Home

ABI 391 manual

1. 1 6 To Reach Technical Support Through the 1 8 To Obtain Documents on nnne nnne 1 9 User Ce ERE 1 10 Material Safety Data Sheets MSDS ssssssssssssseseeeeeeeneneennen nennen 1 10 Text Conventions 2 eee En re d te ree n 1 11 Section 2 Operation mee EM 2 2 Pre synthesis Check List e onec ertet resi tee et e eg Lee c 2 3 How to Prepare 5 2 4 How to Dissolve 5 2 5 How to Store Dissolved Phosphoramidites sese 2 6 How to Install Reagent Bottles nennen 2 7 How to Install the Phosphoramidites bottles 1 5 2 7 How to Install Bottles 9 15 2 8 How to Install Bottle 18 ecce ceret dn eme Eee odes 2 8 How to Begin a Synthesis sessssssssssssessesee eene eene 2 9 How to Install the Column nennen nennen nnne nnns neris 2 12 Post Synthiesis uote tele atii ee bono daar perde iecur e oret d 2 13 Manual Deprotection and Cleavage 1 nene nnne nnns 2 13 i oe ette 2 13 Materials and 4 eene nennen
2. 2 34 How to Use OPC Oligonucleotide Purification 2 35 2 35 Protocol for Lysine Pre treatment of Longmers gt 70 bases 2 37 OPC Purification 2 38 Solutions Needed merreni onecie ke ac 2 38 2 40 Section 3 Software Menu Descriptions ItPOGUCTIOM eL X A 3 2 The MAIN and MENU Soft Keys sssssssssssssesseseeeeneeenee nennen 3 3 Software Abbreviations and 1 1 enne 3 4 The Mam Menu e em 3 5 Summary of Menu nennen nnne nnne nnns 3 6 Main Menu Option DNA Editor nennen enn 3 7 The EdItKoY cenon nnum 3 8 The Copy Key need Lee ete m pope eit net Lect e edet dus 3 11 TREPERE ahd 3 12 Main Menu Option Start Synthesis enne 3 13 Main Menu Option Monitor Synthesis sssssssssseseeseeeeeeeeeneeen eene 3 16 Instrument Status 5121 0 3 17 The Holding Mernu nee ese EE 3 19 The Jump Step
3. nnne nnns entres nnne 3 22 Ihenterr pt Menu recte hoi vas ee eet t E EU Ee d eti ns 3 24 Main Menu Option Change Bottles sssssssssseseeeeeeeneeeen eee 3 29 Menu Deseniption P RD TREE o RE PUER 3 29 Applied Biosystems The Change Bottles Menu Keys emere 3 30 Bottle Usage Data irti e doe teo Deere HR ees 3 33 Main Menu Option Cycle nennen nnne nnns 3 34 Introduction cuocere dc 3 34 The Cycle Editor 3 35 The Edit cti ee cele eo p ni ER ei Ee REESE UE tei rt eto rne Es ces 3 35 The Bas Specifl r Field i iecore et beet ite Ede iia 3 37 The Copy Gy ha ette eerte 3 39 Main Menu Option Manual Control essen enne nnne nnns 3 40 The Valve Keys eee e reed ette trei eet reete te a t be fa eb eoe ced 3 40 e ren etm oe Du e ER e ers 3 41 Main Menu Option Fract nnne enne nennen nennen nennen 3 42 Main Menu Option Procedure Editor sssssssssseseeeeeeeeenenneeee eene 3 42 The 3 43 The itor eter b te te teo 3 43 The Print Keys itr enden e UTR CREER HE REC cates 3 44 Main Menu Option FXN Editor sessssess
4. O 5 2 The Chemical Delivery System 5 3 PIOSSUIG de er RE 5 4 Reagent and Solvent 5 1 5 4 Delivery Valve 0 EAREN rnm rentrer 5 6 MEDICI 5 9 The a e eet mete terea eto 5 10 Waste and nennen rentrer 5 11 The Battery m E 5 12 The Controllera o eh oett tek Wave tese gene eon urne ge eed ees ater b a dt etin 5 13 5 14 Section 6 Chemistry for Automated DNA Synthesis IritrodUctioni 4 ecd eee ai e ees 6 2 Th Solid Suppott toe ettet em ecu dete 6 5 DNA Synthesis Chemistry eene eene nennen enn nnne nnns 6 7 pug 6 8 COupIING ee EE 6 12 eris 6 15 OXIGATION p ES 6 16 Completion of the Synthesis nennen nennen 6 18 Manual Deprotection and Cleavage ssssssssseseseeeeeeee eene nennen nennen 6 18 P 6 18 Phosphate nnne nnne nennen 6 18 Base
5. 3 52 Applied Biosystems Introduction The Model 391 software is menu driven Menus and pages of menus are shown on a 2 line liquid crystal display LCD The menus present various options and necessary information about the syn thesis or status of the instrument In response you select an option and give instructions by pressing the appropriate key on the keyboard start change cycle synth botes editor Figure 3 1 The Keyboard The keyboard has several labeled keys 0 9 A G C T X delete left and right arrows and 5 soft keys directly below the display The labels and actions of the soft keys change depending on the information displayed directly above them Pressing one of the gray keys labeled 0 through 9 enters a numeric value at the cursor position Pressing the appropriate gray key labeled A G C T or X enters a base ina e DNA sequence These keys operate when viewing the DNA Editor Menu X Em To make entries or deletions the cursor must be in the correct position and of lt ten must be moved Pressing the right or left lt arrow key moves the cur sor one position in the arrow s direction Continuously pressing an arrow repeats the action In menus that have multiple entry areas arrows also move the cursor from one entry area to another 3 2 Section 3 Software Menu Descriptions Applied Biosystems DELETE Pressing the delete
6. A 6 19 Quantitation of the Oligonucleotide 6 20 Storage of the Oligonucleotide essen enne 6 20 Analysis and P rificatiori c ne e edet tbe rc e vede Ed beet eu 6 21 OPC Oligonucleotide Purification Cartridge sse 6 21 PAGE E 6 22 cim Mate eoe uta ho coe mft doors 6 24 Alternative Chemistries nennen nnne trente nnns enne 6 24 RNA SynthesiS e etate Le p ees 6 24 Hydrogen Phosphonate Chemistry 6 25 Phosphorothioate 6 26 1 eee ete ac re 6 27 Fluorescent dye Linked Sequencing Primers sssssssseeneeee 6 28 Applied Biosystems amp 2 E DRM DEUM 6 30 Appendix A Functions Cycles and Procedures Appendix B DNA Synthesizer Schematic DNA Synthesizer Plumbing Diagram Appendix C Synthesis Log Sheet Reagent Solvent Log Sheet Appendix D 391 Illustrated Parts List Appendix E Warranty 391 Pre Installation Manual Safety ELEME E 3 User Attention Words Material Safety Data Sheets and Waste Profiles E 4 User Attention WOrd
7. 1 2 9 How to Install the Column iseer eui III 2 12 Post Syntheslss c e dos Soon M bate de a 2 13 Manual Deprotection and Cleavage 2 13 How to Abort a 1 m 2 18 About the Synthesis Reagents and 1 2 19 How to Store Reagents 0 0 cee cece eee s 2 19 About DeoxytinOsinie iue cte 2 23 How to Change an Argon Tank 585 3 2 25 How to Change the Waste 2 25 How to Perform the Flow Test Procedure 2 26 Aminolink 21M Re as nt gt ebbe b ees bbs 2 30 How to Use Aminolink 2 een teen ees 2 32 How to Use OPC Oligonucleotide Purification 2 35 References hd mca tate Ne Mense veces aui UE dries au NN fo ced S oe 2 40 Applied Biosystems Power On 1 Connect the instrument to a power source and turn the power switch on The power switch is located on the front of the instrument to the right of bottle position 5 IMPORTANT Theargon cylinder must always be connected to the synthesizer before the power is turned on If this is not
8. EUM UM 17 Preinstallation 1 aana adaa aaa 18 Technical Support et eost e ente tt eec t E 19 Contacting Technical Support nennen nnne nnne nnne E 19 To Contact Technical Support by E Mail sese E 19 Hours for Telephone Technical Support E 19 To Contact Technical Support by Telephone or E 20 To Reach Technical Support Through the Internet E 22 To Obtain Documents on nennen nnne E 23 AB LIMITED sinn E 24 vi Section 1 Introduction How To Use This Manual ereinen iae ns 1 2 General Introduction Mare ta dad P UR d Ow Reni E Pee dde 1 3 Howto Get Help edea re ete e gr oos op etea e Pa de ae c P e 1 5 User Attentionsz s SOE OER eek See VERAS 1 10 Material Safety Data Sheets 1 10 Text Conventions ccc cc cee cee eee ee ehe hh einn 1 11 Applied Biosystems How To Use This Manual This Users Manual is divided into 6 sections Introduction 1 Operation 2 Software Menu De scriptions 3 Functions Cycles and Procedures 4 System Description Hardware 5 and Chemistry for Automated DNA Synthesis 6 In addition there are
9. OFF Select to deactivate the function and return to the previous menu NEXT Shows the subsequent function number and its description When the last func tion is being shown selecting NEXT will display Function 1 Shows the preceding function number and its description When Function 1 is PREV being shown selecting PREV will display the last function Section 3 Software Menu Descriptions 3 41 Applied Biosystems MENU Deletes the designated function number closes all valves if a function was ac tivated and returns to the previous menu Follow the prompt FXN and type a function number The number and its description will be shown For example when 9 is entered Function 9 18 to column is displayed 18 TO COLM press on or off off next prev menu If you enter an invalid function number that area of the screen will be blank Next press ON or OFF When you choose ON the function is activated and the screen returns to the previous menu which shows the active function The function can be deactivated by pressing ALL OFF or OFF Also a valve or function will be deactivated automatically upon returning to the Main Menu Only one function can operate at a time When a second one is activated the first is automatically deactivated However when a function is on up to eight additional individual valves may be opened Main Menu Option Fract Pulse Use the Fract Pulse Menu fraction collector pulse to change t
10. 6 20 Storage of the Oligonucleotide 2 0 Lecce cece eee 6 20 Analysis and Purification ee etter ete teen eer eres 6 21 OPC Oligonucleotide Purification 1 6 21 PAGE 6 22 Site BA cu dae io iiu es ope tA 6 24 Alternative Chemistries 6 24 Synthesis vider Se eq Betws ke betreut e ae ee dede 6 24 Hydrogen Phosphonate Chemistry e 6 25 Phosphorothioate DNA 0 0 ccc 55 6 26 S Attachm nts eerte Needle NE Dg Hte Saec id aste b e dap aad ele 6 27 Fluorescent dye Linked Sequencing 6 28 Amino Link2 2 5052 8 0S 09 ev ex Uie e ee ere E p gn 6 28 Referen ES mi eco E hat deci tus 6 30 Applied Biosystems Introduction DNA synthesis is quite simple in concept reactive 3 phosphorous group of one nucleoside is cou pled to the 5 hydroxyl of another nucleoside The former is a monomer delivered in solution The latter is immobilized on a solid support An internucleotide linkage is thus formed Three other chemical reactions are necessary to prepare the growing chain of DNA for the next coupling In this way a synthesis cycle is conducted adding one nucleoside monomer at a time The desired sequence a
11. Applied Biosystems At the end of each cycle this function signals the controller to perform Step 1 of the cycle which begins the coupling reaction Upon completion of all base additions the cycle will finish at cycle entry if the DNA is to remain trityl on If the ending method is trityl off detritylation will be per formed and the cycle will finish at cycle end FUNCTION 17 INTERRUPT This function is used during the bottle change and shut down procedures It provides a pause when reagent bottles are being removed and replaced Procedure Functions The following functions are used during the bottle change phosphoramidite purge and shut down procedures The bottle change procedure is used to remove empty reservoirs and replace them with fresh reagents The phosphoramidite purge procedure fills the phosphoramidite and tetrazole deliv ery lines with fresh reagent prior to beginning a synthesis The shut down procedure prepares the instrument for storage It removes all reagents from the delivery lines and washes and dries all chemical pathways Functions which prime delivery lines When a bottle of fresh reagent is placed on the instrument the delivery line from the reservoir to the valve block must be primed or filled with the reagent To prime the line argon pressure forces the chemical from its reservoir through the reagent valve blocks and to the waste bottle Functions 52 56 and 61 are also used during the phosphoramidi
12. Applied Biosystems Cooling Requirements The Model 391 or 391 EP generates a maximum of 600 Btu h While there are no special cooling requirements a constant laboratory temperature between 16 22 60 72 is recommended Avoid placing the instrument close to heaters or cooling ducts Temperatures below 16 C 60 F must be avoided because they will cause the tetrazole to precipitate from solution Argon A regulated cylinder size of prepurified 99 998476 argon must be connected to the rear panel of the synthesizer The instrument has a gas input that accepts 1 4 in o d Parflex tubing with ap propriate Swagelok tube fittings 1 4 in nut and ferrule A 10 ft length of Parflex tubing 1 4 in o d and the necessary Swagelok fittings to connect this tubing to the instrument are provided The argon tank requires a two gauge regulator with a CGA Compressed Gas Association 580 ar gon cylinder adapter on the inlet side and a Swagelok fitting that accepts a 1 4 in o d tube The primary gauge 0 3000 psi 0 25 000 kPa recommended measures tank pressure and the secondary gauge 0 200 psi 0 2000 kPa recommended measures regulated pressure The regulator must be obtained by the user prior to installation Typical argon consumption is approximately 3 0 m every four weeks Size 1A cylinders have a capacity of 8 2 cm and should last approximately three months The tank should be regulated to approximately 65 ps
13. main VALVE Select to activate a valve FXN Select to activate a function ALL OFF Immediately closes all valves The Valve Key To open or close valves first press VALVE and the screen will display Enter valve press on or off on off Opens the valve OFF Closes the valve 3 40 Section 3 Software Menu Descriptions Applied Biosystems MENU Erases a valve number after it was entered and returns to the previous menu Press MENU if VALVE was accidently selected from the previous display To activate the valve follow the instructions on the screen and enter a valve number To erase a mistake without returning to the previous menu move the cursor to the unwanted number and press the delete key on the fixed keyboard Next follow the prompt and press ON or OFF When you select ON the valve is activated The screen returns to the previous menu and shows the activated valve all off main A maximum of eight valves can be opened simultaneously by repeating this procedure i e Press VALVE enter the valve number then press ON Select ALL OFF to immediately close all valves To close a single valve select VALVE enter the appropriate valve number and press OFF The screen will then display the previous menu and show the valves still remaining open The Function Key Upon choosing FXN function the screen will display press on or off next prev ON Choose to activate the function
14. VALVE BLOCKS TETRAZOLE 2 s ACETIC ANHYDRIDE Ac 0 ll 1 METHYLIMIDAZOLE NMI TRICHLOROACETIC ACID TCA H IODINE s e s s ACETONITRILE CH CN GAS j Figure 4 1 Synthesizer Schematic 4 4 Section 4 Functions Cycles and Procedures Applied Biosystems Functions A valve or set of valves opened simultaneously to perform a specific delivery or task is a function Functions 1 through 90 108 and 109 provide all necessary operations for synthesis Seven test func tions 101 to 107 are used during the flow test procedure In addition up to eight user functions numbered 92 to 99 can be created using the Function Editor Menu Refer to Figure 4 3 for a com plete list of all functions Functions are automatically performed during a synthesis and require no intervention When a func tion is activated the correct valves automatically open After a specified time the function is deac tivated and the valves close Using the Manual Control Menu functions can also be manually activated prior to synthesis or when a synthesis is interrupted This can be useful when troubleshoot ing Functions are given abbreviated names to describe the action they perform For example Function 9 F9 is named 18 to column It delivers the contents of bottle 18 acetonitrile to the column Functions can be grouped according to their action see Figure 4 4 Not
15. days 10 nuaw 20812 495 ignis qut ON NAHAN 43165 4mnr Oi ANIN DNIO130H vow plou 25959 ZI 2 Z 9504 941215 5 as G jo 315 01 BIH 1 sass JOD vvv vvv lt S i aow 130 69 71 90 330 N0 buoy nuaw soppa 53 4409 aww buoy Jopuow YNG Section 3 Software Menu Descriptions 3 28 Applied Biosystems Main Menu Option Change Bottles The Change Bottles Menu provides a procedure for removing empty reservoirs and replacing them with bottles of fresh reagents In addition it displays bottle usage information and provides an alarm to alert you that reagent levels are low Upon selecting CHANGE BOTTLES the screen will read alarm 0 prev change Menu Description A reservoir number and an abbreviated description of its contents are displayed The above example shows Bottle 1 1 which contains A phosphoramidite The screen also shows the alarm and cycle or bottle usage information for the reservoir being viewed The Cycle Setting Cycle displays the number of cycles a reservoir has been accessed During a synthesis the software tabulates which bottles are accessed during each cycle of base addition Tabulation occurs when Function 33 cycle entry has been reached If a bottle has been used at
16. enter next menu Section 3 Software Menu Descriptions 3 11 Applied Biosystems If DNA 1 will be copied into a different location select NEXT until the correct DNA strand is shown In this example DNA 2 has zero bases However the copy command will over write any DNA sequence currently in DNA 2 Select ENTER to execute the copy command The DNA Edit Menu will then be displayed showing the sequence in DNA 2 and enabling any necessary editing Note that the DNA sequence will not only be in DNA 2 but will also remain in DNA 1 2 5 gt 3 60 space erase The Print Key The printout from the DNA Editor not only includes the DNA sequence but also lists the total num ber of bases the molecular weight the base composition and the time and date Note that base X and mixed base sites are not included in the molecular weight calculation The following example shows a DNA Editor printout DNA SEQUENCE 1 NUMBER OF BASES 10 BASES USED 2 C22 G 2 T 2 2 DALTONS 2644 TIME 10 00 DATE 06 01 89 5 gt 3 3 12 Section 3 Software Menu Descriptions Applied Biosystems Main Menu Option Start Synthesis This section describes the software of the start synthesis menu For more details on how to begin a synthesis refer to Section 2 Pre synthesis Check List and How to Begin a Synthesis When the instrument is ready to begin a synthe
17. gt J Male to Male Luer gt rr SEDE Stopper gt gt Figure 2 1 Manual Deprotection Apparatus Section 2 Operation 2 15 Applied Biosystems Methods 1 After the synthesis is complete remove the column from the instrument and attach one end to the syringe Luer Connect the male to male Luer to the other end of the column Next attach the syringe needle to the male to male Luer See Figure 2 1 With the syringe plunger inserted into the syringe barrel to the 0 5 mL mark insert the needle into some fresh room temperature ammonium hydroxide Draw up enough reagent to fill the column but minimize the volume in the syringe IMPORTANT The concentration of ammonia is critical Use fresh concentrated ammonium hydroxide which has been opened less than one month Insert the needle into the rubber stopper and let stand for 15 30 minutes This treatment begins cleavage and cyanoethyl deprotection Expel the ammonia into a small DNA collection vial There can be positive pressure inside the syringe system which can force some of the ammonia solution out of the needle as it is removed from the stopper This can be minimized by using ammonium hydroxide at room temperature and by slightly withdrawing the syringe barrel as you remove the needle from the stopper IMPORTANT Usea tightly sealed DNA collection vial that can withstand positive pressure The vial must also have a Tef
18. more editor synth bottles editor menu 2 When describing what a soft key does the key is boxed and appears at the left margin DNA EDITOR Creates edits and prints up to four DNA sequences 3 When the text refers to a key that you will press the key appears in capital letters When you select DNA EDITOR the screen displays one of the DNA strands and shows the number of bases in that strand Section 1 Introduction 1 11 Section2 Operation This section describes step by step procedures for operating the Model 391 DNA Synthesizer If questions arise about the software that are not explained in this section refer to Section 3 which describes all menus and keys in detail Before beginning a synthesis be sure to read the following parts Pre synthesis Check List How to Prepare Phosphoramidites How to Install Reagent Bottles How to Begin a Synthesis Post Synthesis Manual Deprotection and Cleavage and How to Store Reagents Use the rest of the section as you need to 2 2 Pre synthesis Check del e de ea eel i 2 3 How to Prepare Phosphoramidites 2 4 How to Dissolve Phosphoramidites 2 5 How to Store Dissolved 2 6 How to Install Reagent IIIA 2 7 How to Begin
19. probe was found to bind to a complementary strand and have similar dissociation temperature as a Section 2 Operation 2 23 Applied Biosystems 17 mer It is not well understood how deoxyinosine affects the stabilization of the DNA duplex however Martin et al determined the stability of oligodeoxyribonucleotide duplexes with each of the four normal bases using optical techniques for measuring melting temperatures They observed large neighboring base effects upon the stability of the base pairs between inosine and the normal bases The results obtained by this group indicate that deoxyinosine reduces the specificity of hybridiza tion probes Ohtsuka from the faculty of Pharmaceutical Sciences and Institute for Molecular and Cellular Bi ology at Osaka Japan has found that synthetic oligonucleotides with deoxyinosine residues at am biguous points are useful as hybridization probes Takahashi also from Osaka University used a synthetic probe containing deoxyinosine to isolate the cholecytokinin gene directly from a human genomic library 2 24 Section 2 Operation Applied Biosystems How to Change an Argon Tank You can replace an empty argon tank before beginning a synthesis or when a synthesis has been interrupted Replace the empty cylinder as follows 1 2 Shut off the cylinder at the tank and at the needle valve on the regulator Remove the line that connects the tank to the synthesizer by unscre
20. sistently corroborated For convenience in this manual the detritylation acid will exclusively be re ferred to as TCA Detritylation in more detail Immediately before detritylation the CPG support is washed with acetonitrile to eliminate traces of the preceding reagent Next TCA bottle 14 is delivered to the column to cleave the trityl group Detritylation under anhydrous conditions is a reversible reaction The DMT cation is highly reac tive and can re tritylate any reactive nucleophile Detritylation is driven to completion by the re moval of the DMT cation from the synthesis column Therefore detritylation is conducted by continuous delivery of TCA and elution of the DMT cation Unlike the other reactions in the cycle there is no wait period for detritylation Any residual TCA must be removed by an acetonitrile wash to prevent detritylation of the incoming phosphoramidite If the phosphoramidite monomer be comes detritylated an unwanted dimer can form in solution and then couple to the support bound nucleotide chain Continued chain propagation would result in some sequences being longer than the product making purification difficult Following both acetonitrile washes the remaining solvent is forced out of the column by an argon reverse flush argon passes through the column from top to bottom and pushes the liquid to waste For a summary of these steps see Table 6 1 6 8 Section 6 Chemistry for Automated DNA Synthesis A
