Home

Illumina VariantStudio User Guide

1. 20 Somatic VCF Fields Reported in the Variants Table 21 lt sf TL pe Le lt P no VariantStudio v2 2 Software User Guide 1 JOJACUD Getting Started Introduction The VariantStudio software imports SNPs and indels reported in VCF v4 0 and later file formats After import VariantStudio provides commands to annotate variants filter results using filtering options and export data to a report Figure 1 VariantStudio Workflow Create a project or open an existing project Import SNPs and indels reported in VCF 4 0 or later file formats Import one sample or multiple samples to a single project Annotate variants for the current sample An internet connection is Ft required to annotate variants Annotate Y Filter data based on any combination of filtering options Save filter combinations for use in other projects Classify variants according to their biological impact LA Apply Classifications D Generate a sample report using a customized report template LE Export data and filtering history to text files Export data to a Sample histogram or pie chart Report System Requirements Installing the VariantStudio software requires the following system specifications 64 bit Windows OS Windows 7 or later 2 GB RAM minimum 4 GB RAM recommended 25 MB hard drive space for installation Internet connection req
2. 1 t a r 3 AE Re PRG QE me y An AA Wa s reat Seer Tam e ARA YA pa CGGCATEAreGAGTCETCA gt ATA gt PRPS GGGTGSS aa ac e AS 7 pe se til VariantStudio v2 2 Software User Guide D 5 y J19S1deyo Generating Reports Introduction VariantStudio provides tools to export results from a project to an external report Use the commands on the Reports tab to create a sample report and to export data to text files and graphical representations Figure 33 Reports Tab Home Annotation amp Classification Reports Help a l 1 amp In e Sample Manage Filtered All Transcripts Filter Histogram Pie Chart Report Templates Variants for Variants History Reports Export Charts 5 6 Part 15040890 Rev E Sample Report Overview The sample report consists of five sections plus a footer and is generated as a PDF file or RTF file depending on your preference A sample report includes the following sections Lab information Typically this section is defined in the template and appears as a header in the sample report Sample information This section contains details about the sample and appears as a two column table in the sample report The first column contains the field name and the second column contains the value There are two ways to populate this section of the report Specify field names using the Manage Templates feature and then manually enter the value in
3. Click and drag your mouse to slide the view from end to end Use the scrolling feature on your mouse to zoom in and zoom out Menus and Commands VariantStudio commands are arranged in the following four tabs Home tab Contains commands for saving projects importing data managing favorite filters and changing layout options For more information see the following sections Import Variant Call Files on page 9 Modify Table Views on page 17 Create Favorite Filters on page 53 Annotation and Classification Contains commands to annotate variants and apply classifications For more information see Annotate Variants on page 24 Reports tab Contains commands for exporting results to reports For more information see Introduction on page 56 Help tab Contains information about the software version and a link to online help An internet connection is required to access the help files VariantStudio v2 2 Software User Guide 298 9 U S4EMIJOS OIPNISIUBIIBA Getting Started Create or Open a Project The Project menu includes commands to create open save and name projects Figure 7 Project Menu Commands Home Annotation amp Classification a Ly L Eon New ab Close Save Save As Project Command Description New Creates a project Starting a new project closes the current project If you have not yet saved changes to the current project a reminder to save your changes appears Open Opens a project
4. Show variants with annotation Show variants without annotation Show variants that contain in Custom in Custom2 in Custom3 in Custom Custom filters enable filtering based on input provided in the custom annotations input file For more information Filter Name Do not filter on custom annotation Show variants with annotation Show variants without annotation Show variants that contain Classification Filter Classification Y Filter by classification Benign Presumed Benign Presumed Pathogenic Pathogenic Unknown Significance Use the classification filter to filter by classifications assigned in the classification database see Create Custom Annotations on page 27 Setting Description Turns off custom annotations This setting is on by default Filters data to show variants that match criteria provided in the custom annotations input file with an assigned annotation value in the annotations column Filters data to show variants that match criteria provided in the custom annotations input file without an assigned annotation value in the annotations column Filters data to show variants that match criteria provided in the custom annotation input file Options include annotations from any of the four possible annotation columns Any customized classifications appear in the classification filters list 1 Select the Filter by classification checkbox VariantStudio v2 2 Softw
5. Variant Filters Pass Filter FJ Quality gt Read Depth gt 0 Alt Variant Freq gt 0 E Show only variants Inside genes In conserved regions Only variants without dbSNP ID Only variants with Cosmic annotation where matches mutant allele where not matches mutant allele E Only variants with ClinVar annotation where matches mutant allele where not matches mutant allele O Part 15040890 Rev E Use the Variant filters to filter by variant call attributes variant positions and variants with specific annotation Filter Name Variant Call Show only variants Only variants with Gene Filters Gene Disease Include List Exclude List Min Variant Alleles 2 FP where custom gene annotation contains AND OR where optional gene annotation contains Setting Description Filters data based on a specified value for variant call quality pass filter quality score read depth or percentage of variant frequency for the minor allele Select the checkbox and then use the up down arrows to specify a minimum threshold Filters data based on variant position Options include inside genes and in conserved regions Filters data based on the source of annotation Options include variants without dbSNP ID with COSMIC annotation and with ClinVar annotation COSMIC and ClinVar annotation enable two more choices e If where matches mutant all
6. Not present in somatic VCF files e Acceptable GT values are 0 0 0 1 and 1 1 Non numeric GT values or as in a no call are not imported e Hemizygous alt GT values 1 are accepted Hemizygous reference calls 0 are not imported e If FORMAT and Sample are not empty then a GT value is required e IF FORMAT and Sample are empty the software assumes that GT is heterozygous 0 1 Genome VCF Files Importing genome VCF gVCF files is supported as of VariantStudio v2 1 for targeted enrichment data Using gVCF is not recommended for whole genomes without pre processing with gV CF tools Alternatively you can load only exonic regions or only regions from a gene list or BED file without the need for pre processing For more information see VCF Import Options on page 9 A Part 15040890 Rev E VariantStudio Software Interface When the VariantStudio software launches the interface opens with a Start menu on the left panel Figure 2 Start Menu Start Project Mew Project Open Project Recent Cancer 12878a Click New Project The VariantStudio interface opens to a blank project Click Open Project and browse to an existing project Project names use the vbp file extension If recent projects are listed click a project name from the list 298 19 U S4EMIJOS OIPNISIUBIIBA Interface Commands The VariantStudio interface is an interactive view of genes and variants in a selected sample Us
7. Part 15040890 Rev E Create Custom Annotations Applying custom annotations requires a tab delimited input file with a txt extension One input file is required for variant level annotations and one for gene level annotations NOTE VariantStudio assumes that all annotations are expressed in the genomic coordinates on the positive strand including any custom annotations that are imported into VariantStudio Input File for Custom Variant Annotations The input file for custom variant annotations requires five columns Chr Position Ref Variant and Annotation as shown in the following example Chr Position Ref Variant Annotation 1 11046855 G T Good 1 11046909 A T Bad 1 14096821 T C Confirmed Chr The chromosome for the variant 1 22 X Y or M Position The genomic coordinate of the variant on the chromosome 1 based Ref The reference base or bases for an insert or deletion at the specified position Variant The base or bases for an insert or deletion at the specified position Annotation The value assigned to a variant with matching values for chr position ref and variant Optional Three additional annotation columns are recognized input for custom variant annotations Use the headings Annotation2 Annotation3 and Annotation4 NOTE The Ref field and Variant field must be expressed in VCF format where indels contain the preceding base in common between the reference and variant allele For more inf
8. This section is reserved for a description of the methodology specific to the report Set up preferred content and formatting in the template Add information specific to the report when you create the report References This section is reserved for references applicable to the contents of the report Page footer Typically this section is defined in the template For example the footer can contain the facility address and contact information or it can be blank VariantStudio v2 2 Software User Guide D MeIAI9AQO od y ejdues Generating Reports 08 Create aSample Report Template Use the Manage Templates feature to create a customized template for sample reports After templates are created use Manage Templates to duplicate edit rename or delete templates in the template library VariantStudio includes an example report template to help in creating a template The example report template cannot be edited Instead create a copy of the example report template From this copy rename the template and customize each section of the template using the template tabs Click Manage Templates The Manage Report Templates window opens Figure 35 Manage Report Templates Window ee Manage Report Templates Report Template Template Data Sample Info Lab Information Test Summary Methodology References Page Footer Classifications Sample ID Sample Type Sample Collection Date tec Date Reported
9. verifi VeriSeq the pumpkin orange color and the streaming bases design are trademarks of Illumina Inc and or its affiliate s in the U S and or other countries All other names logos and other trademarks are the property of their respective owners Read Before Using this Product This Product and its use and disposition is subject to the following terms and conditions If Purchaser does not agree to these terms and conditions then Purchaser is not authorized by Illumina to use this Product and Purchaser must not use this Product 1 Definitions Application Specific IP means Illumina owned or controlled intellectual property rights that pertain to this Product and use thereof only with regard to specific field s or specific application s Application Specific IP excludes all lumina owned or controlled intellectual property that cover aspects or features of this Product or use thereof that are common to this Product in all possible applications and all possible fields of use the Core IP Application Specific IP and Core IP are separate non overlapping subsets of all lumina owned or controlled intellectual property By way of non limiting example Illumina intellectual property rights for specific diagnostic methods for specific forensic methods or for specific nucleic acid biomarkers sequences or combinations of biomarkers or sequences are examples of Application Specific IP Consumable s means lumina branded reagents and con
10. Allele is 0 and the Alt Allele is 12 Alt Read Depth is listed as 12 For somatic VCF files allele frequency is calculated from values in the VCF file before data are reported in the Variants table e For SNVs Using only the first values for AU CU GU TU allele frequency is calculated as alt allelic depth alt allelic depth ref allelic depth 100 In the example 0 0 0 0 10 10 3 4 Alt Variant Freq is 23 08 by calculating 3 3 10 100 e For indels Using only the first values for TAR and TIR allele frequency is calculated as TIR TIR TAR 100 In the example 0 0 12 12 Alt Variant Freq is 100 by calculating 12 12 0 100 Based on values listed in the INFO column If SOMATIC is listed in the INFO column the genotype is listed as somatic som in the Variants table 21 SIUBUBA 9y Ul peyodex Sp 814 JO A 91EUI0S Variants Table Column Heading VCE File Column or Field Description Quality Quality is based on different values for SNVs and indels e For SNVs Quality is based on the OSS NT field in the INFO column This score represents the probability that the SNV exists and is somatic e For indels Quality is based on the OSI NT field in the INFO column This score represents the probability that the indel exists and is somatic Getting Started Read Depth For SNVs and indels Read Depth is extracted from values listed for DP in the FORMAT column of the cancer sample 2 2 Part 15040890 Rev E Applyi
11. Custom Annotation 3 Custom Annotation 4 and Custom Gene Annotation Show ClinVar Shows and hides ClinVar RS ClinVar Ref ClinVar Alleles ClinVar Significance ClinVar Disease Name ClinVar Accession ClinVar MedGen ClinVar OMIM ClinVar Orphanet ClinVar Gene Reviews and ClinVar SnoMedCt ID Show COSMIC Shows and hides COSMIC ID COSMIC Wildtype COSMIC Allele COSMIC Gene COSMIC Primary Site and COSMIC Histology Set Table Options Figure 11 Table Options Menu Select All CH Copy A Smaller A Larger Column Order Table Options The Table Options menu includes the following commands Select All which selects all rows in a table Part 15040890 Rev E Copy which copies selected data to the clipboard Smaller and Larger which changes text size in a table Column Order which includes commands to change table layout From the Table Options menu click Column Order to open the Table Column Display window From this window drag and drop column headings to specify table layout 1 To show or hide columns drag and drop column headings from the Displayed Columns list to the Hidden Columns list 2 To prevent selected columns from scrolling horizontally drag and drop column headings from the Scrolling list to the Fixed list 3 Click OK when you are finished 4 To save this layout for use in other VariantStudio projects click Save As Default from the Layout menu In the following example the Ge
