2. GeneFishingTM DEG Kits
Contents
1. 6 3 Power of GeneFishing DEG Kits 7 4 List of Components 11 5 Storage Conditions 13 6 Reagent and Equipment to be Supplied by User 13 7 Protocol for GeneFishing DEG Kits 13 A Reverse transcription 14 B GeneFishing PCR 14 8 Expected Results GE 17 9 Troubleshooting Guide 18 10 Ordering Information 20 Appendix A Reamplification of PCR Products 21 Appendix B Examples of GeneFishing DEG Kits Applications 22 Short Protocol 24 Related Products 25 www see gene com 1 What is ACP Technology ACP Technology patent pending represents the most accurate and extensive PCR technology developed by Seegene The spe2. 1 Add the following reagents to a PCR tube for the PCR reaction on ice 1 2 ul Eluted DNA 5 ul 10X buffer without MgCl ul 25 mM MgCl ul 5 uM arbitrary ACP or 1ul of 10uM 5 UNP ul 10 uM dT ACP2 or 3 UNP ul 2mMdNTP ul Distilled water 0 5 ul Taq DNA polymerase 5U ul 50 ul Total volume Note Amplified DNA fragments from GeneFishing PCR are extracted from agarose gel and then diluted with distilled water usually 10 20 fold If the amplification products have a smear background the extracted DNA fragments can be diluted up to 50 100 fold to amplify the major products The diluents are used in the reamplification process as the template Note For the reamplification of DNA fragments the use of Roche s Taq DNA polymerase is recommended Note The final concentration of MgCl can be adjusted depending on the brand of Taq DNA polymerase OO A NA 2 Place the tube in a preheated 94 C thermal cycler 3 Commence the PCR reaction immediately using the following program Segment No of cycles Temperature Duration 1 1 94 C 3 minutes 2 35 94 C 40 sec 65 40 sec 72C 40 sec 3 1 72C 5 minutes Note Alternatively you may use our universal primers provided in the kit www see gene com 21 instead of the ACP set for the reamplification In this case use 1 ul of 10 uM 5 universal primer and 1 ul of 10 uM 3 universal primer Appendix B Examples of GeneFishing DEG Kits Applications Various experiments to co
3. PCR using the recommended Taq DNA polymerase c The number of PCR products can be fluctuated depending on samples More bands may be obtained by decreasing the annealing temperature at the 1 stage PCR but it may result in increasing the false positives as well Bad resolution on agarose gel We recommend using 2 agarose gel and running the gel 12 X 14 cm until the bromophenol blue dye migrates to 6 cm from the well Smearing only in experimental samples You may have problems with RNA quality or Taq DNA polymerase or PCR reaction itself a Please repeat your RNA samples with phenol chloroform extraction or use fresh RNA samples in RT reaction polymerase www see gene com 18 b Retry the GeneFishing PCR using the recommended Taq DNA polymerase c It is critical to set up the PCR reaction on ice immediately before samples are placed in the thermal cycler Minimum req RNA quantity uired When we performed reverse transcription using mouse conceptus total RNA to confirm limitation of total RNA reproducible results could be obtained by using at least 250 ng of total RNA limitation Cloning of DEG band week If you failed to clone the extracted PCR product due to it s band intensity we recommend you to try following procedures a Repeat 2 3 times GeneFishing PCR using the same arbitrary ACP dT ACP2 combination which used in original PCR and directly clone the DEG b
4. l Synthesize first strand cDNA by RT dT ACP1 l Amplify differentially exoressed cDNAs by GeneFishing PCR Arbitrary ACP dT ACP2 Display DEGs on agarose gel Combinations of primers A1 T A2 T A3 T AAT A5 T DNA sample A B A B A B AB AB Fig 2 Overview of GeneFishing DEG Kits www see gene com 1 First strand cDNA synthesis e First strand cDNA is synthesized using dT ACP 1 by RT 1 2 2 GeneFishing PCR dT ACP2 First stage PCR for second 3 3a x strand cDNA synthesis Annealing is allowed at Tanneai 50 C e Arbitrary ACP which is relatively high enough to i EN 3b prevent the core of the dT ACP2 from binding 3a l Only core 10 mer of arbitrary ACP is