21. 0 180 331409 United Kingdom Warrington Cheshire 44 0 1925 825650 44 0 1925 282502 All other countries not listed Warrington UK 44 0 1925 282481 44 0 1925 282509 Japan Japan Hacchobori Chuo Ku Tokyo 81 3 5566 6230 81 3 5566 6507 Latin America Del A Obregon Mexico 305 670 4350 305 670 4349 To Reach Technical Support Through the Internet We strongly encourage you to visit our Web site for answers to frequently asked questions and for more information about our products You can also order technical documents or an index of avail able documents and have them faxed or e mailed to you through our site The Applied Biosystems Web site address is http www appliedbiosystems com techsupp To submit technical questions from North America or Europe hours Step Action 5 Access the Applied Biosystems Technical Support Web site 6 Under the Troubleshooting heading click Support Request Forms then select the relevant support region for the product area of interest 7 Enter the requested information and your question in the displayed form then click Ask Us RIGHT NOW blue button with yellow text 8 Enter the required information in the next form if you have not already done so then click Ask Us RIGHT NOW You will receive an e mail reply to your question from one of our technical experts within 24 to 48 E 22 Appe
22. 17 Interrupt 31 Recorder On 32 Recorder Off 33 Cycle Entry 34 Cycle End DELIVER TO COLUMN 9 18 to Column 13 415 to Column 14 14 to Column 19 Base Tetrazole to Column 22 Cap to Column 101 A to Column 102 G to Column 103 C to Column 104 T to Column 105 X to Column 90 TET to Column 106 11 to Column 107 12 to Column RINSE AND FLUSH 1 Block Flush 2 Reverse Flush 9 18 to Column 10 418 to Waste 108 Flush to Trit 109 Flush thru Col PREPARE REAGENTS 16 Cap Prep 28 Phosphoramidite Prep 43 18 Prep 51 Tetrazole Prep PRIME DELIVERY LINES 52 A to Waste 53 G to Waste 54 C to Waste 55 T to Waste 56 X to Waste 59 Cap A to Waste 60 Cap B to Waste 61 Tetrazole to Waste 81 15 to Waste 82 14 to Waste ARGON TO RESERVOIRS 62 Flush to A 63 Flush to G 64 Flush to C 65 Flush to T 66 Flush to X 69 Flush to Tetrazole 70 Flush to 18 86 Flush to 14 15 89 Flush to 11 12 ACETONITRILE TO RESERVOIRS 71 18 to A 72 18 to G 73 4818 to C 74 18 to T 75 18 to X 78 18 to Tetrazole 84 18 to 14 85 18 to 15 87 18 to 11 88 18 to 12 Section 4 Functions Cycles and Procedures 4 9 Applied Biosystems Synthesis Cycle Functions This part of Section 4 categorizes the functions and explains what each function does Functions which deliver a reagent to the column
23. Contact the Applied Biosystems Technical Support Department for repair instructions The Column The initial support bound nucleoside is contained in a disposable column which has two silica re taining filters two end fittings and two caps Figure 5 5 All parts except the aluminum caps are made of inert materials The retaining filters are porous Teflon held in place by a circular ridge on the inside of the column Under pressure from the metal cap the end fittings press against the ridge to form a tight seal around the edge of each filter Tear off aluminum tabs protect the filters during shipping The inlet and outlet are female Luer fittings designed to mate with the male Luer fittings on the instrument The column is symmetrical i e no top or bottom no front or back and can be attached to the male Luer fittings in any way Each column is color coded to show the initial nucle oside and has a unique serial number Column Color code A green G yellow C red T blue The normal flow into the column is from the bottom By sending the liquid stream upward the CPG particles are lifted and maintained in a fluidized state The flow rates of the solvents and reagents have been set to achieve proper mixing of the particles 5 10 Section 5 System Description Hardware Applied Biosystems COLUMN BODY NL COLUMN ALUMINUM 13mm Figure 5 5 The Column Waste and Venting The ultimate destina
24. STEP 1 OF 9 STEPS 3 30 Section 3 Software Menu Descriptions Applied Biosystems STOP Select to halt the current step and return to the previous menu Stop has the same function in all Change Bottles displays Note Do not reuse the phosphoramidites or tetrazole after these steps are completed because the reservoirs now contain HPLC grade acetonitrile from bottle 18 If you are going to remove partially used phosphoramidites store them and reuse them later the bottle change procedure should not be performed See Section 2 for instructions on How to Store Dissolved Phosphoramidites When these steps are completed the screen displays Change bottle 1 A PHOS then enter enter stop Follow the prompt Change Bottle 1 A PHOS Remove the empty reservoir and upon opening the fresh bottle quickly place it on the instrument For details on How to Install Reagent Bottles refer to Section 2 After the reservoir is correctly installed press ENTER The reservoir is then prepared for chemical deliveries and the cycle counter is reset to zero The screen will now display the step number being performed and the time remaining for that step Changing 1 STEP 6 OF 9 STEPS When the procedure is finished the display returns to the first menu in this series enabling you to change an additional bottle To return to the Main Menu select MAIN Now the synthesis can either begin by selecting START SYNTH or continue
25. Toluenesulfonic Acid Purchase the 500 g bottle of p toluenesulfonic acid monohydrate 99 P N T 3751 from Sigma Chemical Co St Louis MO 63178 This is used to dilute the trityl cation WARNING P toluenesulphonic acid is hazardous and must be handled with great caution Refer to the Sigma Chemical Co MSDS to familiarize yourself with its hazards and the precautions that must be taken All procedures must be conducted in a correctly operating fume hood Use of eye protection appropriate rubber gloves and safety clothing is imperative Ammonium Hydroxide As mentioned under Start Up Chemical Kit on page 7 you must purchase concentrated analytical grade ammonium hydroxide preferably in 500 mL bottles for deprotection This reagent is not included in the Start Up Chemical Kit WARNING Ammonium hydroxide is hazardous and must be handled with great caution Refer to the supplier s MSDS to familiarize yourself with its hazards and the precautions that must be taken procedures must be conducted in a correctly operating fume hood Use of eye protection appropriate rubber gloves and safety clothing is imperative E 12 Appendix E Warranty 391 Pre Installation Manual Applied Biosystems Site Preparation Laboratory Space Allocating sufficient laboratory space Figure E 1 is critical for successful installation and trouble free maintenance A sturdy freestanding table with locking wheels is strongly preferred o
26. inner surfaces of the chemical delivery system are made of inert materials Controller Chemical Delivery System Column Valve Optional Fraction Collector Waste Bottle Figure 5 1 Major Components of the Model 391 Section 5 System Description Hardware 5 3 Applied Biosystems Pressure System pressure is provided by pre purified 99 909840 argon Argon s high density and low oxygen contamination make it preferable to nitrogen An argon cylinder is connected to the inlet port at the right rear of the Model 391 using 14 inch oxygen impermeable tubing and a gas tight connector sup plied by Applied Biosystems The pressure regulator on the tank is set to 60 psi This high pressure argon is used to operate the vacuum assist system described later in this section and to supply ar gon to a regulator in the synthesizer IMPORTANT The argon cylinder must always be connected to the synthesizer before the power is turned on If this is not done the vacuum assist valves will be activated continuously and can overheat and fail causing argon to leak An empty argon cylinder can be replaced before beginning a synthesis or when an active synthesis is interrupted Refer to Section 2 How to Change an Argon Tank Argon entering the synthesizer travels through a 10 micron particle filter to a pressure regulator The regulator delivers argon to specific pressure valves used to pressurize the reagent and solvent re
27. supplies a 25 foot length of tubing to connect the vent line to a fume hood Proper venting allows operation of the Model 391 on an open lab bench IMPORTANT Prevent condensation from collecting in the vent line by continuously sloping the tubing upward toward the fume hood The tubing should not be horizontal or have troughs that will form collecting points Condensation will eventually cause erratic deliveries and can even stop the flow IMPORTANT The waste bottle is the low pressure side of the delivery system and must always be vented to atmosphere If itis not back pressure will be generated which will decrease the deliveries of reagents and solvents The Battery A lithium battery is provided in the Model 391 When the main power is turned off either inten tionally or during a power failure all synthesis parameters are retained These parameters include the DNA sequences user defined cycles procedures and functions and bottle usage information If a power failure occurs during an active synthesis the synthesis will be interrupted and can only be resumed when the main power returns The battery also maintains the synthesizer s internal clock If a power outage does occur the clock records the time the power failed and the time it was restored A synthesis will then automatically resume if the elapsed time of the failure is less than the time you entered in the Power Fail Menu Refer to Section 3 Main Menu Option Po
28. the contents of the bottles are delivered to waste to prime the lines using F 59 for acetic anhydride and F 60 for NMI for 5 seconds Finally the valve blocks are rinsed and cleared by F 10 for 7 seconds and F 1 for 10 seconds The TCA Bottle 14 and iodine Bottle 15 reservoirs use the same bottle change procedure The valve blocks are cleared and rinsed by F 1 for 5 seconds and F 10 for 7 seconds The bottles are then removed and replaced Next the delivery lines are primed for 5 seconds F 82 for TCA F 81 for iodine Finally the valve blocks are rinsed and cleared by 10 for 7 seconds and then F 1 for 10 seconds 4 26 Section 4 Functions Cycles and Procedures Applied Biosystems The Shut Down Procedure The shut down procedure prepares the instrument for long term storage It removes all reagents in the delivery lines and washes and dries all chemical pathways To perform this procedure select Shut Down from the main menu and follow the instructions in Section 3 STEP FUNCTION NUMBER FUNCTION TIME NUMBER DESCRIPTION SECONDS 1 BLOCK FLUSH 5 2 F 10 18 TO WASTE 5 3 F71 18 TOA 60 4 F 72 18 TOG 60 5 F 73 18 TOC 60 6 F 74 18 TOT 60 7 F 75 18 TOX 60 Old phosphoramidites in the delivery lines are removed and forced back into the reservoirs by an acetonitrile wash 8 F 62 FLUSH TO A 60 9 F 63 FLUSH TO G 60 10 F 64 FLUSH TOC 60 11 F 65 FLUSH TO T 60 12 F 66 FLUSH TO X 60 The lines are cleared by an
29. 10uM cycles do not appear as options Note The first time the main power is turned on the Applied Biosystems ROM cycles are automatically loaded into the RAM cycle locations as shown below For example to synthesize using the 2 cycle simply display Cycle 1 63 in the Start Synthesis Menu ROM RAM Total crude synthesis cycle Number yield O D cycle location of steps 20mer 2uM Cycle 1 63 5 5 20 25 luM Cycle 2 64 5 5 100 120 Low Cycle 3 61 5 5 20 25 10uM Cycle 4 53 24 800 1000 Yield figures based on a 20mer sequence Absorbance measured at 260nm Assuming 33 micrograms O D unit The Low cycle is on the 2uM scale After the ROM cycles are transferred to RAM cycle locations they will be stored there indefinitely until you change or delete them Once transferred they can be edited as desired Once you edit a cycle the edited version will be stored in RAM and will appear in the Start Synthesis Menu If the 3 34 Section 3 Software Menu Descriptions Applied Biosystems main power is turned off the edited version will still be stored in RAM If you want to transfer a ROM cycle back into a RAM location use the COPY key The Cycle Editor Menu Upon selecting CYCLE EDITOR the display shows a cycle name and the number of steps in that cycle If a cycle has zero steps it has not been defined The following example shows Cycle 1 which has 63 steps due to the automatic transfer of the 2uM cycle Select acti
30. 14 1 508 383 7855 Expedite Nucleic acid Synthesis Systems 1 800 899 5858 then press 15 1 508 383 7855 Peptide Synthesis Pioneer and 9050 Plus Peptide Synthesizers 1 800 899 5858 then press 15 1 508 383 7855 PNA Custom and Synthesis 1 800 899 5858 then press 15 1 508 383 7855 E 20 Appendix E Warranty 391 Pre Installation Manual Applied Biosystems Product or Product Area Telephone Dial Fax Dial FMAT 8100 HTS System and Cytofluor 4000 Fluorescence Plate Reader 1 800 899 5858 then press 16 1 508 383 7855 Chemiluminescence Tropix 1 800 542 2369 U S only or 1 781 271 0045 1 781 275 8581 Applied Biosystems MDS Sciex 1 800 952 4716 1 650 638 6223 Outside North America Region Telephone Dial Fax Dial Africa and the Middle East Africa English Speaking and West Asia Fairlands South Africa 27 11 478 0411 27 11 478 0349 South Africa Johannesburg 27 11 478 0411 27 11 478 0349 Middle Eastern Countries and North Africa Monza Italia 39 0 39 8389 481 39 0 39 8389 493 Eastern Asia China Oceania Australia Scoresby Victoria 61 3 9730 8600 61 3 9730 8799 China Beijing 86 10 64106608 86 10 64106617 Hong Kong 852 2756 6928 852 2756 6968 Korea Seoul 82 2 593 6470 6471 82 2 593 6472 Mala
31. 20 RN Wo NN NNOO 4 4 2 O22 7 C 0 21 mer 17 21 17 21 oa D 7 21 BOMNNOOS MM MIA MM co 0 0mN OOOOOOoOO PO 0 16 23 4 Appendix A Functions Cycles and Procedures Applied Biosystems 391 FUNCTION LIST VERSION TIME DATE FUNCTION NUMBER 92 93 94 95 96 97 98 99 FUNCTION NUMBER 101 102 103 104 105 106 107 108 109 03 16 05 10 89 FUNCTION NAME USER A USER B USER C USER D USER E USER USER G USERH FUNCTION NAME A TO COLUMN G TO COLUMN C TO COLUMN T TO COLUMN X TO COLUMN 11 TO COLUMN 12 TO COLUMN FLUSH TO TRIT FLUSH THRU COL FUNCTION VALVE LIST FUNCTION VALVE LIST 11 12 16 20 10 12 16 20 9 12 16 20 Appendix A Functions Cycles and Procedures A 5 Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME 2uM NUMBER OF STEPS 63 TIME 04 22 DATE 05 11 89 STEP FUNCTION STEP ACTIVE FOR BASES NUMBER NAME TIME A G T X 1 10 18 TO WASTE 2 Yes Yes Yes Yes Yes 2 9 18 TO COLM 15 Yes Yes Yes Yes Yes 3 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 4 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 5 28 PHOS PREP 3 Yes Yes Yes Yes Yes 6 90 TET TO COLUMN 3 Yes Yes Yes Yes Yes 7 19 B TET TO COL
32. 43 0 1 867 35 750 43 0 1 867 35 75 11 Belgium 32 0 2 712 5555 32 0 2 712 5516 Czech Republic and Slovakia Praha 420 2 61 222 164 420 2 61 222 168 Denmark Naerum 45 45 58 60 00 45 45 58 60 01 Finland Espoo 358 0 9 251 24 250 358 0 9 251 24 243 France Paris 33 0 1 69 59 85 85 33 0 1 69 59 85 00 Germany Weiterstadt 49 0 6150 101 0 49 0 6150 101 101 Hungary Budapest 36 0 1 270 8398 36 0 1 270 8288 Italy Milano 39 0 39 83891 39 0 39 838 9492 Norway Oslo 47 23 12 06 05 47 23 12 05 75 Poland Lithuania Latvia and Estonia Warszawa 48 22 866 40 10 48 22 866 40 20 Portugal Lisboa 351 0 22 605 33 14 351 0 22 605 33 15 Section 1 Introduction 1 7 Applied Biosystems Telephone Fax Region Dial Dial Russia Moskva 7 095 935 8888 7 095 564 8787 South East Europe Zagreb Croatia 385 1 34 91 927 385 1 34 91 840 Spain Tres Cantos 34 0 91 806 1210 34 0 91 806 1206 Sweden Stockholm 46 0 8 619 4400 46 0 8 619 4401 Switzerland Rotkreuz 41 0 41 799 7777 41 0 41 790 0676 The Netherlands Nieuwerkerk IJssel 31 0 180 331400 31 0 180 331409 United Kingdom Warrington Cheshire 44 0 1925 825650 44 0 1925 282502 All other countries not listed Warrington UK 44 0 1925 282481 44 0 1925 282509 Japan Japan Hacchobori Ch
33. 7 TIME 03 18 DATE 05 10 89 STEP FUNCTION STEP NUMBER TIME 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 7 3 17 INTERRUPT 1 4 16 CAP PREP 5 5 60 CAP B TO WASTE 5 6 10 18 TO WASTE 7 7 1 BLOCK FLUSH 10 Appendix A Functions Cycles and Procedures A 21 Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 14 BOTTLE CHANGE NUMBER OF STEPS 6 TIME 03 19 DATE 05 10 89 STEP FUNCTION STEP NUMBER TIME 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 7 3 17 INTERRUPT 1 4 82 14 TO WASTE 5 5 10 18 TO WASTE 7 6 1 BLOCK FLUSH 10 A 22 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 15 BOTTLE CHANGE NUMBER OF STEPS 6 TIME 03 19 DATE 05 10 89 STEP FUNCTION STEP NUMBER TIME 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 7 3 17 INTERRUPT 1 4 81 15 TO WASTE 5 5 10 18 TO WASTE 7 6 1 BLOCK FLUSH 10 Appendix A Functions Cycles and Procedures A 23 Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 18 BOTTLE CHANGE NUMBER OF STEPS 5 TIME 03 19 DATE 05 10 89 STEP FUNCTION STEP NUMBER TIME 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 7 3 17 INTERRUPT 1 4 10 18 TO WASTE 7 5 1 BLOCK FLUSH 10 A 24 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard PHOS PURGE NUMBER OF STEPS 9 TIME 03 17 D
34. G C T X delete and left and right arrows The labels and actions of the soft keys change depending on the information dis played directly above them The software is menu driven where menus and pages of menus present various options and nec essary information about the synthesis or status of the instrument In response you select an option and give instructions by pressing the appropriate key For a complete description of all menus refer to Section 3 To perform automated synthesis the software uses a cycle consisting of a series of steps which com plete all chemical reactions For further information about cycles see Section 3 Main Menu Op tion Cycle Editor and Section 4 Synthesis Cycles Proper operation of the controllers electronic components are verified by a system self test For fur ther instructions refer to Section 3 Main Menu Option Self Test Section 5 System Description Hardware 5 13 Applied Biosystems IMPORTANT A fan on the rear of the instrument distributes air through the electronics for cooling and should not be obstructed Fuses The Model 391 has two power fuses They are located at the rear of the instrument to the left of the fan and directly above the power line Although the fuses have a very long life they can stop oper ating For example if the 391 has no power i e the fan is not working or the LCD screen is blank a bad fuse may be causing the problem and will need re
35. G TO COL WAIT C TO COL WAIT T TO COL WAIT X TO COL WAIT TET PREP TET TO COL WAIT CAP PREP 11 TO COL WAIT 12 TO COL WAIT 14 TO COL WAIT 15 TO COL WAIT 18 PREP 18 WASTE WAIT 18 TO COL INTERRUPT WASTE PORT TIME 40 20 20 20 20 20 20 20 20 20 20 20 10 120 20 120 20 120 20 120 20 120 20 10 120 20 10 120 20 120 20 120 20 120 20 10 120 20 120 Appendix A Functions Cycles and Procedures A 27 Applied Biosystems Flow test procedure continued STEP FUNCTION TIME 45 14 TO COL 150 46 INTERRUPT 1 47 BLOCK FLUSH 60 48 WASTE BOTTLE 1 49 FLUSH TO 18 60 50 FLUSH TO 14 15 60 51 FLUSH TO 11 12 60 52 FLUSH TO TET 60 53 FLUSH TO X 60 54 FLUSH TO T 60 55 FLUSH TOC 60 56 FLUSH TO G 60 57 FLUSH TO A 60 58 REVERSE FLUSH 60 59 BLOCK FLUSH 60 A 28 Appendix A Functions Cycles and Procedures Appendix B DNA Synthesizer Schematic DNA Synthesizer Plumbing Diagram Applied Biosystems COLUMN VALVE BLOCKS REAGENT VALVE BLOCKS 22 GAS GAS i Lum 11 12 15 Ac 0 NMI b TCA 9 gt gt e 9 o COLUMN gt e 9 ee lt e 9 9 x e s Es s s TETRAZOLE ACETIC ANHYDR
36. Guanosine isobutyry protected b Thymidine Cytosine benzoy protected Figure 6 3 Protected exocyclic base amines Adenosine A and cytosine C are protected by a benzoyl group Bz and guanosine G by an isobutyryl group Ib Thyrnidine T does not need a protecting group DNA Synthesis Chemistry Cycle Each cycle of base addition consists of four steps 1 Detritylation 2 Coupling 3 Capping 4 Oxidation These reaction steps are repeated in the above order until all bases are added Following synthesis the DNA chain must be manually cleaved and deprotected from the solid support Each step will be discussed in detail Section 6 Chemistry for Automated DNA Synthesis 6 7 Applied Biosystems Detritylation The first step in oligonucleotide synthesis is to remove the acid labile dimethoxytrityl DMT pro tecting group on the 5 hydroxyl of the support bound nucleoside As shown in Figure 6 4 treatment with the protic acids trichloroacetic acid TCA or dichloroacetic acid DCA will deprotect or de tritylate the 5 end This will yield a reactive 5 hydroxyl which can couple with a phosphoramidite during the following addition step The two acids can be used interchangeably and are both avail able from Applied Biosystems Dichloroacetic acid is a weaker acid and may yield lower levels of depurination in the synthesis of long oligonucleotides However this observation has not been con
37. Horn and Mickey Urdea of Chiron Co published a procedure for extending the utility of OPC to the purification of long oligonucleotides They found that apurinic sites undergo internu cleotide cleavage with 1 molar lysine without cleavage of the oligonucleotide from the support See the Protocol for Lysine Pre treatment of Longmers gt 70 bases The DMT bearing cleavage fragment is washed away leaving a non DMT bearing fragment bound to the support Following ammonia cleavage and deprotection they used the OPC purification protocol This was effective in purifying oligomers up to 118 bases in length Although depurination is a valid concern during DNA synthesis of long oligonucleotides the de gree of depurination encountered during synthesis is highly sequence and reagent dependent Since 2 36 Section 2 Operation Applied Biosystems the 3 bases of an oligo the initial couplings have the greatest reagent exposure varied purine con tent in this area will generate varied potential for depurination Another factor in depurination is the purity of the acid used for detritylation Contaminants such as water or in the trichloroacetic or dichloroacetic acid will greatly promote depurination Applied Biosystems supplies high purity trichloroacetic and dichloroacetic acid reagents In a study involving the synthesis of a 72 mer the use of Applied Biosystems reagents did not promote detectable depurination Analysis of t