12. EXTENT PERMITTED BY LAW AND SUBJECT TO THE EXPRESS PRODUCT WARRANTY MADE HEREIN ILLUMINA MAKES NO AND EXPRESSLY DISCLAIMS ALL WARRANTIES EXPRESS IMPLIED OR STATUTORY WITH RESPECT TO THIS PRODUCT INCLUDING WITHOUT LIMITATION ANY IMPLIED WARRANTY OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE NONINFRINGEMENT OR ARISING FROM COURSE OF PERFORMANCE DEALING USAGE OR TRADE WITHOUT LIMITING THE GENERALITY OF THE FOREGOING ILLUMINA MAKES NO CLAIM REPRESENTATION OR WARRANTY OF ANY KIND AS TO THE UTILITY OF THIS PRODUCT FOR PURCHASER S INTENDED USES 8 Product Warranty All warranties are personal to the Purchaser and may not be transferred or assigned to a third party including an affiliate of Purchaser All warranties are facility specific and do not transfer if the Product is moved to another facility of Purchaser unless Illumina conducts such move a Warranty for Consumables lumina warrants that Consumables other than custom Consumables will conform to their Specifications until the later of i 3 months from the date of shipment from Illumina and ii any expiration date or the end of the shelf life pre printed on such Consumable by Illumina but in no event later than 12 months from the date of shipment With respect to custom Consumables i e Consumables made to specifications or designs made by Purchaser or provided to lumina by or on behalf of Purchaser lumina only warrants that the custom Consumables will be made and test
13. Novo Mutation Workflow Proband Subtract All variants that are heterozygous 0 1 or homozygous 1 1 in the mother father and unaffected siblings AA Filtering results Deleterious variants VariantStudio v2 2 Software User Guide D SMOIHIONA BUI3 14 peseg Ajiwe Applying Filters Autosomal Dominant Transmission Workflow gt A variant is heterozygous 0 1 in the affected parent The variant is not present 0 0 in the unaffected parent The variant is heterozygous 0 1 in the affected children Figure 30 Autosomal Dominant Transmission Logic Il Il 0 1 0 0 UI LL 0 1 0 1 0 0 0 0 gt _ Unaffected reference gt Unaffected carrier gt M Affected Mutation Autosomal Dominant Transmission Workflow Proband Y Subtract All variants that are heterozygous 0 1 in unaffected parent or siblings Subtract All variants that are not heterozygous 0 1 in affected parent or siblings hd Filtering results Deleterious variants 5 2 Part 15040890 Rev E Create Favorite Filters To save any combination of filtering options for use with a different sample or for later use in another project save the filtering options as a favorite filter The Filter Favorites menu includes commands to save apply modify and manage saved filters Save a Favorite Filter 1 2 3 Apply a Favorite Filter 1 2 3 VariantStudio v2 2 Software User Guide Figure 31 Filter Fav
14. Shows a graphical representation of the selected gene F Table views View of data shown in the Variants table Genes table and No Call Regions table Use the table tabs to toggle between table views VariantStudio v2 2 Software User Guide 5 Getting Started Filters Pane The Filters pane provides various filtering options to narrow results to your area of interest Combine any number of filtering options from the filter categories and click Apply Filters Filters are applied to the current sample only notto all samples that are imported into the project To clear filters click Clear Filters For more information see Apply Filters on page 38 Figure4 Filters Pane Filters General Variant Gene Consequence Population Frequency Cross Sample Subtraction Family Based Custom Classification Apply Filters gt Clear Filters Filter History The Filter History pane shows filters that have been applied to the samples in this project Filters can be a single filter a combination of filters or a saved filter from the favorite filter list Figure 5 Filter History Pane Filter History Num Genes Num Variants Filter Name Filter 447 1969 Untitled 0 260 665 Untitled AlleleFreg lt 17 61 81 Untitled AlleleFreq lt 17 AND Splice OR Inframe_Insertion OR Stop Lost OR Inframe_Deletion OR Initiator_Codon OR Stop_Gained OR Frameshift OR Missense Column Heading Descripti
15. The Example Template may not be modified Please duplicate it to use it as the basis for a new template New Duplicate Revert Make Default Current Default Lab Name Template 1 Done Do one of the following Highlight Example Template in the Report Template field and click Duplicate and enter a template name Click OK To create a template without using the example template click New and enter a template name Click OK To edit an existing template click to highlight the template name in the Report Template list This template is now the active template and ready for editing For each of the following tabs enter the information to be included in reports using this template Use the formatting tools to customize the layout Information included in the following sections of the template are editable when creating the sample report Sample Info tab Specify the sample fields to include in the report Each field name generates a row in the sample information table Lab Information tab Enter the lab name and location or other preferred information for the report header Test Summary tab Enter preferred introductory content to begin this section Otherwise leave this section blank in the template Methodology tab Similar to Test Summary enter preferred introductory content to begin this section Otherwise leave this section blank in the template References tab Simila
16. external classifications file For more information see Import Classifications on page 35 Figure 21 View Classification Database Variant Classification Database Entries Database Path C ProgramData Illumina llumina YariantS tudio ClassificationD b bin Import Classifications Chr Position Ref Variant Classification Report Fragmer 877831 T 981931 4 1147422 C 1254841 C 3352784 3354615 T 3697663 C 13036587 C 131220864 T 4 Recordiof31 WOW Y x 4 Pathogenic Benign Notes For report Pathogenic Pathogenic Unknown Signific Disease Causing Benign Benign Pa aA aA Al AAN Presumed Patho a Ne nm ne nm ne ne RA 2 Add or Remove Classification Categories Click Classification Settings to add remove or rename classification categories Add In the Add Category field enter a new category name Click Add Remove Select a category from the list Click Remove Rename Select a category from the list Click Rename and enter a new name Figure 22 Classifications Options Dialog Box Llassitl on fons Classification Categories Benign Presumed Benign Add Category Presumed Pathogenic Pathogenic Unknown Significance New category Remove OK Cancel VariantStudio v2 2 Software User Guide 3 3 Suoljeoiisse y ebeuel Applying Annotations and Classifications Classification Database Location By default the classification database is saved loca
17. in the Current Sample field of the Samples menu e Exonic Variants of Current Sample Annotates variants found within an exon plus 20 bp on either side of the exonic region to include the annotation of splice site variants e Selected Variants of Current Sample Annotates only the variants that you have selected or filtered e All Samples Annotates all variants within each sample imported into the project This process can take time to complete depending on the number of samples in the project Opens a window to browse to the location of the custom annotations file for variant level annotation For more information see Input File for Custom Variant Annotations on page 27 Opens a window to browse to the location of the custom annotations file for gene level annotation For more information see Input File for Custom Gene Annotations on page 27 Opens a window that lists the default transcript for each gene and options for changing to other than the default transcript Although mitochondrial variants can be imported the annotation database does not provide annotations for these variants 24 Part 15040890 Rev E Annotation Options From the Annotate menu click Annotation Options The Annotation Options form opens with options to annotate only certain variants Figure 14 Variant Option Form Annotation Options gt Include Intronic Transcript Source Type Ref Seq This option can be ch
18. other is the cancer sample All reported values are specific to the cancer sample The following table lists the VCF fields that are unique to somatic VCF files Variants Table Column Heading Allelic Depth Alt Read Depth Alt Variant Freq Genotype VariantStudio v2 2 Software User Guide VCF File Column or Field Description Based on values in the FORMAT column Allelic Depth is calculated differently for SNVs and indels e For SNVs Based on four values listed as AU CU GU TU in the FORMAT column These values are listed as two numbers each separated by a comma and represent each possible allele in the cancer sample The Allelic depth column is populated with the full set of numbers 0 0 0 0 10 10 3 4 e For indels Two values listed as TAR TIR in the FORMAT column represent the Ref Allele and Alt Allele respectively Only the first number in each value is used In the example 0 0 12 12 the Ref Allele is 0 and the Alt Allele is 12 Allelic Depth is listed as 0 12 Based on values in the FORMAT column Alt Read Depth is calculated differently for SNVs and indels e For SNVs Based on the first value from the appropriate Allelic Depth AU CU GU TU In the example 0 0 0 0 10 10 3 4 the values are 10 10 for GU and 3 4 for TU If the Ref Allele is G and the Alt Allele is T the Alt Read Depth is 3 e For indels Based on the first value from the appropriate Allelic Depth TAR TIR In the example 0 0 12 12 the Ref
19. selected template Click Preview to preview the report before generating it Click Export to PDF or Export to RTF to generate the report To save the report contents without generating the report click Done Part 15040890 Rev E Export Text Files and Charts In addition to sample reports VariantStudio provides tools for exporting to text files and graphical representations of data Export Data Files Exporting filtered variants and all transcripts for variants generates a tab separated values file Exporting filter history generates a comma separated values CSV file These text file formats are not application specific and can be opened in any text editor The ANT file is a binary file that contains Command Description Filtered Variants Exports filtered variants from the current sample ISV For variants that overlap multiple genes only the transcripts that appear on the interface are exported All Transcripts for Exports all transcripts for filtered variants in the sample Variants TSV Filter History CSV Exports a report of all filters applied to the project Export Charts From the Charts menu select a preferred format to export results in a histogram or a pie chart Command Description Histogram Generates a histogram of filtered results from the Variants table e Use the Plot drop down list on the generated histogram Figure 38 to represent variant quality values or indel variant length e Use Data Source op
20. services not supplied by Illumina iv the use of this Product to perform any assay or other process not supplied by Illumina or v lumina s compliance with specifications or instructions for this Product furnished by or on behalf of Purchaser each of i v is referred to as an Excluded Claim Indemnification by Purchaser Purchaser shall defend indemnify and hold harmless Illumina its affiliates their non affiliate collaborators and development partners that contributed to the development of this Product and their respective officers directors representatives and employees against any claims liabilities damages fines penalties causes of action and losses of any and every kind including without limitation personal injury or death claims and infringement of a third party s intellectual property rights resulting from relating to or arising out of i Purchaser s breach of any of these terms and conditions ii Purchaser s use of this Product outside of the scope of research use purposes iii any use of this Product not in accordance with this Product s Specifications or Documentation or iv any Excluded Claim Conditions to Indemnification Obligations The parties indemnification obligations are conditioned upon the party seeking indemnification i promptly notifying the other party in writing of such claim or action ii giving the other party exclusive control and authority over the defense and settlement of such cla
21. the number of bases or padding to include on both sides of the exon Select the radio button and click Browse to navigate to the location of a gene list file A gene list file must be a text file with a txt file extension that lists one gene per line Select the radio button and click Browse to navigate to the location of the BED file This setting applies to gVCF files Select the checkbox to import all homozygous reference positions 0 0 Clear the checkbox to omit homozygous reference positions from the import Part 15040890 Rev E Data in VariantStudio Tables Imported and annotated information for the visible sample is arranged in three tables on the VariantStudio interface Variants table Genes table and No Call Regions table Use the tabs below the table area to navigate between tables Figure 10 Navigation Tabs for Variants Table Genes Table and No Call Regions Table Chr Coordinate Type Genotype Exonic Filters Quality GOK pa 69270 snv 69270 snv 69511 snv 69511 snv 69897 snv 69897 snv 1 1 1 1 1 1 335538 SAMD 11 NOC2L G gt A A SAMD 11 NOC2L G gt A A M4 44 4 Variant 7 of 98192 Y Show Population Frequencies V Show Transcript Info Y Show Custom Annotations V Show ClinVar Y Show Cosmic ggg Variants Table The Variants table lists the genes that overlap variants identified in the selected sample Each row of the table contains the gene and reported variant Genes that inclu
22. the text fields Import sample information from an external text file The text file must have two tab delimited or comma separated columns one for the field name and one for the field value and use a txt csv or tsv extension Test summary This section is reserved for a description of the test performed Set up preferred content and formatting in the template Add information specific to the report when you create the report Results This section lists variants in the open project that have a classification assigned This section is blank if the project does not contain assigned classifications Results are formatted in a four column table with headings of Gene Variant Classification and Details Information in the Details column comes from the Report Fragment field in the classification database Figure 34 Example of a Results Section Gene Variant Classification Details G NM_000064 2 c 941C gt T Benign GHRHR NM_000823 3 c 169G gt A Benign GHRHR NM_000823 3 c 363G gt T Benign ABCC9 NM_020297 2 c 1165 6delT Presumed Benign es NM_000064 2 c 304C gt G Presumed Benign APOE NM_000041 2 c 388T gt C Pathogenic CASP10 NM_032977 3 c 1228G gt A Pathogenic CLCN1 NM_000083 2 c 2680C gt T Pathogenic NCF1 NM_000265 4 c 73_74delGT Pathogenic POLG NM_002693 2 c 1399G gt A Pathogenic SLC4A1 NM_000342 3 c 166A gt G Pathogenic BCHE NM_000055 2 c 1699G gt A Unknown Significance MEFV NM_000243 2 c 1772T gt C Unknown Significance Methodology
23. 16 Classification Menu Apply Classifications View Classification Classification from Database Database Settings Classification Command Description Apply Classifications Use this command to apply classifications to any variants in the from Database current sample that are listed in the classification database For more information see Apply Classifications from Database on page 30 View Classification Use this command to open the classification database edit entries in Database the database or import classifications from an external file For more information see View Classifications Database on page 33 Classification Settings VariantStudio provides five classifications Benign Presumed Benign Presumed Pathogenic Pathogenic and Unknown Significance Use this command to add or remove classification categories For more information see Add or Remove Classification Categories on page 33 Variant classifications can be changed at any time in the classification database or changed locally in the current project without changing database entries For more information see Edit Variant Classifications on page 31 By default the classification database is saved locally for use with any VariantStudio project that is opened locally For more information see Classification Database Location on page 34 A backup of the classification database is created with the first change of each day For more information see Classification Datab
