sequences for translation initiation Kozak sequences in the DNA to be amplified then these features need to be incorporated into your forward primer Kozak 1987 Kozak 1991 Kozak 1990 An example of a Kozak consensus sequence is provi
15. 2 pEF6 V5 TOPO lacZ Comments for pEF6 V5 His TOPO lacZ 9044 nucleotides EF 1a promoter bases 470 1653 T7 promoter priming site bases 1670 1689 lacZ ORF bases 1761 4964 V5 epitope bases 5030 5071 Polyhistidine 6xHis tag bases 5081 5098 BGH reverse priming site bases 5121 5138 BGH polyadenylation signal bases 5127 5351 f1 origin of replication bases 5397 5825 SV40 promoter and origin bases 5835 6179 EM 7 promoter bases 6216 6282 Blasticidin resistance gene bases 6283 6681 SV40 early polyadenylation signal bases 6839 6969 pUC origin bases 7352 8025 complementary strand bla promoter bases 21 105 complementary strand Ampicillin b a resistance gene bases 8170 9030 complementary strand 27 Recipes LB Luria Bertani Medium and Plates X Gal Stock Solution 28 Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 mL deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave the solution on liquid cycle for 20 minutes at 15 psi Allow the solution to cool to 55 C and add antibiotic if needed 50 100 ug mL ampicillin 4 Store the medium at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave the medium plus agar on liquid cycle for 20 min
16. CG AGT CTA GAG GGC CCG CGG TTC GAA GGT AAG CCT ATC CCT Gly Gly Arg Ser Ser Leu Glu Gly Pro Arg Phe Glu Gly Lys Pro Ile Pro V5 epitope Polyhistidine region AAC CCT CTC CTC GGI CTC GAT TCT ACG CGT ACC GGT CAT CAT CAC CAT CAC Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr Gly His His His His His Pme BGH reverse priming site CAT TGA GTT TAAACCCGCT GATCAGCCTC GACTGTGCCT TCTAGTTGCC AGCCATCTGT His Note that there are two BstX I sites flanking the TOPO Cloning site Producing PCR Products Materials Needed Taq polymerase e Thermocycler e DNA template and primers for PCR product Polymerase If you wish to use a mixture containing Taq polymerase and a proofreading Mixtures polymerase you must use Taq in excess of a 10 1 ratio to ensure the presence of 3 A overhangs on the PCR product If you use polymerase mixtures that do not have enough Tag polymerase or only have a proofreading polymerase you can add 3 A overhangs to your PCR product post amplification using the method on page 22 Producing PCR 1 Set up the following 50 pL PCR reaction Use less DNA if you are using Products plasmid DNA as a template and more DNA if you are using genomic DNA as a template Use the cycling parameters suitable for your primers and template Be sure to include a 7 to 30 minute extension at 72 C after the last cycle to ensure that all PCR products are full length and 3 adenylated DNA Templat
17. Cloning reaction for 20 to 30 minutes instead of 5 minutes Increasing the incubation time of the salt supplemented TOPO Cloning reaction allows more molecules to ligate increasing the transformation efficiency Adding salt appears to prevent topoisomerase from rebinding and nicking the DNA after it has ligated the PCR product and dissociated from the DNA To clone dilute PCR products you may Increase the amount of the PCR product Incubate the TOPO Cloning reaction for 20 to 30 minutes Concentrate the PCR product 11 Transfection Introduction Plasmid Preparation Methods of Transfection Lipofectamine 2000 12 After you have confirmed that your construct is in the correct orientation and that it is fused to the C terminal peptide if desired you are ready to transfect your cell line of choice We recommend that you include the positive control vector see next page and a mock transfection to evaluate your results Plasmid DNA for transfection into eukaryotic cells must be very clean and free from contamination with phenol and sodium chloride Contaminants may kill the cells and salt interferes with lipid complexing decreasing the transfection efficiency When isolating plasmid DNA from E coli strains such as TOP10 that are wild type for endonuclease 1 endA1 with commercially available kits ensure that the Lysis or Resuspension Buffer contains 10 mM EDTA EDTA inactivates the endonuclease a
18. Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 35730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com SDS Certificate of Analysis Limited Warranty 32 Safety Data Sheets SDSs are available at www invitrogen com sds The Certificate of Analysis CofA provides detailed quality control information for each product and is searchable by product lot number which is printed on each box CofAs are available on our website at www invitrogen com support Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liab
19. TC TCGAGCTTTT GGAGTACGTC GICTTTAGGT TGGGGGGAGG 1481 GGTTTTATGC GATGGAGTTT CCCCACACTG AGTGGGTGGA GACTGAAGTT AGGCCAGCTT 1541 GGCACTTGAT GTAATTCTCC TTGGAATTTG CCCTTTTTGA GTTTGGATCT TGGTTCATTC 3 end of Intron 1 1601 TCAAGCCTCA GACAGTGGTT CAAAGTTTTT TTCTTCCATT TCAGGTGTCG TGA 5 end of Exon 2 pEF6 V5 His TOPO Vector Map of The figure below summarizes the features of the pEF6 V5 His TOPO vector The pEF6 V5 His vector is supplied linearized between base pairs 1 760 and 1 761 This is the TOPO TOPO Cloning site Unique restriction sites flanking the TOPO Cloning site are shown The complete sequence for pEF6 V5 His TOPOS is available for downloading at www invitrogen com or by contacting Technical Support see page 32 PCR Product A Comments for pEF6 V5 His TOPO 5840 nucleotides EF 1a promoter bases 470 1653 T7 promoter priming site bases 1670 1689 TOPO Cloning site bases 1760 1761 V5 epitope bases 1826 1867 Polyhistidine 6xHis tag bases 1877 1894 BGH reverse priming site bases 1917 1934 BGH polyadenylation signal bases 1923 2147 f1 origin of replication bases 2193 2621 SV40 promoter and origin bases 2626 2970 EM 7 promoter bases 3012 3078 Blasticidin resistance gene bases 3079 3477 SV40 early polyadenylation signal bases 3635 3765 pUC origin bases 4148 4821 complementary strand bla promoter bases 21 105 complementary strand Ampicillin b a resistance gene bases 4966