able to bind to the first strand cDNA with 8 10 base pair matches 3b 4 Second strand cDNA is synthesized in only one cycle 4 dT ACP2 Second stage PCR for amplifying Arbitrary ACP a Arbitrary the second strand cDNA x x Sa D s 35 40 cycles of PCR were performed at Tanneal 65 C stringent enough to Sb Sy prevent core sequences from annealing but still good for universal sequences to bind each other 6 l Arbitrary ACP and dT ACP2 cannot anneal at first strand cDNA 5a e The second strand cDNA is amplified by priming the Arbitrary ACP and dT ACP2 at 3 and 5 ends respectively 5b Only authentic PCR products are Electrophoreses PCR produc
5. gotta see gene Seegene Gene Fishing DEG Kits User Manual Version 2 2 Published August 2003 Catalog No DEGK 3101 DEGK 3106 Storage Conditions 20 C For Research Use Only Product Warranty and Liability Seegene warrants the performance of all products as described when used according to instruction Any problem incurred for any reason other than misuse should be reported to Seegene immediately This warranty limits our liability to replacement of the products Safety Warning and Precautions This product is limited for research use only not recommended or intended for diagnosis of disease in humans or animals Do not use internally or externally in humans nor animals Ordering Information and Technical Services Seegene Inc Seegene USA 142 21 Samsung dong Kangnam gu PO Box N Seoul 135 090 Del Mar CA 92014 0376 Korea USA Tel 82 2 566 9830 Tel 858 610 9610 Fax 82 2 566 9831 Fax 858 623 9610 E mail info see gene com E mail info see gene com URL www see gene com URL www see gene com www see gene co kr The PCR process is covered by patents owned by Hoffman La Roche Inc No license or immunity under any other patent is either expressed or implied by the sale of any Seegene product www see gene com 2 Table of Contents 1 What is ACP Technology 4 2 GeneFishing DEG Kits
6. Protocol for GeneFishing DEG Kits Please read User Manual before using this short protocol This abbreviated protocol is provided for your convenience but is not intended for first time users Reverse transcription 1 Add the following reagents to a tube for RT on ice ul Total RNA 3 pg 2 ul 10 uM dT ACP1 ul RNase free water 9 5 ul Incubate the tube at 80 C for 3 min 3 Chill the tube on ice for 2 min and spin the tube briefly 4 Add the following reagents to the tube from step 3 4 ul 5XRT buffer 5 wl 2mMdNTP Ubu RNase inhibitor 40 u ul 1 ul M MLV reverse transcriptase 200 u ul 20 ul Total volume Incubate the tube at 42 C for 90 min Heat the tube at 94 C for 2 min Chill the tube on ice for 2 min and spin the tube briefly Oo NO Sp Dilute the first strand cDNA by adding 80 ul of RNase free water GeneFishing PCR 1 Add the following reagents to a PCR tube for the PCR reaction on ice 3 5 ul Diluted first strand cDNA 50 ng 5 ul 10X buffer without MgCl 5 pl 25 mM MgCl 2 ul 5 pM arbitrary ACP one of arbitrary ACPs 1 ul 10 uM dT ACP2 5 ul 2mMdNTP wl Distilled water 0 5 ul Taq DNA polymerase 5U 1 50 ul Total volume 2 Place the tube in a preheated 94 C thermal cycler 3 Commence the PCR reaction in GeneAmp PCR System 9700 Segment No of cycles Temperature Duration 1 1 94 C 3 minutes 2 1 50 C 3 minutes 3 1 72C 1 minute 4 40 94 C 40 sec 65 40 sec 72 40
7. arbitrary ACP1 and dT ACP2 If all procedures follow exactly the instruction in the User Manual the exact pattern of the positive control display should always be reproduced in the positive control cDNAs Seegene provide M represents 100 bp ladder www see gene com 17 9 Troubleshooting Guide Problems Comments No band You may have a problem with RT or PCR reaction Please check follow a If several bands are shown in the control cDNAs but not in your experimental samples you may have a problem with RT reaction or RNA quality Make sure that Seegene s dT ACP 1 is added in the RT reaction and check the integrity of the RNA samples by formaldehyde agarose gel The PCR reaction can be confirmed using our control cDNAs c If there are not any problem in RT and PCR you d better check the first strand cDNAs cDNAs may be degraded by repeated freezing and thawing and watery dilution oO Repeated same band pattern on comparing samples You may have a contamination problem with genomic DNA or reagents for PCR a If your RNA samples are contaminated chromosomal DNA treat your RNA with DNase b If cross contamination of PCR product in your reagents change all of reagents and keep on beware Less than usual bands on samples but control cDNA works a Check the integrity of your total RNA b Some Taq DNA polymerase may be not compatible with GeneFishing PCR You d better retry the GeneFishing