24. 2 Num Transcripts Transcript Description The genotype which is either heterozygous het homozygous hom or somatic som A variant found within a coding region 20 bp on both sides of the coding region The status of the variant call quality as annotated in the VCF file PASS indicates that all filters were passed otherwise the variant call filter is listed The filter listed and threshold for passing filter depends on the method used to generate the VCF file The numeric value of variant call quality as written to the QUAL column of the VCF file Determination of variant quality depends on the variant caller The conservative measure of genotype quality derived from the minimum of the GO and QUAL values listed in the VCF file This field is not populated for somatic VCF files For more information see Somatic VCF Fields Reported in the Variants Table on page 21 The inherited source of the variant Possible values are father mother both indeterminate or ambiguous If the variant is heterozygous in the father mother and child a variant is listed as ambiguous If the variant is homozygous in the child and heterozygous in both parents a variant is listed as both If the inheritance of the variant cannot be determined from the other VCEs the variant is listed as indeterminate Entries in this column are meaningful only when the family based filter is applied The frequency of the Alt Allele The to
25. 800 911850 Switzerland 0800 563118 Germany 0800 180 8994 United Kingdom 0800 917 0041 Ireland 1 800 812949 Other countries 44 1799 534000 Safety Data Sheets Safety data sheets SDSs are available on the Illumina website at support illumina com sds ilmn Product Documentation Product documentation in PDF is available for download from the Illumina website Go to support illumina com select a product then click Documentation amp Literature VariantStudio v2 2 Software User Guide 6 Q 9oue sissy BOIUU98 AA eA TT aaae O a RAA TALIRI TAALA a AI aA oan nr i 1 n Tes cu air re n ajg k r LS RTE i r MARERA oS ue Tue WA TE WA aunt ABATIAGT TANTEA ae pcan ita Annee wanya Nae ATTRACT Te WA AGT AE E TOTES TAA 1 joe aus EAA Lau ce TEARI AATUN aeran ina SAATI ate A Ai eee a ee Re re r WA STALCGTAAL ge i el fie ACT ju r LAA ae saat Fe A KAMTA AT PTAC ITALIA et nr ARC La ea a au La ee ee TESI Ti ria a an TA alee a te Gi TEON sheet BA WA LA les AA Ah reat an maal AN an a o WA sha LA LEP TA ANGA The FT Tone at Lu Y 7 ATi GTAA WA AAA TAL MER a Is air AZA SES Ru en DUT at Sarr aon Fe TAG RTE MIT manaa ee ATTA a creat Fate Pat taa TA Tr A Tae al feat shah RATE EN Boyer hh iti ca us LE LEE ss a Pel EEND fe rae eet seth pnp tee o AL ai ep La ATT FEA PANA a En pa LEARI a cof BAT Thee TT a i nett TA dE a Wa ea Wa EE ata i ETAGE He ice ee NE Ween
26. ACCGTAACGAACGT CTT CT WA AA SA A AN CAE AR LUN at VOC Gu pied Ue RU ed ch re tee tr AGACTAAATAT TAACGTACCAT TAAGAGCTACAACCT TAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATATTAACGTACCAT TAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACAC TGATAACAGTAACACACTTCTGTTAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT T GAGAC AAA Fat OLE A A GG RSC aA GALa CANES AC COCA TCAAC IACCAT TAAGAGCTACCGTGCAACTTAACCTTAAGAT TACT T GATCCACT GAT TCAACGTACCGTAACGAACGTAT CAAT TGAGACTA AAGAT TACT T GCTACCGTGCAACGAAAATAACCTT EE a E E e CGTACTTCTGTTAACCTTAAGATTACTTGATCCAC GAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGAT T NA E N a Ua psa AA Q C TT TT GTACC TATCAA CTTCTG C GAAAAGAATGATAACAGTAACACACTTCTGTTAACCT TAAGAT TACT TGATCCACTGAT TCAACGTACCGTAAAGAT TACTTGATG urgartaGaCcACl TA icatTTaCcACAATTAA iT ACAGTACGTACAACAT UMGOGAMGACAGOTTACCAT TIATTAGATATTGTACATCCAG MAGAGTCAAGATT IGCAGGTGAATT CAGAAGTTG GG FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part 15040890 Rev E June 2014 This document and its contents are proprietary to Illumina Inc and its affiliates Illumina and are intended solely for the contractual use of its customer in connection with the use of the product s described herein and for no other purpose This document and its contents shall not be used or distributed for any other purpose and or otherwise communicated disclosed or reproduced in any way whatsoever without the prior written consent of Illumina Il
27. ACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTAC TGATAACAGTAACACACTICTGTTAACCTT a ES O aa TACCGTGCAACGACGAAAAGAATGATAACAGTAACACACTTCTG TACCATTAAGAGCTACCGTGCAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACG O e WAA CGACGAAAAGAATGATA TGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAAC ZGTACCGTAACGAACGTATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTI WA KAA eee TTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGCTICTGTTAACCTTAAGATTACTIGATCCACT a AA AA G GAATGAT C AC C TACCG CGTACCGT AA TTAACGTACCA TGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGTTGATCCACTGATTCAACGTACCGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCG gt CACTGATTCAACGTACCAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACG GAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTAC D AAGATTACTTGATCCACTGATTCAAC TTGAGACTAAATAT TAACGTTGTTAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTTCTGTTAACCT TAAGAT TACT TGATCCACTGAT TCAACGTACCGT TATGAATTGAGACTA TAAATAT TAACGTACTTAACCT TAAGAT TACT TGATCCACT GATT CAACGT
28. C1704429 Familial hypoalphalipoproteinemia The protein name associated with gene function The No Call Regions table shows regions where calls could not be confidently made due to a low read depth or failing a quality filter The No Call Regions table is populated directly from the non variant regions reported in the genome VCF gVCF file Non variant regions are reported as 0 0 in the gVCF file For more information see sites google com site gvcftools home about gvcf evcf conventions Each row of the table contains the gene and information reported for the gene The following information is provided in the No Call Regions table Column Heading Description Gene The name of the gene located within the no call region Chr The chromosome number in which the no call region occurs Start The start chromosomal coordinate of the no call region Part 15040890 Rev E Column Heading Description Stop The end chromosomal coordinate of the no call region Length The length of the no call region Depth The read depth of the no call region Ouality The numeric value of variant call guality as written to the DUAL column of the VCF file Determination of variant guality depends on the variant caller Filter The filter associated with the variant call quality as annotated in the VCF file Modity Table Views To modify how data appear in the tables click the column headings Options include sorting in descending or ascending order showin
29. Guide Q Applying Filters 2 A single gene contains One variant that is heterozygous 0 1 in the mother e The same gene contains a different variant that is heterozygous 0 1 in the father Both variants are present in the affected child 0 1 and 0 1 Figure 28 Autosomal Recessive Transmission Logic 2 i Il 0 1 0 1 i Il 0 1 0 1 0 0 0 1 0 1 0 0 0 0 0 0 gt _ Unaffected reference gt Unaffected carrier gt E Affected Mutation Autosomal Recessive Transmission Workflow 2 Proband Subtract All variants that are homozygous 1 1 in the father mother and unaffected siblings Include Compound heterozygous 0 1 variants if at least two variants are in the same gene at least one variant is heterozygous in the father and other variants are heterozygous in the mother Subtract All variants that are not compound heterozygous 0 1 in affected siblings Subtract All variants that are compound heterozygous 0 1 in unaffected siblings E Filtering results Deleterious variants 5 O Part 15040890 Rev E De Novo Mutation Workflow gt A variant is present 0 1 or 1 1 in the proband The variant is not present 0 0 in either parent or siblings Only one child in the family is affected Figure 29 De Novo Mutation Logic lll Il 0 0 0 0 WU WL 0 1 0 0 0 0 0 0 L Unaffected reference L Unaffected carrier M Affected Mutation VV v VW De
30. Opening another project closes the current project If you have not yet saved changes to the current project a reminder to save your changes appears Close Closes the current project This command does not close the software application If you have not yet saved changes to the current project a reminder to save your changes appears Save Saves changes made to an open project If your project is new you are prompted to name the project Save As Save As Provides the option to save the current project with a different name Save As Reduced Project Provides the option to save the current project with a different name at a reduced size You cannot recover variants that were filtered out when saving at a reduced size 8 Part 15040890 Rev E Import Variant Call Files From the Home tab use commands on the Samples menu to import variant call files in VCF file format and manage samples in the project Figure 8 Samples Menu Commands Wi e E Current Sample Inherited_Dise 3 Import Add Variants WCF to Sample Import Remove Folder Sample Samples Command Import VCF Add Variants to Sample Import Folder Current Sample Remove Sample VCF Import Options Description Opens a window to browse to a file location and import one selected VCF file Opens a window to browse to a file location and import SNPs and indels from another VCF file This command imports data from the selected VCF file and ad
31. S SEE EZ oo p Re ms Wu re A TS pe A Cora e gan En Se TE Se SO TGC GGCATEA TA GAGICGTOA d ESTAN q ata L Sa GIGGGTGOGGS a Y Y peo ecaco ias 5 e A E 7 i 2 her mo B g Mie Seo VariantStudio v2 2 Software User Guide 6 3 Y XxIpuedawy Annotation Sources Annotation Sources Annotation sources are static in the VariantStudio software Any changes to source databases such as ClinVar do not automatically update the annotation sources connected to VariantStudio The VariantStudio software includes the following annotation sources Variant Effect Predictor VEP 1000 Genomes Project Catalogue of Somatic Mutations in Cancer COSMIC ClinVar National Center for Biotechnology NCBI National Heart Lung and Blood Institute NHLBI Exome Variant Server UCSC VEP v2 8 Source Uses data from the Ensembl infrastructure release 72 ftp ncbi nih gov snp organisms human_9606 V CF 00 All vcf gz Ensembl infrastructure pulls information from RefSeq release 56 Values Positional specific to the position not necessarily matching the allele GMAF Global minor allele frequency www ncbi nlm nih gov variation tools reporter docs faq gmaf GMAF allele HGNC of overlapping transcripts for Ensembl only For RefSeq see NCBI on page 65 Transcript specific Feature Feature Type Consequence cDNA Position CDS Position Protein Position Amino Acids Codons Exon Intron HGNC Direct from Ensembl for ENST For Ref
32. Seq same as NCBI Distance Canonical Sift PolyPhen ENSP Domains CCDS Reported for Ensemble annotations only HGVSc HGVSp Positional Specific to the position not necessarily matching the allele 6 A Part 15040890 Rev E Feature ID Feature Type Conseguence Motif Name Motif Position High Influence Position Motif Score Change Cell Type 1000 Genomes April 2012 v3 Source ftp 1000genomes ebi ac uk vol1 ftp release 20110521 ALL wgs phasel_release_ v3 20101123 snps_indels_sv sites vcf gz Values Ancestral Allele AA Global allele Frequency AF Population allele frequencies www 1000genomes org category frequently asked questions population African AFR_AF Ad Mixed American AMR_AF East Asian ASN European EUR COSMIC v65 Source ngs sanger ac uk production cosmic _noLimit vcf gz Additional annotation for COSMIC entries were obtained from ftp sanger ac uk pub CGP cosmic data_export CosmicCompleteExport_ tsv gz From the CosmicCompleteExport data file the following four fields were added primary_site site_subtype primary_histology histology_subtype ClinVar Version September 5 2013 www ncbi nlm nih gov clinvar NCBI dbSNP v137 Source ftp ncbi nih gov snp organisms human_9606 V CF 00 All vcf gz Values rsID RefSeq Transcript ID and HGNC VariantStudio v2 2 Software User Guide 6 D S991N0S UOI E OUU Annotation Sources Sources ftp ncbi nlm nih gov gene DATA gene_info
33. ality in VariantStudio v2 1 e Importing e Added best practices for importing classifications e Annotating e Noted that all genomic coordinates are on the positive strand e Noted that VariantStudio assumes that custom annotations are expressed on the positive strand e Reporting e Noted which transcripts are exported for variants that overlap multiple genes Part 15040890 15040890 Revision B A Date October 2013 May 2013 Description of Change Updated with descriptions of the following features introduced in VariantStudio v2 1 e Software interface e Added description of gene table and no call regions table e Added descriptions of new columns in variants table e Added description of settings for fixed columns and show hide features e Importing e Added feature to import variants in exons with specified padding e Added description of gVCF files for import e Added feature to import variants from another sample to the current sample e Annotating e Added gene level annotations e Added classification annotation and description of classification database e Expanded annotations from COSMIC database e Removed annotations previously derived from HGMD Professional e Added ClinVar MedGen GeneReviews and SNOMED CT annotations sources e Updated annotation source versions for Ensembl COSMIC and NHLBI Variant Server e Filtering e Added family based filter with descriptions of
34. an result in some variants not being annotated with imported classifications when you use the command Apply Classifications from Database Because VariantStudio assumes that all annotations are expressed in genomic coordinates on the positive strand the classification database requires an exact match for variants to be annotated with stored classifications VariantStudio v2 2 Software User Guide 3 5 suo l eoI issejo produ 36 Part 15040890 Rev E Applying Filters Apply Filters 222222222222 222222222222 222222 38 Family Based Filtering Workflows Create Favorite Filters 53 N AD 3 SS pm 4 Y 2 AN x J pe SAAR A j a comes ee eee a es ar an TT OF ui HAZ a MAA er aa ee Tease s ee A art de e gt w lt TA GTGGGA e CAS gt a sr pol VariantStudio v2 2 Software User Guide 3 J49IJLYO Applying Filters Apply Filters 38 The Filters pane provides options for applying any combination of filters to the data in your project Filters are grouped in nine expandable sections General Variant Gene Consequence Population Frequency Cross Sample Subtraction Family Based Custom and Classification Figure 23 Filters Pane Filters General Yariant Gene Consequence Population Frequency Cross Sample Subtraction Family Based Custom Classification Apply Filters gt Clear Filters Click the down arrow lL icon to expand a f