20. Term Storage 10 You may wish to use PCR to directly analyze positive transformants For PCR primers use a combination of the T7 Promoter or the BGH Reverse sequencing primer with a primer that binds within your insert You will have to determine the amplification conditions If this is the first time you have used this technique we recommend that you perform restriction analysis in parallel to confirm that PCR gives you the correct result Artifacts may be obtained because of mispriming or contaminating template The following protocol is provided for your convenience Other protocols are also suitable 1 Prepare a PCR cocktail consisting of PCR buffer dNTPs primers and Tag polymerase Use a 20 uL reaction volume Multiply by the number of colonies to be analyzed 2 Pick 10 colonies and resuspend them individually in 20 uL of the PCR cocktail Prepare a patch plate to preserve the colonies for further analysis 3 Incubate the reaction for 10 minutes at 94 C to lyse the cells and to inactivate the nucleases 4 Amplify your samples for 20 to 30 cycles using the amplification conditions you have determined 5 For the final extension incubate the reaction at 72 C for 10 minutes Store at the reactions at 4 C 6 Visualize the results by agarose gel electrophoresis After you have identified the correct clone purify the colony and make a glycerol stock for long term storage Keep a DNA stock of your plasmid at 20
21. aCl 10 mM MgCl in the TOPO Cloning reaction increases the number of transformants 2 to 3 fold We have also observed that in the presence of salt incubation times of greater than 5 minutes can increase the number of transformants This is in contrast to earlier experiments without salt where the number of transformants decreases as the incubation time increases beyond 5 minutes Inclusion of salt allows for longer incubation times because it prevents topoisomerase I from rebinding and potentially nicking the DNA after ligating the PCR product and dissociating from the DNA The result is more intact molecules leading to higher transformation efficiencies Because of the above results we recommend adding salt to the TOPO Cloning reaction A stock salt solution is provided in the kit for this purpose Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells provided or electrocompetent cells For this reason two different TOPO Cloning reactions are provided to help you obtain the best possible results Materials Needed 42 C water bath or electroporator with cuvettes optional e LB plates containing 50 100 pg mL ampicillin two for each transformation e Reagents and equipment for agarose gel electrophoresis e 37 C shaking and non shaking incubator e General microbiological supplies i e plates spreaders Preparation For each tr
22. able 1 After amplification with Vent or Pfu polymerase place vials on ice and add 0 7 1 unit of Taq polymerase per tube Mix well It is not necessary to change the buffer Incubate at 72 C for 8 10 minutes do not cycle Place the vials on ice The DNA amplification product is now ready for TOPO Cloning into pEF6 V5 His TOPO Note If you plan to store your sample s overnight before proceeding with TOPO Cloning you may want to extract your sample s with phenol chloroform to remove the polymerases After phenol chloroform extraction precipitate the DNA with ethanol and resuspend the DNA in TE buffer to the starting volume of the amplification reaction You may also gel purify your PCR product after amplification with Vent or Pfu see pages 20 21 After purification add Taq polymerase buffer dATP and 0 5 unit of Taq polymerase and incubate 10 15 minutes at 72 C Use 4 uL in the TOPO Cloning reaction Vent is a registered trademark of New England Biolabs Blasticidin Blasticidin Molecular Weight Formula and Structure Preparing and Storing Stock Solutions Blasticidin S HCI isolated from Streptomyces griseochromogenes is a nucleoside antibiotic which inhibits the protein synthesis in prokaryotic and eukaryotic cells Takeuchi et al 1958 Yamaguchi et al 1965 Resistance is conferred by the expression of either one of two blasticidin S deaminase genes bsd from Aspergillus terreus K
23. adenylation of mRNA Goodwin and Rottman signal 1992 fl origin Allows rescue of single stranded DNA SV40 early promoter and Allows efficient high level expression of the origin blasticidin resistance gene and episomal replication in cells expressing the SV40 large T antigen EM 7 promoter For expression of the blasticidin resistance gene in E coli Blasticidin resistance gene Selection of stable transfectants in mammalian cells bsd Kimura et al 1994 SV40 polyadenylation Efficient transcription termination and signal polyadenylation of mRNA pUC origin High copy number replication and growth in E coli bla promoter Allows expression of the ampicillin bla resistance gene Ampicillin resistance gene P lactamase Selection of transformants in E coli 26 pEF6 V5 His TOPO lacZ Vector Description pEF6 V5 His TOPO lacZ is a 9 044 bp control vector containing the gene for P galactosidase The lacZ gene was amplified and TOPO Cloned into pEF6 V5 His TOPO such that it is in frame with the C terminal peptide containing the V5 epitope and the polyhistidine 6x His tag Map of pEF6 V5 The figure below summarizes the features of the pEF6 V5 His TOPO lacZ His TOPO lacZ vector Unique restriction sites flanking the lacZ gene are shown The complete sequence for pEF6 V5 His TOPO9 lacZ is available for downloading at www invitrogen com or by contacting Technical Support see page 3
24. age 30 Using Lipofectamine 2000 to transfect eukaryotic cells offers the following advantages e You can add the DNA Lipofectamine 2000 complexes directly to cells in culture medium in the presence of serum e You do not have to remove the complexes or change or add medium following transfection however you may remove the complexes 4 6 hours after transfection without loss of activity e Provides the highest transfection efficiency in 293FT cells Continued on next page Transfection continued Positive Control Assay for B galactosidase Activity pEF6 V5 His TOPO lacZ is provided as a positive control vector for mammalian transfection and expression and it may be used to optimize transfection and expression conditions for your cell line The gene encoding B galactosidase is expressed in mammalian cells under the control of the human EF 1a promoter A successful transfection results in P galactosidase expression that you can be easily assay You may assay for P galactosidase expression by activity assay using cell free lysates Miller 1972 or by staining the cells for activity Invitrogen offers the B Gal Assay Kit and the P Gal Staining Kit for fast and easy detection of B galactosidase expression see page 30 for ordering information 13 Analyzing Recombinant Protein Detecting Fusion Proteins Note Purification 14 To detect the expression of your fusion protein from pEF6 V5 His TOPO