38. Option Cycle Editor for instructions ROM RAM cycle Total cycle time crude synthesis location number of min yield O D cycle steps 20mer Cycle 1 63 5 5 20 25 luM Cycle 2 64 5 5 100 120 Low Cycle 3 61 5 5 20 25 10uM Cycle 4 53 25 800 1000 Yield figures based on a 20mer sequence Absorbance measured at 260nm Assuming 33 micrograms O D unit The Low cycle is on the 2uM scale The synthesis cycle Low is a low reagent consumption cycle on the 2uM scale It uses 33 less phosphoramidites than the 2uM cycle although its coupling efficiencies are slightly lower about 97 Low can be used to synthesize sequences less than 50 bases Sequences less than 30 bases usually only need desalting Sequences greater that 30 bases should be OPC purified c Press ON OFF until the desired ending method is shown The 5 terminus of the fully synthesized DNA chain can either remain protected by a dimethoxytrityl group trityl on or can be detritylated to yield a 5 hydroxyl trityl off Trityl on is usually selected when purifying by trityl specific OPC or reverse phase HPLC Trityl off is usually chosen when purifying by gel electrophoresis or ion exchange HPLC When all information is displayed correctly select BEGIN bottles will then be checked for us age Checking bottle usage for base 1 Please Wait 2 10 Section 2 Operation Applied Biosystems According to the alarm you set in the C
39. Shutdown step 1 of 29 steps seconds 60 total time 17 min During these steps old reagents are removed from the lines by acetonitrile washes The lines are then flushed dry When all steps are completed the screen will read Remove all bottles wipe all lines enter 3 52 Section 3 Software Menu Descriptions Applied Biosystems Follow the prompt and take all bottles off the instrument and the wipe all delivery lines with a lint free tissue When finished press ENTER The screen will then show the steps being performed ad ditional argon flushes Shutdown step of 29 steps seconds total time 17 min When finished the screen will read Place clean bottles on all positions To protect the exposed delivery lines place clean empty bottles on all positions STOP Halts the procedure Section 3 Software Menu Descriptions 3 53 Section4 Functions Cycles and Procedures This section contains information essential to understanding functions synthesis cycles and proce dures Be sure to read the Introduction Valves Functions pages 4 5 to page 4 6 and Synthesis Cy cles pages 4 18 to 4 20 The rest of the section can be used as needed Introduction eee REA Ur Rad ERA ga RE awa heed wee ee 4 2 bin MIA TET 4 2 Functions Synthesis Cycle Functions 4 10 Procedure Functions ios ena ee ene Ne pede e pe pad ave Vac des Voces 4 15 Test F nctions oo ete epp HUS S ie er p i OREMUS t
40. The following five functions provide for flow of a reagent driven by argon pressure from its res ervoir through the valve block through the column and ultimately to the waste bottle Since the column is the site of all chemical reactions necessary for synthesis these deliveries are critical FUNCTION NAME VALVES NUMBER F9 18 TO COLUMN 1 17 12 16 Acetonitrile is delivered to the column frequently used during synthesis to wash the column and support to remove traces of reagents before a chemical step F 13 15 TO COLUMN 2 12 16 18 Iodine is delivered to the column used to oxidize the DNA following capping F 14 14 TO COLUMN 3 12 16 19 is delivered to the column used to detritylate the support bound oligonucleotides prior to coupling F 19 BASE TET TO COLM X 12 16 20 23 6 X any combination of 7 8 9 10 11 According to the sequence the correct phosphoramidite s and tetrazole are lsimultaneously delivered to the column to perform the coupling reaction F22 CAP TO COLM 4 5 12 16 22 Both capping reagents acetic anhydride cap A and NMI cap B are simultaneously delivered to the column used following coupling to terminate or cap unreacted oligonucleotide chains F 90 TET TO COLUMN 6 12 16 23 Tetrazole is delivered to the column activates phosphoramidites for coupling reaction 4 10 Section 4 Functions Cycles and Procedures Applied Biosystems Functions which
41. Triehloraacetit dichloromethane Figure D 1 Model 391 PCR MATE DNA Synthesizer Front View D 6 Appendix D 391 Illustrated Parts List Applied Biosystems Figure D 2 Model 391 PCR MATE M DNA Synthesizer Left Side View Appendix D 391 Illustrated Parts List D 7 Applied Biosystems 7 OF Figure D 3 Model 391 PCR MATE DNA Synthesizer Rear View D 8 Appendix D 391 Illustrated Parts List Applied Biosystems Figure D 4 Model 391 PCR MATE M DNA Synthesizer Controller PCB Memory Module and Cabling Appendix D 391 Illustrated Parts List D 9 Appendix E Warranty 39 Pre Installation Manual Salety posu E 3 User Attention Words Material Safety Data Sheets and Waste Profiles 4 Abbreviations Initializations and 6 Introduction 4 i A Bese Se a he ROI ee oa AS DRE E 7 Chemicals and Accessories llle E 7 Start Up Chemical Kit ete RE ERAS REDE EMI UD E 7 Additional Chemicals and Columns ees E 9 Shipping List EC ee Me debi iesu eq ede deer dec E 10 User Supplied Equipment 5 E 11 Site Preparations Se uo lel ARUM EE E dede E 13 Laboratory CR be Ue NS a E 13 Electrical Requirem nts onere DUCES qu DV RId Gast ging a exp E 14 Power Quality solio ee
42. Yes 28 9 18 TO COLM 50 Yes Yes Yes Yes Yes 29 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 30 9 18 TO COLM 50 Yes Yes Yes Yes Yes 31 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 32 9 18 TO COLM 50 Yes Yes Yes Yes Yes 33 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 34 9 18 TO COLM 50 Yes Yes Yes Yes Yes 35 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 36 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 37 33 CYC ENTRY 1 Yes Yes Yes Yes Yes 38 10 18 TO WASTE 3 Yes Yes Yes Yes Yes 39 9 18 TO COLM 80 Yes Yes Yes Yes Yes 40 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 41 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 42 5 ADVANCE FC 1 Yes Yes Yes Yes Yes 43 6 WASTE PORT 1 Yes Yes Yes Yes Yes Continued next page A 12 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE NAME 10uM NUMBER OF STEPS 53 TIME 04 25 DATE 05 11 89 STEP FUNCTION NUMBER NAME 44 82 14 TO WASTE 45 14 14 TO COLUMN 46 2 REVERSE FLUSH 47 1 BLOCK FLUSH 48 10 18 TO WASTE 49 9 18 TO COLM 50 2 REVERSE FLUSH 51 1 BLOCK FLUSH 52 7 WASTE BOTTLE 53 34 CYC END STEP TIME 160 45 80 45 A Page 2 ACTIVE FOR BASES G 1 X Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Appendix A Functions Cycles and Procedures Applied
43. a powerful acetylating agent The two reagents need to Section 6 Chemistry for Automated DNA Synthesis 6 15 Applied Biosystems be segregated since the active acetylating agent is unstable This agent reacts at the 5 hydroxyls ren dering these moieties unreactive for the remainder of the synthesis The excess reagents are then removed by an argon reverse flush The capping time required to acetylate the 1 or 2 unreacted 5 hydroxyls is very brief only a few seconds It is important to minimize this time to prevent loss of cyanoethyl groups from the internucleotide linkages and to prevent base modification by products The efficiency of shorter capping time and the capping oxidation order have been extensively dem onstrated in studies at Applied Biosystems i SF 2 A _ N77 WCHs CH3C N N CH3 CH3COCCH EMEN CIN Ez ACETIC ANHYDRIDE N METHYL IMIDAZOLE ACETYLATING REAGENT HO B D CH3CO FAILURE SEQUENCES CAPPED FAILURE SEQUENCES Figure 6 7 Capping of unreacted chains The capping reagents acetic anhydride and 1 methylimidazole NMI are used to terminate unreacted chains by acetylating the 5 hydroxyl groups Oxidation The newly formed internucleotide linkage is a phosphite trivalent phosphorous triester The phos phite linkage is unstable and is susceptible to acid and base cleavage Therefore immediately after capping the trivalent phosphite triester is oxidized to a stable pentavalent pho
44. allowing you to begin again The above menu gives the option of purging the tetrazole and phosphoramidite delivery lines prior to beginning a synthesis A purge refills these lines with fresh reagents This is strongly recom mended when the instrument has been idle for more than 12 hours more than 6 hours in humid en vironments or if one of the phosphoramidite reservoirs has not been accessed within 12 hours Over this time oxygen and atmospheric water can penetrate the delivery lines and cause failures of the fast addition reaction Answer the question do you want to purge the phosphoramidite delivery lines Choose YES or NO Bypasses the purge steps Synthesis automatically begins and the menu dis playing the synthesizing status is shown NO is usually chosen when the instru ment has been running continuously and all phosphoramidites have been accessed within 12 hours YES Purges the phosphoramidite lines The screen then shows the step number be ing performed and the time remaining for that step Phos purge step 1 of 9 steps seconds Section 3 Software Menu Descriptions 3 15 Applied Biosystems When all steps are finished the synthesis automatically begins and the menu displaying the synthe sizing status is shown STOP Ends the purge by performing steps 8 and 9 of the procedure which rinse the reagent valve blocks The following menu is then shown Rinsing step 8 of 9 steps seconds Once
45. argon flush to each bottle 13 10 18 TO WASTE 10 14 78 18 TO TET 60 15 87 18 TO 11 60 16 88 18 TO 12 60 17 84 18 TO 14 60 18 85 18 TO 15 60 Reagents in these delivery lines are removed and forced back into the reservoirs by an acetonitrile wash 19 69 FLUSH TO TET 60 20 89 FLUSH TO 11 12 60 21 86 FLUSH TO 14 15 60 The lines are cleared by an argon flush to each bottle 22 10 18 TO WASTE 10 23 1 BLOCK FLUSH 5 24 17 INTERRUPT 1 17 Provides a pause to remove all bottles and wipe the lines 25 62 FLUSH TO A 5 26 63 FLUSH TO G 5 27 64 FLUSH 5 28 65 FLUSH 5 29 66 FLUSH TO X 5 30 70 FLUSH TO 18 10 Provides an additional argon flush to clear the phosphoramidite and acetonitrile lines 31 1 BLOCK FLUSH 10 Section 4 Functions Cycles and Procedures 4 27 Applied Biosystems The Flow Test Procedure The flow test procedure is used to measure flow rates through all essential delivery lines It can be used for routine maintenance troubleshooting and recalibration of the instrument if you suspect flow related problems To perform this procedure select SELF TEST from the Main Menu Then press MORE until the FLOWTST option is shown Further instructions appear in Section 3 Main Menu Option Self Test and Section 2 How to Perform the Flow Test Procedure This procedure is not found in the procedure editor and cannot be edited or printed A copy of the flow test procedure can be found in Appendix A The
46. been interrupted either manually or by the alarm This process is especially important for preventing ox ygen and water contamination of atmosphere sensitive phosphoramidites and tetrazole In summary the procedure begins by removing old reagent from the delivery line and forcing it back into the reservoir by an acetonitrile wash The bottles are then removed and replaced Next argon purges the reservoir s headspace to eliminate air and the delivery line is then refilled with fresh reagent For a complete description of the bottle change procedures see Section 4 To begin the procedure press CHANGE The screen will read Enter bottle 10 change 1 press enter enter menu Follow the instructions and enter the bottle number that you want to change Note that the screen will automatically display the bottle number which was showing in the previous menu If a different reservoir needs to be changed type the appropriate number and it will appear on the screen Be sure it is the correct number as printed on the bottle label and above its receptacle Next press ENTER and the steps which prepare the bottle for removal will begin The screen will display which bottle is being changed the step number being performed and the time remaining for that step For example if the A phosphoramidite reservoir is empty and needs replacing enter 1 unless 1 is already displayed press ENTER and the screen will read Changing 1
47. bottle labels The numbers are 1 5 9 11 12 14 15 and 18 These numbers correspond to those on other Applied Bio systems DNA synthesizers which have 18 positions WARNING Consider each chemical in the synthesizer potentially harmful Do not inhale vapors Work in a well ventilated area Always use eye protection and wear acid impermeable gloves and a lab coat Do not leave any chemicals uncapped If any chemical is ingested or comes in contact with the eyes immediately consult a physician If there is any physical contact with a chemical wash immediately with water Please refer to the Material Safety Data Sheets MSDS in the Safety Data Section for further information about the chemicals The MSDS provide details about physical characteristics hazards precautions first aid spill cleanup and disposal procedures In addition refer to Section 2 How to Change the Waste Bottle before waste disposal How to Store Reagents Applied Biosystems chemicals must be stored properly to assure their stability Improper storage will result in reduced shelf life All DNA synthesizer reagents except the iodine solution are guar anteed for one year from the date of manufacture The iodine is guaranteed for six months from the date of manufacture Please follow the storage recommendations below Store at room temperature away from excessive heat and moisture e 1 methylimidazole bottle 12 Acetic Anhydride bottle 11 Trichloroacetic Acid b
48. care when dissolving them The following instructions will help avoid contamination prevent degradation and ensure high coupling yields Important factors to consider when dissolving phosphoramidites 1 Useanhydrous acetonitrile with less than 90 ppm water to dissolve the phosphoramidites Use of Applied Biosystems anhydrous acetonitrile Part Number 400060 is strongly recommended Do not use HPLC grade acetonitrile its higher water content will decrease coupling efficiency After opening the acetonitrile keep it blanketed with argon to avoid contamination with air 2 When transferring the acetonitrile to a phosphoramidite bottle use a clean dry glass syringe with a needle Store it in a 100 120 C oven to prevent atmospheric moisture contamination Keep the syringe dedicated to this use Use acetonitrile to rinse it do not use water Do not contaminate the acetonitrile bottle with traces of phosphoramidites i e do not allow the syringe needle to contact the phosphoramidites 3 Add the correct amount of acetonitrile to each phosphoramidite as follows B cyanoethyl volume of weight of molarity phosphoramidite acetonitrile phosphoramidite M mL grams A 2 8 25 0 1 5 6 9 0 1 11 2 1 0 0 1 G 2 9 25 0 1 5 8 5 0 1 11 6 1 0 0 1 C 2 9 25 0 1 5 9 5 0 1 11 8 1 0 0 1 T 3 3 25 0 1 6 6 5 0 1 13 2 1 0 0 1 Deoxyinosine 3 4 25 0 1 The above concentrations result in a 10 fold excess of soluble phosphoramidite ove
49. control gas and chemical flows to the column and exit ports Figure 5 3 shows a sche matic representation of all three valve blocks 5 6 Section 5 System Description Hardware Applied Biosystems o gt rowasrE dem Ton COLUMN COLLECTOR VALVE e 69 4 BLOCKS SYNTHESIS gt e dad 5 s 2 c x s REAGENT VALVE BLOCKS rinde TETRAZOLE 5 did ACETIC ANHYDRIDE 0 11 ac a 1 METHYLIMIDAZOLE NMI 12 4 TRICHLOROACETIC ACID TCA 2 IODINE 15 e ACETONITRILE CH CN s 07 as Figure 5 3 Valve Blocks Schematic Section 5 System Description Hardware 5 7 Applied Biosystems The first reagent valve block is an eight port block which controls the delivery of the following sol vents and reagents tetrazole bottle 9 acetic anhydride bottle 11 1 methylimidazole bottle 12 trichloroacetic acid bottle 14 iodine bottle 15 acetonitrile bottle 18 Each of the above reagents flows from its reservoir through the first reagent valve block and then through the second which directs the flow to the column or waste The first reagent valve block also controls the delivery of argon through both reagent valve blocks The second reagent valve block an eight port block controls the delivery of the phosphoramidites to t
50. depurination It has been reported that the 5 terminal purine is more susceptible to depurination than an internucleotide purine with a 3 and a 5 phosphorous The quantity of DNA fragments generated by apurinic ammoniolysis is usually insignificant If the synthesis is conducted Trityl On for purification by OPC or Trityl On HPLC the 5 end fragment of apurinic ammoniolysis will bear a DMT group and may complicate purification In practice how ever using the AB reagents and cycles optimized for DNA synthesis depurination is not detectable or significant except for long oligonucleotides 280 bases which are purine rich near the 3 end To minimize depurination each treatment with TCA should not be extended beyond the times spec ified in the cycles IMPORTANT Do not stop a synthesis while the DNA is exposed to TCA Do not increase TCA delivery times Section 6 Chemistry for Automated DNA Synthesis 6 11 Applied Biosystems Coupling Phosphoramidites Phosphoramidites shown in Figure 6 5 are chemically modified nucleosides which are used as the building blocks for synthesizing DNA They are added to the support bound nucleotide chain one at a time until all bases in the sequence are coupled The cyanoethyl phosphoramidite nucleosides have the following functional groups 1 A diisopropylamino on 3 trivalent phosphorous moiety The phosphoramidite is very stable and is made highly reactive by the activator tetr
51. designated reservoir For example Function 71 18 to A delivers acetonitrile to the adenosine phosphoramidite reservoir FUNCTION NAME VALVES NUMBER F71 18 TOA 1 11 17 21 F 72 18 TOG 1 10 17 21 F 73 18 TOC 1 9 17 21 F 74 18 TOT 1 8 17 21 F 75 18 TOX 1 7 17 21 F 78 18 TO TET 1 6 17 84 18 14 1 3 17 85 18 15 1 2 17 F 87 18 TO 11 1 5 17 F 88 18 TO 12 1 4 17 4 16 Section 4 Functions Cycles and Procedures Applied Biosystems Functions which deliver argon to a reservoir These functions are used during the bottle change procedure for the phosphoramidite tetrazole and acetonitrile reservoirs After acetonitrile removes old reagent from the delivery line the acetonitrile is removed by an argon flush Argon travels through the reagent valve block by opening Valve 0 and into the reservoir which forces the acetonitrile into the bottle The phosphoramidite bottles share a single vent valve which is open during this step In addition functions that deliver argon to bottle positions 11 12 14 and 15 are used during the shut down and flow test procedures The functions below deliver argon to the designated reservoir For example Function 62 Flush to A delivers argon to the adenosine phosphoramidite reservoir FUNCTION NAME VALVES NUMBER F 62 FLUSH TO A 0 11 21 F 63 FLUSH TO G 0 10 21 F 64 FLUSH TO C 0 9 21 F 65 FLUSH TO T 0 8 21 66 FLUSH TO X 0 7 21 F 69 FL
52. designated standard procedure If the standard procedure has not been edited it will print when you press USER or STD Main Menu Option FXN Editor Use the FXN function Editor to create and edit user functions and to print lists of functions You can create new functions not already in memory These user functions are defined by specify ing a set of valves to be opened when the function is activated Up to eight user functions called F 92 USER A through F 99 USER H can be created Like standard functions they can be activated from Manual Control inserted into any synthesis cycle via the Cycle Editor and into any procedure via Procedure Editor Note Refer to the DNA Synthesizer Schematic Appendix B when creating user functions and check that the correct flow path will be created Also refer to Section 4 Functions Cycles and Procedures and Figure 4 4 The Function Editor is also used to print the standard test and user functions Standard functions include F 1 through 90 108 and 109 and are used in the synthesis cycle the phosphoramidite purge the bottle change and the shut down procedures Test functions include F 101 through F 107 and are used to perform the flow test Note that the standard and test functions are stored in the permanent memory and cannot be edited 3 44 Section 3 Software Menu Descriptions Applied Biosystems Upon selecting FXN EDITOR from Page 2 of the Main Menu the display will read Selec
53. done the vacuum assist valves will be activated continuously and can overheat and fail causing argon to leak 2 Select START from the following display Applied Biosystems 391 DNA Synthesizer PCR MATE EP Ver 1 00 Page 1 of the Main Menu will then be shown DNA start change cycle more editor synth bottles editor menu The display can be adjusted for optimal viewing by turning the knob at the left of the screen 2 2 Section 2 Operation Applied Biosystems Pre synthesis Check List Before beginning a synthesis be sure to complete the following steps 1 Check reagent levels of all reservoirs Empty reservoirs should be replaced with bottles of fresh reagents From the Main Menu choose CHANGE BOTTLES and follow the prompts For further instructions refer to How to Install Reagent Bottles found later in this section Be sure bottles are on every position Since all phosphoramidite reservoirs are pressurize simultaneously with a single valve all 5 bottles must be attached to the instrument even if some are empty to perform synthesis Check thatall alarms are set correctly Refer to Section 3 Main Menu Option Change Bottles for instructions on how to set the alarm As needed prepare the phosphoramidites for use by dissolving them in anhydrous acetonitrile For further instructions refer to How to Prepare Phosphoramidites later in this section Check the pressure supply
54. edit copy or print for the designated procedure The Edit Key Select this option to edit standard procedures or to create new ones When chosen the screen shows step zero of the designated procedure PP 0 of 9 steps in PHOS PURGE next prev insert delete The Procedure Editor operates in the same way as the Cycle Editor Refer to The Cycle Editor Menu for complete instructions Once you change a standard procedure the new user version will automatically be used during sub sequent operations and will appear in the editor To return to the standard version copy it into the editor using the COPY key The Copy Key Select this option to copy the designated standard procedure into the editor Copying is only neces sary to restore the standard procedure once it has been edited or deleted When you press COPY the screen reads Copy standard version to PP PHOS PURGE yes menu Section 3 Software Menu Descriptions 3 43 Applied Biosystems Choose YES to execute the copy command Step zero of the procedure will then be shown in the editor Once the standard version is restored it will automatically be used during subsequent oper ations The Print Key When a printer is connected to the instrument select this option to print the designated procedure When you choose PRINT the display reads Select print version PHOS PURGE user std USER Prints the procedure currently in the editor STD Prints the