35. anged by editing the Mode entry in the Variant Studio exe config file and restarting the application allowed values are RefSeq or Ensembl Option Transcript Annotation Transcript Source Type Forget BaseSpace Logon Set Default Transcripts 1 Click Set Default Transcripts A window opens that lists the default transcript for each Description Provides options to annotate only variants in the canonical transcript which is the longest translated transcript in the gene and variants in intronic regions Annotates variants identified in a specific annotation source which is RefSeq by default The default can be changed to Ensembl by editing the mode entry in the VariantStudio configuration file VariantStudio exe config as follows lt add key Mode value Ensembl gt Close and reopen VariantStudio to enable the change Clears BaseSpace login information such as ID and password gene By default VariantStudio lists the canonical transcript which is the longest translated transcript in the gene 2 For genes with multiple transcripts use the drop down list to set the default to another transcript VariantStudio v2 2 Software User Guide 29 S UEIIE A a ejo0uuy Applying Annotations and Classifications 26 Figure 15 Set Default Transcripts Use this tool to specify which transcript to display for the variants in the Variant Table that have multiple transcripts associated with them You ca
36. are User Guide 45 s191114 Add Applying Filters 2 Select the checkbox next to any number of available classifications 46 Part 15040890 Rev E Family Based Filtering Workflows The mode of inheritance which is the inheritance pattern of a genetic trait or disorder as passed down through generations is typically one of the following Autosomal recessive Autosomal dominant X linked recessive De novo mutation Disease causing variants co exist with the disorder according to the mode of inheritance Family based filtering requires at least two samples the affected person also known as the proband and at least one parent or sibling Figure 25 Example Father Mother and Proband i Affected Because the proband contains thousands of variants that appear deleterious filtering is necessary to remove variants that are not disease causing and identify disease causing variants VariantStudio v2 2 Software User Guide A SMO 1410 MM Bunai peseg Ajiwe Applying Filters X Linked Recessive Transmission Workflow gt A variant is on the X chromosome The variant is heterozygous 0 1 in the mother The variant is not present in the father The variant is homozygous 1 1 in the affected child Figure 26 X Linked Recessive Transmission Logic 1 0 0 0 1 X X Y X X X Y X 0 1 1 1 0 0 0 0 gt _ Unaffected reference gt LI Unaffected carrier gt E Affected Mutation X Linked Reces
37. are or any third party software Purchaser further agrees that the contents of and methods of operation of this Product are proprietary to Illumina and this Product contains or embodies trade secrets of Illumina The conditions and restrictions found in these terms and conditions are bargained for conditions of sale and therefore control the sale of and use of this Product by Purchaser 5 Limited Liability TO THE EXTENT PERMITTED BY LAW IN NO EVENT SHALL ILLUMINA OR ITS SUPPLIERS BE LIABLE TO PURCHASER OR ANY THIRD PARTY FOR COSTS OF PROCUREMENT OF SUBSTITUTE PRODUCTS OR SERVICES LOST PROFITS DATA OR BUSINESS OR FOR ANY INDIRECT SPECIAL INCIDENTAL EXEMPLARY CONSEQUENTIAL OR PUNITIVE DAMAGES OF ANY KIND ARISING OUT OF OR IN CONNECTION WITH WITHOUT LIMITATION THE SALE OF THIS PRODUCT ITS USE ILLUMINA S PERFORMANCE HEREUNDER OR ANY OF THESE TERMS AND CONDITIONS HOWEVER ARISING OR CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE 6 ILLUMINAS TOTAL AND CUMULATIVE LIABILITY TO PURCHASER OR ANY THIRD PARTY ARISING OUT OF OR IN CONNECTION WITH THESE TERMS AND CONDITIONS INCLUDING WITHOUT LIMITATION THIS PRODUCT INCLUDING USE THEREOF AND ILLUMINA S PERFORMANCE HEREUNDER WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE SHALL IN NO EVENT EXCEED THE AMOUNT PAID TO ILLUMINA FOR THIS PRODUCT 7 Limitations on Illumina Provided Warranties TO THE
38. ase Backup on page 34 For each classified variant two text fields are available for recording comments about the variant the Notes field and the Report Fragment field Notes Information in Notes field is stored in the classification database only Report Fragment Information in the Report Fragment field is stored in the classification database and exported as a column in the sample report For more information see Sample Report Overview on page 57 There are three ways to apply classifications to variants in a project From the menu apply classifications to variants in the current sample that are listed in the classification database From the Variants table apply a classification to a selected variant in the Variants table and save the classification to the database From the Variants table apply a classification to multiple selected variants in the Variants table and save the classification to the database The same classification must apply to all selected variants VariantStudio v2 2 Software User Guide 2 Q SUOIJPIIJISSP JUBUBA Addy Applying Annotations and Classifications Apply Classifications from Database Click Apply Classifications from Database Any variants in the current project that have matching criteria in the classification database are annotated with the classification as specified in the database Apply Classifications in the Variants Table 1 Click the Lel icon in the Classification column for the
39. assifications 222 22222222 33 Import Classifications 2 2222222222222222 35 Chapter 3 Applying Filters 2 2 of Apply Filters 22222222 38 Family Based Filtering Workflows 47 Create Favorite Filters 2222 53 Chapter 4 Generating Reports oooooccoccccccccocccccncccccnccccnnccccncccnno 99 IMTOQUCUON escritoras 56 Sample Report Overview _ 2 2 22 2 eee cece cece e cece 2222222 57 Create a Sample Report Template 58 Create a Sample Report 2222 60 Export Text Files and Charts 2mmmeememee 61 Appendix A Annotation Sources 2 63 Annotation Sources 2 cece ec eee eee e idee 64 SS 67 Technical Assistance 2mmmmemme2m22222 69 VariantStudio v2 2 Software User Guide VI Part 15040890 Rev E Getting Started Introduction nes 2 VCF Input Requirements 222222222222 3 VariantStudio Software Interface 22 5 Create or Open a Project 222222222222 8 Import Variant Call Files 22 9 Data in VariantStudio Tables 2mmmmmmeme 2 11 VCF Fields Reported in the Variants Table
40. de multiple variants are listed multiple times in the table one time for each variant The following information is provided in the Variants table If a column described in the following is not visible in your instance of VariantStudio click Column Order from the Table Options menu to view hidden columns Column Heading Description Gene The name of the gene Variant Lists the reference allele and the diploid genotype call for the sample as Reference gt AlleleA AlleleB AlleleA and AlleleB are explicitly defined from the REF ALT and GT fields of the VCF file For example at a heterozygous position noted as GI 0 1 is represented as REF gt REF ALT and a homozygous non reference position noted as GT 1 1 is represented as REF gt ALT ALT Chr The chromosome number in which the gene occurs Coordinate The genomic location of the variant 1 based Classification The classification assigned to the variant This field is populated for variants that match criteria specified in the classification database Type The type of variant which is either a single nucleotide variant SNV insertion deletion or ref for reference call VariantStudio v2 2 Software User Guide 1 1 se qeL OIPNISIHBUBA ul eyeg Getting Started Column Heading Genotype Exonic Filters Quality GOK Inherited From Alt Variant Freg Read Depth Alt Read Depth Allelic Depth Custom Annotation Custom Gene Annotation Custom Gene Annotation
41. dit Variant Classifications There are two ways to edit classifications for variants with assigned classifications Edit variant classifications in the database Edit classifications locally in the current project without changing database entries Edit Classifications in the Database 1 Click the Ltl icon in the Classification column for the variant you want to change A window opens that shows information about the variant the current classification and any comments in the Report Fragment field 2 Click Edit Classification in Classification Database The Classification for Variant in Database window opens Figure 18 Edit Classifications Variant Information Gene Transcript NM_0014083 Global Freq Chromosome HGWSc NM_001409 3 c 409164 Polyphen Position HGVSp NP_001400 3 p Arg1364His SIFT Variant Consequence missense_variant Amino Acid JAH SUOIJEINISSE D JUBIIBA ypg Classification for for this sample Classification Benign E Report Fragment displayed as a column in the sample report Apply Classification from Classification Database Edit Classification in Classification Database 3 Do one of the following To change the classification in the database select a new classification from the Classification drop down list and click Save Changes in Database To remove the classification from the database click Remove Classification from Database Figure 19 Remove Classification
42. ds it to the current sample Important There is no change to the sample name to denote that variant calls have been merged Opens a window to browse to a folder location and import all VCF files in the selected folder Shows the active sample name The Current Sample drop down list shows all samples in the project To change to another sample in the project select a sample name from the drop down list Removes the current sample from the project A confirmation dialog box opens before the sample is removed from the project With any command to import variant calls the VCF Import Options dialog box opens From this dialog box specify which variants to import using one of four options VariantStudio v2 2 Software User Guide S9114 29 uenea odui Getting Started 10 Figure 9 VCF Import Options Please select which variants you would like to import from your CF file s All variants Variants in exons Padding 20 bases Variants in genes specified by gene list v Browse Variants in regions specified by BED file Load hom ref positions Command All variants Variants in exons Variants specified in a gene list Variants in regions specified in a BED file Load hom ref positions v Browse Description Select the radio button to import all variants in the selected VCF files Select the radio button to import only variants found in exonic regions With this option set
43. e Based on values in the POS column Exonic Based on values in the CHROM and POS columns and calculated from a list of exonic regions Filters Based on values in the FILTER column Gene Based on values in the CHROM and POS columns and calculated using a list of gene coordinates Genotype Based on values listed for GT in FORMAT Sample Name GQX Based on values listed for GQX in FORMAT Sample Name Quality Based on values in the QUAL column Read Depth Based on values listed for DP in FORMAT Sample Name DPI in FORMAT Sample Name for insertion and deletion events called by the Illumina Isaac Alignment and Variant Calling workflow Type Based on the number of bases in the REF and ALT columns Variant Based on values in the REF and ALT columns e At a heterozygous position the value is REF gt REF ALT e At ahomozygous position the value is REF gt ALT ALT i NOTE Some fields reported in the Variants table differ for somatic VCF files For more information see Somatic VCF Fields Reported in the Variants Table on page 21 2 O Part 15040890 Rev E somatic VCF Fields Reported inthe Variants Table Information reported in VariantStudio for VCF files generated by the Illumina cancer analysis pipeline differs from what is reported for other VCF files For these files there is no genotype GT or genotype score GOR Instead allelic depths are listed Each VCF includes two samples one of which is a reference and the
44. e the interface commands to import VCF files sort data apply filters and export data to a report Figure 3 VariantStudio Interface Home Annotation amp Classification Reports Help A A A um H G Cd M Ras Bae w w Current Sample NA12877 SLe rrent v wa Copy a vi New Close Save SaveAs Import Add Variants Import Manage Save As i a aK VCF to Sample Folder Variant Chr Coordinate Genotype Exonic Filters Quality GOK Alternate Inherited AltVariant Read AltRead j Alleles From q Depth Depth A gt G G 69270 snv LowG A gt G G 69270 snv LowG A gt G G 69511 snv PASS A gt G G 69511 snv T gt C C 69897 snv N N NN NN Ny N N nin SAMD11 NOC2L G gt A A SAMD11 NOC2L G gt A A M 4 4 Variant 7 of 98192 Y Show Transcript Info V Show Custom Annotations Y Show ClinVar V Show Cosmic OL History Sample NA12877_S1 e _wrth_no_calls Genes Variants 15189 98192 gt 15364 98192 Menu and commands Contains commands for managing the project annotating variants and reporting results Commands are organized in four tabs Home Annotation and Classification Reports and Help B Filters pane Provides options for filtering data using any combination of filters C Filter history Opens the history panel that shows all filters applied to the project D Table tabs Navigation between the Variants table Genes table and No Call Regions table E Gene view
45. ed in accordance with Illumina s standard manufacturing and quality control processes lumina makes no warranty that custom Consumables will work as intended by Purchaser or for Purchaser s intended uses b Warranty for Hardware Illumina warrants that Hardware other than Upgraded Components will conform to its Specifications for a period of 12 months after its shipment date from Illumina unless the Hardware includes lumina provided installation in which case the warranty period begins on the date of installation or 30 days after the date it was delivered whichever occurs first Base Hardware Warranty Upgraded Components means Illumina provided components modifications or enhancements to Hardware that was previously acquired by Purchaser Illumina warrants that Upgraded Components will conform to their Specifications for a period of 90 days from the date the Upgraded Components are installed Upgraded Components do not extend the warranty for the Hardware unless the upgrade was conducted by Illumina at Ilumina s facilities in which case the upgraded Hardware shipped to Purchaser comes with a Base Hardware Warranty c Exclusions from Warranty Coverage The foregoing warranties do not apply to the extent a non conformance is due to i abuse misuse neglect negligence accident improper storage or use contrary to the Documentation or Specifications ii improper handling installation maintenance or repair other than if performed by Illumi
46. edu EVS November 2012 accessed 13 saiqe olpnysjueie ul eyeq Getting Started Column Heading EVS Coverage EVS Samples Conserved Seguence COSMIC ID COSMIC Wildtype COSMIC Allele COSMIC Gene COSMIC Primary Site COSMIC Histology ClinVar Accession ClinVar Ref ClinVar Alleles ClinVar Allele Type ClinVar Significance Regulatory Feature Alternate Alleles Google Scholar Description The average depth of coverage for SNVs that were called at this position from the Exome Variant Server EVS The number of samples that were called at this position from the Exome Variant Server EVS Denotes if the variant is an identical or similar sequence that occurs between species and maintained between species throughout evolution The numeric identifier for the variant in Catalogue of Somatic Mutations in Cancer COSMIC database if the genomic position of the variant overlaps a variant listed in COSMIC The COSMIC ID links to the COSMIC page associated with the identifier The allele in unaffected individuals as reported in the COSMIC database The allele as reported in the COSMIC database The gene name as reported in the COSMIC database The primary tissue type associated with the allele as reported in the COSMIC database The tissue type associated with the allele as reported in the COSMIC database The alpha numeric ID assigned to the allele in the ClinVar database and link to the ass