25. ansformation you need one vial of competent cells and two selective plates 1 Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli 2 For electroporation dilute a small portion of the Salt Solution 4 fold to prepare Dilute Salt Solution e g add 5 uL of the Salt Solution to 15 pL sterile water 3 Warm the vial of SOC medium from Box 2 to room temperature Warm selective plates at 37 C for 30 minutes 5 Thaw on ice 1 vial of One Shot cells for each transformation Continued on next page TOPO Cloning Reaction and Transformation continued Important Setting Up the TOPO Cloning Reaction Performing the TOPO Cloning Reaction e For TOPO Cloning and transformation into chemically competent E coli adding sodium chloride and magnesium chloride to a final concentration of 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction increases the number of colonies over time A Salt Solution 1 2 M NaCl 0 06 M MgCl is provided to adjust the TOPO Cloning reaction to the recommended concentration of NaCl and MgCl e For TOPO Cloning and transformation of electrocompetent E coli you must reduce the amount of salt to 50 mM NaCl 2 5 mM MgCl to prevent arcing Dilute the Salt Solution 4 fold to prepare a 300 mM NaCl 15 mM MgCl solution for convenient addition to the TOPO Cloning reaction The table below describes how to
26. d below TM The PureLink Quick Gel Extraction Kit allows you to rapidly purify PCR products from regular agarose gels see page 30 for ordering information 1 2 Equilibrate a water bath or heat block to 50 C Cut the area of the gel containing the desired DNA fragment using a clean sharp blade Minimize the amount of surrounding agarose excised with the fragment Weigh the gel slice Add Gel Solubilization Buffer GS1 supplied in the kit as follows e For lt 2 agarose gels place up to 400 mg gel into a sterile 1 5 mL polypropylene tube Divide gel slices exceeding 400 mg among additional tubes Add 30 uL of Gel Solubilization Buffer GS1 for every 10 mg of gel e For gt 2 agarose gels use sterile 5 mL polypropylene tubes and add 60 pL of Gel Solubilization Buffer GS1 for every 10 mg of gel Incubate the tube at 50 C for 15 minutes Mix every 3 minutes to ensure gel dissolution After gel slice appears dissolved incubate the tube for an additional 5 minutes Preheat an aliquot of TE Buffer to 65 70 C Place a Quick Gel Extraction Column into a Wash Tube Pipette the mixture from Step 4 onto the column Use one column per 400 mg agarose Centrifuge the column at gt 12 000 x g for 1 minute Discard the flow through Place the column back into the Wash Tube Optional Add 500 uL of Gel Solubilization Buffer GS1 to the column and incubate it at room temperature for 1 minute Centrifuge the column at
27. ded below Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring sequence with strong consensus Replacing one of the two bases at these positions provides moderate consensus while having neither results in weak consensus The ATG initiation codon is shown underlined G AJNNATGG e Clone in frame with the V5 epitope and polyhistidine tag C terminal peptide in order to detect and or purify your fusion PCR product OR e Include the native stop codon to express the native protein e Do not add 5 phosphates to your primers for PCR The PCR product synthesized will not ligate into the pEF6 V5 His TOPO vector e Cloning efficiencies may vary depending on the primer nucleotide sequence see Factors Affecting Cloning Efficiency page 19 e Use the diagram on the next page to design your PCR primers After you have designed your PCR primers proceed to Producing PCR Products page 5 TM The MembranePro Functional Protein Expression System is optimized for use with the pEF6 vector However cloning your gene into the pEF6 V5 His TOPO vector without a stop codon and in frame with the polylinker will result in a fusion protein with V5 and polyhistidine 6xHis tags on the C terminus of your protein As the C terminus of your transmembrane protein will likely be inside the VLP these tags will be inaccessible to purification resins and antibodies In
28. e 10 100 ng 10X PCR Buffer 5 pL 50 mM dNTPs 0 5 pL Primers 100 200 ng each Sterile water add to a final volume of 49 pL Tag Polymerase 1 unit uL 1 pL Total Volume 50 uL 2 Check the PCR product by agarose gel electrophoresis You should see a single discrete band If you do not see a single band refer to the Note below If you do not obtain a single discrete band from your PCR you may gel purify Note your fragment before using the pEF6 V5 His TOPO TA Expression Kit see page 20 Take special care to avoid sources of nuclease contamination and long exposure to UV light Alternatively you may optimize your PCR to eliminate multiple bands and smearing Innis et al 1990 The PCR Optimizer Kit from Invitrogen can help you optimize your PCR see page 30 for ordering information For more information visit www invitrogen com or contact Technical Support page 32 TOPO Cloning Reaction and Transformation Introduction TOPO Cloning technology allows you to produce your PCR product ligate it into pEF6 V5 His TOPO and transform the recombinant vector into E coli all in one day It is important to have everything you need set up and ready to use to ensure you obtain the best possible results If this is the first time you have TOPO Cloned you may wish to perform the control reactions on pages 17 18 in parallel with your samples Recent experiments at Invitrogen demonstrate that inclusion of salt 200 mM Note N