55. elim inates the need to purify by time consuming and labor intensive polyacrylamidge gel electrophoresis PAGE or HPLC If you currently only desalt your synthetic oligonucleotides you can now use OPC to desalt and purify in less time than it takes to desalt alone is fast easy to use and delivers consistent results The time required to go from the deprotect ed crude oligonucleotide to its use in an experiment is greatly reduced Complete purification re quires only 15 minutes After completing deprotection and cleavage an aliquot of the crude oligonucleotide still in ammo nia is diluted with water and then loaded directly onto the OPC cartridge This eliminates the need to evaporate the sample prior to purifying The remaining portion of the crude synthesis can then be stored in ammonia either refrigerated or at 20 C without harming the DNA In fact this is prefer able to storing it as an evaporated sample or dissolved in water The ammonia protects the sample from acidic by products present in the crude Detritylation is also done on the cartridge eliminating the need for post purification work up The purified oligonucleotide is then eluted as a trityl off species in a volatile buffer Quantification can be easily accomplished and only the volume containing the amount required for the experiment need be evaporated The reminder can be stored at 20 C for later use Once dry the pure oligonu cleotide can be redissolved in an
56. five appendices refer to the Table of Contents For an overview and a general understanding of the synthesizer read the General Introduction in this section and the introductions to Sections 3 through 6 Be sure to read the rest of this section for other important information such as how to get help if you have questions or problems Section 2 Operation provides step by step instructions on how to operate the instrument and per form necessary procedures Prior to your initial synthesis be sure to read the following parts of this section Power On Pre synthesis Check List How to Prepare Phosphoramidites How to Install Reagent Bottles How to Begin a Synthesis Post Synthesis and Manual Deprotection and Cleav age The remaining parts of this section should be read as needed Section 3 Software Menu Descriptions explains how to use each menu option shown on the dis play screen summary of all options appears on page 3 6 Prior to your initial synthesis be sure to read the Main Menu Option DNA Editor Main Menu Option Start Synthesis Main Menu Option Monitor Synthesis and Main Menu Option Change Bottles Read about the remaining menu options as you need to use them Sections 4 5 and 6 contain important information about how the instrument operates It is very use ful to read through these sections but they can also be used as a reference guide Refer to the Table of Contents to locate a specific topic Each section is further de
57. flow test has four parts and takes about one hour to perform The first part steps 1 14 washes and primes the delivery lines with acetonitrile The second steps 15 43 measures the flow of ace tonitrile from each bottle position to the lower column Luer fitting The third part steps 44 46 mea sures the flow from bottle 14 to the trityl collection line In the final part steps 47 59 all the lines are flushed dry with argon enabling reattachment of the reagents 4 28 Section 4 Functions Cycles and Procedures Section 5 System Description Hardware This section describes the components of the Model 391 DNA Synthesizer Use it as a reference guide to familiarize yourself with the synthesizer and its operations cente RUD BOR Sue 5 2 The Chemical Delivery System RR REWARD MEA e 5 3 Pressure obese X ee tee sas bloc erepti ONG Ver De wa dec D ed 5 4 Reagent and Solvent Reservoirs llle 5 4 Delivery ValyveBlockS unen ERR ERU Rae OV ER tae 5 6 ASSIS oui ue Ree RR GERNE SEE RENS SENI E CENE 5 9 The Colur n rv ESSI 5 10 Waste and Ventng iie Ever POE iR e RES e er de a ets 5 11 The Battery 53 2m DLRRSOIR E DERNIER ERA t 5 12 Th Controller ESI CDI REOR ot eun 5 13 Applied Biosystems Introduction The major components of the Model 391 Automated DNA Synthesizer are shown in Figure 5 1 All chemical steps required for DNA synthesis take place within a r
58. iodine which develops the tar before the expiration date will be replaced without charge by Applied Biosystems Use in a well ventilated area and avoid inhalation Section 2 Operation 2 21 Applied Biosystems Bottle 18 Acetonitrile HPLC grade acetonitrile is used to wash the support valve blocks and delivery lines and to remove nucleophiles from the support prior to the coupling step IMPORTANT Use HPLC or UV grade acetonitrile with a specification of less than 300 ppm of water Water contamination of even 1000 ppm will lead to a 1 to 2 decrease in coupling efficiency If unsure of the water content either check the acetonitrile using the Karl Fischer method of titration requiring an automatic titration apparatus or distill it over phosphorous pentoxide followed by re distillation over calcium hydride Although Applied Biosystems supplies HPLC grade acetonitrile it may be more economical to purchase it from a local supplier such as Burdick and Jackson Part Number 015 Manual Deprotection and Cleavage Reagents Ammonium Hydroxide Concentrated ammonium hydroxide is used to deprotect the DNA and cleave it from the support Reagent grade ammonium hydroxide should be purchased in 500 mL bottles from a local source Store it tightly sealed and keep refrigerated It should not be used for more than one month after opening Any loss of ammonia concentration decreases its effectiveness therefore only open it im mediately b
59. is blocked by the linker an alternate 3 end labeling procedure must be used to radiolabel Aminolink oligonucleotides To effect a 3 end label the enzyme Terminal Deoxynucleotidyl Transferase is used TDT adds a single nucleotide to the 3 hydroxyl Because the enzyme would continue propagation beyond the first nucleotide addition a dideoxynucleotide analogue of 2 is used The analogue alpha P 5 triphosphate does not have a 3 hydroxyl and therefore further addition is prevented Below is a protocol for the labeling proce dure 3 End Labeling 1 Prepare a stock solution of 10X 3 end labeling buffer 1 4 M Sodium Cacodylate 10 mM Cobaltous Chloride 1 0 mM Dithiothreitol pH 7 5 with This chemical is carcinogenic handle with care 2 32 Section 2 Operation Applied Biosystems 2 Aliquot 2 pmol of oligonucleotide into an Eppendorf type tube 1 5 mL dry in a Speed Vac and ethanol rinse with 10 uL of 95 Ethanol dry 3 Add the following to the tube while on ice 1 uL of 10X 3 end labeling buffer 1 uL of alpha P Cordycepin 5 Triphosphate New England Nuclear 114 specific activity greater than 5000Ci mmol 7 uL of deionized water 1 uL of TDT ENZO Biochemicals 5 units per microliter 4 Spin the tube very briefly in a microcentrifuge to bring contents of tube to the bottom Incubate sample at 37 C for one hour 5 Add 25 uL of 1 0 mM
60. is foul smelling and toxic In addition this adds an extra 30 60 minutes to deprotection time For these reasons use of cyanoethyl phosphoramidites is strongly recommended Methyl phosphoramidites since they offer no advantage or unique utility are no longer available from Applied Biosystems Section 6 Chemistry for Automated DNA Synthesis 6 3 Applied Biosystems DMTO Q DMTO B Oc P OCH2CHSEN 0 28 EN DETRITYLATION OXIDATION il DMTO HO Us GB TOCH2CH2CN P 28 COUPLING CAPPING DMTO CE H CH3 B Q 1 iPr2N P OCH4CH4CN 0 PHOSPHORAMIDITE Figure 6 1 The Synthesis Cycle 6 4 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems The Solid Support CPG The Model 391 DNA Synthesizer uses a solid phase synthesis chemistry in which the growing DNA chain remains covalently attached to an insoluble support All reagents and solvents flow through the support which is contained within a synthesis column The support used for DNA synthesis is Controlled Pore Glass CPG When used with the Model 39 and other Applied Biosystems reagents CPG produces coupling efficiencies of 98 to 100 as measured by the trityl cation assay This enables the synthesis of oligomers up to 175 bases in length CPG is a porous non swelling particle which is about 150 microns in diameter and has 500A pores A wide pore CPG support 1000A is also available and shoul
61. least once or more than once during that cycle the cycle counter increases by one When performing the bottle change pro cedure the counter is automatically reset to zero when a bottle is removed and replaced If a phos phoramidite is partially used stored frozen and then reused the cycle counter should be reset Simply move the cursor to the right of cycles and enter up to a 3 digit number The Alarm Setting Alarm displays the number of cycles which will trigger the alarm You need to set this number ac cording to the guidelines described in the following pages See About the Alarm and Table 3 1 Bottle Usage Data To set the alarm move the cursor to the right of alarm and enter up to a 3 digit number Note If the alarm is set to zero it will not function Section 3 Software Menu Descriptions 3 29 Applied Biosystems The Change Bottles Menu Keys NEXT Displays the cycle and alarm information for the subsequent reservoir When bottle 18 is being viewed selecting NEXT will show bottle 1 PREV Displays the cycle and alarm information for the preceding bottle When bottle 1 is being viewed selecting PREV previous will show bottle 18 CHANGE Initiates the steps for the bottle change procedure About the Bottle Change Procedure The bottle change procedure is used to remove empty reservoirs and replace them with bottles of fresh reagents It can be done before beginning a synthesis or when an active synthesis has
62. more Select MORE for additional synthesis information Note that the time remaining for the step freezes when you press HOLD STEP 1 18 TO WASTE 3 OF 5 SEC resume jump intrpt more main Select MORE again for further information 1 5 gt AAA AAA AAA GCT resume jump intrpt Select MORE again for further information Making DNA 1 12 Cycle 1 63 Trityl OFF ON OFF more Note The resume jump and intrpt keys operate from Pages 1 2 and 3 The ONIOFF key operates from Page 4 IMPORTANT When a chemical delivery step is on hold the extra reagent consumption is not recorded in bottle usage and is not included in the alarm tabulation RESUME Releases the Hold on the step and continues the synthesis Section 3 Software Menu Descriptions 3 19 Applied Biosystems JUMP Shows the Jump Step Menu the hold is not yet released Using Jump Step the synthesis can be continued at any point in the cycle before or after the step cur rently on Hold The Hold is released when the jump is activated Jump Step al lows parts of the chemical cycle to be skipped or repeated Refer to The Jump Step Menu for further instructions INTRPT Displays the first page of the Interrupt Menu When you interrupt immediately it releases the Hold on the step and stops the synthesis The synthesis will not continue until the interrupt is removed For further instructions refer to The In terrupt Menu MAIN Returns to the
63. move the cursor to the base position and se lect YES The base will then reappear and the step will occur when synthesiz ing that base To display the DELETE and MENU keys again move the cursor under the time step or function number Section 3 Software Menu Descriptions 3 37 Applied Biosystems Creating a New Cycle How to Insert Steps The INSERT key is used to add steps to existing cycles and to create entirely new cycles To create a new cycle begin by viewing step zero of the desired programmable RAM cycle e g Cycle 4 C4 0 of 0 steps in Cycle 4 next prev insert delete menu IMPORTANT All steps of an existing cycle will be erased by pressing DELETE while observing step zero Select INSERT and the display will read To define the first step move the cursor next to Fxn _ and enter the correct function number The corresponding function description will automatically appear If an invalid function is entered Bad Function is displayed Once a function has been entered the symbol for the step time t appears Move the cursor next to t and enter the desired time If the step should occur for every base all bases should be showing in the base specifier field Once you enter the correct information press either EXIT or STEP OK STEP OK Select to enter the step in the cycle and to remain in the insert mode The sub sequent step can then be defined and entered Choose STEP OK when inserting several
64. nnne 2 14 uae 2 16 How to Aborta Synthliesis utente bc tee dienten 2 18 About the Synthesis Reagents and Solvent sssssssseeeeeeeeeenenns 2 19 Applied Biosystems How to Store Reagents nennen rennen nennen rennes 2 19 Manual Deprotection and Cleavage 2 22 About Deoxyinosirie rei HE to Re tei odas 2 23 How to Change an Argon 4 ennemi ennt en nnne nnne 2 25 How to Change the Waste Bottle ssessssssssseeneeeeneeeenenen nennen nnne 2 25 How to Perform the Flow Test Procedure ssssseeeeeeeem eene 2 26 Aminolink 2M teure ire ec b npe eade te eder aret 2 30 Introductionis ort ume need 2 30 Chemical Description dene testes Seca cep n 2 30 How to Use Aminolink 2 iade e a e aa a aaaea aee 2 32 Analysis and Purification of Aminolink Oligonucleotides 2 32 3 End Labelirig iiiter ete ee tbe te I vet e rip ber de deg Peut Rape 2 32 Applications eid abate a Se 2 34 General Protocol for Tag Labeling Substrate
65. occurred and to provide dates on printouts After selecting SET CLOCK the display will show Move the cursor to the right of time and enter the current time then to the right of date and enter the date The date is entered as month day last two digits of the year For example if the time is ten A M on July 8 1989 the display should read Section 3 Software Menu Descriptions 3 51 Applied Biosystems Date 07 08 89 main To correct mistakes move the cursor to the incorrect entry and type a new one over it Note The clock will continue to update the time although the time shown on the menu will remain fixed Main Menu Option Shut Down Use this menu to prepare the instrument for long term storage The shut down procedure removes all reagents in the delivery lines and washes and dries all chemical pathways The procedure takes about 17 minutes and is further described in Section 4 Upon selecting SHUT DOWN the screen reads Replace 9 11 12 14 15 with empty bottles enter Follow the prompt and remove bottles 9 11 12 14 and 15 and replace them with clean empty bot tles Removing the reservoirs prevents HPLC grade acetonitrile from contaminating reagents which could be reused at a later date If the phosphoramidites will be reused their reservoirs should be removed as well When finished press ENTER and the display will show the step number being performed and the time remaining for that step
66. of the argon tank Check that the low pressure gauge reads 60 psi Change the tank as it is depleted Watch it carefully when the high pressure gauge drops below 400 psi With average synthesizer use an argon tank should last approximately 3 months To change an argon tank refer to the instructions later in this section Check the waste level The synthesizer generates 1 to 2 liters of hazardous halogenated organic liquid waste per 100 base additions The waste is collected in a 4 liter bottle supplied by Applied Biosystems When the waste bottle is full it must be emptied and the waste disposed of properly The bottle can be changed prior to a synthesis or when a synthesis is interrupted To change the waste bottle refer to the instructions later in this section Hill the fraction collector with 10 to 15 mL volumetric tubes to collect the trityl cation released at each detritylation step Use one tube for each base in the sequence Be sure to label the tubes and align the fraction collector so tube number one collects the first trityl Section 2 Operation 2 3 Applied Biosystems How to Prepare Phosphoramidites The prepackaged phosphoramidites are bottled as powders and sealed under argon pressure In this state they are stable for at least 1 year To prepare them for use they are dissolved in anhydrous acetonitrile Since the phosphoramidites are extremely sensitive to acid oxygen and water you must take spe cial
67. or 4 For example to modify the 2uM cycle select NEXT from the first page of the Cycle Editor until the menu reads Select action for Cycle 2uM 63 steps edit copy print next Choose COPY and the message will state that the 2uM cycle will be copied into another cycle lo cation in this example Cycle 2 Copy 2uM to Cycle 2 0 steps enter next menu If 2uM should be copied into a different location press NEXT until the desired cycle is shown In this example Cycle 2 has zero steps However if Cycle 2 were already defined it would not need erasing prior to copying Copying will overwrite any cycle Select ENTER to execute the copy com mand The editor will then be displayed showing step zero of the new Cycle 2 and enabling any changes C2 0 of 63 steps in Cycle 2 next prev insert delete menu Section 3 Software Menu Descriptions 3 39 Applied Biosystems Main Menu Option Manual Control Use the Manual Control Menu to manually activate functions and to open and close individual valves IMPORTANT Before opening any valves refer to the DNA synthesizer schematic or the plumbing diagram Appendix B and the function list Appendix A to be sure the correct flow path will be formed Also refer to Section 4 Functions Cycles and Procedures and Figure 4 4 Manual control will not operate during a synthesis unless you interrupt the run Upon selecting MANUAL CONTROL the screen will display
68. pendix Monitoring the trityl cation is very important but the results must be interpreted with caution The trityl assay is only an indirect measure of synthesis efficiency Certainly high trityl cation yields 298946 must be present for a good synthesis However high trityl yields can be present when a poor synthesis occurs The reason for this discrepancy is that although this chemistry is highly refined it is not perfect Unwanted side reactions do occasionally occur Some of these side reactions con tribute to the trityl cation released each cycle In particular a low level of extraneous chain growth other than the desired oligonucleotide occurs Sites besides the 5 hydroxyl group participate in cou pling e g imperfectly capped sites on the support or branched sites on the nucleic bases Other scenarios for imperfect results is if detritylation or capping is incomplete This could happen if the synthesizer is not operating correctly the cycle is not optimized or the reagents are wet or impure These occasions generate species other than the desired product which release the trityl cat ion Low trityl cation yields lt 98 always predict a less than optimal synthesis In practical terms 6 10 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems trityl yields of less than 9596 will not allow identification or purification of even short oligonucle otides For the above reasons the trityl assay must be viewed o
69. phosphoramidite used in a coupling step of a one micromole synthesis In addition manual deliveries using the Manual Control Menu de liveries during a hold step and acetonitrile used during the bottle change procedure are not tabulat ed in the cycle counter When synthesizing mixed sequence probes each phosphoramidite which is delivered is tabulated in the cycle counter When the alarm is triggered the instrument will finish the current addition cycle interrupt the syn thesis at Cycle Entry and sound an alarm blinking will be shown in the bottom right corner of any menu being viewed Press the MENU key until the display reads Bottle Empty Alarm Change bottle to clear alarm Select MAIN to return to the Main Menu and then select CHANGE BOTTLES Once the Change Bottles Menu is showing the alarm message will be cleared However the synthesis will still re main interrupted Proceed with the bottle change procedure as described earlier in the section When finished return to the Main Menu select MONITOR SYNTH and continue the synthesis by select ing RESUME If the alarm has been triggered but the bottle is not yet empty the synthesis can be continued by clearing the interrupt by choosing MONITOR SYNTH and then RESUME The alarm message can be cleared by simply viewing the Change Bottles Menu If this is done it is important to reset the alarm to an appropriate number 3 32 Section 3 Software Menu Descript
70. service as depicted in Figure E 2 E 14 Appendix E Warranty 391 Pre Installation Manual Applied Biosystems FY CIRCUIT BREAKER EARTH GROUND DEDICATED LINE 3 OR 4 WIRE DEPENDS ON INSTRUMENT VOLTAGE Figure E 2 Dedicated Power Line Power Quality Line Voltage Fluctuation The line voltage must be within 5 of the nominal figures High or low voltage conditions will have an adverse effect on electronic components of the instrument In areas where the supplied power is subject to fluctuations exceeding the above limits a power line regulator is strongly suggested Please consult your local Applied Biosystems service representative if you suspect a problem Voltage Spikes Short duration high voltage spikes can be caused by other devices such as large motors using the same power source or by outside influences such as lightning If your laboratory environment con tains devices that are electronically noisy or if you are in an area with frequent electrical storms a line conditioner may greatly enhance reliability of your system The line conditioner must have a rating of at least 0 5 Several sources of line conditioners are as follows Best Power P 0 Box 280 Necedah WI 54646 Tel 608 565 7200 RTE Deltec 2727 Kurtz St San Diego CA 92120 Tel 619 291 4211 Elgar 9250 Brown Deer Rd San Diego CA 92121 Tel 619 450 0085 Appendix E Warranty 391 Pre Installation Manual E 15
71. traces of trityl cation to the trityl collection port Produces more accurate trityl assay results F 109 FLUSH THRU COL 0 12 16 Argon flows through the column from the bottom to the top and exits at the waste bottle Functions which prime the reagent valve blocks Three functions are used to fill or prime the reagent valve blocks prior to column delivery of the reagent Argon pressure drives the reagent from its reservoir through the valve block and to the waste bottle These functions are also used during the bottle change procedure FUNCTION NAME VALVES NUMBER F 61 TET TO WASTE 6 13 23 Delivers tetrazole to the waste bottle fills the reagent valve block prior to coupling F 81 15 TO WASTE 2 13 18 Delivers iodine to the waste bottle fills the reagent valve block prior to oxidation F82 14 WASTE 3 13 19 Delivers TCA to the waste bottle fills the reagent valve block prior to detritylation Miscellaneous functions FUNCTION 4 WAIT Function 4 is a pause which is used following a chemical delivery such as base tetrazole to col umn to allow the reagents to remain in the column so the reaction can be completed FUNCTION 33 CYCLE ENTRY This function signals the controller to perform the first set of chemical steps necessary for base ad dition detritylation Note that this does not mean the first numerical step of the cycle FUNCTION 34 CYCLE END 4 14 Section 4 Functions Cycles and Procedures