47. ele is selected and variant has multiple records only pass variant if at least one matches e If where not matches mutant allele is selected and variant has multiple records only pass variant if none matches Use the Gene filters to filter data by disease or include or exclude specific genes Filter Name Disease Include List Exclude List VariantStudio v2 2 Software User Guide Setting Description Filters data to show genes associated with the specified disease Enter the disease name This field is not case sensitive Filters data to include specified genes To include genes click the button to open the gene list field next to the Include List options and enter the gene name This field is not case sensitive Filters data to exclude specified genes To exclude genes click the button to open the gene list field next to the Exclude List options and enter the gene name This field is not case sensitive 4 s191114 Add Applying Filters Filter Name Setting Description Min Variant Alleles Filters data to show only variants that overlap genes with the specified number of variant alleles A homozygous variant counts as two variant alleles while a heterozygous variant counts as one variant allele Custom and Optional Filters data to show only genes with as specified custom Gene Annotation annotation You can use Boolean logic AND and OR to between the Custom and Optional Gene Annotation filters The Opti
48. es window closes VariantStudio v2 2 Software User Guide 5 Q oje duse yod y asjdwes e 912919 Generating Reports Create a Sample Report Before proceeding consider creating a template using the Manage Templates feature For more information see Create a Sample Report Template on page 58 1 GO From the Reports menu click Sample Report The Sample Report window opens Figure 37 Sample Report Sample Info Tab Sample Report Report Template MySampleReport Template gt Restore From Template Sample Info Lab Information Test Summary Methodology References Page Footer Enter data manually based on fields specified in report template Sample ID Import Sample Information Sample Type Click Import to import sample information from a text file The text file must have two columns separated by either a comma or a tab The first column Sample Collection Date contains the field such as Sample Name and Date of Birth and the second column contains the value for the field such as John Doe and Jan Date Reported 1 1990 Export to PDF Export to RTF From the Report Template drop down list select an appropriate template for the report On the Sample Info tab enter information in the fields provided or click Import to browse to the location of the text file containing the information Enter information for the remaining tabs that are not already populated in the
49. eselect the favorite filter name from the Current drop down list 53 Applying Filters Modify a Favorite Filter 1 Select additional filtering options from the Filters pane and click Apply Filter An asterisk appears next to the saved filter name which indicates that changes have been applied while the saved filter was selected To modify the saved filter with the applied filtering options click Save in the Filter Favorites menu The selected saved filter is modified to include the additional filtering options Manage Favorite Filters To rename duplicate or delete favorite filters use the Manage Favorites feature Figure 32 Managing Favorite Filters 1 Click Manage Favorites Names of saved filters appear on the left panel and a block diagram of the selected filter appears on the right panel To adjust the view of the block diagram click anywhere on the right panel and use the scrolling feature on your mouse to zoom in or zoom out 2 Click Done to apply changes 5 A Part 15040890 Rev E Generating Reports Introduction mm mmm mwm eececeeceeee 56 Sample Report Overview 2 57 Create a Sample Report Template 2 58 Create a Sample Report 2222222222 60 Export Text Files and Charts 22 61 AZ a E ts Y q A MAD D E SO lt YA 9 A fire x KA 3 o Y q has Wis t y i 0
50. files fields in the variants table 20 missense 42 eVCF 4 N import options 9 importing 9 NCBI 65 requirements 3 NHLBI Exome Variant Server 66 ao VCF 21 no call regions table 16 P W padding with import 9 workflow 2 PA chart creating 61 X olyPhen 13 42 population frequency 43 X linked variants filtering by 44 PubMed in genes table 16 R recessive transmission filtering by 44 reportin filter history 61 sample report 57 60 templates 58 variants 61 reports 56 requirements system 2 CF input 3 S sample reports creating 57 60 creating a templates 58 SIFT 13 42 somatic variant calls 21 splice 42 Start menu 5 system requirements 2 T table views modifying 17 tables genes 5 15 no call regions 5 16 variants 5 11 technical assistance 69 templates example report 58 sample report 58 transcript source 25 transcripts input file 25 input file default transcripts 26 Part 15040890 Rev E Technical Assistance For technical assistance contact Illumina Technical Support Table 1 Ilumina General Contact Information Illumina Website www ilumina com Email techsupport illumina com Table 2 lumina Customer Support Telephone Numbers Region Contact Number Region Contact Number North America 1 800 809 4566 Italy 800 874909 Austria 0800 296575 Netherlands 0800 0223859 Belgium 0800 81102 Norway 800 16836 Denmark 80882346 Spain 900 812168 Finland 0800 918363 Sweden 020790181 France 0
51. filtering logic e Added classification filter e Added advanced filter for complex Boolean expressions e Reporting e Added sample report feature with customizable report template e Added option to export all transcripts For a complete list of features included in VariantStudio v2 1 see the software release notes provided with the software installer Initial release Part 15040890 Rev E Table of Contents Revision HIStory iii V Table of Contents 2 VII Chapter 1 Getting Started mmmmm2mmmmmm2mmm2 1 OO 2 VCF Input Requirements 1 3 VariantStudio Software Interface 5 Create or Open a Project w wemmmmee meme 8 Import Variant Call Files 1 9 Data in VariantStudio Tables 11 VCF Fields Reported in the Variants Table 20 Somatic VCF Fields Reported in the Variants Table 21 Chapter 2 Applying Annotations and Classifications 23 Annotate Variants 222 2 24 Create Custom Annotations 0 2 2 2 cece cece cece eee cece ec aaan 2222an 27 Apply Variant Classifications 29 Edit Variant Classifications 31 Manage Cl
52. from Database lassification for Variant in ase Variant Information Gene Transcript Global Freq Chromosome i HGVSc NM_001409 3 c 4091G gt 4 Polyphen Position HGVSp NP 001400 3 p Arg1364His SIFT Variant Consequence Amino Acid R H Information in Yariant Classification Database Classification Bengn Notes not displayed in sample report Report Fragment displayed as a column in the sample report Last Updated 9 29 2013 by ctillotson Remove Classification from Database Save Changes in Database Cancel VariantStudio v2 2 Software User Guide 31 Applying Annotations and Classifications Edit Variant Classifications Locally To change variant classifications locally the variant must already have a classification assigned in the classification database 32 1 Click the Ll icon in the Classification column for the variant that you want to edit locally A window opens that shows information about the variant the current classification and any comments in the Report Fragment field Figure 20 Reapply Classifications from Database Variant Information Gene EGF6 Transcript NM_0014093 Global Freq Chromosome HGVYSc NM_0014093 c 4091G gt 4 Polyphen benign 0 005 Position 410973 HGVSp SIFT Variant gt C T Consequence missense_variant Amino Acid RH Classification for for this sample Classification Benign Report Fragment displayed as a column in the sample report Appl
53. g only selected data based on listed values or adjusting column order d NOTE Modifying how data appear in the Variants table only affects how information is arranged in the table Modifying views does not change the underlying data Sort Data in Ascending or Descending Order To change the order in which data appear in the Variants table click a column heading Data are sorted in either descending or ascending order of values listed in that column Click again to reverse the order When the table is sorted in ascending order the up arrow icon appears in the column heading When the table is sorted in descending order the down arrow icon appears in the column heading Show Only Selected Data To show only selected data based on information in the Variants table use the show hide icon in the column heading 1 Click the show hide HI icon in the column heading A drop down list opens that contains all values present in that column Y Genot Custom Blanks Non blanks hem het hom 2 Select a value from the drop down list The Variants table shows only data that contains your selection To restore the default view of the Variants table use one of the following methods VariantStudio v2 2 Software User Guide 1 se qeL OIPNISHBUBA ul eyeg Getting Started Click the show hide L icon in the column heading used to modify the table and select All from the drop down list Click the icon a
54. gz ftp ncbi nlm nih gov gene DATA gene2refseq gz Values Transcript ID and gene name are mapped as follows Transcript ID gt Gene ID gt HGNC using the NCBI unique Gene ID to link the two databases NHLBI Exome Variant Server Version ESP6500SI V2 updated June 7 2013 Source evs gs washington edu EVS ESP6500SI V2 SSA137 dbSNP138 snps_indels vcf tar gz ESP650051 V2 coverage all_sites txt tar gz Values For SNVs and indels Allele frequency computed from the TAC field which reports alternate alleles observed and reference alleles observed From the all_sites file identifies captured positions even if a variant is not present TotalSamplesCovered AvgSampleReadDepth UCSC hg19 Placental mammalian phastCons elements downloaded from UCSC table browser 6 6 Part 15040890 Rev E Index x VDD 1 1000 Genomes annotation source 65 in variants table 13 A alelle frequency 13 43 annotation commands 24 custom 24 options 25 sources 64 transcript source 25 B BED file importing 9 C cancer analysis pipeline 21 canonical transcript 25 classification filter 45 classifications adding removing 33 applying to variants 29 database 29 database backup 34 database storage options 34 edit database 31 importing 35 in reports 58 in variants table 11 report fragments 29 ClinVar annotation source 65 filter annotations with 41 in variants table 15 codon intiatator 42 consequence 13 conseque
55. illumina VariantStudio v2 2 Software User Guide o ANA EE TA T TA A TE TGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGTTGATCCACTGATTCAACGTACCGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCG gt CACTGATTCAACGTACCAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTAT CRT GAGACTARATATTAACOTACCALTNACAGCTACEGTCTECTGLAACCTIAAGATTAGTT GATCCACIGATICAACGTACCETAACG GAAAAGAAT CAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCAT TAAGAGCTAC TGATAACAGTAACACAC C GATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGA TAAATATT ATTAAGAGCTACCGTCTTCT C ACTTGATCCACTGATT ATTGAGAC TA TTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCAT T CTTGATCCACTGAT TCAACGTACCGT i TAT CAAT TGAGACTAAATAT T ACTTAACC TTGATCCACTGATTCAACGTACCGTAACGAACGTCTT AA GATTACTTGATCCACTGATTCAACGTACCGTAACGAA TCAATTG AACGAC AGA TAT TAACGTACCAT TAAGAGCTACAACC ACTTGATCCACTGAT TCAAC CGTAACGAACGTATCAAT TGAGACTAAATAT TAA ATTAAGAGCTACCGTGC AGTAACAC TGATAACAGTAACACACTTC ATTACTTGATCCACTGATTCAACG AACGAACGTATCAATTGA TATTAACGTACCATTAAGAGCTACC TTCT CTTAAGATTACTTGATCCACTGATTCAA TACC CCTTAAGATTA A A T TGAGACTAAATAT TAACG GACGAACTICTGT TAA G GCTACCGTGCAACGAAAATAACCTTAAGATTACTTGATCCACTGATTCAACGTACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAGCTACCGTGCAACGACGAAAAGAATGA GAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGT
56. ilter section From the available options select filter settings Use any combination of settings from any number of filters Click Apply Filters Filters are applied to the current sample only not to all samples that are imported into the project Click Clear Filters to remove applied filters NOTE You can create a filter using any combination of the filter options in the Filters pane and then save the combination as a single filter Saved filters can later be applied to other samples For more information see Create Favorite Filters on page 53 Part 15040890 Rev E General Filters s191114 Add W Y Y Chromosome All Chromosomes C Autosomal Grenosone Use Advanced Filter Edit Filter Use the General filters to filter data by genotype variant type and chromosome Filter Name Setting Description Genotype Filters data to show any combination of heterozygote homozygote or hemizygote All options are selected by default Variant Type Filters data to show any combination of SNVs Insertions Deletions or Reference calls Chromosome Filters data to show all chromosomes default autosomal chromosomes or a specific chromosome number Advanced Filters data based on selections that you make in the Advanced Filter window Advanced Filter Options Use the Advanced filter options to create a multi branched Boolean expression for filtering data in the Variants table As
57. im or action iii not admitting infringement of any intellectual property right without prior written consent of the other party iv not entering into any settlement or compromise of any such claim or action without the other party s prior written consent and v providing reasonable assistance to the other party in the defense of the claim or action provided that the party reimburses the indemnified party for its reasonable out of pocket expenses incurred in providing such assistance Third Party Goods and Indemnification Illumina has no indemnification obligations with respect to any goods originating from a third party and supplied to Purchaser Third party goods are those that are labeled or branded with a third party s name Purchaser s indemnification rights if any with respect to third party goods shall be pursuant to the original manufacturer s or licensor s indemnity Upon written request Illumina will attempt to pass through such indemnity if any to Purchaser Part 15040890 Rev E Revision History Part Revision Date 15040890 E June 2014 15040890 D December 2013 15040890 C November 2013 VariantStudio v2 2 Software User Guide Description of Change Release for VariantStudio v2 2 which has minor modifications to filtering annotation and file import and export Updated to clarify VCF version requirements are 4 0 and later and that only SNPs and indels are imported to VariantStudio Updated to clarify function