29. ed to get experienced users quickly started with the pEF6 V5 His TOPO TA Expression Kit Information is provided elsewhere in the manual if you need help with any of the steps Before Starting Determine a strategy for PCR pages 3 4 and generate the PCR product containing your gene of interest page 5 e Prepare LB plates containing 50 100 pg mL ampicillin see page 28 Store the plates at 4 C Prior to transformation warm the plates at 37 C for 30 minutes 2 plates for each transformation e Prepare or purchase chemically competent or electrocompetent TOP10 cells For convenient high efficiency transformation we recommend One Shot TOP10 Chemically Competent E coli supplied with the kit or One Shot TOP10 Electrocompetent Cells which are available separately from Invitrogen see page 30 for ordering information Prior to transformation thaw the competent cells on ice 1 vial of cells for each transformation e Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli e For electroporation dilute a small portion of the Salt Solution 4 fold to prepare Dilute Salt Solution e g add 5 uL of the Salt Solution to 15 uL sterile water e Warm the vial of SOC medium from Box 2 to room temperature TOPO Cloning 1 Set up your TOPO Cloning reaction 6 uL according to the table below Mix Reaction the reaction gently and incubate it for 5 mi
30. ee the table below for ordering information Item Amount Cat no T7 Promoter Primer 2mg N560 02 BGH Reverse Primer 2mg N575 02 PCR Optimizer Kit 100 reactions K1220 01 One Shot TOP10 Chemically Competent E coli 20 reactions C4040 03 One Shot TOP10 Electrocomp E coli 20 reactions C4040 52 PureLink HiPure Plasmid Miniprep Kit 100 preps K2100 03 PureLink HQ Mini Plasmid Purification 100 preps K2100 01 PureLink Quick Gel Extraction Kit 50 preps K2100 12 Lipofectamine 2000 Transfection Reagent 0 75 mL 11668 027 1 5 mL 1668 019 15 mL 11668 500 Calcium Phosphate Transfection Kit 75 reactions K2780 01 S O C Medium 10 x 10 mL 15544 034 Ampicillin Sodium Salt irradiated 200 mg 11593 027 Blasticidin 50 mg R210 01 Phosphate Buffered Saline PBS pH 7 4 50 mL 10010 023 Trypsin EDTA 0 05 Trypsin EDTA 4Na 100 mL 25300 054 TrypLE Express Dissociation Enzyme 100 mL 12604 013 B Gal Staining Kit 1 kit K1465 01 B Gal Assay Kit 80 mL K1455 01 MembranePro The MembranePro Functional Protein Expression System allows the expression Functional Protein and display of mammalian cell surface membrane proteins including G protein Expression coupled receptors GPCRs in an aqueous soluble format The MembranePro System Functional Protein Expression System is optimized for use with the pEF6 vector and the pEF6 V5 His TOPO TA Vector Kit allows you to directly
31. ertebrate mRNA Sequences Intimations of Translational Control J Cell Biol 115 887 903 Continued on next page 35 References continued Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Lindner P Bauer K Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor New York Cold Spring Harbor Laboratory Mizushima S and Nagata S 1990 pEF BOS a Powerful Mammalian Expression Vector Nuc Acids Res 18 5322 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J B
32. f the protein of interest Use the procedure below to prepare stably transfected cells for lysis prior to purifying your protein on ProBond You need 5 x 10 to 1 x 10 cells for purifying of your protein on a 2 mL ProBond column For more information refer to the ProBond Purification System manual 1 Seed cells from a stable cell line in five T 75 flasks or two to three T 175 flasks Grow the cells in selective medium until they are 80 90 confluent Harvest the cells by treating them with trypsin EDTA or TrypLE Express dissociation reagent for 2 to 5 minutes or by scraping the cells in PBS 4 Inactivate the dissociation reagent by diluting with fresh medium if necessary and transfer the cells to a sterile microcentrifuge tube 5 Centrifuge the cells at 1 500 x g for 5 minutes You may lyse the cells immediately or freeze in liquid nitrogen and store at 70 C until needed If you are using ProBond resin refer to the ProBond Purification System manual for details about sample preparation for chromatography If you are using other metal chelating resin refer to the manufacturer s instruction for recommendations on sample preparation Appendix pEF6 V5 His TOPO TA Cloning Control Reactions Introduction Before Starting Producing Control PCR Product If you have trouble obtaining transformants or vector containing insert we recommend performing the following control TOPO Cloni
33. hake for at least 1 hour at 37 C to allow the expression of the antibiotic resistance gene Spread 10 50 pL from each transformation on a pre warmed selective plate and incubate the plates overnight at 37 C You may add a small amount of SOC to the transformation mix before plating to ensure even spreading of small volumes We recommend that you plate two different volumes to ensure that at least one plate has well spaced colonies An efficient TOPO Cloning reaction produces hundreds of colonies Pick 10 colonies for analysis see Analyzing Transformants next page Adding the Dilute Salt Solution in the TOPO Cloning Reaction brings the final concentration of NaCl and MgCl in the TOPO Cloning reaction to 50 mM and 2 5 mM respectively To prevent arcing of your samples during electroporation the volume of cells should be between 50 uL and 80 pL 0 1 cm cuvettes or 100 pL to 200 uL 0 2 cm cuvettes If you experience arcing during transformation try one of the following Reduce the voltage normally used to charge your electroporator by 10 Reduce the pulse length by reducing the load resistance to 100 ohms Ethanol precipitate the TOPO Cloning reaction and re suspend it in water prior to electroporation Analyzing Transformants Note Analyzing Positive Clones Important There is no blue white screening for the presence of inserts Analyze individual recombinant colonies by restriction analysis or sequencing for
34. he 3 ends of PCR products The linearized vector supplied in this kit has single overhanging 3 deoxythymidine T residues This allows PCR inserts to ligate efficiently with the vector Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites and cleaves the phosphodiester backbone after 5 CCCTT in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products see below Topoisomerase CCCcTT Flaccc GGGA ne A PCR Product ETE HO o CT Topoisomerase Once the PCR product is cloned into pEF6 V5 His TOPO and transformants analyzed for the correct orientation the plasmid may be transfected into the mammalian cell line of choice The strong human EF 1a promoter in pEF6 V5 His TOPO allows high level expression of your PCR product across a broad range of cell types Goldman et al 1996 Mizushima and Nagata 1990 The PCR product may be expressed as a fusion to the C terminal V5 epitope and polyhistidine 6xHis tag for detection and purification or by designing the 3 PCR primer