8. CGGAG 3 5 GTCTACCAGGCATTCGCTTCATXXXXXGATGCCGCTG 3 5 GTCTACCAGGCATTCGCTTCATXXXXXTGGTCGTGCC 3 5 GTCTACCAGGCATTCGCTTCATXXXXXCT GCAGGACC 3 5 GTCTACCAGGCATTCGCTT CATXXXXXACCGT GGACG 3 5 GTCTACCAGGCATTCGCTTCATXXXXXGCTTCACCGC 3 www see gene com 11 ACP14 5 GTCTACCAGGCATTCGCTTCATXXXXXGCAAGTCGGC 3 ACP15 5 GTCTACCAGGCATTCGCTTCATXXXXXCCACCGT GTG 3 ACP16 5 GTCTACCAGGCATTCGCTTCATXXXXXGT CGACGGTG 3 ACP17 5 GTCTACCAGGCAT TCGCTTCATXXXXXCAAGCCCACG 3 ACP18 5 GTCTACCAGGCATTCGCTTCATXXXXXCGGAGCATCC 3 ACP19 5 GTCTACCAGGCATTCGCTTCATXXXXXCTCT GCGAGC 3 ACP20 5 GTCTACCAGGCATTCGCTTCATXXXXXGACGTTGGCG 3 e 5 Universal primer 10 uM 30 rxns e 3 Universal primer 10 uM 30 rxns e Control cDNAs E4 5 10 ng ul 2 rxns Control cDNAs were synthesized using total RNAs isolated from mouse conceptus tissues at E4 5 days e Control cDNAs E18 5 10 ng ul 2 rxns Control cDNAs were synthesized using total RNAs isolated from mouse conceptus tissues at E18 5 days e Arbitrary ACP1 5 uM 4 rxns for GeneFishing PCR Not supplied for DEG101 e Diagram for the components O Arbitrary ACPs Arbitrary ACP1 dT ACP1 dT ACP2 S Universal primers Control cDNAs www see gene com 12 5 Storage Conditions Store the GeneFishing DEG Kits below 20 C Minimize the number of times for freezing and thawing the components 6 Reagents and Equipment to be Supp
9. ICR dog cow pig rabbit chicken frog Xenopus fish Zebra fish C elegans and yeast Canons DNA We are offering genomic DNAs obtained from 12 different sample sources for your screening assays Seegene s genomic DNA is qualified for genomic analysis including PCR and library construction www see gene com 25
10. ands after gel extraction b Perform GeneFishing PCR using the 2 3 times higher concentration arbitrary ACP dT ACP2 combination to increase band intensity and then clone the DEG bands after gel extraction c Perform reamplification after gel extraction refer to Appendix A Note We recommend you refer to GeneFishing DEG FAQ in Seegene s home page www see gene com 19 10 Ordering Information GeneFishing DEG Kits Cal t No Product Description Size DEGK 3101 GeneFishing DEG101 ACP 1 to 20 DEGK 3102 GeneFishing DEG102 ACP 21 to 40 DEGK 3104 GeneFishing DEG104 20 reactions DEGK 3105 GeneFishing DEG105 20 reactions DEGK 3106 GeneFishing DEG106 20 reactions Components GeneFishing DEG Kits DEG101 106 e dT ACP1 for RT Cat No TACP 1001 e dT ACP2 for PCR Cat No TACP 1002 e 20 Arbitrary ACPs Cat No AACP 1001 to 1120 e D Universal primer Cat No DUNP 1005 e 3 Universal primer Cat No DUNP 1003 e Control cDNAs Mouse conceptus cDNAs E4 5 and E18 5 e User manual The above items are available for individual purchase Please contact us at info see gene com for details www see gene com 20 Appendix A Reamplification of PCR products If the intensity of the differentially expressed bands of your interest is not sufficient the bands may be reamplified using the same set of ACPs as used in the original GeneFishing PCR