72. 0 seconds The iodine solution is removed by an argon reverse flush and several acetonitrile washes each followed by an argon reverse flush Other oxidizing agents such as sulfur can be used in place of oxygen to create nucleotide phos phate analogs or to introduce radioactive atoms IMPORTANT Do not stop the synthesis while the phosphorous is unoxidized lo 20 pyridine THF _ P OCH gt CH gt CN OCH2CH2CN trivalent phosphite pentavalent phosphotriester Figure 6 8 Oxidation of the trivalent phosphorous The unstable trivalent phosphorous of the newly formed internucleotide linkage is oxidized to a stable pentavalent phosphorous using an iodine solution Section 6 Chemistry for Automated DNA Synthesis 6 17 Applied Biosystems Completion of the Synthesis Cycle Following oxidation a cycle of nucleotide addition is complete The 5 terminus of the oligomer is protected by the dimethoxytrityl group DNA synthesis continues by removing the 5 trityl and re peating another cycle of base addition This is done until DNA of specified length has been fully synthesized Immediately after completing the synthesis a trityl group may still be attached to the 5 terminus according to the user s option The ending method instructions may be programmed for the trityl group to remain attached trityl on or be cleaved trityl off The oligonucleotides are usually de tritylated when purifying by gel elect
73. 1 9 18 TO COLM 10 Yes Yes Yes Yes Yes 32 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 33 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 34 33 CYC ENTRY 1 Yes Yes Yes Yes Yes 35 10 18 TO WASTE 3 Yes Yes Yes Yes Yes 36 9 18 TO COLM 10 Yes Yes Yes Yes Yes 37 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 38 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 39 5 ADVANCE FC 1 Yes Yes Yes Yes Yes 40 6 WASTE PORT 1 Yes Yes Yes Yes Yes 41 82 14 TO WASTE 3 Yes Yes Yes Yes Yes 42 14 14 TO COLUMN 10 Yes Yes Yes Yes Yes 43 108 FLUSH TO TRIT 1 Yes Yes Yes Yes Yes Continued on next page A 10 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE NAME Low NUMBER OF STEPS 61 TIME 04 24 DATE 05 11 89 STEP FUNCTION NUMBER 44 14 14 TO COLUMN 45 108 FLUSH TO TRIT 46 14 14 TO COLUMN 47 108 FLUSH TO TRIT 48 14 14 TO COLUMN 49 108 FLUSH TO TRIT 50 14 14 TO COLUMN 51 108 FLUSH TO TRIT 52 14 14 TO COLUMN 53 108 FLUSH TO TRIT 54 9 18 TO COLM 55 108 FLUSH TO TRIT 56 7 WASTE BOTTLE 57 1 BLOCK FLUSH 58 9 18 TO COLM 59 2 REVERSE FLUSH 60 1 BLOCK FLUSH 61 34 CYC END STEP TIME Page 2 ACTIVE FOR BASES G 1 X Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes
74. 150 seconds Use the first 30 seconds to prime the line Then watching the time on the display place the trityl collection line inside the 10 mL graduated cylinder and collect the flow for 120 seconds Calculate the flow rate in milliliters per minute The flow rate should be 2 30 to 2 60 mL min If the flow rate is not correct there may be a problem with the post column valve block If you suspect this call the Technical Support De partment for help Part 4 The procedure is interrupted again at step 46 In part 4 steps 47 to 59 the delivery lines and valve blocks are flushed dry with argon Press RESUME and the residual acetonitrile will be collected in each bottle starting at position 15 and going backwards The test is now complete Reagents can be reattached using the Change Bottles Menu As each flow test bottle is removed wipe the exposed delivery line with a lint free tissue Once all chemicals are attached synthesis can begin Section 2 Operation 2 29 Applied Biosystems Aminolink 21M Reagent Introduction Aminolink 2 is a DNA synthesis reagent which affords a convenient method to introduce an aliphat ic primary amine at the 5 end of oligonucleotides This amine can react to form oligonucleotide conjugates with a variety of substrates such as biotin 9 fluorescent dyes EDTA or alkaline phosphatase 3 Applications include Non radio labeled hybridization probes 10 13 14 Sequence specific cleavage of sin
75. 17 22 CAP TO COLUMN 0 Yes Yes Yes Yes Yes 18 4 WAIT Yes Yes Yes Yes Yes 19 10 18 TO WASTE Yes Yes Yes Yes Yes 20 2 REVERSE FLUSH Yes Yes Yes Yes Yes 21 1 BLOCK FLUSH Yes Yes Yes Yes Yes 22 81 15 TO WASTE Yes Yes Yes Yes Yes 23 13 15 TO COLUMN 0 Yes Yes Yes Yes Yes 24 10 18 TO WASTE Yes Yes Yes Yes Yes 25 4 WAIT 5 Yes Yes Yes Yes Yes 26 2 REVERSE FLUSH Yes Yes Yes Yes Yes 0 001 0 001 01 01 01001 01 0001001 0010 27 1 BLOCK FLUSH Yes Yes Yes Yes Yes 28 10 18 TO WASTE Yes Yes Yes Yes Yes 29 9 18 TO COLM 0 Yes Yes Yes Yes Yes 30 2 REVERSE FLUSH Yes Yes Yes Yes Yes 31 9 18 TO COLM 0 Yes Yes Yes Yes Yes 32 2 REVERSE FLUSH Yes Yes Yes Yes Yes 33 9 18 TO COLM 0 Yes Yes Yes Yes Yes 34 2 REVERSE FLUSH Yes Yes Yes Yes Yes 35 1 BLOCK FLUSH Yes Yes Yes Yes Yes 36 33 CYC ENTRY Yes Yes Yes Yes Yes 37 10 18 TO WASTE Yes Yes Yes Yes Yes 38 9 18 TO COLM 0 Yes Yes Yes Yes Yes 39 2 REVERSE FLUSH Yes Yes Yes Yes Yes 40 1 BLOCK FLUSH Yes Yes Yes Yes Yes 41 5 ADVANCE FC Yes Yes Yes Yes Yes 42 6 WASTE PORT Yes Yes Yes Yes Yes 43 82 14 TO WASTE Yes Yes Yes Yes Yes 44 14 14 TO COLUMN 0 Yes Yes Yes Yes Yes 45 108 FLUSH TO TRIT Yes Yes Yes Yes Yes 46 14 14 TO COLUMN 0 Yes Yes Yes Yes Yes continued Section 4 Functions Cycles and Procedures Applied Biosystems Figure 4 5 21 B cyanoethyl synthesis cycle Continued STEP FUNCTION STEP ACTIVE FOR BASE
76. 28 teflon D 4 Appendix D 391 Illustrated Parts List Applied Biosystems Photo Number Part Number Description Bottle Positions 1 5 31 600192 Bottle receptacle assembly pushbutton type 200082 Knob slide black 32 601852 Insert tube assembly 1 5 221014 O ring Kalrez Bottle Positions 9 11 12 and 15 33 110130 1 4 28 teflon Nos 11 and 12 pressure 34 601946 Insert assembly 8 oz 2 line 35 001208 Ratchet cap receptacle mount outer shell 36 003558 Ratchet receptacle 8 oz 003560 Ratchet receptacle lid 002571 Wave spring nickel plated Bottle Position 14 37 001208 Ratchet cap receptacle mount outer shell 003559 Ratchet receptacle 16 oz 003560 Ratchet receptacle lid 002571 Wave spring nickel plated 38 601945 Insert assembly 16 oz 2 line Bottle Position 18 39 602458 not shown Cap assembly 4 L 1 8 in T 2 line 002268 not shown Gasket 1 38 in o d x 0 88 in i d x 0 030 in high EPR 40 140041 not shown Safety carrier 4 L 002170 not shown Bottle rack 4 L Waste Bottle 41 601865 not shown Waste cap assembly 4 L 1 4 in T Appendix D 391 Illustrated Parts List Applied Biosystems Biosystems 395 Synthesizer PER MATE RA REAGE M T7 STROMBERG HES 2 m DNA GA PE 65 s Gat it x HE oret 7 todiner water ote E Acotic A f 1 sie Mothyliridorot d Tetrahydrotorat Tetranparaturer 4 etrahydrohursit
77. 3 To insert in the fourth position in the sequence 5 AAA3 5 gt _ lt 3 select T 5 gt _ 3 Continuously pressing the button corresponding to a base will repeatedly insert that base How to Delete a Base Most deletions are made at the cursor position For example to delete C from the sequence S AGCT 3 5 gt AGCT lt 3 select delete 5 lt 3 When the cursor is at the 3 end of sequence the deletion is made to the left of the cursor For example to delete T from the sequence 5 AGCT 3 5 gt AGCT_ lt 3 select delete 5 gt _ lt 3 Multiple bases within parentheses are deleted when the cursor is on either parenthesis For example to delete AGCT from the third position in the sequence 5 AA AGCT TTT 3 S AA AGCT TTT 3 select delete S AATTT lt 3 To erase a single base within parentheses place the cursor on the unwanted base and press delete For example to delete C from the sequence 5 AA AGCT TTT 3 S AA AGCT TTT 3 select delete 5 gt lt 3 Continuously pressing delete will repeatedly erase entries 3 10 Section 3 Software Menu Descriptions Applied Biosystems How to Change a Base To change a base you first insert the desired base then delete the unwanted base For example to change 5 AATG 3 to 5 AACG 3 5 gt AATG 3 select C 5 gt AACTG lt 3 select delete 5 gt AACG lt 3 You can enter up to 250 characters a combin
78. 5981 DNA Synthesis 1 800 831 6844 then press 21 1 650 638 5981 Fluorescent DNA Sequencing 1 800 831 6844 then press 22 1 650 638 5981 Fluorescent Fragment Analysis includes GeneScan applications 1 800 831 6844 then press 23 1 650 638 5981 Integrated Thermal Cyclers ABI PRISM9877 and Catalyst 800 instruments 1 800 831 6844 then press 24 1 650 638 5981 ABI 3100 Genetic Analyzer 1 800 831 6844 then press 26 1 650 638 5981 Biolnformatics includes BioLIMS BioMerge and SQL GT applications 1 800 831 6844 then press 25 1 505 982 7690 Peptide Synthesis 433 and 43X Systems 1 800 831 6844 then press 31 1 650 638 5981 Protein Sequencing Procise Protein Sequencing Systems 1 800 831 6844 then press 32 1 650 638 5981 PCR and Sequence Detection 1 800 762 4001 then press 1 for PCR 2 for the 7700 or 5700 6 for the 6700 or dial 1 800 831 6844 then press 5 1 240 453 4613 Voyager MALDI TOF Biospectrometry and Mariner ESI TOF Mass Spectrometry Workstations 1 800 899 5858 then press 13 1 508 383 7855 Biochromatography BioCAD Workstations and Poros Perfusion Chromatography Products 1 800 899 5858 then press 14 1 508 383 7855 Expedite Nucleic acid Synthesis Systems 1 800 899 5858 then press 15 1 508 383 7855 Peptide Synthesis Pioneer and 9050 Plus Peptide Syn
79. 686 6 to one end of the OPC column and a male to male Luer tip to the other end See Figure 2 4 Make sure all fittings are snug OdO 3 Flush the cartridge with 5 mL HPLC grade acetonitrile followed by 5 mL 2 0 M triethylamine acetate Note Keep the flow rate at 1 to 2 drops per second for all reagent additions Jen ej ew IEW 4 Dilute the ammonium hydroxide solution containing the cleaved deprotected trityl on crude oligonucleotide with one third volume of deionized water 5 Load 20 40 OD s of the above solution into the syringe and then gently push it through the cartridge saving the eluted fraction Reload this fraction and again push it through the cartridge This will load 1 to 5 OD units of the trityl oligonucleotide depending on length sequence and synthesis quality onto the cartridge Save this final eluted fraction in ammonia at 20 C it can be put through Figure 2 4 another cartridge until exhausted of trityl oligonucleotide 6 Flush cartridge with 3 x 5 mL dilute ammonium hydroxide 7 Flush cartridge with 2 x 5 mL deionized water 2 38 Section 2 Operation Applied Biosystems 8 Detritylate the OPC bound oligonucleotide with 5 mL of the 246 trifluoroacetic acid solution Gently push 1mL through the cartridge incubate for 5 minutes then flush the remaining solution through the cartridge 9 Flush cartridge with 2 x 5 mL deionized water 10 For seq
80. ASTE 10 13 20 54 C TO WASTE 9 13 20 55 T TO WASTE 8 13 20 56 X TO WASTE 7 13 20 59 CAP A TO WASTE 5 13 22 60 CAP B TO WASTE 4 13 22 61 TET TO WASTE 6 13 23 62 FLUSH A 0 11 21 63 FLUSH TO G O 10 21 64 FLUSH TOC 0 9 21 65 FLUSH TOT 0 8 21 66 FLUSH TO X 0 7 21 69 FLUSH TO TET 0 6 70 FLUSH TO 18 0 1 71 18 TO A 1 11 17 21 72 18 G 1 10 17 21 73 18 1 9 17 21 74 18 TOT 1 8 17 21 75 18 TO X 1 7 17 21 78 18 1 6 17 81 15 WASTE 2 13 18 82 14 WASTE 3 13 19 84 18 TO 14 1 3 17 85 18 TO 15 1 2 17 86 FLUSH TO 14 15 0 2 3 87 18 TO 11 1 5 17 88 18 TO 12 1 4 17 89 FLUSH TO 11 12 0 4 5 90 TET TO COLUMN 6 12 16 23 Section 4 Functions Cycles and Procedures 4 7 FUNCTION FUNCTION FUNCTION NUMBER NAME VALVE LIST 101 A TO COLUMN 11 12 16 10 102 G TO COLUMN 10 12 16 20 103 C TO COLUMN 9 12 16 20 104 T TO COLUMN 8 12 16 20 105 X TO COLUMN 7 12 16 20 106 11 TO COLUMN 5 12 16 20 107 12 TO COLUMN 4 12 16 22 108 FLUSH TO TRIT 0 12 15 109 FLUSH THRU COL 0 12 16 FUNCTION FUNCTION FUNCTION NUMBER NAME VALVE LIST 92 USER A 93 USER B 94 USER C 95 USER D 96 USER E 97 USER F 98 USER G 99 USER H 4 6 Section 4 Functions Cycles and Procedures Applied Biosystems Figure 4 4 MODEL 391 DNA SYNTHESIZER FUNCTIONS CONTROL 4 Wait 5 Advance Fraction Collector 6 Waste to Port 7 Waste to Bottle
81. ASTE 7 3 74 18 TOT 10 4 65 FLUSH TO T 10 5 17 INTERRUPT 1 6 65 FLUSH TO T 5 7 55 T TO WASTE 4 8 10 18 TO WASTE 7 9 1 BLOCK FLUSH 10 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 5 BOTTLE CHANGE NUMBER OF STEPS 9 TIME 04 30 DATE 05 11 89 STEP FUNCTION STEP NUMBER 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 7 3 75 18 TOX 10 4 66 FLUSH TO X 10 5 17 INTERRUPT 1 6 66 FLUSH TO X 5 7 56 X TO WASTE 4 8 10 18 TO WASTE 7 9 1 BLOCK FLUSH 10 A 18 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 9 BOTTLE CHANGE NUMBER OF STEPS 6 TIME 04 30 DATE 05 11 89 STEP FUNCTION STEP NUMBER TIME 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 7 3 17 INTERRUPT 1 4 61 TET TO WASTE 4 5 10 18 TO WASTE 7 6 1 BLOCK FLUSH 10 Appendix A Functions Cycles and Procedures A 19 Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 11 BOTTLE CHANGE NUMBER OF STEPS 7 TIME 03 18 DATE 05 10 89 STEP FUNCTION STEP NUMBER TIME 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 7 3 17 INTERRUPT 1 4 16 CAP PREP 5 5 59 CAP A TO WASTE 5 6 10 18 TO WASTE 7 7 1 BLOCK FLUSH 10 A 20 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 12 BOTTLE CHANGE NUMBER OF STEPS
82. ATE 05 10 89 STEP FUNCTION STEP NUMBER TIME 1 28 PHOS PREP 10 2 52 A TO WASTE 4 3 53 G TO WASTE 4 4 54 C TO WASTE 4 5 55 T TO WASTE 4 6 56 X TO WASTE 4 7 61 TET TO WASTE 4 8 10 18 TO WASTE 7 9 1 BLOCK FLUSH 10 Appendix Functions Cycles and Procedures A 25 Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard SHUTDOWN NUMBER OF STEPS 31 TIME 03 18 DATE 05 10 89 STEP FUNCTION STEP NUMBER 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 5 3 71 18 60 4 72 18 TOG 60 5 73 18 60 6 74 18 60 7 75 18 TOX 60 8 62 FLUSH TO A 60 9 63 FLUSH TO G 60 10 64 FLUSH TOC 60 11 65 FLUSH TOT 60 12 66 FLUSH TO X 60 13 10 18 WASTE 10 14 78 18 60 15 87 18 TO 11 60 16 88 18 TO 12 60 17 84 18 TO 14 60 18 85 18 TO 15 60 19 69 FLUSH TO TET 60 20 89 FLUSH TO 11 12 60 21 86 FLUSH TO 14 15 60 22 10 18 TO WASTE 10 23 1 BLOCK FLUSH 5 24 17 INTERRUPT 1 25 62 FLUSH A 5 26 63 FLUSH TO G 5 27 64 FLUSH TOC 5 28 65 FLUSH TOT 5 29 66 FLUSH TO X 5 30 70 FLUSH TO 18 10 31 1 BLOCK FLUSH 10 A 26 Appendix Functions Cycles and Procedures Applied Biosystems Flow test procedure STEP gt FUNCTION WAIT 18 TO 15 18 TO 14 18 TO 12 18 TO 11 18 TO TET 18 TOX 18 TOT 18 18 TOG 18 18 TO COLM 18 TO WASTE INTERRUPT WAIT PHOS PREP A TO COL WAIT
83. Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 1 BOTTLE CHANGE NUMBER OF STEPS 9 TIME 04 29 DATE 05 11 89 STEP FUNCTION STEP NUMBER TIME 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 7 3 71 18 TOA 10 4 62 FLUSH A 10 5 17 INTERRUPT 1 6 62 FLUSH TO A 5 7 52 A TO WASTE 4 8 10 18 TO WASTE 7 9 1 BLOCK FLUSH 10 A 14 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 2 BOTTLE CHANGE NUMBER OF STEPS 9 TIME 04 29 DATE 05 11 89 STEP FUNCTION STEP NUMBER TIME 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 7 3 72 18 TOG 10 4 63 FLUSH TO G 10 5 17 INTERRUPT 1 6 63 FLUSH TO G 5 7 53 G TO WASTE 4 8 10 18 TO WASTE 7 9 1 BLOCK FLUSH 10 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 3 BOTTLE CHANGE NUMBER OF STEPS 9 TIME 04 29 DATE 05 11 89 STEP FUNCTION STEP NUMBER 1 1 BLOCK FLUSH 5 2 10 18 TO WASTE 7 3 73 18 10 4 64 FLUSH C 10 5 17 INTERRUPT 1 6 64 FLUSH TO C 5 7 54 C TO WASTE 4 8 10 18 TO WASTE 7 9 1 BLOCK FLUSH 10 A 16 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Standard 4 BOTTLE CHANGE NUMBER OF STEPS 9 TIME 04 30 DATE 05 11 89 STEP FUNCTION STEP NUMBER TIME 1 1 BLOCK FLUSH 5 2 10 18 TO W
84. CT OR cuo e SAN Y 3 5 o HO TGTTGCAGCACTGACCCT 0 P O Figure 2 2 Aminolink 2 Oligonucleotide Section 2 Operation 2 31 Applied Biosystems How to Use Aminolink 2 Aminolink 2 Part Number 400808 is supplied in 250 mg quantities Store the unopened linker des iccated away from heat and moisture 1 Dilute Aminolink 2 with 3 3 mL of anhydrous acetonitrile following the instructions in How to Prepare Phosphoramidites Once diluted and placed on the instrument the compound is stable for at least 2 weeks 2 Place Aminolink 2 on bottle position 5 3 Using the DNA Editor enter X the Aminolink bottle position as the first base 5 end of the sequence 4 Configure the synthesis Trityl ON since detritylation is not necessary after Aminolink 2 addition 5 Deprotect and cleave the Aminolink oligonucleotide following the instructions in the Manual Deprotection and Cleavage Procedure Although Aminolink has a methyl phosphate protecting group thiophenol deprotection is not necessary Ammonia treatment will demethylate the single methyl phosphotriester group of the Aminolink oligonucleotide without adversely affecting product purity Analysis and Purification of AminolinkTM Oligonucleotides Aminolink oligonucleotides can be analyzed and purified by the same methods used for conven tional oligonucleotides Since the 5 hydroxyl usually available for phosphorylation by kinase and
85. Dahl B H Nielsen J and Dahl O Nucleic Acids Research 15 1729 1743 1987 13 Zon G Gallo K A Samson C J Shao K Summers M F and Byrd R A Nucleic Acids Research 15 8181 8196 1985 14 Applied Biosystems Nucleic Acid Research News Issue No 7 October 1988 Effect of the Synthesis Cycle on the Chemical Authenticity of Synthetic DNA 15 Bauer B F and Holmes W M Nucleic Acids Research 15 812 1989 16 Stec W J Zon G Egan W and Stec B J Am Chem Soc 106 6077 6079 1984 17 The DOUBLE SYRINGE METHOD for manual ammonia cleavage a Attach an empty luer tip syringe with plunger fully inserted into one end of the synthesis column b Load 2 ml of conc ammonia in another luer tip syringe and attach to the other end of the column 6 30 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems c Holding a syringe in each hand carefully inject the reagent through the column to the empty syringe and return the reagent through the column several times d Allow it to stand for at least one hour at room temperature e Drain all of the reagent into one syringe detach and eject contents carefully into an appropriate vial for heating to achieve complete deprotection 18 L J McBride McCollum C Davidson S Efcavitch J W Andrus A and Lombardi S J Biotechniques 6 No 4 362 367 1988 A New Reliable Cartridge for the Rapid Purification of Syntheti
86. Department Upon choosing SELF TEST the screen will read Select a test Version 1 00 all battery valves more main 3 48 Section 3 Software Menu Descriptions Applied Biosystems ALL Performs the self test on the battery the valves the relays ROM read only memory and RAM random access memory When testing these components it is simpler to press ALL instead of each option individually BATTERY Tests for the proper functioning of the battery VALVES Tests for the proper operation of all valves Select MORE for additional test options Select a test Version 1 00 relays ROM RAM more main RELAYS Tests for the proper operation of the fraction collector relays ROM Tests for the proper operation of the permanent memory or the Read Only Memory RAM Tests for the proper operation of the Random Access Memory or the user de fined memory Select MORE for additional test options Select a test tr 235 Version 1 00 keys display clock more main Select MORE for additional test options Select a test Version 1 00 tones repeat RESET more main The KEYS DISPLAYS CLOCK and TONES key are only used during manufacturing REPEAT Section 3 Software Menu Descriptions 3 49 Applied Biosystems Repeats the self test for the battery valves relays ROM and RAM until the STOP key is pressed RESET Clears the clock setting and RAM including any stored DNA sequences and user defined c
87. E Warranty 391 Pre Installation Manual E 9 Applied Biosystems Shipping List The instrument will be shipped in a crate with the following accessory items Part No Description Quantity 000160 Ferrule 1 16 in teflon 2 000161 Bushing 1 16 in plastic 2 002170 4 L Bottle 1 002268 Gasket EPR 1 100072 Wrench 1 4 in x 5 16 in 1 110005 Connector 1 4 MP 1 4 T brass 1 110096 Nut 1 4 in brass 1 110097 Ferrule swage 1 4 in 1 140024 4 L waste bottle 1 140041 4 L bottle safety carrier 1 200270 Solvent inlet filter 40 um 1 221014 O ring Karlez 1 225016 Tubing 1 4 in o d polypropylene 10 ft 3 m 225075 Tubing Tygon 3in 76 mm 400501 Bottle seals 16 oz 10 pkg 1 400790 Bottle seals 200 ml 10 pkg 1 600223 Trityl collection tubing assembly 1 600235 Fraction collector cable 1 601865 4 L waste cap assembly 1 In addition a plug voltage kit from the list below will be included with your instrument Part No Description Voltage and Frequency 401202 Plug voltage kit for US Canada 120V 60 Hz 401203 Plug voltage kit for Continental Europe 220V 50 Hz 401204 Plug voltage kit for United Kingdom 240V 50 Hz 401205 Plug voltage kit for Australia 240V 50Hz 401201 Plug voltage kit for Japan 100V 50 60Hz Verify that the plug voltage kit you received is the correct one for your installation site E 10 Appendix E Warranty 391 Pre Installation Manual Applied Biosystems The 391 EP PCR MATE will be shipped wit
88. EDTA in deionized formamide loading buffer to the sample Bromophenol Blue and Xylene Cyanol can be added as marker dyes to the formamide prior to addition to the sample The sample can be loaded onto an analytical gel in the same manner as described in Applied Biosystems DNA Synthesis User Bulletin No 13 Revised Analysis and Purification of Synthetic Oligonucleotides The linker retards the migration of the oligonucleotide by approximately one half of a base in the gel There is occasionally a radioactive contaminant which is a by product of the labeling procedure This contaminant is most likely a type of enzyme Cordycepin complex which co electrophoreses with the sample and may appear on the autoradiogram as a fuzzy band in the region of a 16 mer It is recommended that a blank sample containing the constituents of the reaction but without DNA be loaded on the gel so that the contaminant can be compared with the DNA sample Note that since phosphorylation of the 5 hydroxyl by T4 kinase should be blocked by the presence of the linker this procedure can be used as a qualitative analysis of the efficiency of Aminolink 2 addition Anion exchange HPLC described in User Bulletin No 13 Revised can be used for Aminolink oligonucleotide analysis or purification The inherent problem with using reverse phase HPLC for purification is that the oligonucleotide and the Aminolink oligonucleotide are not well resolved Gel purification seems to give better r
89. GENT VALVE BLOCKS 0000000 OOOOH USER SUPPLIED TRITYL COLLECT gt FRACTION COLLECTOR 9 4 SYNTHESIS COLUMN TO WASTE TETRAZOLE ACETIC ANHYDRIDE 0 1 METHYLIMIDAZOLE NMI TRICHLOROACETIC ACID TCA Legend IODINE ACETONITRILE CH CN Q Valve ae Bottle s 8 s S 2 s Applied Biosystems 391 FUNCTION LIST VERSION 1 00 TIME 04 27 DATE 05 11 89 FUNCTION FUNCTION NUMBER NAME 1 BLOCK FLUSH 2 REVERSE FLUSH 4 WAIT 5 ADVANCE FC 6 WASTE PORT 7 WASTE BOTTLE 9 18 TO COLM 10 18 TO WASTE 13 15 TO COLUMN 14 14 TO COLUMN 16 CAP PREP 17 INTERRUPT 19 TO COLUMN 22 CAP TO COLUMN 28 PHOS PREP 31 RCDR ON 32 RCDR OFF 33 CYC ENTRY 34 CYC END 43 18 PREP 51 TET PREP 52 A TO WASTE 53 TO WASTE 54 C TO WASTE 55 T TO WASTE 56 X TO WASTE 59 CAP A TO WASTE 60 CAP B TO WASTE 61 TET TO WASTE 62 FLUSH A 63 FLUSH TO G 64 FLUSH TOC 65 FLUSH TOT 66 FLUSH TO X 69 FLUSH TO TET 70 FLUSH TO 18 71 18 TO 72 18 TOG 73 18 74 18 75 18 TO X 78 18 TO TET 81 15 TO WASTE 82 14 TO WASTE 84 18 TO 14 85 18 TO 15 86 FLUSH TO 14 15 87 18 TO 11 88 18 TO 12 89 FLUSH TO 11 12 90 TET TO COLUMN FUNCTION VALVE LIST 0 13 14 16 12 13 14 1 12 16 17 1 13 17 2 12 16 18 3 12 16 19 22 6 12 16 20 23 4 5 12 16 22 20 23 17 23 11 18 20 10 13 20 9 13