58. imitation any rights from third parties or rights to Application Specific IP Illumina makes no guarantee or warranty that purchaser s specific intended uses will not infringe the intellectual property rights of a third party or Application Specific IP 3 Regulatory This Product has not been approved cleared or licensed by the United States Food and Drug Administration or any other regulatory entity whether foreign or domestic for any specific intended use whether research commercial diagnostic or otherwise This Product is labeled For Research Use Only Purchaser must ensure it has any regulatory approvals that are necessary for Purchaser s intended uses of this Product 4 Unauthorized Uses Purchaser agrees a to use each Consumable only one time and b to use only Illumina consumables reagents with Illumina Hardware The limitations in a b do not apply if the Documentation or Specifications for this Product state otherwise Purchaser agrees not to nor authorize any third party to engage in any of the following activities i disassemble reverse engineer reverse compile or reverse assemble the Product ii separate extract or isolate components of this Product or subject this Product or components thereof to any analysis not expressly authorized in this Product s Documentation iii gain access to or attempt to determine the methods of operation of this Product or iv transfer to a third party or grant a sublicense to any Softw
59. ionally include a Notes column and a Fragment column Chr Position Ref Variant Classification Notes 1 11046855 G T Classification 1 Note 1 1 11046868 C G Classification 2 Note 2 1 11046909 A T Classification 3 Note 3 Chr The chromosome for the variant 1 22 X Y or M Position The genomic coordinate of the variant on the chromosome Ref The reference base or bases for an insert or deletion at the specified position Variant The base or bases for an insert or deletion at the specified position Classification The value assigned to a variant with matching values for chr position ref and variant The classification name must match one of the classifications listed in your database Notes Note about the entry Information in this field is not included in the sample report Fragment Notes about the entry that are intended for the sample report i NOTE Make sure that you add any new classification names to the database using the Classifications Settings command Best Practices for Importing Classifications i NOTE All coordinates used in VariantStudio are genomic coordinates on the positive strand Before importing previously classified variants into the VariantStudio classification database convert classifications to genomic coordinates This step is especially important for variants that were classified based on HGVSc notations and transcripts Importing classifications before converting to genomic coordinates c
60. le in the ClinVar database The disease associated with the allele as reported in the ClinVar database The alpha numeric identifier of the disease as reported by MedGen and link to the associated page of the MedGen database The numeric identifier for the disease as reported by Online Mendelian Inheritance in Man OMIM and link to the associated page of the OMIM database The numeric identifier of the disease as reported by Orphanet and link to the associated page in the Orphanet database The alpha numeric identifier of the disease as reported by Gene Reviews and link to the associated page in the Gene Review database The numeric identifier of the disease and associated clinical terms as reported by SnoMedCt The exon number in which the variant is present The intron number in which the variant is present Distance between the variant and the nearest end of the gene e For upstream variants this value is the distance to the beginning of the first exon e For downstream variants this value is the distance to the end of the last exon The Genes table lists the genes that contain variants identified in the selected sample Each row of the table contains the gene and number of variants reported along with the following information reported for each gene Column Heading Name Gene ID Chr VariantStudio v2 2 Software User Guide Description The name of the gene The Entrez Gene ID for the gene and link to the as
61. lly in Ci ProgramData lumina lumina VariantStudio ClassificationDb bin When the database is stored locally classifications are available for the current project and any future projects opened on that computer If the classification database is stored on a network location classifications are available to projects opened in any installation of VariantStudio with access to that network location 1 To change the default setting open the VariantStudio configuration file in C Program Files lumina lumina VariantStudio VariantStudio exe config 2 h the value field of the ClassificationDatabaseFilePath key enter the preferred network path 3 Save and close the configuration file 4 Close and reopen VariantStudio to enable the change Classification Database Backup 34 A backup of the classification database is created the first time the database is changed on any given day The backup is named DDMMYYYY bin and is stored in the folder DatabaseBackups which is located in the same folder as the classification database Ci ProgramData lumina Ilumina VariantStudio DatabaseBackups Part 15040890 Rev E Import Classifications To import classifications to the classification database from an external file create an input file in a tab delimited text format TSV using a tsv file extension The input file requires five columns Chr Position Ref Variant and Classification as shown in the following example Opt
62. lumina does not convey any license under its patent trademark copyright or common law rights nor similar rights of any third parties by this document The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order to ensure the proper and safe use of the product s described herein All of the contents of this document must be fully read and understood prior to using such product s FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT S INJURY TO PERSONS INCLUDING TO USERS OR OTHERS AND DAMAGE TO OTHER PROPERTY ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT S DESCRIBED HEREIN INCLUDING PARTS THEREOF OR SOFTWARE OR ANY USE OF SUCH PRODUCT S OUTSIDE THE SCOPE OF THE EXPRESS WRITTEN LICENSES OR PERMISSIONS GRANTED BY ILLUMINA IN CONNECTION WITH CUSTOMER S ACQUISITION OF SUCH PRODUCT S FOR RESEARCH USE ONLY 2013 2014 Illumina Inc All rights reserved Illumina 24sure BaseSpace Bead Array BlueFish BlueFuse BlueGnome cBot CSPro CytoChip DesignStudio Epicentre GAIIx Genetic Energy Genome Analyzer GenomeStudio GoldenGate HiScan HiSeq HiSeq X Infinium iScan iSelect ForenSeq MiSeq MiSeqDx MiSeq FGx NeoPrep Nextera NextBio NextSeq Powered by Illumina SeqMonitor SureMDA TruGenome TruSeq TruSight Understand Your Genome UYG VeraCode
63. n use a text file to import the desired default transcript for each gene The file should be a tab delimitted text file with two columns gene_name and transcript_name Gene Transcript File Com Gla 8975150 9381129 43088127 137842560 53701240 125549925 178191862 151531861 151451704 12776118 12704566 170981373 99403533 67493366 69685127 77532208 219128852 74449433 34824447 Be N mem Npe N un 8 43116876 137851229 53715412 125627871 178203277 151546276 151475556 12788726 12727097 171011372 99417599 67547074 69870977 77583398 219134893 74466199 34844853 Num Tr en Default Transcript 1 NM_130786 3 1 NR_015380 1 ERE 1 NM_000014 4 1 NR_026971 1 2 NM_144670 4 1 NR_040112 1 1 NM_017436 4 1 NM_016161 2 2 NM_001173466 1 1 NM_023928 3 1 NR_024035 1 1 NM_001086 2 1 NM_207365 3 2 NM_001103169 1 1 NM_001013630 1 2 NM_016228 3 1 NM_153698 1 1 NM_024666 3 1 NM_014911 3 1 NM_024684 2 1 NM_001087 3 2 NM_001088 2 1 NM_015511 3 Copy to Clipboard Set HGMD Transcripts Y Alternatively click Browse to navigate to a tab delimited text file containing your preferred default transcripts and click Load Input File for Default Transcripts The input file for default transcripts requires two columns Gene_Name and Transcript_ Name as shown in the following example Gene_Name ACTN3 ADH1B AKAP10 Transcript_Name NM 003793 3 NM 000668 4 NM_007202 3
64. na s personnel iii unauthorized alterations iv Force Majeure events or v use with a third party s good not provided VariantStudio v2 2 Software User Guide by Illumina unless the Product s Documentation or Specifications expressly state such third party s good is for use with the Product Procedure for Warranty Coverage In order to be eligible for repair or replacement under this warranty Purchaser must i promptly contact Illumina s support department to report the non conformance ii cooperate with lumina in confirming or diagnosing the non conformance and iii return this Product transportation charges prepaid to Illumina following Ilumina s instructions or if agreed by Illumina and Purchaser grant Illumina s authorized repair personnel access to this Product in order to confirm the non conformance and make repairs Sole Remedy under Warranty Illumina will at its option repair or replace non conforming Product that it confirms is covered by this warranty Repaired or replaced Consumables come with a 30 day warranty Hardware may be repaired or replaced with functionally equivalent reconditioned or new Hardware or components if only a component of Hardware is non conforming If the Hardware is replaced in its entirety the warranty period for the replacement is 90 days from the date of shipment or the remaining period on the original Hard ware warranty whichever is shorter If only a component is being repaired or replaced
65. nce filters 42 COSMIC annotation source 65 filter annotations with 41 in variants table 14 cross sample subtraction filter 43 custom annotation 24 applying 27 creating 27 filters 45 in variants table 12 input file genes 27 input file variants 27 customer support 69 VariantStudio v2 2 Software User Guide xapu D de novo mutation filtering by 44 deletion in frame 42 documentation 69 dominant transmission filtering by 44 Ensembl annotation source 64 in variants table 13 Entrez Gene ID 15 EVS 43 family based filtering 44 favorite filters 53 filters advanced 39 ee 6 classification 45 clear history 6 clearing 6 consequence 42 creating favorites 53 cross sample substraction 43 custom 45 family based 44 gene 41 eneral 39 istory pane 6 history reporting 61 interface 5 population frequency 43 variants 41 filters pane 6 38 frameshift 42 G Gene ID 15 gene list filtering 41 importing from 9 ene view 7 eneReviews 16 genes table 15 Bae VCF 4 Ox in variants table 12 in VCF file 20 H help technical 69 HGNC in variants table 13 transcript in variants table 13 G Index HGVS 13 setting default 25 histogram creating 61 U UCSC 66 import commands 9 import options 9 V initiator codon 42 ee input file add to current sample 9 default transcripts 26 annotating 24 insertion in frame 42 i i importing 9 installation side by side 2 ME ae 11 M VCF
66. ne column is set to Fixed and variant length and optional custom annotation columns are hidden Figure 12 Table Column Display Window Table Column Display Drag and drop the columns between the Displayed Column list and the Hidden Column list The order of the columns in the Displayed Column list will be the order they are displayed in the table You can use shift click and ctrl click to select multiple columns to drag Dont forget to press the Save As Default button in the layout group of the main window ribbon if you would like to keep this layout as your default layout for new projects Displayed Columns Hidden Columns ae Variant Length Custom Annotation 2 Custom Annotation 3 Custom Annotation 4 Gene Alt Variant Freq Read Alt Read Depth Allelic Depths Custom Annotation VariantStudio v2 2 Software User Guide 1 Q se qeL OIPNISHBUBA ul e eq Getting Started VCF Fields Reported inthe Variants Table Several columns of the Variants table are populated from columns or fields in the VCF file as described in the following table Variants Table VCF Fil l i E Column Heading CF File Column or Field Description Allelic Depth Based on values listed for AD in INFO or FORMAT Sample Name Alt Read Depth Based on the second value listed for AD in INFO or FORMAT Sample Name Alt Variant Freq Based on values listed for VF in INFO or FORMAT Sample Name Chr Based on values in the CHROM column Coordinat
67. ng Annotations and Classifications Apply Variant Classifications Edit Variant Classifications 31 Manage Classifications Import Classifications lt 4 9 A lm 7 Y S rs NS WAN Y heget amp mme D on ar me oar ooo TR anraacran ga ran ptf nacre L ASE ha PAGSIGGSTSSS i ac e AS 7 gt E VariantStudio v2 2 Software User Guide 2 3 y g Je1deuo Applying Annotations and Classifications Annotate Variants From the Annotations and Classification tab use commands on the Annotate menu to annotate variants in the current sample with options to annotate all variants or only those variants specified All coordinates used in VariantStudio are genomic coordinates on the positive strand Always annotate variants before applying filters g NOTE An internet connection is required to annotate variants After annotating an internet connection is not necessary Figure 13 Annotate Menu Home Annotation amp Classification Reports Help XK e le l l Annotate Custom Custom Gene Annotation Set Default Annotaton Annotaton Options Transcripts Command Annotate Custom Annotation Custom Gene Annotation Set Default Transcripts d NOTE Annotate Description Annotates variants in the project using the following options e All Variants of Current Sample Annotates all variants in the current sample The current sample is listed
68. ociated page of the ClinVar database The Reference Allele as reported in the ClinVar database The name of the allele as reported in the ClinVar database The type of allele either single nucleotide variant SNV insertion deletion or duplication as reported in the ClinVar database The clinical significance or classification assigned to the allele as reported in the ClinVar database A link to regulatory information in Ensembl for that genomic region The number of nucleotide bases called for Allele A and Allele B that differ from the RefAllele Link to the Google Scholar search page for the selected variant cDNA and amino acid The page opens with an auto populated search field Click search to continue The search is transcript dependent If a rs number is present the number is included in the search Part 15040890 Rev E Column Heading PubMed UCSC Browser ClinVar RS ClinVar Disease Name ClinVar MedGen ClinV ar OMIM ClinVar Orphanet ClinVar Gene Reviews ClinVar SnoMedCt ID Exon Intron Distance Genes Table Description Link to PubMed search page for the selected variant CDNA and amino acid The page opens with an auto populated search field Click search to continue The search is transcript dependent If a rs number is present the number is included in the search Link to UCSC Browser search page for the selected chromosome and position The numeric rsID assigned to the alle
69. ommand The reference allele The alternate allele The quality score assigned by the variant caller A value of is acceptable and is reported as a 0 Recognized fields are VF alt variant freq DP read depth AD allelic depth SOMATIC and none e VF Represented in the Alt Variant Freq column in the Variants table e DP Represented in the Read Depth column in the Variants table e DPI Represented in the Read Depth column in the Variants table for insertion and deletion events called by the Illumina Isaac Alignment and Variant Calling workflow e AD Represented in the Alt Read Depth and Allelic Depth columns in the Variants table e SOMATIC Represented in the Genotype column in the Variants table This value applies only to somatic variants s u w nb y indu 49A Getting Started VCF Column Reguired Value FORMAT A list of fields that define values in the Sample column Possible values are VF alt variant frequency DP read depth AD allelic depth GT genotype and none e VF Represented in the Alt Variant Freq column in the Variants table e DP Represented in the Read Depth column in the Variants table e DPI Represented in the Read Depth column in the Variants table for insertion and deletion events called by the Illumina Isaac Alignment and Variant Calling workflow e AD Represented in the Alt Read Depth and Allelic Depth columns in the Variants table Genotype Values