11. cificity with which a primer anneals only to its target and not non target sequences is the most critical factor in determining the success of PCR amplification ACP Technology provides a primer with annealing specificity to the template and allows only real products to be amplified such that it enables the researchers to find only real products as a result The principle of ACP Technology is based on the unique tripartite structure of a particular oligonucleotide primer named Annealing Control Primer ACP see Figure 1 having 3 and 5 end distinct portions separated by a regulator and the interaction of each portion during a two stage PCR ACP Annealing Control Primer RAT 3 c a Designation Function a Core Sequence een Annealing at the 1 stage of PCR targeting b Universal sequence strstr Annealing at the 2017 stage of PCR C Regulator E E AE leed Ee AES Regulating the functions of a and b Fig 1 ACP Structure www see gene com 4 The ACP comprises a a 3 end core targeting portion having a hybridizing sequence substantially complementary to a site on a template nucleic acid to hybridize therewith b a 5 end portion having a universal sequence and c a regulator bridging the core and universal sequences of ACP which plays a key role in annealing of each portion to a template on our purposes The ACP system requires a two stage PCR AC based PCR amplification to maximize the function
12. cted by Northern blot analysis 3 NO expensive detection methods No radioactive fluorescrent The radioactive fluorescent detection of the reaction products restricts the use of the detection methods to laboratories with the appropriate equipment Expensive detection methods such as radioactive or fluorescent labeling are additional drawbacks of current gene expression profiling methods such as microarray and differential display 4 Guaranteed reproducibility GeneFishing DEG kits generate highly reproducible PCR products in every GeneFishing PCR reaction refer to Fig 4 5 Well trained hands and expensive equipments are not necessary GeneFishing Technology is so simple that even the inexperienced in gene discovery can find DEGs on agarose gel www see gene com 7 6 Speedy and cost effective GeneFishing DEG kits enable the researchers to identify real authentic DEGs within 5 hrs and eventually to save the experimental time as well as the total cost in identifying a true DEG In contrast the all current gene expression profiling methods require intensive downstream work in identifying true positive DEG candidates 7 Extensive range of PCR products Each GeneFishing PCR reaction generates long distance PCR products ranging from 150bp to 2kb This wide range of coverage increases the chances to find DEGs and also provides more significant sequence information for the prediction of gene function www see gene com 8
13. lied by User RNase free H2O EtOH 70 100 Reverse transcriptase RNase inhibitor Taq polymerase 2mM dNTP Thermal cycler Micro centrifuge We also recommend reagents and equipment in GeneFishing DEG FAQ17 of Seegene s homepage 7 Protocol for GeneFishing DEG Kits E4 5 E18 5 gt gt gt IMPORTANT M Please consider the following prior to your experiments If you are using GeneFishing DEG kits for the first time please set up an initial GeneFishing PCR conditions with the positive control experiments The positive control experiments should be conducted in accordance with the instruction described in this protocol using the control cDNAs as templates and a primer set of arbitrary ACP1 and dT ACP2 which were provided in the kit You can assume that the initial experiment conditions are set up when the pattern of the positive control displayed on the agarose gel is identical to the figure on the right www see gene com 13 A Reverse transcription 1 Wi CO NO On Add the following reagents to a tube for RT on ice ul Total RNA 3 ug Zu 10 uM dT ACP1 Zu RNase free water 9 5 ul Note Mix the reagents by tapping or pipetting Note In order to identify differentially expressed bands between RNA samples it is crucially important to add the same amount of RNA samples to be compared Incubate the tube at 80 C for 3 min Chill the tube on ice for 2 min and spin the tube briefly Add the f