90. IDE 0 ji 1 METHYLIMIDAZOLE NMI TRICHLOROACETIC ACID TCA H IODINE ACETONITRILE CH CN GAS SOOO Oeo o j Figure B 1 DNA Synthesizer Schematic SYNTHESIS s s s s USER SUPPLIED FRACTION COLLECTOR CH CN Appendix B DNA Synthesizer Schematic DNA Synthesizer Plumbing Diagram B 3 Applied Biosystems V amp ACCUM BALLAST 29497 2 8 E Figure 2 DNA Synthesizer Plumbing Diagram B 4 Appendix B DNA Synthesizer Schematic DNA Synthesizer Plumbing Diagram Appendix C Synthesis Log Sheet Reagent Solvent Log Sheet SYNTHESIS LOG SHEET SEQUENCE NAME SEQUENCE DATE USER Absorbance of Nucleoside Trityl Solution Micromoles SON locom pA ILE ish bn er gt B eA D 99 gt REAGENT SOLVENT LOG MONTH 12 11 9 5 4 3 2 1 12 11 REAGENT SOLVENT LOG MONTH ARGON WASTE 18 15 14 12 11 Appendix D 391 Illustra
91. ION ON THE PART OF AB E 24 Appendix E Warranty 391 Pre Installation Manual Headquarters 850 Lincoln Centre Drive Foster City CA 94404 USA Phone 1 650 638 5800 Toll Free 1 800 345 5224 Fax 1 650 638 5884 Worldwide Sales Offices Applied Biosystems vast distribution and Service network composed of highly trained support and applications personnel reaches into 150 countries on six continents For international office locations please call our local office or refer to our web site at www appliedbiosystems com www appliedbiosystems com AR Applied NB Biosystems Applera Corporation is committed to providing the world s leading technology and information for life scientists Applera Corporation consists of the Applied Biosystems and Celera Genomics businesses Printed in the USA 06 2002 Part Number 900937 Rev D an Applera business
92. LM 10 Yes Yes Yes Yes Yes 39 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 40 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 41 5 ADVANCE FC 1 Yes Yes Yes Yes Yes 42 6 WASTE PORT 1 Yes Yes Yes Yes Yes 43 82 14 TO WASTE 3 Yes Yes Yes Yes Yes Continued on next page A 8 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE NAME 1uM NUMBER OF STEPS 64 TIME 04 23 DATE 05 11 89 STEP FUNCTION NUMBER 44 14 14 TO COLUMN 45 108 FLUSH TO TRIT 46 14 14 TO COLUMN 47 108 FLUSH TO TRIT 48 14 14 TO COLUMN 49 108 FLUSH TO TRIT 50 14 14 TO COLUMN 51 108 FLUSH TO TRIT 52 14 14 TO COLUMN 53 108 FLUSH TO TRIT 54 14 14 TO COLUMN 55 108 FLUSH TO TRIT 56 9 18 TO COLM 57 108 FLUSH TO TRIT 58 7 WASTE BOTTLE 59 1 BLOCK FLUSH 60 2 REVERSE FLUSH 61 9 18 TO COLM 62 2 REVERSE FLUSH 63 1 BLOCK FLUSH 64 34 CYC END STEP TIME 2 ACTIVE FOR BASES G 1 X Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Y
93. M 2 Yes Yes Yes Yes Yes 8 90 TET TO COLUMN 2 Yes Yes Yes Yes Yes 9 19 B TET TO COLM 2 Yes Yes Yes Yes Yes 10 90 TET TO COLUMN 2 Yes Yes Yes Yes Yes 11 19 B TET TO COLM 2 Yes Yes Yes Yes Yes 12 90 TET TO COLUMN 2 Yes Yes Yes Yes Yes 13 4 WAIT 15 Yes Yes Yes Yes Yes 14 16 CAP PREP 3 Yes Yes Yes Yes Yes 15 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 16 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 17 22 CAP TO COLUMN 10 Yes Yes Yes Yes Yes 18 4 WAIT 5 Yes Yes Yes Yes Yes 19 10 18 TO WASTE 3 Yes Yes Yes Yes Yes 20 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 21 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 22 81 15 TO WASTE 3 Yes Yes Yes Yes Yes 23 13 15 TO COLUMN 10 Yes Yes Yes Yes Yes 24 10 18 TO WASTE 5 Yes Yes Yes Yes Yes 25 4 WAIT 15 Yes Yes Yes Yes Yes 26 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 27 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 28 10 18 TO WASTE 5 Yes Yes Yes Yes Yes 29 9 18 TO COLM 10 Yes Yes Yes Yes Yes 30 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 31 9 18 TO COLM 10 Yes Yes Yes Yes Yes 32 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 33 9 18 TO COLM 10 Yes Yes Yes Yes Yes 34 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 35 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 36 33 CYC ENTRY 1 Yes Yes Yes Yes Yes 37 10 18 TO WASTE 3 Yes Yes Yes Yes Yes 38 9 18 TO COLM 10 Yes Yes Yes Yes Yes 39 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 40 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 41 5 ADVANCE FC 1 Yes Yes Yes Yes Yes 42 6 WASTE PORT 1 Yes Yes Yes Yes Yes 43 82 14 TO WASTE 3 Yes Yes Yes Yes Yes Conti
94. Main Menu This will not affect the Holding status 3 20 Section 3 Software Menu Descriptions Applied Biosystems Suip oH HIL 2 8 oni 18 OL Anan 4218 oL duni eunse1 9504 Zi Jo Z 9 04 9NIQ IOH nN3N 295 G 0 31SvM OL 81 1 4315 ONIQ10H Pi 1 gt 199 vvv vvv vvv c T nN3N 440 NO 1 OL 440 1411 9 1 3149 gil VNQ ANAN d31 SNIZIS3HINAS ijo vvv vvv vvv sa 310 340 NO 330 69 1 8 Z2I 1 VNO buio Ee nr o1 asow id aui dunt piou 769504 2 0 Z ISDA ONIZISSHLNAS ONBW 1 1 988 G jo 31SVM OL 8l 4 E dais nuaw 104p9 91104 10jipa aiw abuoys YNG 3 21 Section 3 Software Menu Descriptions Applied Biosystems The Jump Step Menu Using JUMP the synthesizer can execute any step in the cycle before or after the current step being performed Jumping to out of sequence steps enables you to repeat or skip parts of the chemical cy cle The jump step menu and its relationship to the Synthesizing Status Menu are shown in Figure 3 3 When you select JUMP the step being executed will continue indefinitely like pressing HOLD The screen will display the Jump Step Menu showing the
95. N EDITOR Used to create and edit user functions and to print the standard user and test functions POWER FAIL Used to program the instrument to automatically restart synthesis following a power outage or to interrupt the synthesis until you restart or abort it SELF TEST Verifies the correct operation of the electronic components of the instrument Access the Flow Test procedure SET CLOCK Used to enter the current time and date SHUT DOWN Prepares the instrument for long term storage by washing and drying all chem ical pathways screen displays one of the DNA strands and shows the number of bases in that strand For example the following menu shows DNA 1 which currently has zero bases Select action for DNA 1 0 mer edit copy print next main EDIT Select to create edit or delete DNA strand designated in the menu COPY Select to copy the designated DNA strand into any other DNA strand PRINT When printer is connected to the instrument select this option to print the des ignated DNA strand NEXT Select to access the next DNA strand for subsequent editing copying and or printing Applied Biosystems The Edit Key When EDIT is selected the display reads The 5 and 3 positions are clearly marked and the cursor is to the right of 5 gt The number at the top left corner of the screen signifies which DNA strand is being shown i e 1 DNA 1 The number at the top right comer of the screen indic
96. NE DELIVERY VALVES COMMON PATHWAY INLET VAC ASSIST MANIFOLO VALVE BLOCK gt SOLENOID OPEN CLOSED SOLENOID MOUNTING BLOCK MANIFOLD SOLENOID PISTON VALVE BLOCK MANIFOLD COMMON PATHWAY DIAGPHRAM MANIFOLD INLET LINE Figure 5 4 The Valve Block Vacuum Assist For proper valve block operation it is crucial that each diaphragm forms a domed chamber The vacuum assist creates a vacuum on the solenoid side of the diaphragm to form a domed chamber each time a solenoid valve opens An aspirator pump provides vacuum assist to each valve block The aspirator pump requires that regulated argon enter the synthesizer at a gauge pressure of ap proximately 60 psi The argon regulator should be connected to the instrument with the 4 inch tub ing supplied by Applied Biosystems IMPORTANT Do not use 1 8 inch tubing it is too narrow to deliver the correct volume of gas The vacuum gauge should always read between 14 in and 18 in Hg When the gauge drops below 14 in Hg once every 4 10 hours a valve opens to allow high pressure argon to flow to the aspi rator pump The gas is then diverted out of the pump and creates a Venturi vacuum when a second Section 5 System Description Hardware 5 9 Applied Biosystems valve opens to the vacuum assist plumbing If the gauge pressure drops below 14 in Hg more than once every 4 hours there is a leak in the system
97. PCR MATE EP MODEL 391 DNA SYNTHESIZER User s Manual ns Copyright 2002 Applied Biosystems rights reserved PCR MATE OPC Aminolink 2 and Syncom are trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries The Polymerase Chain Reaction PCR process is covered by Cetus Corporation s U S Patent Number 4 683 202 No license to use the PCR process is given or implied by Applied Biosystems Cetus licensing of PCR MATE Teflon is a trademark of the E I DuPont de Neumors Company Parafilm is a trademark of the American Can Company Drierite is a trademark of the W A Hammond Drierite Company Swagelock is a trademark of the Swagelock Company HOW TO START Begin by reading Section 1 Introduction It contains vital information and will help you understand how the manual is organized and how to use it Next refer to Section 2 Operation for instructions on how to prepare and start a synthesis Contents Section 1 Introduction How To Use This 1 2 General Introduction recreo torii ee cree a pee e eee 1 3 How to Get Help intet ueste tet eet detto ta step nda 1 5 Contacting Technical enne nnne nennen nnne 1 5 To Contact Technical Support by E Mail ene 1 5 Hours for Telephone Technical Support 1 5 To Contact Technical Support by Telephone or
98. S t etate e Hip ae t Der ad d Re eec ds E 4 Material Safety Data Sheets MSDS sssssssssssssssee eene E 4 Waste Profile Sensara isen eco IE ee eee eet ee Dee aea E 5 Abbreviations Initializations and E 6 ELEM 7 Chemicals and Accessories entren nnne nnne nnn nennen E 7 Star Up GhemicalKit it eve eoe in DO ER E 7 Additional Chemicals and Columns sse enne E 9 Shipping list eid ed er ER ea e Let air ie up E 10 User Supplied 11 Site Preparations soie te Lett tti nie ee ad E 13 Laboratory Space 5 e rn renti etre ae i Dae nr RR o ee Xa CERE eee E 13 Electrical Requirements nennen nennen nennen nnns E 14 POW6R Quality ec tte peti iuf teste us E 15 Cooling Requirements nennen nennen nennen enne nnne nnns E 16 once eet e eee eret re x eal E 16 Applied Biosystems Ventilation E 16 Liquid Waste Disposal 2 niece ep e die een a E 17 Operator Training at 1 51 E 17 Proof of Performance donee neni nen aae nne ASEE ene niei E 17
99. S NUMBER T X 47 108 FLUSH TO TRIT 1 Yes Yes Yes Yes Yes 48 14 14 TO COLUMN 10 Yes Yes Yes Yes Yes 49 108 FLUSH TO TRIT 1 Yes Yes Yes Yes Yes 50 14 14 TO COLUMN 10 Yes Yes Yes Yes Yes 51 108 FLUSH TO TRIT 1 Yes Yes Yes Yes Yes 52 14 14 TO COLUMN 10 Yes Yes Yes Yes Yes 53 108 FLUSH TO TRIT 1 Yes Yes Yes Yes Yes 54 14 14 TO COLUMN 10 Yes Yes Yes Yes Yes 55 108 FLUSH TO TRIT 1 Yes Yes Yes Yes Yes 56 9 18 TO COLM 10 Yes Yes Yes Yes Yes 57 108 FLUSH TO TRIT 8 Yes Yes Yes Yes Yes 58 7 WASTE BOTTLE 1 Yes Yes Yes Yes Yes 59 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 60 9 18 TO COLM 20 Yes Yes Yes Yes Yes 61 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 62 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 63 34 CYC END 1 Yes Yes Yes Yes Yes 4 22 Section 4 Functions Cycles and Procedures Applied Biosystems Procedures The Phosphoramidite Purge Procedure The phosphoramidite purge procedure fills all phosphoramidite and tetrazole delivery lines from the reservoir to the reagent valve block with fresh reagent This process uses less than one half the amount of phosphoramidite used in a coupling step of a one micromole synthesis A purge is done prior to beginning a synthesis when the instrument has been idle for more than 12 hours more than 6 hours in humid environments or if one of the phosphoramidite reservoirs has not been accessed within 12 hours Over this time oxygen and atmospheric water can penetrate the delivery lines and caus
100. TO Ve s ae i NN tetrazole 1 iProN P gt 2 H i iProN P OCH2CH2SCN phosphoramidite nucleoside 1 2 i P OCH gt CH gt CN N P 0CH5CH5CN support bound B nucleoside tetrazolyl phosphoramidite Figure 6 6 The coupling step Phosphoramidites and tetrazole are delivered to the column which contains the support bound nucleotide The diisopropylamine is protonated and displaced by tetrazole When the 5 OH couples to the phosphorous a 5 to 3 internucleotide linkage is created Capping Because coupling is not always quantitative a small percentage up to 296 of support bound nu cleotides can fail to undergo addition These truncated or failure sequences will remain attached to the support If they remain in the hydroxyl form they can propagate in subsequent coupling steps Failure sequences with one less base than the product would then be generated making isolation of the product more difficult Capping the remaining free hydroxyls by acetylation eliminates this problem The capped failure sequences are then prevented from participating in the rest of the syn thesis reactions To cap equal volumes and equimolar amounts of two binary reagents acetic anhydride bottle 11 and 1 methylimidazole NMI bottle 12 are simultaneously delivered to the column As shown in Figure 6 7 the reagents mix and create
101. USH TO TET 0 6 F 70 FLUSH TO 18 0 1 F 86 FLUSH TO 14 15 0 2 3 F 89 FLUSH TO 11 12 0 4 5 Section 4 Functions Cycles and Procedures 4 17 Applied Biosystems Test Functions Test functions are used to perform the flow test procedure The procedure is used during instrument manufacturing installation and troubleshooting If desired test functions can be inserted into a syn thesis cycle using the Cycle Editor or a procedure using the Procedure Editor The following func tions deliver the contents of the designated bottle to the column FUNCTION NAME VALVES NUMBER F 101 A TO COLUMN 11 12 16 20 F 102 G TO COLUMN 10 12 16 20 F 103 C TO COLUMN 9 12 16 20 F 104 T TO COLUMN 8 12 16 20 F 105 X TO COLUMN 7 12 16 20 F 90 TET TO COLUMN 6 12 16 23 F 106 11 TO COLUMN 5 12 16 22 F 107 12 TO COLUMN 4 12 16 22 Note that when you print the functions F108 and F109 are listed with the test functions When cat egorizing they are included with functions that rinse and flush chemical pathways Synthesis Cycles A function performed for a specified time is called a step During synthesis steps are arranged in a particular order to create a synthesis cycle The cycle completes all operations necessary for one base addition and is repeated until DNA of desired length is fully synthesized Applied Biosystems supplies four synthesis cycles which are optimized for use with B cyanoethyl phosphoramidite
102. Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME 10uM NUMBER OF STEPS 53 TIME 04 25 DATE 05 11 89 STEP FUNCTION STEP ACTIVE FOR BASES NUMBER NAME TIME A G C T X 1 10 18 TO WASTE 3 Yes Yes Yes Yes Yes 2 9 18 TO COLM 50 Yes Yes Yes Yes Yes 3 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 4 9 18 TO COLM 50 Yes Yes Yes Yes Yes 5 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 6 9 18 TO COLM 50 Yes Yes Yes Yes Yes 7 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 8 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 9 28 PHOS PREP 3 Yes Yes Yes Yes Yes 10 61 TET TO WASTE 6 Yes Yes Yes Yes Yes 11 19 B TET TO COLM 55 Yes Yes Yes Yes Yes 12 4 WAIT 15 Yes Yes Yes Yes Yes 13 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 14 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 15 16 CAP PREP 3 Yes Yes Yes Yes Yes 16 22 CAP TO COLUMN 40 Yes Yes Yes Yes Yes 17 4 WAIT 5 Yes Yes Yes Yes Yes 18 10 18 TO WASTE 3 Yes Yes Yes Yes Yes 19 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 20 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 21 81 15 TO WASTE 3 Yes Yes Yes Yes Yes 22 13 15 TO COLUMN 50 Yes Yes Yes Yes Yes 23 4 WAIT 15 Yes Yes Yes Yes Yes 24 10 18 TO WASTE 3 Yes Yes Yes Yes Yes 25 2 REVERSE FLUSH 45 Yes Yes Yes Yes Yes 26 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 27 10 18 TO WASTE 3 Yes Yes Yes Yes
103. al 1 800 831 6844 and press 1 Product or Product Area Telephone Dial Fax Dial ABI PRISM 3700 DNA Analyzer 1 800 831 6844 then press 8 1 650 638 5981 DNA Synthesis 1 800 831 6844 then press 21 1 650 638 5981 Fluorescent DNA Sequencing 1 800 831 6844 then press 22 1 650 638 5981 Fluorescent Fragment Analysis includes GeneScan applications 1 800 831 6844 then press 23 1 650 638 5981 Integrated Thermal Cyclers ABI PRISM9877 and Catalyst 800 instruments 1 800 831 6844 then press 24 1 650 638 5981 ABI 3100 Genetic Analyzer 1 800 831 6844 then press 26 1 650 638 5981 Biolnformatics includes BioLIMS BioMerge and SQL GT applications 1 800 831 6844 then press 25 1 505 982 7690 Peptide Synthesis 433 and 43X Systems 1 800 831 6844 then press 31 1 650 638 5981 Protein Sequencing Procise Protein Sequencing Systems 1 800 831 6844 then press 32 1 650 638 5981 PCR and Sequence Detection 1 800 762 4001 then press 1 for PCR 2 for the 7700 or 5700 6 for the 6700 or dial 1 800 831 6844 then press 5 1 240 453 4613 Voyager MALDI TOF Biospectrometry and Mariner ESI TOF Mass Spectrometry Workstations 1 800 899 5858 then press 13 1 508 383 7855 Biochromatography BioCAD Workstations and Poros Perfusion Chromatography Products 1 800 899 5858 then press
104. appropriated buffer and used in your experiment The product ob tained from OPC is highly purity DNA that can be used with complete confidence The OPC purification protocol appears at the end of this section It successfully purifies sequences up to 70 bases Note that for sequences 40 70 bases long you must perform an additional step num ber 9a This step adds several washes with dilute ammonia after detritylation with 2 trifluoroacetic acid The extra basic wash removes preferentially any shorter sequences that had trityl protecting groups attached and thus co purified with the desired product The purification of longer oligomers gt 70 mers using OPC can be more difficult But a protocol has been developed by Thomas Horn and Mickey Urdea of Chiron Co 15 in which you pre treat the oligonucleotides with lysine and then perform the OPC purification procedure See the Protocol for Lysine Pre treatment of Longmers gt 70 bases The usefulness of the lysine pre treatment is dependent on the amount of depurination in the oligonucleotide The greater the depurination the more useful the procedure might be Depurination is sequence and reagent dependent The higher the purine content of a sequence the greater the chances are of depurination occurring The higher Section 2 Operation 2 35 Applied Biosystems the reagent purity the smaller the chances are of depurination occurring Because of Applied Bio systems high purity reagents
105. ates the base position number It equals zero when there are no entries and increases by one as each base is entered Also it displays the base number corre sponding to the cursor position For example when the cursor is under C in the sequence 5 AGCT 3 is shown as base number 3 5 gt AGCT lt 3 3 IMPORTANT Following standard convention The DNA sequence is entered 5 to 3 The DNA Editor Menu displays the 5 terminus as Base 1 and subsequent bases are numbered 5 to 3 However the DNA strand is actually synthesized 3 to 5 To enter a sequence begin by pressing the gray key labeled A G C T or X which corresponds to the 5 terminus The base will appear on the screen the cursor will move one position to the right and the base position number will increase to one The display will read 1 55A lt 3 1 space erase menu Continue to enter the sequence 5 to 3 until it is the specified length When finished check it care fully to be sure it is correct If possible print the sequence to verify it Use parentheses to insert multiple bases in one position for synthesizing mixed sequence probes EE This is done by selecting the left open parenthesis typing any combination of bases A G C T or X and then selecting the right close parenthesis For example to insert AGCT in the third position of the sequence 5 AA 3 3 8 Section 3 Software Menu Descriptions Applied Biosys
106. ation of bases spaces and parentheses to create a sin gle sequence The screen shows a maximum of 28 characters at a time When additional characters are entered the display shifts to the left and the base s at the 5 position will no longer be seen To observe parts of a sequence not displayed press the right or left arrow key or lt to move the cursor toward the area you want to see Note Once a synthesis has begun the DNA sequence which is currently being synthesized cannot be changed The DNA Editor Menu can be accessed during an active synthesis and new sequences can be created for use in subsequent syntheses Entering a new sequence will not affect the one currently being made even if the active strand is erased or edited The Copy Key The COPY key is used to transfer an exact duplicate of one DNA strand e g DNA 1 into another DNA strand e g DNA 2 This feature is useful when performing consecutive syntheses of similar but not identical sequences For example if DNA 1 has a 60 base sequence the sequence can be copied into DNA 2 DNA 2 can then be edited instead of having to enter the entire sequence To transfer a copy of DNA 1 into DNA 2 the first page of the DNA editor should read Select action for DNA 1 60 mer edit copy print next Choose COPY and the menu will state that the sequence in DNA 1 will be copied into another DNA strand in this example DNA 2 Copy DNA 1 into DNA 2 0 mer
107. aucage S L and Caruthers M H Tetrahedron Letters 22 1859 1862 1981 Beaucage S L and Caruthers M H United States Patent 44 668 777 3 Matteucci M D and Caruthers M H J Am Chem Soc 103 3185 1981 Matteucci M D and Caruthers M H United States Patent 4 458 066 4 Adams S P Kavka K S Wykes E J Holder S B and Galluppi G R J Am Chem Soc 105 661 1983 5 Eadie J S and Davidson D S Nucleic Acids Research 15 8333 8349 1987 Farrance I K Eadie J S and Ivarie R Nucleic Acids Research 17 1231 1245 1989 6 Sinha N D Biernat J and Koster H Tetrahedron Letters 24 5843 5846 1983 7 McBride L J Eadie J S Efcavitch J W and Andrus W A Nucleosides and Nucleotides 6 297 300 1987 Yeung A T Dinehart W J and Jones B K Nucleic Acids Research 16 4539 4554 1988 8 Efcavitch J W McBride L J and Eadie J S Biophosphates and Their Analogues Synthesis Structure Metabolism and Activity pages 65 70 Bruzik K S and Stec W J Eds Proceedings of the 2nd International Symposium on Phosphorus Chemistry Directed Towards Biology Lodz Poland 1986 9 Tanaka T and Letsinger R L Nucleic Acids Research 10 3249 3260 1982 10 Efcavitch J W and Heiner C Nucleosides and Nucleotides 4 267 1985 11 McBride L J and Caruthers M H Tetrahedron Letters 24 245 248 1983 12 Dahl O Phosphorus and Sulfur 18 201 204 1983