70. on Num Genes The number of genes showing with the filters applied Num Variants The number of variants showing with the filters applied Filter Name The name of the filter applied The filter name appears only if the filter was saved as a favorite Otherwise the filter name is Untitled Filter The description of the filter applied which can describe one filter or a combination of filters The Filter History pane includes three buttons Clear History View and Apply Clear History Clears entries in the filter history pane View Shows a block diagram illustration of the filter Apply Applies the filter to the variants table 6 Part 15040890 Rev E You can export information from the Filter History pane in a comma separated values CSV file format For more information see Generating Reports on page 55 Gene View The Gene View shows a graphical representation of the gene with the following indicators Exons are indicated in dark blue Variants are indicated with a red line The selected variant is indicated with an orange line The selected transcript is indicated in purple No call regions are indicated in gray Figure 6 Gene View OPA3 57 1Kb ALLER Alternate Inherited Alt Vari Alleles From Freq v Chr Variant Coordinate Type Genotype Exonic Filters Quality GQX 19 C gt C T 46056620 snv S 46055477 insertion The Gene View is interactive Using your mouse hover over the view to see the coordinate
71. onal Gene Annotation filter is based on the optional second annotation column that you can import E NOTE If you click Clear Filters the gene list is also cleared To save a gene list create a favorite filter For more information see Create Favorite Filters on page 53 Consequence Filters Consequence Show only variants that are Missense Polyphen damaging SIFT deleterious Frameshift Stop gained Stop lost Initiator codon In frame insertion In frame deletion Splice Select All Use the Consequence filters to filter data by variants that alter the coding potential of the transcript 1 Select the checkbox Show only variants that are 2 Select the checkbox for each individual consequence setting or click Select All Filter Name Setting Definition Missense A single base pair substitution that results in the translation of a different amino acid at that position Note PolyPhen and SIFT report only SNVs PolyPhen damaging A prediction of a damaging effect of an amino acid substitution on the function of a human protein based on PolyPhen SIFT deleterious A prediction of a deleterious effect of an amino acid substitution on the function of a human protein based on SIFT 4 2 Part 15040890 Rev E Filter Name Frameshift Stop gained Stop loss Initiator codon In frame insertion In frame deletion Splice Setting Definition An insertion or deletion involving a number of base pairs
72. orites Menu Commands Current Command Current Manage Filters Save Save As Manage Ey Save As Favorites SJ9 14 POAC 9 2919 Description Shows the current filter that is applied and a list of available saved filters Select a saved favorite filter from the drop down list to apply it to the current sample If you change to another sample a favorite filter applied to the previous sample is not applied automatically to the next sample Opens tools for renaming duplicating or deleting saved filters Saves changes to the currently applied filter Opens a dialog box for naming a favorite filter With any combination of filters specified in the Filters pane select Apply Filter Click Save As in the Filter Favorites menu Enter a name for the new filter Click OK When a saved filter is applied the saved filter name appears in the Current field To apply a saved filter expand the Current field drop down list Select a filter name from the list The filter is applied automatically To change to another saved filter expand the drop down list in the Current field and select a different filter name Alternatively click the blank entry at the top of the saved filters list to remove the currently applied filter The variants table is restored to an unfiltered view gt NOTE i The favorite filter is not automatically applied when you move to another sample in your project To apply a favorite filter r
73. ormation see www 1000genomes org wiki Analysis V ariant Call Format vcf variant call format version 41 On this site go to step 3 Data Lines Fixed Fields and then step 4 Ref Input File for Custom Gene Annotations The input file for gene annotations requires two columns Gene and Annotation as shown in the following example Gene Annotation AGRN Myasthenia limb girdle familial CCDC39 Ciliary dyskinesia primary 14 DHTKD1 2 aminoadipic 2 oxoadipic aciduria Gene The gene symbol Annotation The value assigned to the specified gene Apply Custom Annotations 1 Create a custom annotations file using a text editor such as Notepad and save it with a txt file extension From the Annotate menu click Custom Annotations to apply annotations to variants or Custom Gene Annotations to apply annotations to genes Browse to the custom annotations file and click OK This step links the custom annotations file to the project VariantStudio v2 2 Software User Guide 2 SUOIJEJOUUY WOISND 912919 Applying Annotations and Classifications 20 4 Use the custom filters in the Filters pane to filter data based on custom annotations For more information see Custom Filters on page 45 Part 15040890 Rev E Apply Variant Classifications Introduced in VariantStudio v2 1 you can apply classifications to variants according to their biological impact Classifications are stored in the classification database Figure
74. r to Test Summary enter preferred introductory content to begin this section Otherwise leave this section blank in the template Page Footer tab Enter preferred content for the template footer such as contact information This information appears at the bottom of each page in the report Part 15040890 Rev E 4 Click the Classifications tab Drag and drop classification names from the Available Classification list to the Displayed Classification list The selected classifications are included in any reports using this template and they appear in the order listed Figure 36 Classifications for Reporting Manage Report Templates M _ _ _ _ Template Data Sample Info Lab Information Test Summary Methodology References Page Footer Classifications From the Available Classifications list drag the classifications that you want to include in your report to the Displayed Classifications list The order of classifications in the Displayed Classifications list determines the order that variants are shown in the report Available Classifications Benign Presumed Benign Unknown Significance Disease Causing 5 Click Save Changes 6 Optional With the template name highlighted in the Report Template list click Make Default The current default is listed in the lower left corner of the Manage Report Templates window 7 Click Done The Manage Report Templat
75. roduct ships from Illumina solely to use this Product in Purchaser s facility for Purchaser s internal research purposes which includes research services provided to third parties and solely in accordance with this Product s Documentation but specifically excluding any use that a would require rights or a license from Illumina to Application Specific IP b is a re use of a previously used Consumable c is the disassembling reverse engineering reverse compiling or reverse assembling of this Product d is the separation extraction or isolation of components of this Product or other unauthorized analysis of this Product e gains access to or determines the methods of operation of this Product f is the use of non Illumina reagent consumables with Illumina s Hardware does not apply if the Specifications or Documentation state otherwise or g is the transfer to a third party of or sub licensing of Software or any third party software All Software whether provided separately installed on or embedded in a Product is licensed to Purchaser and not sold Except as expressly stated in this Section no right or license under any of Illumina s intellectual property rights is or are granted expressly by implication or by estoppel Part 15040890 Rev E Purchaser is solely responsible for determining whether Purchaser has all intellectual property rights that are necessary for Purchaser s intended uses of this Product including without l
76. sive Transmission Workflow Proband Y Subtract All variants not on X Y Subtract All variants that are not heterozygous 0 1 in mother Subtract All variants that are homozygous 1 1 in father Subtract All variants that are not homozygous 1 1 in affected siblings gt Subtract All variants that are homozygous 1 1 in unaffected siblings Filtering results Deleterious variants 8 Part 15040890 Rev E Autosomal Recessive Transmission Workflow There are two possibilities for recessive transmission 1 A single gene contains a variant that is Heterozygous 0 1 in the mother Heterozygous 0 1 in the father Homozygous 1 1 in the affected children Figure 27 Autosomal Recessive Transmission Logic 1 I Il 0 1 0 1 Al NII 1 1 0 1 0 1 0 0 gt _ Unaffected reference gt Unaffected carrier gt E Affected Mutation SMOIHIONA Bunyi peseg Ajiwe Autosomal Recessive Transmission Workflow 1 Proband Y Subtract All variants that are homozygous 1 1 in the father mother and unaffected siblings Include Homozygous 1 1 variants in the child that are heterozygous 0 1 in the mother and father Subtract All variants that are not homozygous 1 1 in affected siblings Subtract All variants that are homozygous 1 1 in unaffected siblings ail Filtering results Deleterious variants VariantStudio v2 2 Software User
77. sociated entry in the NCBI database The chromosome number in which the gene occurs 15 saiqe olpnysjueie ul eyeq Getting Started Column Heading Start Stop Length Num Alleles Num Variants Paternal Variants Maternal Variants Ambiguous Variants Custom Gene Annotation Custom Gene Annotation 2 PubMed GeneReviews Disease Description No Call Regions Table 16 Description The start coordinate of the gene 1 based The end coordinate of the gene The length of the gene The number of alleles reported The number of variants reported The number of variants inherited from the father The number of variants inherited from the mother The number of ambiguous variants Gene annotations according to values provided in the Annotation column of an optional custom gene annotation file Annotations according to values provided in the Gene Annotation 2 column of an optional custom annotation file Link to PubMed search page for the selected gene The page opens with an auto populated search field Click search to continue Link to GeneReviews website Clicking the entry provides a drop down list with links to GeneReviews Diseases associated with the gene Clicking the disease name provides a drop down list with links to MedGen and OMIM Familial hypercholesterolemia Tangier disease Familial hypoalphalipoproteinemia MedGen OMIM Disease C0020445 Familial hypercholesterolemia co039292 i
78. somal Recessive transmission Gene level filtering of different heterozygous variants in the same gene in relatives or variant level filtering of the same heterozygous variants in both parents De novo mutation Filters variants not present in the relatives This filter can also be applied using the cross sample subtraction filter Autosomal Dominant transmission Variant level filtering of heterozygous variants that are present in the affected relatives and not present in the unaffected relatives This filter requires that you indicate the affected relatives 3 With the child sample set as current use the drop down lists to select at least one parent or sibling All samples to be used in the family based filtering must be present in the current project For more information see Family Based Filtering Workflows on page 47 Best Practices When Using the Family Based Filter When using gVCF files for family based filtering variants that were not called in the parents are included if the variants are otherwise consistent with the selected inheritance mode Part 15040890 Rev E If you have a gVCF file use a gVCF viewer such as the Integrative Genomics Browser IGV to examine the no coverage regions Check for the presence of a disease gene of interest in samples from the child and other family members For more information see www broadinstitute org 1gv Custom Filters Custom 9 Do not Filter on custom annotation
79. sumable items that are intended by Illumina for use with and are to be consumed through the use of Hardware Documentation means llumina s user manual for this Product including without limitation package inserts and any other documentation that accompany this Product or that are referenced by the Product or in the packaging for the Product in effect on the date of shipment from Illumina Documentation includes this document Hardware means Illumina branded instruments accessories or peripherals Illumina means Illumina Inc or an Illumina affiliate as applicable Product means the product that this document accompanies e g Hardware Consumables or Software Purchaser is the person or entity that rightfully and legally acquires this Product from Illumina or an Illumina authorized dealer Software means Illumina branded software e g Hardware operating software data analysis software All Software is licensed and not sold and may be subject to additional terms found in the Software s end user license agreement Specifications means Illumina s written specifications for this Product in effect on the date that the Product ships from Illumina 2 Research Use Only Rights Subject to these terms and conditions and unless otherwise agreed upon in writing by an officer of Illumina Purchaser is granted only a non exclusive non transferable personal non sublicensable right under Illumina s Core IP in existence on the date that this P
80. t Purchaser in connection with such infringement claim If this Product or any part thereof becomes or in Illumina s opinion may become the subject of an infringement claim lumina shall have the right at its option to A procure for Purchaser the right to continue using this Product B modify or replace this Product with a substantially equivalent non infringing substitute or C require the return of this Product and terminate the rights license and any other permissions provided to Purchaser with respect this Product and refund to Purchaser the depreciated value as shown in Purchaser s official records of the returned Product at the time of such return provided that no refund will be given for used up or expired Consumables This Section states the entire liability of Illumina for any infringement of third party intellectual property rights Exclusions to Illumina Indemnification Obligations Illumina has no obligation to defend indemnify or hold harmless Purchaser for any Illumina Infringement Claim to the extent such infringement arises from i the use of this Product in any manner or for any purpose outside the scope of research use purposes ii the use of this Product in any manner not in accordance with its Specifications its Documentation the rights expressly granted to Purchaser hereunder or any breach by Purchaser of these terms and conditions iii the use of this Product in combination with any other products materials or