14. mpare Differentially Expressed Genes DEGs in two or more RNA samples from each different organism were conducted in accordance with the instruction of User Manual using the ACPs of the GeneFishing DEG kits As exemplary results the following are agarose gel photographs we obtained with the use of limited number of ACPs The DEGs on agarose gel shown below represent a typical pattern of results to be generated from your experiments Not to mention the number of PCR products can be various depending on the type of sample or treatment A Mouse Conceptus Tissues E4 5 vs E18 5 M A B C A B C A B C Lane Template A E4 5 B E11 5 E18 5 B Human Brain Tissues Normal vs Tumor Lane Template A Normal B Tumor www see gene com 29 C Human Stomach Tissues Normal vs Tumor Lane Template A Normal B Tumor Fig 5 Agarose gel photographs of RNA fingerprinting for the differentially expressed genes DEGs using GeneFishing Technology A An agarose gel photograph showing DEGs obtained from mouse conceptuses at E4 5 E11 5 and E18 5 using five different arbitrary ACPs B An agarose gel photograph showing DEGs obtained from human brain normal and astrocytic tumor tissues using four different arbitrary ACPs C An agarose gel photograph showing DEGs obtained from human stomach normal and tumor tissues using three different arbitrary ACPs DEGs are marked at the arrows M represents 100 bp ladder www see gene com 23 Short
15. ollowing reagents to the tube from step 3 4 ul 5X RT buffer 5 ul 2mMdNTP 0 5 ul RNase inhibitor 40 u ul 1 ul M MLV reverse transcriptase 200 u ul 20 ul Total volume Note You can use a general M MLV reverse transcriptase Incubate the tube at 42 C for 90 min Heat the tube at 94 C for 2 min Chill the tube on ice for 2 min and spin the tube briefly Dilute the first strand cDNA by adding 80 ul of RNase free water Note Store all cDNA samples at 20 until ready for use GeneFishing PCR Add the following reagents to a PCR tube for the PCR reaction on ice 3 5 ul Diluted first strand cDNA 50 ng 5 ul 10X buffer without MgCl 5 ul 25mM MgCl 2 ul 5 uM arbitrary ACP one of arbitrary ACPs 1 ul 10uM dT ACP2 5 ul 2mMdNTP wl Distilled water 0 5 ul Taq DNA polymerase 5U nul 50 qul Total volume www see gene com 14 Note Depending on the samples the different amount of diluted first strand cDNA can be used as templates for GeneFishing PCR The high amount of starting material the first strand cDNA results in perfect reproducibility and amplification of rare mRNAs and also allows use of the ethidium bromide stained agarose gel to detect differentially expressed products We recommend using 3 5 ul of the diluted first strand cDNA as templates for GeneFishing PCR Note A primer set comprising one of 20 arbitrary ACPs and dT ACP2 should be used as 5 and 3 primers in each PCR reaction N
16. ote GLASSMILK gel extraction kit e g BIO 101 GENECLEAN II KIT is recommended to extract the differentially expressed bands from the agarose gel Note If the intensity of the differentially expressed bands of your interest is not sufficient for direct cloning the bands may be reamplified using the same set of ACPs as used in the original GeneFishing PCR or using our universal primers provided in the kit refer to Appendix A We recommend you refer to GeneFishing DEG FAQ in Seegene s home page Clone the amplified product into a TA cloning vector Note If the intensity of the differentially expressed bands of your interest is not sufficient for direct cloning efficient TA cloning system e g Invitrogen TOPO TA Cloning Kit is recommended www see gene com 16 8 Expected results A typical positive control experiment was conducted using arbitrary ACP1 and dT ACP2 to compare the positive control first strand cDNAs Total RNAs isolated from mouse conceptus tissues at E4 5 E11 5 and E18 5 days were used as starting materials for the synthesis of first strand cDNAs First strand cDNA synthesis and GeneFishing PCR were performed as described in this User Manual E4 5 Ell 5 El8 5 ES bt e M4 2 3 4 5 6 DEGs Fig 4 An agarose gel photograph to show the amplified cDNA products obtained from different stages of mouse conceptus samples E4 5 lanes 1 and 2 E11 5 lanes 3 and 4 E18 5 lanes 5 and 6 using a set of