35. ility to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Limited Use Label License No 5 Invitrogen Technology The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer
36. imura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert blasticidin S to a non toxic deaminohydroxy derivative Izumi et al 1991 The formula for blasticidin is Ci7HzsNsOs HCl and the molecular weight is 458 9 The diagram below shows the structure of blasticidin NH2 Sn As HOOC O CH3 HCl MH N r e NA O Blasticidin is available from Invitrogen in 50 mg aliquots see page 30 Use sterile water to prepare stock solutions of 5 to 10 mg mL e Always wear gloves mask goggles and protective clothing e g a laboratory coat when handling blasticidin Weigh out blasticidin and prepare solutions in a hood e Dissolve blasticidin in sterile water and filter sterilize the solution e Aliquot in small volumes suitable for one time use see next to last point below and freeze at 20 C for long term storage or store at 4 C for short term storage e Aqueous stock solutions are stable for 1 2 weeks at 4 C and 6 8 weeks at 20 C e pH of the aqueous solution should not exceed 7 to prevent the inactivation of blasticidin e Do not subject stock solutions to freeze thaw cycles do not store in a frost free freezer e Upon thawing use what you need and discard the unused portion e You may store medium containing blasticidin at 4 C for up to 2 weeks 23 Human EF 1a Promoter Description The diagram below shows the features of the human EF 1a promoter
37. insert a Taq polymerase amplified PCR product into the pEF6 V5 His TOPO vector in a TOPO Cloning reaction to generate your expression vector For more information visit www invitrogen com or contact Technical Support page 32 Product Amount Cat no MembranePro Functional Protein Expression 10 reactions A11667 Kit MembranePro Functional Protein Support Kit 10 reactions A11668 60 reactions A11669 600 reactions A11670 Continued on next page 30 Accessory Products continued Products for Detecting Recombinant Proteins Products for Purifying Recombinant Protein Once cloned into pEF6 V5 His TOPO you can detect the expression of your PCR product using an antibody to the protein itself or to the appropriate epitope The table below describes the antibodies available for use with pEF6 V5 His TOPO Horseradish peroxidase HRP conjugated antibodies allow one step detection using colorimetric or chemiluminescent detection methods The amount of antibody supplied is sufficient for 25 western blots Antibody Epitope Cat no Anti V5 Detects 14 amino acid epitope R960 25 derived from the P and V proteins of Anti V5 HRP the paramyxovirus SV5 Southern et R961 25 al 1991 GKPIPNPLLGLDST Anti His C term Detects the C terminal polyhistidine R930 25 tag requires the free carboxyl group Anti His C term HRP for detection Lindner et al 1997 R931 25 HHHHHH COOH The metal
38. invitrogen by technologies pEF6 V5 His TOPO TA Expression Kit Five minute cloning of Taq polymerase amplified PCR products for high level expression in mammalian cells Catalog no K9610 20 Rev Date 28 June 2010 Manual part no 25 0279 MAN0000111 Table of Contents Fast SEALE ccs NON iv A ash seh cesses cca E sane bde he eege vi EE 1 Description ofthe System asete osii Seareeteehdekenetssuesadeadistdcunutecd ladies cnansediuade ddestocunutuehlabesnensdaetenideadieten 1 Designing PER Prinses 3 Producing PCR Products iii ita ba 5 TOPO Cloning Reaction and EE EE 6 Analyzing Transformants esere aeaee E Ea tae E S P EEE oa E least TSERE ERE R 9 Optimizing the TOPO Cloning REACH ON ari 11 RE Ee WEE 12 Analyzing Recombinant Protein 14 Creating Stable Cell ines iis saciid sisting ees EES 15 Appendix ET 17 pEF6 V5 His TOPO TA Cloning Control Reach iaa a pia ceo 17 Purifying PCR Prod ctS seisen e Moin aided eege er 20 Adding 3 A Overhangs Post Amplification EE 22 Bla Sti EE 23 Human EP To Dromoter ue 24 EF6 V5 His TOPO Vector nit A A pala daw Vea e aa Sachse 25 pEF6 V5 His LOBOS lacZ e AAA DAS NADA AA E It 27 pEF6 Vo His TOPOS EZ VEO a aia 27 Recipes aiii erg 28 Accessory Products e e eea e ea Ee e ae o Ea E EEE E EE E E E E E 30 Technical SUpport iia ee ee EE R aia EE AAE E AE A ERE A EEEE 32 Purchaser Notification caian paid 33 EE 35 Fast Start Introduction The procedure below is design
39. iol Chem 269 32678 32684 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic The Journal of Antibiotics Series A 11 1 5 Uetsuki T Naito A Nagata S and Kaziro Y 1989 Isolation and Characterization of the Human Chromosomal Gene for Polypeptide Chain Elongation Factor 1a J Biol Chem 264 5791 5798 Wieler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 2010 Life Technologies Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners 36 Notes Notes invitrogen by Lefe technologies Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F
40. iposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Goldman L A Cutrone E C Kotenko S V Krause C D and Langer J A 1996 Modifications of Vectors pEF BOS pcDNA1 and pcDNA3 Result in Improved Convenience and Expression BioTechniques 21 1013 1015 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Harlow E and Lane D 1988 Antibodies A Laboratory Manual Cold Spring Harbor NY Cold Spring Harbor Laboratory Innis M A Gelfand D H Sninsky J J and White T S 1990 PCR Protocols A Guide to Methods and Applications Academic Press San Diego CA Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exp Cell Res 197 229 233 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin S Deaminase Gene from Aspergillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Cells Biochim Biophys Acta 1219 653 659 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nuc Acids Res 15 8125 8148 Kozak M 1991 An Analysis of V