81. t the bottom of the Variants table Vi Genotype het A history of previous selections appears at the top of the column heading drop down list for quick access to frequently used selections To remove a selection from history click the delete icon Show or Hide Selected Columns Use the checkboxes below the table tabs to show or hide specific columns in the Variants table Select the checkbox to show data and clear the checkbox to hide data All options are set to show by default Variant Chr Coordinate Type Genotype Exonic Filters Quality GQX 69270 snv LowG 69270 snv LowG 69511 snv PASS 69511 snv PASS 69897 snv 69897 snv A gt G G A gt G G A gt G G A gt G G H e e m e m SAMD11 NOC2L G gt A A SAMD11 NOC2L G gt A A Variant 7 of 98192 ea Show Population Frequencies Y Show Transcript Info Y Variants Genes No Call Regions Show hide options include the following sections of the Variants table Show Population Frequencies Shows and hides Allele Freq Allele Freq Global Minor global Minor Allele Allele Freq Amr Allele Freq Asn Allele Freq Af Allele Freq Eur and Allele Freq Evs Show Transcript Info Shows and hides Num Transcripts Transcript Consequence cDNA Position CDS Position Amino Acids Codons Exon Intron Transcript HGNC Distance Canonical Sift PolyPhen ENSP HGVSc and HGVSp Show Custom Annotations Shows and hides Custom Annotation Custom Annotation 2
82. tal number of reads passing quality filters at this position The number of reads called at this position The number of reads called for the Ref Allele and the Alt Allele Annotations according to values provided in the Annotation column of an optional custom annotation file Annotations according to values provided in the Annotation column of an optional custom gene annotation file Annotations according to values provided in the Gene Annotation 2 column of an optional custom annotation file The number of transcripts reported in the annotation which includes overlapping transcripts and upstream and downstream transcripts within 5 kb of the variant The name of the transcript usually a database identifier from RefSeq or Ensembl Part 15040890 Rev E Column Heading Conseguence CDNA Position CDS Position Protein Position Amino Acids Codons HGNC Transcript HGNC Canonical SIFT Poly Phen ENSP HGVSc HGVSp dbSNP ID Ancestral Allele Allele Freq Allele Freq Global Minor Global Minor Allele Allele Freg Amr Allele Freg Asn Allele Freg Af Allele Freg Eur Allele Freg Evs VariantStudio v2 2 Software User Guide Description Consequence of the variant described in Sequence Ontology standardized vocabulary Position of the variant in CDNA Position of the variant in the coding region Position of the amino acid in the protein Amino acid or amino acid change If the variant is synonymo
83. that are not a multiple of three which disrupts the triple reading frame The gain of a stop codon in the coding sequence The loss of a stop codon in the coding sequence A codon that acts as a start signal for the synthesis of a protein An insertion that does not alter the reading frame as a result of the insertion A deletion that does not alter the reading frame as a result of the deletion An insertion deletion or substitution that occurs in a splice region of the gene A splice is not in a coding region Population Frequency Filters Population Frequency Global Frequency lt American Pop Frequency lt 4sian Pop Frequency lt African Pop Frequency lt European Pop Frequency EYS Frequency lt 100 100 100 100 100 100 Set allto 52 Set All Use the Population Frequency filters to filter data based on the allele frequency in population studies Options include global frequency American Asian African European and EVS American Asian African and European are allele frequency from 1000 Genomes EVS is allele frequency from the NHLBI exome sequencing project S19 14 Add 1 Select the checkbox and then use the up down arrows to specify a value expressed as percentage 2 To set the same value to all populations use the up down arrows in the Set all to field Click Set All Cross Sample Subtraction Filter Cross Sample Sub
84. the warranty period for such component is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever ends later The preceding states Purchaser s sole remedy and Illumina s sole obligations under the warranty provided hereunder Third Party Goods and Warranty Illumina has no warranty obligations with respect to any goods originating from a third party and supplied to Purchaser hereunder Third party goods are those that are labeled or branded with a third party s name The warranty for third party goods if any is provided by the original manufacturer Upon written request Illumina will attempt to pass through any such warranty to Purchaser 9 Indemnification a Infringement Indemnification by Illumina Subject to these terms and conditions including without limitation the Exclusions to Illumina s Indemnification Obligations Section 9 b below the Conditions to Indemnification Obligations Section 9 d below Illumina shall i defend indemnify and hold harmless Purchaser against any third party claim or action alleging that this Product when used for research use purposes in accordance with these terms and conditions and in accordance with this Product s Documentation and Specifications infringes the valid and enforceable intellectual property rights of a third party and ii pay all settlements entered into and all final judgments and costs including reasonable attorneys fees awarded agains
85. tig QE a He GTA TAC MEME ae tise ETT TANCE DA SETAE Are TAI NZU TA Hu AI TAA TTAMAT TACT TG ARTE AI TANGIA KUI AAA A KI TAT I Ta ETETETT JAT TETE TANT CATA PATIRA ATAT TENA TIA IT lumina Headquartered in San Diego Califomia U S A 1 800 809 ILMN 4566 1 858 202 4566 outside North America techsupport illumina com www illumina com
86. tions to show all variants or only filtered variants Pie Chart Generates a pie chart of filtered results from the Variants table e Use the Plot drop down list on the generated pie chart Figure 39 to represent percentages of variant call filters variant type genotype coding regions or filtered variants e Use Data Source options to show all variants or only filtered variants From the generated chart click Copy to Clipboard to transfer the image from the VariantStudio software to an application that supports images VariantStudio v2 2 Software User Guide 61 seyn pue Sali 1X9 Hodx Generating Reports Figure 38 Histogram Histograms Data Source Aa Quality n Del Variant Length Filtered Variants Copy to Clipboard Quality Num Variants 1000 2000 3000 4000 5000 6000 7000 8000 9000 10000 Figure 39 Pie Chart Pie Chart 11000 12000 Data Source Plot Veith nn Refresh All Yariants Variant Call Filters Variant Type Filtered Variants Copy to Clipboard Genotype Coding Filtered Unfiltered Variant Type insertion 2 26 Yo deletion 4 67 Yo sny 93 07 Yo DA deletion 4 67 DA insertion 2 26 D sv 93 07 Part 15040890 Rev E Annotation Sources Annotation Sources 64 WAT ya ei pa es E Fer ne fo za APD Sy g K DNO n NE 3 OS 7 ie depa nr lt lt O el SAX M Ir lt a ri sane re nr gt A E
87. traction Z Use Cross Sample Subtraction Remove variants that also exist in Inherited Disease 12880 If multiple samples are present in the project use the cross sample filter to exclude variants that are also present in another sample 1 Select the checkbox Use Cross Sample Subtraction VariantStudio v2 2 Software User Guide 43 Applying Filters 2 From the drop down list select a sample in the project Only one sample can be selected as the cross sample filter This filter is helpful when filtering variants present in tumor normal samples Family Based Filter Family Based V Use Family Based Filtering Type X 4inked Recessive NA12877_S1 exom Affected Siblings Edit Affected Siblinas Unaffected Siblings Edit Unaffected Siblinas 7 Use only passing variants in relatives Use the Family Based filter to filter for variants that are consistent with user specified inheritance mode and provided variant data for available family members The Family Based Filter requires input of at least one parent or sibling This filter is useful in identifying candidate disease causing variants 1 Select the checkbox Use Family Based Filtering 2 Using the Type drop down list select a type from the following choices X linked Recessive Variant level filtering of heterozygous variants in affected females that are not present in the father and hemizygous in affected males Auto
88. uired NOTE An internet connection is required for annotating variants After variants have been annotated and saved in a project an internet connection is no longer required Installation To install VariantStudio double click the software installer msi file and follow the prompts in the installation wizard y NOTE Installation of VariantStudio v2 2 or later does not overwrite the version previously installed on your computer allowing side by side installation of different software versions P Part 15040890 Rev E VCF Input Requirements VariantStudio imports SNPs and indels reported in VCF v4 0 or later file formats If analysis software other than Illumina analysis software is used to generate data the VCF file might not contain the required columns VCF Column CHROM POS ID REF ARE QUAL INFO VariantStudio v2 2 Software User Guide Required Value The chromosome number Values are c or chr where is the chromosome number as in 1 22 or name as in X or Y or M for mitochondrial The position of the variant Values are numeric with the first base having position 1 1 based The ID is the rs number for the SNP as recorded in dbSNP txt A value must be present If a dbSNP entry does not exist a missing value marker is an acceptable value Although the ID column and valid values are required the values are not imported The software applies dbSNP annotations with the Annotate c
89. us then there is no change and one amino acid is listed Specific codon noted with and without the variant highlighted in uppercase The gene name expressed as official HGNC nomenclature The transcript name expressed as official HGNC nomenclature Indicates whether the transcript is the canonical transcript SIFT score PolyPhen score Protein ID Ensembl ID Human Genome Variation Society HGVS notation in the cDNA Human Genome Variation Society HGVS notation in the protein The rsID entry in dbSNP The inferred allele ancestral to the chimpanzee human lineage For more information see www 1000genomes org faq where does ancestral allele information your variants come The allele frequency from all populations of 1000 genomes data April 2012 phase 1 call set v3 update Global minor allele frequency GMAP technically the frequency of the second most frequent allele For more information see www ncbi nlm nih gov projects SNP docs rs_ attributes html gmaf The specific allele with the reported GMAF The allele frequency from 1000 Genomes Ad Mixed American population The allele frequency from 1000 Genomes East Asian population The allele frequency from 1000 Genomes African population The allele frequency from 1000 Genomes European population The allele frequency from the NHLBI exome sequencing project Exome Variant Server NHLBI GO Exome Sequencing Project ESP Seattle WA evs gs washington
90. variant you want to classify The Classification for Variant in Database window opens which shows information for the variant and provides a drop down list of available classification categories Figure 17 Classification for Variant in Database _ Classification for Variant in Database Variant Information Gene EGF6 Transcript Global Freq Chromosome HGWVSc Polyphen Position 410973 HGVSp SIFT Variant gt C T Consequence Amino Acid Information in Variant Classification Database Classification Notes not displayed in sample report Report Fragment displayed as a column in the sample report Last Updated Save Changes in Database j Cancel Select a classification category from the Classification drop down list and enter any applicable comments in the Notes field and Report Fragment field Click Save Changes to Database The classification can later be removed from the classification database Apply Classifications to Multiple Variants 30 1 2 Use shift click or ctrl click to select more than one row in the Variants table Right click in the Classifications column over a selected row and then select Classify Selected Variants From the Classify Selected Variants window use the drop down list to assign a classification Enter any applicable comments in the Notes field and Report Fragment field Click OK The classification assignments are saved to the database automatically Part 15040890 Rev E E
91. y Classification from Classification Database Edit Classification in Classification Database Select a different classification category from the Classification drop down list Click OK The classification is applied to the variant in the current project only The variant classification recorded in the database can be reapplied to the variant later To revert the classification to what is assigned in the database click the l icon in the Classification column Click Apply Classification from Classification Database The classification recorded in the database appears in the Classification field Click OK Part 15040890 Rev E Manage Classifications From the Annotations and Classification tab use commands on the Classifications menu to view the classification database and manage classification settings View Classifications Database Click View Classification Database to view the entries in the classification database From this window you can edit an entry delete an entry or import classifications from an internal file Edit an entry Select a row or use shift click or ctrl click to select multiple rows Click Edit Selected Reassign a classification or add comments Delete an entry Select a row or use shift click or ctrl click to select multiple rows Click Delete Selected The entry is permanently deleted from the database Import classifications Click Import Classifications and browse to the location of your
92. you build the advanced filter a diagram appears to illustrate the filter and branches in the expression 1 Select the checkbox labeled Use Advanced Filter and then click Edit Filter The Create Advanced Filter window opens VariantStudio v2 2 Software User Guide 3 Q Applying Filters Figure 24 Create Advanced Filter Window CE Allele Freq Af gt Allele Freq Asn Allele Freq Af gt Allele Freq Eur ClinVar Significance Consequence Conserved Sequence Coordinate COSMIC Allele COSMIC Gene COSMIC Hietnl 4 m ab Allele Freg Af gt Allele Freq Eur Allele Freq Af gt Allele Freq Asn AND Allele Freq Af gt Allele Freq Eur 2 Select a column heading from the list on the left hand side 3 Select an operation from the Operation list 4 Select either Constant or Parameter To filter on a constant enter a constant associated with the selection from the left hand column To filter on a parameter select a column heading from the list on the right hand side 5 Click the generate filter button A diagram of the filters appears 6 To add another branch to the advanced filter select the radio button for either and or xor exclusive Then click Add A new branch is added to the diagram 7 Continue selecting options and operators until you have completed the filter 8 When the advanced filter is complete click OK 9 From the Filters pane click Apply Filters

Illumina VariantStudio User Guide

Contents

Download Pdf Manuals

Related Search

Related Contents