17. ote You can use a general Taq DNA polymerase Among the commercialized Taq DNA polymerase which we have had especially experience we have received good results with Roche s cat no 1 435 094 Genecraft s cat no GC 002 250 Invitrogen s cat no 10342 053 and Promega s cat no M1661 Please find more details on GeneFishing DEG FAQ in Seegene s home page Note The final concentration of 2 5 mM MgCl is recommended but this concentration could be adjustable depending on the commercial brand of Taq DNA polymerase Please refer to each instruction of Taq DNA polymerase Place the tube in a preheated 94 thermal cycler Note It is important to preheat 94 the thermal cycler before placing the tube in Commence the PCR reaction immediately using the following program Segment No of cycles Temperature Duration 1 1 94 C 5 minutes 2 1 50 3 minutes 3 1 72C 1 minute 4 40 94 C 40 sec 65C 40 sec 72C 40 sec 5 1 72 5 minutes Note We recommend the GeneAmp PCR System 9700 of Applied Biosystems having a heated lid Electrophorese 5 10 ul of the PCR products on 2 agarose gel stained with EtBr www see gene com 15 Note If the band intensity of DEGs of your sample is very week the intensity can be stronger by increasing the starting material diluted first strand cDNA or the ACP primer concentration in the GeneFishing PCR Extract the differentially expressed bands on the agarose gel N
18. s of each portion as follows 1 1 stage PCR for generating a specific PCR product The regulator is not favorable in annealing to the template under the conditions that the 3 end core portion anneals to a site of the template at a first annealing temperature such that the regulator is capable of interrupting the annealing of the D end portion and restricting a primer annealing portion to the 3 end portion The strength in which the specific annealing of the 3 end portion sequence occurs is relatively stronger than the strength in which the non specific annealing occurs under the first annealing temperature which results in the improvement of primer annealing specificity In this regard the effect or performance of the regulator on the 5 and 3 end portions of ACP is one of the key features of ACP Technology 2 2 stage PCR for amplifying 1 PCR product Only the resultant product generated from annealing and extension of the 3 end portion sequence of ACP in step 1 can be amplified close to the theoretical optimum of a two fold increase of product for each PCR cycle by priming the ACPs at 3 and 5 ends under high stringency conditions in which the sequence of the 3 end core portion alone is not allowed to anneal to the template In this step only the sequences at the 3 and 5 ends of the 1 PCR product act as donors of priming sequences for the amplification which results in the amplification of only a
19. sec 5 1 72 5 minutes 4 Electrophorese 10 ul of the PCR products on 2 agarose gel stained with EtBr 5 Extract the differentially expressed bands on the agarose gel e g GENECLEAN II KIT 6 Directly clone the amplified product into a TA cloning vector e g TOPO TA Cloning Kit www see gene com 24 Related Products DES kits All of the GeneFishing DEG kits DEG101 106 comprise 20 randomly selected arbitrary ACPs Annealing Control Primers and each DEG kit works equally for your target samples 1000P DNA ladle The 100bp ladder consists of 12 fragments between 100 and 1 000bp in exact 100bp increments and additional fragments at 1200 and 1500bp The 500 1 000 and 1 500bp fragments have increased intensity to serve as reference points sss hst poo gz zg e r Northern blots are pre made for immediate use and designed to See Gene expression in specific tissues and at specific developmental stages Our Northern blots allow you to assess the distribution size alternative splicing forms and level of your transcripts in one experiment Seegene s Full length cDNAs are ideal to study gene expression in specific Tissues and at specific developmental stages and also to clone the genes belonging to a multigene family We are offering zoo blot pre made genomic Southern blot including 12 different species for your screening assays Genomic DNAs were prepared from human rat SD mouse