41. ise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts Place the tube at 37 C to keep the agarose melted Add 4 pL of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 7 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted Transform 2 to 4 uL directly into chemically competent One Shot TOP10 cells using the method on page 8 Note that cloning efficiency may decrease with purification of the PCR product Optimize your PCR to produce a single band see Producing PCR Products page 5 21 Adding 3 A Overhangs Post Amplification Introduction Materials Needed Procedure Note 22 Direct cloning of DNA amplified by Vent or Pfu polymerases into TOPO TA Cloning vectors is often difficult because of very low cloning efficiencies These low efficiencies are caused by the 3 to 5 exonuclease activity of proofreading polymerases which removes the 3 A overhangs necessary for TOPO TA Cloning Invitrogen has developed a simple method to clone these blunt ended fragments e Taq polymerase e A heat block equilibrated to 72 C e Phenol chloroform optional e 3M sodium acetate optional e 100 ethanol optional e 80 ethanol optional e TE buffer optional This is just one method for adding 3 adenines Other protocols may be suit
42. le Be sure that your insert does not contain the restriction enzyme site you wish to use to linearize your vector Enzyme Restriction Site bp Location Ssp I 3 Upstream of EF 1a promoter Aat II 121 Upstream of EF 1a promoter Bst1107 I 3 767 End of SV40 polyA Sap 1 4 030 Backbone Eam1105 I 5 039 Ampicillin gene Fsp 1 5 261 Ampicillin gene Sca I 5 519 Ampicillin gene Continued on next page 15 Creating Stable Cell Lines continued Selecting Stable Integrants Preparing the Cells for Lysis Lysing the Cells 16 After you have determined the appropriate concentration of blasticidin to use for selection generate a stable cell line expressing your pEF6 V5 His TOPO construct 1 Transfect mammalian cells with your pEF6 V5 His TOPO construct using the desired protocol Remember to include a plate of untransfected cells as a negative control 24 hours after transfection wash the cells and add fresh medium to the cells 48 hours after transfection split the cells into fresh medium containing blasticidin at the pre determined concentration required for your cell line Split the cells such that they are no more than 25 confluent If the cells are too dense the antibiotic will not kill the cells Antibiotics work best on actively dividing cells 4 Feed the cells with selective medium every 3 4 days until you can identify foci 5 Pick and expand at least 20 foci to test for expression o
43. ll line Typically concentrations between 2 ug mL and 10 pg mL of blasticidin are sufficient to kill the untransfected host cell line Test a range of concentrations see below to ensure that you determine the minimum concentration of blasticidin necessary to prevent the growth of your untransfected cell line Refer to the Appendix page 23 for instructions on how to prepare and store blasticidin 1 Plate or split a confluent plate so that the cells are approximately 25 confluent Prepare a set of 6 plates 2 The next day substitute the culture medium with medium containing varying concentrations of blasticidin e g 0 1 3 5 7 5 and 10 pg mL blasticidin 3 Replenish the selective medium every 3 4 days and observe the percentage of surviving cells 4 Count the number of viable cells at regular intervals to determine the appropriate concentration of blasticidin that prevents growth within 1 2 weeks after addition of the antibiotic To obtain stable transfectants you may choose to linearize your pEF6 V5 His TOPO construct before transfection While linearizing your vector may not improve the efficiency of transfection it increases the chances that the vector does not integrate in a way that disrupts the gene of interest or other elements required for expression in mammalian cells The table below lists unique sites that may be used to linearize your construct prior to transfection Other restriction sites are also possib
44. n and Transformation continued One Shot TOP10 Chemical Transformation Transformation by Electroporation Note 1 pl Gy Olt e 2 TO Add 2 pL of the TOPO Cloning reaction from Step 2 above into a vial of One Shot TOP10 Chemically Competent E coli and mix gently Do not mix by pipetting up and down Incubate the transformation mix on ice for 5 to 30 minutes Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 uL of room temperature SOC medium to the transformation mix Cap the tube tightly and shake it horizontally 200 rpm at 37 C for 1 hour Spread 10 50 pL from each transformation on a pre warmed selective plate and incubate the plates overnight at 37 C We recommend that you plate two different volumes to ensure that at least one plate has well spaced colonies An efficient TOPO Cloning reaction produces hundreds of colonies Pick 10 colonies for analysis see Analyzing Transformants next page Add 2 uL of the TOPO Cloning reaction into a 0 1 cm cuvette containing 50 uL of electrocompetent E coli and mix gently Do not mix by pipetting up and down Avoid forming bubbles Electroporate your samples using your own protocol and your electroporator If you have problems with arcing see Note below Immediately add 250 uL of room temperature SOC medium to the transformations Transfer the solution to a 15 mL snap cap tube i e Falcon and s
45. nd avoids DNA nicking and vector degradation We recommend using the PureLink HQ Mini Plasmid Purification or the PureLink HiPure Plasmid Miniprep kits for isolating pure plasmid DNA see page 30 for ordering information Refer to www invitrogen com or contact Technical Support page 32 for more information on a large selection of plasmid purification columns For established cell lines e g HeLa COS 1 consult the original references or the supplier of your cell line for the optimal method of transfection We recommend that you follow the protocol for your cell line exactly Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells For more information see Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wieler et al 1977 lipid mediated Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 Invitrogen offers a large selection of reagents for transfection for more information on the reagents available visit www invitrogen com or call Technical Support see page 32 The Lipofectamine 2000 reagent is a proprietary cationic lipid based formulation suitable for the transfection of nucleic acids into eukaryotic cells It is supplied with the MembranePro kits and is also available separately from Invitrogen see p