108. azole 2 A B cyanoethyl protecting group on the 3 phosphorous moiety This group prevents side reactions and aids in solubility of phosphoramidites It is removed upon completion of the synthesis by using ammonia In deprotection ammonia acts as a base to remove a proton on the methylene group bearing the nitrile group This anion is formed only in low concentration but rapidly fragments by a B elimination reaction to form acrylonitrile and the deprotected internucleotide phosphodiester group Acrylonitrile then reacts irreversibly with ammonia to form 3 aminopropionitrile an inert compound 3 A dimethoxytrityl DMT protecting group on the 5 hydroxyl The DMT is removed during each detritylation step leaving a reactive 5 hydroxyl available for coupling an incoming phosphoramidite 4 A benzoyl protecting group on the exocyclic amines of A and C C92 and an isobutyryl protecting group on the exocyclic amine of G These amide groups prevent side reactions and are removed upon completion of the synthesis with ammonia Since thymidine is unreactive and does not contain an exocyclic amine moiety it is not protected e NH DMTO iProN P OCH2CH2CN Figure 6 5 Structure of guanosine cyanoethyl phosphoramidite 6 12 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems Coupling Before beginning the coupling step the support is made anhydrous and free of nucl
109. b iting in vitro viral replication of HIv 7 6 26 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems a ad Oo EF EF CONVERSION OF HYDROGEN PHOSPHONATE TO PHOSPHATE ANALOGS XIDANT lo pyr EtzN Ho0 THF S sulfur CSo pyr EtzNn HNR2 CClA OR ROH base CCla Figure 6 12 5 Attachments In the last several years many applications have been identified and developed for the covalent at tachment of small molecules to oligonucleotides These molecules include fluorescent dyes 0 32 and other species that allow the identification of oligonucleotides in biological biotin proteins systems In addition oligonucleotides can be derivatized to allow attachment to solid supports In this way for example an affinity matrix can be constructed to purify a sequence complementary to the support bound sequence The attachment can be made at several sites on the oligonucleotide However this site must not im pair hybridization or confer chemical instability For these reasons and for synthesis ease and effi ciency the 5 terminus is usually the preferred location for derivatization of an oligonucleotide Section 6 Chemistry for Automated DNA Synthesis 6 27 Applied Biosystems Fluorescent dye Linked Sequencing Primers Amino Link 2 The 5 fluorescent dye labelled sequencing primers used for the Applied Biosystems 370A DNA Sequencer consist of three parts t
110. ber Nucleotide bases are added one at a time to the support bound DNA chain until the sequence is fully synthesized Solid support synthesis allows excess reagents to be removed by fil tration and eliminates the need for purification between base additions Typically stepwise yields of 98 to 100 are obtained enabling synthesis of oligonucleotides more than 180 bases in length With these high coupling efficiencies the desired sequence is so abundant in shorter syntheses up to 30 bases that you usually do not need to purify the product A simple desalting is adequate for most applications When you need to purify longer oligonucleotides Applied Biosystems offers the Oligonucleotide Purification Cartridge This fast and easy to use cartridge completely de salts and purifies the DNA product in about 15 minutes Applied Biosystems chemicals are pretested to ensure high yield syntheses Solvents and re agents are packaged in bottles that you attach directly to the synthesizer All chemicals except the phosphoramidites are ready to use To prepare the phosphoramidites you only need to dissolve them in anhydrous acetonitrile Each phosphoramidite column reagent and solvent manufactured by Applied Biosystems is unconditionally guaranteed If you are not completely satisfied by the product and it is used prior to any applicable expiration date and under the correct operating con ditions it will be replaced at no charge Reagents an
111. by releasing the interrupt select MONITOR SYNTH and press RESUME as needed About the Alarm The alarm is triggered when a bottle has been used a specified number of cycles To operate effec tively the alarm must be set correctly If set too high the reservoir could run dry and the synthesis could fail Chemical consumption can vary with each instrument due to different pressure regulator settings and use of different cycle scales Bottle usage data is provided in Table 3 1 as a guideline for setting the alarm This data shows the average number of uses or cycles obtainable per bottle When ini Section 3 Software Menu Descriptions 3 31 Applied Biosystems tially setting the alarm use values which are 5 to 7 uses less than these numbers and adjust as nec essary IMPORTANT Since consumption rates will vary from instrument to instrument it is important to visually monitor reagent consumption for the first several syntheses Once you determine the usage the alarms can be effectively set Note that the number of uses obtainable per bottle will change depending on which cycle is being performed e g 2u M lu M Low or 10u M Longer chemical delivery steps result in greater re agent consumption and fewer uses per bottle Consider these factors when setting the alarm Phosphoramidites used during the phosphoramidite purge procedure are not tabulated in the cycle counter This process uses less than one half the amount of
112. c DNA Applied Biosystems User Bulletin No 51 OPC Purification of Long Oligonucleotides 19 Rapid Purification Desalting and Detritylation of Synthetic Oligonucleotides McCollum C Davidson S McBride L J Efcavitch J W and Andrus A poster FASEB Las Vegas 1988 20 Horn and Urdea M S Nucleic Acids Research 16 11559 11571 1988 21 Efcavitch J W The Electrophoresis of Synthetic Oligonucleotides Gel Electrophoresis of Synthetic Oligonucleotides 2nd Ed IRL Press Practical Approach Series in press 22 Applied Biosystems User Bulletin No 47 RNA Synthesis April 1988 23 Usman N Ogilvie K K Jiang M Y and Cedergren R J J Am Chem Soc 109 7845 7854 1987 Ogilvie K K Damha M J Usman N and Pon R T Pure amp Applied Chem 59 325 330 1987 Ogilvie K K Usman N Jiang M Y and Cedergren R J Proc Natl Acad Sci 5764 1988 24 Froehler B C and Matteucci M D Tetrahedron Letters 27 469 472 1986 Froehler B C Ng P G and Matteucci M D Nucleic Acids Research 14 5399 5407 1986 Garegg P J Lindh I Regberg Stawinski J and Stromberg R Tetrahedron Letters 27 4051 4057 1986 25 Andrus W A Efcavitch J W and McBride L J United States Patent 4 816 571 Chemical Capping By Phosphitylation During Oligonucleotide Synthesis 26 Andrus A Efcavitch J W McBride L J and Giusti B Tetrahedron Lette
113. ccord with local state and federal regulations Additional free copies of the waste profiles are available from Applied Biosystems on request Appendix E Warranty 391 Pre Installation Manual E 5 Applied Biosystems Abbreviations Initializations and Units AB Applied Biosystems Btu h British thermal units hour CGA Compressed Gas Association cm centimeter DNA deoxyribonucleic acid ea each EP extended programmability fpm feet per minute ft feet g gram gal gallon h hour HPLC high performance liquid chromatography Hz hertz i d inside diameter in inch kg kilogram kPa kiloPascal kVA kilovolt amperes L Ib pound M molar m meter m cubic meters mL milliliter mm millimeter mol wt molecular weight MSDS material safety data sheet nm nanometer No number o d outside diameter oz ounce P N part number par paragraph PCR polymerase chain reaction ppm parts per million psi pounds per square inch V volt C degrees Celsius F degree Fahrenheit um micron umol micromole E 6 Appendix E Warranty 391 Pre Installation Manual Applied Biosystems Introduction This manual will help you prepare for the installation of your Model 391 or Model 391 with extend ed programmability EP DNA Synthesizer The first part describes 1 items that will be shipped with the instrument and 2 chemicals and e
114. cle on the 2uM scale Table 4 1 Applied Biosystems Synthesis Cycles The 0 2 uMol scale provides sufficient oligomers for most applications Using this scale the ex pected crude yield in optical density units or odu nm equals the number of bases in the sequence For example synthesis of a 20 mer typically yields approximately 20 O D of crude oligonucleotide When larger quantities of DNA are needed the 11M or lOuM cycle can be used With the 1M cycle synthesis of a 20 mer will yield about 100 of crude oligonucleotide 1uM crude yield O D length x 5 Synthesizing a 20 mer with the lO uM cycle will yield about 800 odu of crude DNA The steps in each cycle have optimized delivery times which ensure completion of each chemical reaction yet an entire synthesis cycle is complete in 5 5 minutes The cycle time for lOuM is 25 minutes The 0 24 cycle cost is about 45 less than the 1u M cycle cost The Low cycle costs are about 25 less than the 0 2u M cost All cycles are listed in Appendix A In addition the 2uM cycle is shown in Figure 4 5 Each cycle consists of the required number of steps which are listed with the corresponding function number name and step time To determine the purpose of each step refer to the explanation of Synthesis Cycle Functions found earlier in this section Section 4 Functions Cycles and Procedures 4 19 Applied Biosystems More About the 2uM Cycle The four es
115. consecutive steps EXIT Inserts the step in the cycle and returns to the previous menu Choose EXIT af ter completing all insertions or when inserting a single step If neither a valid function nor the time has been entered pressing EXIT will return to the previ ous menu without inserting the step How to Correct Mistakes To correct mistakes type over the incorrect entry or erase it by pressing the delete key on the fixed keyboard Once a step has been inserted it can only be erased by viewing the step and selecting the DELETE soft key 3 38 Section 3 Software Menu Descriptions Applied Biosystems IMPORTANT When creating new cycles they must contain Function 33 Cycle Entry and Function 34 Cycle End for non zero times e g 1 second In addition Cycle Entry should appear before Cycle End Adding a step to an existing cycle is done in the same manner as just described Note that all new steps are inserted after existing ones For example when step 8 is shown and insert is selected the new step will become step 9 subsequent steps are renumbered accordingly IMPORTANT During an active synthesis only step times can be edited Any new times will be effective immediately and will be used during the current synthesis as well as in subsequent syntheses The Copy Key The COPY key is used to transfer an exact duplicate of one cycle 1 2 3 4 2u M 1u M Low or 10uM into a programmable RAM cycle 1 2 3
116. control external events The following three functions do not activate solenoid valves but control electrical switches They are used to give electrical signals to a fraction collector or a chart recorder FUNCTION NAME SWITCH ACTION NUMBER F5 ADVANCE FRAC COLLECT PULSE F31 RECORDER ON RELAY CLOSE F 32 RECORDER OFF RELAY OPEN Function 5 advance frac collect fraction collector provides a 100 millisecond pulse to Terminals and 2 located on the terminal strip at the left rear of the instrument When the terminals are con nected to a fraction collector this pulse moves the tube rack one position The pulse time can be changed by using the Fract Pulse Menu The fraction collector is used to collect the trityl cation re leased during each detritylation step Function 31 recorder on closes an electrical relay or switch and activates an external chart record er Function 32 recorder off and deactivates the chart recorder The chart recorder should be con nected to Terminals 3 and 4 on the rear of the instrument to receive the proper signal When connected to a spectrophotometer with a flow cell a chart recorder can be used to automate trityl assays However these readings will not be quantitative because the trityl solution is too concen trated In addition to controlling a chart recorder these functions can be used to activate and deactivate a heater However be sure not to run any of the heater s current through the termi
117. coupling The four nucleoside phosphoramidites have slightly differ ent reactivities as all different molecules must P The cyanoethyl phosphoramidites follow the reactivity order of T gt gt gt A When all four are delivered simultaneously their representation will be normalized to 100 T 3096 G 2696 C 2496 A 20 These values are slightly dependent on cycle location of the site in the oligonucleotide age of the phosphoramidite solutions etc They have a range of about 3 because of these variables Section 6 Chemistry for Automated DNA Synthesis 6 13 Applied Biosystems Table 6 2 Coupling Steps STEP DESCRIPTION acetonitrile bottle 18 delivery to column argon reverse flush tetrazole bottle 9 delivery to column tetrazole phosphoramidite bottles 1 to 5 delivery to column tetrazole delivery to column tetrazole phosphoramidite delivery to column wait argon reverse flush PURPOSE remove nucleophiles render support anhydrous remove residual acetonitrile dry column deliver activator activate phosphoramidite begin coupling reaction continue coupling continue coupling complete coupling reaction remove the tetrazole and phosphoramidite IMPORTANT These deliveries are critical Under delivery causes low coupling efficiency Over delivery wastes reagents 6 14 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems Z DMTO DM
118. current step for example step 1 18 to waste Enter step 1 18 TO WASTE enter next Follow the prompt and enter the step number to be performed next The number and the correspond ing function description will appear on the screen be sure it is correct Then press ENTER ENTER Continues synthesis from the specified step The screen will then display Page 2 of the Synthesizing Status Menu showing the new step being performed If you press ENTER without specifying a step number the synthesis will continue from the same step IMPORTANT Jumping to step 1 increments to the next base For example when synthesizing base 2 and you jump to step 1 the synthesis will proceed with step 1 of base 3 To remain within the base 2 cycle jump to step 2 or any subsequent step During synthesis if you jump over Cycle Entry the cycle counter which records bottle usage will not increment NEXT Displays the subsequent step and its function description Continue to press NEXT until the desired step is shown PREV Displays the preceding step and its function description Continue to press PREV until the desired step is shown Upon selecting MENU a jump will not occur The step being held will be re leased the synthesis will resume and the display will return to the synthesizing status menu MENU 3 22 Section 3 Software Menu Descriptions Applied Biosystems imonilot chonge 1 Synth ledi
119. cyclic amines of A G and C must be removed see Base Deprotection Phosphate Deprotection The cyanoethyl protecting groups are removed by treatment with ammonium hydroxide This oc curs at the same time as cleavage making phosphate deprotection very quick and simple See Figure 6 9 6 18 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems Base Deprotection The benzoyl and isobutyryl base protecting groups are removed by placing the vial of DNA at 55 for 8 to 15 hours This also cleaves the acetyl caps from the failure sequences Base deprotection is an ammoniolysis reaction where ammonia is a nucleophile attacking the carbonyl of the amide protecting groups For effective treatment use fresh concentrated ammonium hydroxide during cleavage To ensure no decrease in ammonia concentration store the reagent in a refrigerator tight ly capped Discard thirty days after opening IMPORTANT Use a rightly sealed DNA collection vial that can withstand positive pressure The vial must also have a Teflon lined cap Rubber lined caps have contaminants that leach out of the cap liner during deprotection Teflon lined caps can be ordered from Wheaton Part Number 240408 size 13 425 After completing deprotection cool the ammonium hydroxide DNA solution on ice to prevent loss es from bubbling Then remove the ammonia by vacuum Ammonia is much easier to transfer at lower temperature than at room temperature When
120. d Biosystems Summary of Main Menu Options DNA Creates edits and prints up to four DNA sequences EDITOR START Initiates the steps to begin a synthesis From this menu you specify the cycle SYNTH ending method and DNA strand you want to synthesize MONITOR Displays the status of the instrument during a synthesis Use it to identify EM SYNTH which base is being added and which step and function are being performed Use Monitor Synth to interrupt or abort a synthesis and to manipulate the syn thesis cycle by using the HOLD and JUMP keys In addition during synthesis the ending method can be changed from page 4 of this menu Note When the instrument is ready to begin a synthesis START SYNTH is displayed on Page 1 of the Main Menu However during a synthesis MONITOR SYNTH is shown in that position CHANGE Provides a procedure for removing empty reservoirs and replacing them with BOTTLES bottles of fresh reagents It also shows bottle usage and provides an alarm to alert you that reagent levels are low CYCLE Creates edits and prints synthesis cycles EDITOR MANUAL Used to manually activate functions and to open and close individual valves CONTROL FRACT Changes the pulse time which advances the fraction collector PULSE PROC Used to create edit and print the bottle change phosphoramidite purge and EDITOR shut down procedures MB E S Section 3 Software Menu Descriptions Applied Biosystems FX
121. d be used when synthe sizing oligonucleotides greater than 60 bases CPG is covalently derivatized with one of the four nucleosides A G C or T see Figure 6 2 The reactive groups on these nucleosides are blocked or protected to prevent unwanted side reactions They are all blocked at the 5 hydroxyl with a dimethoxytrityl group As shown in Figure 6 3 the exocyclic amines on adenosine A and cytosine C are protected by a benzoyl group A 95 and the exocyclic amine on guanosine by isobutyryl group GP Thymidine does not need a protecting group since the thymine ring does not participate in the synthesis chemistry As shown in Figure 6 2 CPG has a linker attached to its surface via a siloxane bond All free silanol groups are capped to prevent side reactions The support is then derivatized by covalently attaching the 3 hydroxyl of the nucleoside to the linker via a succinate ester bond The bond is base labile and allows for removal of the DNA from the support with ammonia After synthesis is complete the oligonucleotide is quantitatively cleaved with a free 3 hydroxyl The loading of nucleoside as measured by DMT release is 27 to 30 micromoles per gram of 500 support Pre filled columns contain 0 2 umol 1 umol or 10 umol of initial nucleoside The 0 2 umol scale provides sufficient amounts of purified oligomers for most applications The 1 umol scale is used when greater quantities of DNA are needed The 10 umol scale is usef
122. d retained in the cartridge Thus Section 6 Chemistry for Automated DNA Synthesis 6 21 Applied Biosystems the purified fully deprotected oligonucleotide is eluted in a small volume of 20 acetonitrile in wa ter completely desalted and ready for use PAGE Polyacrylamide gel electrophoresis PAGE is a widely used method for the analysis and purifica tion of oligonucleotides When a mixture of charged molecules are exposed to an electric field they will migrate with velocities determined primarily by their mass to charge ratios This ratio changes linearly with the log of the molecular weight of DNA of differing chain lengths This al lows a very ordered progression of oligonucleotides with mobility decreasing as the length increas es Proper PAGE technique can provide resolution and preparative isolation of single base length differences Oligonucleotide samples for PAGE are typically prepared by drying a known odu amount by mea suring absorbance and redissolving in media such as formamide 1X TBE 9 1 or 7M urea which are denser than the 1X TBE running buffer These media and the gel matrix containing 7M urea should be denaturing to ensure disruption of secondary structure and hydrogen bonding The most desirable format for PAGE of oligonucleotides is the slab gel There are many commercial devices which essentially consist of a sandwich of two glass plates held apart by two side spacers The thickness of the spacers deter
123. d solvents are delivered to the column by a pressure driven chemical delivery system The system uses patented zero dead volume valves which increase reliability eliminate cross con tamination and reduce the reagent costs The Model 391 has menu driven software designed for simplicity and ease of operation A 2 line screen displays various options and necessary information about the synthesis or status of the in strument In response you select an option and give instructions by pressing the appropriate key on the keyboard Automated synthesis uses a cycle consisting of a series of steps which completes all chemical re actions needed to couple one base The cycle is repeated until all bases of the oligonucleotide chain are added Applied Biosystems supplies four cycles that have been thoroughly tested and optimized for use with B cyanoethyl phosphoramidites They vary according to how much initial 3 terminal nucleoside is attached to the support e g 2uM Iu M 10uM You decide which one to use based on how much final product you need for your experiments Section 1 Introduction 1 3 Applied Biosystems The Extended Programmability EP feature allows you to create and edit cycles as well as proce dures and functions optimized for your own needs And you can implement alternative chemistries such as synthesis and hydrogen phosphonate synthesis to create nucleotide analogs When us ing these chemistries you only need to l
124. ded For example in the sequence 5 AAA AAA GCT 3 shown below C is currently being coupled G will be added next which is followed by A and so on The number in the upper left corner signifies which DNA strand is being synthesized for example 1 ZDNA 1 1 5 gt hold jump intrpt more Note The hold jump and intrpt keys operate from pages 1 2 and 3 of the synthesizing status menu Selecting MORE again displays Page 4 which shows the DNA strand being synthesized e g DNA 1 a 12 base sequence the cycle being performed e g Cycle 1 which has 63 steps and the ending method e g trityl off Making DNA 1 12 Cycle 1 63 Trityl OFF ON OFF more The ON OFF key operates during synthesis to change the ending method from Trityl OFF to Trityl ON and vice versa Following the last step of the final base addition the ending method cannot be changed 3 18 Section 3 Software Menu Descriptions Applied Biosystems Selecting MORE again returns to Page 1 of the Synthesizing Status Menu The Holding Menu When you select HOLD the step currently being executed will continue indefinitely During a Hold all activated valves remain open The Hold can be used to increase the delivery time of a re agent The Holding Menu and its relationship to the Synthesizing Status Menu are shown in Figure 3 2 Upon pressing HOLD the screen will read HOLDING base x of xx bases resume jump intrpt