20. target product as a result this is another key feature of ACP Technology www see gene com 5 2 GeneFishing DEG Kits As the first application of the Seegene s ACP Technology GeneFishing DEG kits for identifying differentially expressed genes DEGs in two or more nucleic acid samples is specially designed to overcome the disadvantages and limitations of the current gene expression profiling related methodologies such as microarray and differential display GeneFishing DEG kits require the following three steps including a two stage PCR GeneFishing PCR see Figures 2 3 Step 1 RT is conducted using dT ACP1 to synthesize first strand cDNAs from samples wherein the 3 end core portion of the dT ACP1 comprises a hybridizing sequence complementary to a poly A region of mRNA transcripts Step 2 17 stage PCR for only one cycle is conducted using an arbitrary ACP to synthesize second strand cDNAs under conditions that the 3 end core portion of the dT ACP2 is prevented from annealing to the first strand cDNAs and only the 3 end core portion 10 mer of the arbitrary ACP comprising a hybridizing sequence sufficiently complementary to a region of the first strand cDNAs is involved in annealing to the first strand cDNAs This step makes it possible to initially and fundamentally exclude the results from the problems of the arbitrary arbitrary products or the dT ACP2 dT ACP2 products Step 3 2 stage PCR follows
21. ts amplified 6 on agarose gel J NO false positives Fig 3 Flow chart of the cDNA synthesis and the GeneFishing PCR www see gene com 10 4 List of Components e dT ACP1 10 uM 10 rxns for RT dT ACP1 5 CTGTGAATGCT GCGACTACGAT XXXXX T 1 A e dT ACP2 10 uM 40 Orxns for GeneFishing PCR dT ACP2 5 CTGTGAATGCTGCGACTACGATXXXXX T 15 3 e Arbitrary ACPs 5 uM 20 rxns for GeneFishing PCR Note Any kit of the GeneFishing DEG101 Arbitrary ACP1 Arbitrary ACP20 DEG102 Arbitrary ACP21 Arbitrary ACP40 DEG103 Arbitrary ACP41 Arbitrary ACP60 DEG104 Arbitrary ACP61 Arbitrary ACP80 DEG105 Arbitrary ACP81 Arbitrary ACP100 DEG106 Arbitrary ACP101 Arbitrary ACP120 DEG kits DEG101 106 comprises 20 arbitrary ACPs The 3 end core portion of each arbitrary ACP consists of 10 randomly selected sequence respectively The following sequences present an exemplary 20 arbitrary ACPs used for the DE ACP1 ACP2 ACP3 ACP4 ACP5 ACP6 ACP7 ACP8 ACP9 ACP10 ACP11 ACP12 ACP13 G101 kit 5 GTCTACCAGGCATTCGCTTCATXXXXXGCCATCGACC 3 5 GTCTACCAGGCATTCGCTTCATXXXXXAGGCGATGCC 3 5 GTCTACCAGGCATTCGCTTCATXXXXXCCGGAGGATG 3 5 GTCTACCAGGCATT CGCTTCATXXXXXGCT GCTCGCG 3 5 GTCTACCAGGCATTCGCTTCATXXXXXAGT GCGCTCG 3 5 GTCTACCAGGCATTCGCTTCATXXXXXGGCCACATCG 3 5 GTCTACCAGGCAT TCGCTT CAT XXXXXCT GCGGATCG 3 5 GTCTACCAGGCAT TCGCT T CAT XXXXXGGT CA
22. under high stringency conditions to amplify only the arbitrary primed second cDNA strands generated from step 2 Both of dT ACP2 and arbitrary ACP are involved in annealing to only the sites or complementary sites of 3 and 5 ends of the second cDNA strands which results in the amplification of only real PCR products with NO false products www see gene com 6 3 Power of GeneFishing DEG kits The power of GeneFishing DEG kits gives you the following benefits in your experiments 1 NO false positives GeneFishing DEG kits deliver the Differentially Expressed Genes DEGs which never fail in Northern blot or RT PCR confirmation The problem of false positives has been a major bottleneck remaining for the current gene expression profiling methodologies such as microarray and differential display so that freedom from false positives can save subsequent labor intensive work to verify true positives 2 NO PAGE gel agarose gel is sufficient Annealing Control Primer ACP incorporated in GeneFishing DEG kits dramatically improves specificity and sensitivity of PCR amplification and results in a few PCR products In addition GeneFishing Technology allows the use of the sufficient amount of starting material and the high concentration of dNTP Eventually these benefits allows the ethidium bromide stained agarose gel to detect DEGs The bands shown on agarose gels by GeneFishing Technology have sufficient resolution to be dete
Download Pdf Manuals
Related Search