46. ng reactions to help you evaluate your results Performing the control reactions involves producing a control PCR product containing the lac promoter and the a fragment of P galactosidase using the reagents included in the kit Successful TOPO Cloning of the control PCR product yields blue colonies on LB agar plates containing ampicillin and X gal Prepare the following reagents before performing the control reaction e 40 mg mL X gal in dimethylformamide see page 28 for a recipe e LB plates containing 50 100 ug mL ampicillin and X gal 2 plates per transformation To add X gal to previously made agar plates warm the plate to 37 C Pipette 40 uL of 40 mg mL X Gal stock solution onto the plate Spread evenly and let dry 15 minutes Protect the plates from light 1 To produce the 500 bp control PCR product containing the lac promoter and LacZa set up the following 50 uL PCR Control DNA Template 50 ng Lut 10X PCR Buffer 5 pL 50 mM dNTPs 0 5 pL Control PCR Primers 0 1 ug L 1 pL Sterile Water 41 5 pL Tag Polymerase 1 unit uL Lu Total Volume 50 pL 3 Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2minutes 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 60 C 25X Extension 1 minute 72 C Final Extension 7minutes 72 C 1X 4 Remove 10 pL from the reaction and analyze it by agarose gel electrophoresis A discrete 500 bp band should be
47. nies found on the Vector PCR Insert plate pUC19 plasmid is included to check the transformation efficiency of the One Shot competent cells Transform one vial of One Shot TOP10 cells with 10 pg of pUC19 DNA using the protocol on page 8 Plate 10 uL of the transformation mixture plus 20 pL SOC on LB plates containing 50 100 pg mL ampicillin Transformation efficiency should be 1 x 10 cfu yg DNA Continued on next page pEF6 V5 His TOPO TA Cloning Control Reactions continued Factors Affecting Lower transformation and or cloning efficiencies result from the following Cloning Efficiency variables Most of these are easily corrected but if you are cloning large inserts you may not obtain the expected 90 or more cloning efficiency Variable Solution pH gt 9 in PCR amplification reaction Check the pH of the PCR amplification reaction and adjust with 1 M Tris HCI pH 8 Incomplete extension during PCR Be sure to include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Cloning large inserts gt 3 kb Increase amount of insert Or gel purify as described on pages 20 21 Excess or overly dilute PCR product Reduce or concentrate the amount of PCR product Note You may use up to 4 uL of your PCR reaction in a TOPO Cloning reaction Cloning blunt ended fragments Add 3 A overhangs by incubating with Tag pol
48. nk HQ Mini Plasmid Purification or PureLink HiPure Plasmid Miniprep kits see page 30 for ordering information 3 Analyze the plasmids by restriction analysis or by sequencing The T7 Promoter and BGH Reverse sequencing primers are included to help you sequence your insert Refer to the diagram on page 4 for the sequence surrounding the TOPO Cloning site For the complete sequence of the vector visit www invitrogen com or contact Technical Support see page 32 After you have identified the correct clone purify the colony and make a glycerol stock for long term storage Keep a DNA stock of your plasmid at 20 C 1 Streak the original colony out on an LB agar plate containing 50 100 pg mL ampicillin Incubate the plate at 37 C overnight Isolate a single colony and inoculate into 1 2 mL of LB containing 50 100 pg mL ampicillin Grow the cells until the culture reaches stationary phase ODeo 1 2 Mix 0 85 mL of the culture with 0 15 mL of sterile glycerol and transfer the mix to a cryovial Store the glycerol stocks at 80C Kit Contents Shipping Storage pEF6 V5 His TOPO TA Cloning Reagents vi The pEF6 V5 His TOPO TA Expression Kit is shipped on dry ice Each kit contains a box with pEF6 V5 His TOPO TA Cloning reagents Box 1 and a box with One Shot TOP10 chemically competent cells Box 2 Store Box 1 at 20 C and Box 2 at 80 C pEF6 V5 His TOPO TA Cloning reagents Box 1
49. nutes at room temperature Note See page 11 for additional information on optimizing the TOPO Cloning reaction for your needs Reagent Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5 to 4 uL 0 5 to 4 pL Salt Solution Lut Dilute Salt Solution Lut Sterile Water to a final volume of 5 uL to a final volume of 5 pL TOPO vector 1 pL 1 pL Store all reagents at 20 C when finished Store the salt solutions and water at room temperature or 4 C 2 Place the reaction on ice and proceed to Transformation next page Note You may store the TOPO Cloning reaction at 20 C overnight Continued on next page Fast Start continued Transformation Analyzing Positive Clones Long Term Storage 1 Add 2 uL of each TOPO Cloning reaction to a separate tube of competent cells 40 50 uL and transform using your method of choice see page 8 2 Spread 10 50 uL from each transformation on a pre warmed selective plate and incubate the plates overnight at 37 C We recommend that you plate two different volumes to ensure that at least one plate has well spaced colonies 3 Proceed to Analyzing Positive Clones below 1 Pick 10 colonies and culture them overnight in LB medium containing 50 pg mL ampicillin 2 Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend using Invitrogen s PureLi
50. roduct for purposes other than and the Blasticidin research contact Licensing Department Life Technologies Corporation 5791 Selection Marker Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Limited Use Label EF 1lalpha promoter products are sold under license for research purposes only License The use of this product for any commercial purpose including but not limited No 60 EF 1alpha to use in any study for the purpose of a filing of a new drug application Promoter requires a license from Mochida Pharmaceutical Co Ltd 7 Yotsuya 1 Chome Shinjuku Ku Tokyo 160 Japan Tel 81 3 3225 5451 Fax 81 3 3225 6091 34 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Brownstein M J Carpten J D and Smith J R 1996 Modulation of Non Templated Nucleotide Addition by Taq DNA Polymerase Primer Modifications that Facilitate Genotyping BioTechniques 20 1004 1010 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nuc Acids Res 15 1311 1326 Felgner P L Holm M and Chan H 1989 Cationic L
51. set up your TOPO Cloning reaction 6 uL for eventual transformation into chemically competent TOP10 One Shot E coli provided or electrocompetent E coli See page 11 for additional information on optimizing the TOPO Cloning reaction for your needs Note The red or yellow color of the TOPO vector solution is normal and is used to visualize the solution Reagent Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5 to 4 uL 0 5 to 4 pL Salt Solution Lut Dilute Salt Solution Lut Sterile Water to a final volume of 5 pL to a final volume of 5 pL TOPO vector 1 pL 1 pL Store all reagents at 20 C when finished Store the salt solutions and water at room temperature or 4 C 1 Mix reaction gently and incubate for 5 minutes at room temperature Note For most applications 5 minutes yields plenty of colonies for analysis Depending on your needs you can vary the length of the TOPO Cloning reaction from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time yields more colonies 2 Place the reaction on ice and proceed to One Shot Chemical Transformation or Transformation by Electroporation next page Note You may store the TOPO Cloning reaction at 20 C overnight Continued on next page TOPO Cloning Reactio
52. the presence and orientation of the insert in pEF6 V5 His TOPO You may use the T7 Promoter and BGH Reverse sequencing primers supplied in the kit to sequence across an insert in the TOPO Cloning site to confirm that your insert is fused in frame with the C terminal peptide Refer to page 5 for the location and sequence of the priming sites Pick 10 colonies and culture them overnight in LB medium containing 50 pg mL ampicillin Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend using Invitrogen s PureLink HQ Mini Plasmid Purification or PureLink HiPure Plasmid Miniprep kits see page 30 for ordering information Refer to www invitrogen com or contact Technical Support for more information on a large selection of plasmid purification columns Analyze the plasmids by restriction analysis or by sequencing The T7 Promoter and BGH Reverse sequencing primers are included to help you sequence your insert Refer to the diagram on page 4 for the sequence surrounding the TOPO Cloning site For the complete sequence of the vector visit www invitrogen com or contact Technical Support see page 32 If you have problems obtaining transformants or the correct insert perform the control reactions to troubleshoot your experiment see pages 17 18 Continued on next page Analyzing Transformants continued Alternative Method of Analysis Long
53. utes at 15 psi 3 After autoclaving cool the medium to 55 C add antibiotic 50 100 pg mL ampicillin and pour into 10 cm plates 4 Let the agar harden then invert the plates and store them at 4 C in the dark 1 To make a 40 mg mL stock solution dissolve 400 mg X Gal in 10 mL of dimethylformamide Protect the X Gal solution from light by storing it in a brown bottle at 20 C 2 To add X Gal to previously made agar plates warm the plate to 37 C Pipette 40 pL of the 40 mg mL X Gal stock solution onto the plate spread it evenly and let it dry for 15 minutes Protect the plates from light Continued on next page Recipes continued Cell Lysis Buffer 50 mM Tris 150 mM NaCl 1 Nonidet P 40 pH7 8 1 You can prepare this solution from the following common stock solutions For 100 mL combine 1 M Tris base 5 mL 5 M NaCl 3 mL Nonidet P 40 1 mL 2 Bring the volume of the solution up to 90 mL with deionized water and adjust the pH to 7 8 with HCl 3 Bring the volume of the solution up to 100 mL Store the solution at room temperature Note You may add protease inhibitors to the Cell Lysis Buffer at the following concentrations 1 mM PMSF 1 pg mL pepstatin 1 pg mL leupeptin 29 Accessory Products Additional A number of products included with the pEF6 V5 His TOPO TA Expression Products Kit as well as other reagents that may be used with the kit are available separately from Invitrogen S
54. utic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicensing lifetech com Continued on next page 33 Purchaser Notification continued Limited Use Label This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and License foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or No 22 Vectors Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in and Clones research Information about licenses for commercial use is available from Encoding QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany Histidine Hexamer Limited Use Label Blasticidin and the blasticidin resistance gene bsd are the subject of U S Patent License No 5 527 701 sold under patent license for research purposes only For No 51 Blasticidin information on purchasing a license to this p
55. ymerase page 22 PCR cloning artifacts false positives TOPO Cloning is very efficient for small fragments lt 100 bp present in certain PCR reactions Gel purify your PCR product pages 20 21 or optimize your PCR PCR product does not contain sufficient 3 A overhangs even though you used Taq polymerase Taq polymerase is less efficient at adding a nontemplate 3 A next to another A Tag is most efficient at adding a nontemplate 3 A next to a C You may have to redesign your primers so that they contain a 5 G instead of a 5 T Brownstein et al 1996 Do not use a 2 step cycling program denaturation and annealing only to produce PCR products Use only a 3 step cycling program denaturation annealing and extension Taq polymerase is more likely to add nontemplate 3 A residues in a 3 step cycling program than in a 2 step cycling program 19 Purifying PCR Products Introduction Using the PureLink Quick Gel Extraction Kit 20 Smearing multiple banding primer dimer artifacts or large PCR products gt 1 kb may necessitate gel purification If you intend to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Two simple protocols are provide
Download Pdf Manuals
Related Search