125. depurination is usually not detectable More about lysine treatment of longmers gt 70 bases before purification For long oligomers even with very high synthesis efficiency the desired full length product is a minor component compared to the sum of the failure sequences Certain side reactions also become more prevalent due to increased exposure to the synthesis reagents In particular the acids used for detritylation trichloroacetic or dichloroacetic acid can promote cleavage of the purine nucleobases A and G from the ribose rings During synthesis of a long mer the cumulative time that the bases near the 3 end are subjected to acid can be more than an hour During this time apurinic sites can be created These apurinic sites in the oligonucleotide undergo internucleotide cleavage during am monia deprotection at 55 C When the synthesis is conducted Trityl On in preparation for OPC pu rification some of the cleavage products will bear a 5 trityl group see Figure 2 3 Apurinic cleavage can generate trityl bearing species that are less than full length Reverse phase HPLC or purification methods which depend on trityl selectivity are then less efficient in purifying the full length oligo AGTCAGTGCGCTTAGCCATAAG 2 DMT full length oligo AGTC GTGCGCTTAGCCATAAG 2 oligo with apurinic site 2 2 n AGTC OPO 2 DMT ammonia cleavage products Figure 2 3 Thomas
126. e do not complete these steps or HPLC grade acetonitrile will contaminate the bottles Refer to Section 2 for instructions on how to store dissolved phosphoramidites 6 A PHOS F 62 FLUSH TO BOTTLE 5 G PHOS F 63 C PHOS F 64 T PHOS F 65 X PHOS F 66 Argon purges the headspace of the phosphoramidite reservoirs to eliminate air 7 A PHOS F 52 BOTTLE TO WASTE 4 G PHOS F 53 C PHOS F 54 T PHOS F 55 X PHOS F 56 TETRAZOLE F 61 The delivery line is refilled primed with fresh reagent by delivering the contents of the designated bottle to waste for 10 seconds F 10 18 TO WASTE 7 9 Fl BLOCK FLUSH 10 The reagent valve blocks are rinsed by F 10 18 to waste for 7 seconds and cleared by F 1 block flush for 10 seconds oo Section 4 Functions Cycles and Procedures 4 25 Applied Biosystems Similarly the bottle change for acetonitrile Bottle 18 begins by performing F 1 block flush for 5 seconds and F 10 18 to waste for 7 seconds The bottle is then removed and replaced Finally fresh acetonitrile is delivered to waste F 10 for 7 seconds and the reagent valve block is cleared by a block flush F 1 for 10 seconds Both capping reagents cap A acetic anhydride Bottle 11 cap B NMI Bottle 12 use the same procedure The valve blocks are cleared and rinsed by F 1 for 5 seconds and F 10 for 7 seconds The bottles are then removed and replaced Next argon pressurizes the reservoir by F 16 cap prep for 5 seconds Then
127. e the desired product oligonucleotide will always elute after the lesser charged failure sequences The high salt mobile phase also provides a denaturing media Both of these factors allow easy product identification Preparative ion exchange HPLC re quires a final desalting operation most efficiently conducted with OPC Consult the chapter on HPLC in User Bulletin 13 Revised found in the appendix for more details Alternative Chemistries In addition to the phosphoramidite chemistry method to prepare normal phosphodiester oligonu cleotides recently many alternative chemistries have been demonstrated on AB synthesizers These other products include synthetic RNA phosphate analog oligonucleotides and chemically deriva tized oligonucleotides which can be covalently attached to other molecules RNA Synthesis RNA oligoribonucleotides can be synthesized on the Model 391 2223 Using the 2 silyl 5 DMT cy anoethyl phosphoramidite RNA monomers the only cycle change is to increase the coupling wait time to 600 seconds The RNA monomers bear a large 2 silyl protecting group and therefore require 6 24 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems longer time to couple The details from Applied Biosystems User Bulletin No 47 apply for the Model 391 with a few simplifying refinements The ammonia ethanol 3 1 solution of crude RNA oligo DMT OFF is heated overnight at 55 dried treated with 10 mic
128. e and for when it will need replacing According to alarms that you must set in the Change Bottles Menu the screen will show if and when the synthesis will be interrupted by the alarm For example if an oligomer 20 bases long will be synthesized and tet razole Bottle 9 will empty after performing 11 cycles of base addition the screen will read Bottle 9 will interrupt in 11 cycles begin You then have the option of allowing the alarm to be triggered interrupting the synthesis after elev en base additions or changing the bottle immediately To replace the bottle return to the Main Menu and choose the Change Bottles Menu When bottle usage has been checked and synthesis is ready to start press BEGIN 3 14 Section 3 Software Menu Descriptions Applied Biosystems After pressing BEGIN the display will show which column you need to place on the instrument For example if T is the 3 terminus of DNA 1 the screen will read Install T Column then press enter enter Follow the instructions and install a T column Be sure to use the column size corresponding to the synthesis cycle Remember to record the serial number to identify the synthesis After installing the column select ENTER and the display will read Purge Phosphoramidite lines no yes menu IMPORTANT You can press the MENU key from any of the above menus to cancel the start of the synthesis The display will then show the Configure Synthesis Menu
129. e argon line remains above the liquid level while the delivery line extends to the bottom of the bottle Upon opening the correct set of valves the reservoir headspace is pressurized by argon and the liquid is pushed into the delivery line and flows to its destination VALVE BLOCK DELIVERY LINE PRESSURE VENT LINE Figure 5 2 Reagent Reservoir Since all phosphoramidite reservoirs are pressurized simultaneously by a single valve bottles must be attached to all 5 positions even if some are empty or the argon will escape out any exposed pressure line Also bottles should be placed on all positions to keep the lines clean Notice that all lines are color coded Phosphoramidite delivery lines are red 0 5mm ID while the other reagent delivery lines are blue 0 8mm ID pressure lines are blue 0 8mm ID Section 5 System Description Hardware 5 5 Applied Biosystems Venting In addition to being pressurized the phosphoramidites are vented using the pressure vent line When fresh phosphoramidites which are atmosphere sensitive are placed on the instrument they are purged with argon to eliminate air purge delivers gas through the delivery line As the gas is passed through the bottle the air escapes out the pressure vent line This is performed automatically by the bottle change procedure Delivery Valve Blocks The chemical delivery system includes two reagent valve blocks and one column valve block The valve blocks
130. e containing an adsorbent material with an affinity for DMT oligonucleotides The ammonia solution of the crude DMT oligonucleotide 10 20 crude odu is applied directly to the cartridge The DMT oligonucleotide product is retained By products failure sequences not bearing a DMT group and other impurities are not retained and are eluted The DMT group of the OPC bound oligonucleotide is removed with a mild acid solution then the purified oligonucleotide is eluted typically 1 5 odu with about 1 ml of a 20 acetonitrile solution The entire operation re quires 15 20 minutes and several OPC purifications can be conducted in parallel Efficient reliable purifications are achieved with oligonucleotides up to about 70 bases A recent report has shown that OPC purification is effective with oligonucleotides longer than 70 bases when a preliminary treatment with a lysine solution is conducted after synthesis and before ammonia treatment Lysine acts to cleave apurinic sites a major source of DMT bearing failure sequences This purifying operation allows OPC to be effective even with long oligonucleotides Several features of this operation are noteworthy No sample preparation is required The OPC ma terial is stable to concentrated ammonia The ammonia solution provides a denaturing media elim inating secondary structure and hydrogen bonding which would allow co elution of partially complementary failure sequences The DMT group is detached an
131. e failures in the first coupling phosphoramidite purge eliminates this problem and helps en sure a successful synthesis IMPORTANT Not performing a phosphoramidite purge when it is needed will cause a synthesis to fail When in doubt it is best to purge since it may save a synthesis Before beginning a synthesis you must choose whether to perform the procedure Refer to Section 3 Main Menu Option Start Synthesis for further information Note that a phosphoramidite purge is not included in the bottle cycle counter which is used to tabulate the alarm As shown below the procedure consists of nine steps If desired the steps can be changed using the Procedure Editor Menu The Phosphoramidite Purge Procedure STEP FUNCTION FUNCTION TIME NUMBER NUMBER NAME SECONDS 1 28 10 pressurizes the phosphoramidite and tetrazole reservoirs prior to delivery 2 F52 A TO WASTE 4 3 F 53 G TO WASTE 4 4 F54 C TO WASTE 4 5 F 55 T TO WASTE 4 6 F 56 X TO WASTE 4 7 F61 TET TO WASTE 4 Steps 2 7 deliver the contents of the designated reservoir to the waste bottle Fills the delivery lines and the reagent valve block Section 4 Functions Cycles and Procedures 4 23 Applied Biosystems STEP FUNCTION FUNCTION TIME NUMBER NUMBER NAME SECONDS 8 F 10 18 WASTE 7 Removes the phosphoramidite and tetrazole left in the reagent valve block Rinses the valve block 9 Fl BLOCK FLUSH 10 Removes aceton
132. e not previously done so then click Deliver Selected Documents Now to submit your order Note There is a limit of five documents per request for fax delivery but no limit on the number of documents you can order for e mail delivery Appendix E Warranty 391 Pre Installation Manual E 23 Applied Biosystems AB LIMITED WARRANTY Applied Biosystems warrants to the Customer that for a period ending on the earlier of one year from completion of installation or 15 months from the date of shipment to the Customer the Warranty Period the AB Model 391 purchased by the customer the Instrument will be free from defects in material and workmanship and will perform in accordance with the performance specifications contained in the applicable AB product literature the Specifications This Warranty does not apply to the Instrument s valves reagent lines or performance unless the Customer uses only reagents and solvents supplied by AB or expressly recommended by AB or to any damages caused by reagents or solvents not supplied by AB even though recommended by AB This Warranty does not extend to any Instrument or part thereof that has been subjected to misuse neglect or accident that has been modified or repaired by anyone other than AB or that has not been used in accordance with the instructions contained in the Instrument Operator s Manual Nor does this Warranty cover any Customer installable consumable pa
133. e synthesis will remain interrupted when the main power returns The alarm will sound and the screen will show the two menus mentioned in Example 1 However you must decide whether to re sume or abort the synthesis This is done by selecting MONITOR SYNTH to view the Interrupted Menu and then pressing RESUME or ABORT It is helpful to view page 2 of the Interrupted Menu to determine which step was interrupted For example if the synthesis was stopped during detritylation the oligonucleotides would be exposed to acid from the time the power failed This could cause depurination resulting in some intrachain cleavage during base deprotection If the exposure was for several hours it would be best to abort the synthesis and begin another one Note that if you abort synthesis at a step other than Cycle Entry or Circle End the valve blocks and delivery lines must be rinsed Refer to Section 2 How to Abort Synthesis for details Main Menu Option Self Test Use the Self Test Menu to verify the correct operation of the electronic components of the instru ment and to access the flow test procedure Self test should be performed routinely approximately once every few months In addition it should be done if the instrument malfunctions The easiest way to perform self test is by pressing the option ALL If the test passes the top line of the display will read PASSED If a FAILED message is shown contact the Applied Biosystems Technical Support
134. e that a single function may appear in more than one category Many of the functions are used during the synthesis cycle and the remainder are used during the bottle change phosphoramidite purge shut down and flow test pro cedures During synthesis you can check which function is being performed by viewing the Monitor Syn thesis Menu DNA synthesis requires various reagents to be delivered to a specified destination A reagent can flow from its reservoir to the waste bottle or through the column and then to the waste bottle or the trityl collection port Functions have been defined to perform each necessary delivery To achieve flow of a reagent specific valves must open simultaneously so that the following occurs 1 The reservoir is pressurized 2 The pathway from the reservoir to the valve block is opened and 3 Anexit is provided out of the valve block i e to waste or to the column and then to waste or the trityl collection port The pathway created by activating a function can be traced using the 391 DNA synthesizer sche matic Figure 4 1 For example Function 9 18 to column delivers acetonitrile to the column Ac tivating Function 9 does the following 1 Opens Valve 17 to allow argon to flow into the acetonitrile reservoir to pressurize it 2 Opens Valve 1 to open the pathway between the reservoir and the valve block 3 Opens Valve 12 to open the pathway from the valve block to the column and 4 Opens Valve 16 to
135. eaction chamber called the col The column contains the 3 terminal nucleoside which is covalently attached to a support The DNA chain is built by adding one base at a time to the support bound nucleoside reagents and solvents necessary for synthesis are accessed by the chemical delivery system In this system a set of solenoid valves opens to create a pathway for chemical flow Pressure regulated argon forces the chemicals to flow from their reservoirs through the pathway consisting of one or more valve blocks and delivery lines and then to the column After completing a chemical step the column effluent flows to either the waste bottle or the trityl collection port to collect the dimethox ytrityl cation for analysis The controller directs and initiates all synthesizer activity and consists of a microprocessor the soft ware a keyboard a display screen and associated electronics Information is displayed on a two line screen and you give instructions by pressing the appropriate key on the keyboard 5 2 Section 5 System Description Hardware Applied Biosystems The Chemical Delivery System The flow of reagents solvents and gas through the Model 391 is controlled by a positive pressure chemical delivery system The system components include a regulated pressure source eleven re agent and solvent reservoirs delivery valves a column a vented waste bottle and delivery lines which interconnect the components
136. eet RE ed 4 18 Synthesis Cycles ss went reu ERE shoe ed Voas RM Russa d aurae e ge cn 4 18 Procedutes ma oe Sov e NE eaaet e Nes er ve peu Ur 4 23 The Phosphoramidite Purge Procedure 4 23 The Bottle Change Procedure llle 4 24 The Shut Down Procedure tence eens 4 27 The Flow Test 4 28 Applied Biosystems Introduction Automated DNA synthesis requires chemical deliveries to specified destinations on the instrument such as the column These deliveries are controlled by electrically activating solenoid valves to open and close creating various pathways through the Model 391 Each solenoid valve is assigned a number which can be used to open or close it A valve or set of valves opened or closed simultaneously to perform a specific delivery or task is a function For ex ample function 9 18 to column delivers acetonitrile to the column Function 9 opens valves 1 12 16 and 17 simultaneously A function which is programmed to occur for a specified amount of time is a step e g Function 9 can be activated for 10 seconds series of steps programmed to perform a chemical process re peatedly is a cycle Synthesis cycles contain all the steps necessary for the efficient addition of one base The cycle is repeated until every base in the sequence is added Procedures are a series of st
137. efore use Use in a fume hood 2 22 Section 2 Operation Applied Biosystems Reagents and Solvents Bottle Reagent Solvent Position 1 Deoxyadenosine dA bz phosphoramidite B cyanoethyl B cyanoethyl B cyanoethyl 2 Deoxyguanosine dG ib phosphoramidite B cyanoethyl B cyanoethyl B cyanoethyl 3 Deoxycyctosine dC bz phosphoramidite B cyanoethyl B cyanoethyl B cyanoethyl 4 Deoxythymidine dT phosphoramidite B cyanoethyl B cyanoethyl B cyanoethyl 5 Available for modified bases for example Deoxyinosine B cyanoethyl 9 Tetrazole acetonitrile 180mL 11 Acetic anhydride lutidine THF 180mL 12 1 methylimidazole 180mL 14 Trichloroacetic acid 450mL 15 Iodine water pyridine THF 200mL 18 Acetonitrile 4 L Anhydrous Acetonitrile for dissolving phosphoramidites Ammonium hydroxide It may be more economical to purchase ammonium hydroxide and HPLC grade acetonitrile from a local supplier About Deoxyinosine 0 25g 0 5g 1 0g 0 25g 0 5g 1 0g 0 25g 0 5g 1 0g 0 25g 0 5g 1 0g 0 25g Part Number 400600 400330 400326 400601 400331 400327 400603 400332 400328 400602 400333 400329 400402 400606 400607 400785 400236 400753 400443 400060 400019 Deoxyinosine base pairs with A T and C which makes it a suitable choice for synthesis where the degree of degeneracy needs to be reduced A 23 mer with five inosine substitutions used a as a
138. egins and page one of the Synthesizing Status Menu one of the Monitor Synthesis Menus is shown SYNTHESIZING base 1 of xx bases hold jump intrpt more In the above menu equals the total number of bases in the cycle Press the MORE key to view the current synthesis cycle step Press MORE again to view the DNA sequence and the base cur rently being synthesized Press MORE again to view the synthesis configuration From this menu you can hold or interrupt a step or jump to another step in the cycle Refer to Section 3 Main Menu Option Monitor Synthesis for details on how to hold interrupt and jump a step Notes for after synthesis begins Following synthesis start check that the column does not leak during chemical deliveries Also note if and when bottles will need replacing During the synthesis you can continue to view the Monitor Synthesis Menu or return to the Main Menu to access other ones During an active synthesis Self Test Manual Control and Shut Down cannot be accessed However you can access the Cycle Editor during synthesis to change cycle step times 2 12 Section 2 Operation Applied Biosystems When the synthesis is finished SYNTHESIS COMPLETE is displayed in the Monitor Synthesis Menu Post Synthesis 1 Remove the column To identify it be sure to record its serial number 2 Remove the trityl tubes Visually inspect the trityl solutions Be sure there are no clear tubes and that the
139. eophiles e g water by an extensive wash with acetonitrile Any extraneous nucleophiles will compete with the support bound 5 hydroxyls for the activated phosphoramidite and will decrease coupling efficien cy The column is then dried by an argon reverse flush to remove residual acetonitrile Tetrazole the phosphoramidite activator is next delivered to the column According to the oligonucleotide se quence one or more of the phosphoramidites bottles 1 to 5 and tetrazole bottle 9 are then simul taneously delivered to the column Depending on the synthesis cycle alternate deliveries of tetrazole and then base plus tetrazole are repeated up to 3 times When these reagents mix the mild acid tetrazole 4 8 Ref 8 transfers a proton to the nitrogen of the diisopropyl group on the 3 phosphorous See Figure 6 6 This protonated amine makes a very good leaving group upon nu cleophilic attack by the tetrazole to form a tetrazolyl phosphoramidite This is the reactive inter mediate which forms the internucleotide phosphite with the support bound 5 hydroxyl A molar excess of tetrazole ensures that the phosphoramidite will be activated The excess of phosphoramid ite relative to free 5 hydroxyl ensures that the reaction is nearly quantitative over 98 coupling The coupling steps are summarized in Table 6 2 Mixed sequence probes are synthesized by simultaneous delivery of up to 5 bases AGCTX and tetrazole with near equivalent
140. eps programmed to complete a task such as changing a reagent bottle Upon command the steps are performed once and are not repeated There are four procedures bottle change phosphoramidite purge shut down and flow test Valves The Model 391 has 24 solenoid valves numbered 0 to 23 which are opened and closed electrically and are controlled through the microprocessor Refer to Section 5 Delivery Valve Blocks for a physical description of the valves During a synthesis valves are automatically opened to create the correct chemical pathways and allow all necessary reagent and gas deliveries You can also manually operate individual valves by using the Manual Control Menu This is helpful when troubleshooting and can be done before syn thesis or when a synthesis is interrupted AII valves with descriptions of what they control are listed next Refer to Figure 4 1 DNA Synthe sizer Schematic to view the placement of the valves Valves 0 to 11 control the flow of the follow ing reagents or argon from their reservoirs to the reagent valve blocks 4 2 Section 4 Functions Cycles and Procedures Applied Biosystems Valve 0 Valve 12 13 14 15 16 Controls the flow of argon acetonitrile bottle 18 iodine bottle 15 bottle 14 NMI bottle 12 acetic anhydride bottle 11 tetrazole bottle 9 contents of reserve 5 T phosphoramidite bottle 4 C phosphora
141. ers that begin with 3 Wide pore CPG columns are recommended when synthesizing oligonucleotides greater than 80 bases They are available on the 2uM scale only Wide pore columns have labels with broken col ored lines and serial numbers that begin with 4 Section 2 Operation 2 11 Applied Biosystems How to Install the Column 1 Remove the aluminum tabs from both ends and tap the ends on a dark surface to check for leaks If CPG falls out do not use the column Any faulty columns will be replaced by Applied Biosystems without charge 2 Firmly push either end straight up onto the upper male Luer fitting on the instrument Since the column is symmetrical it can be attached in any way 3 Firmly push the lower male Luer fitting straight up into the bottom of the column The column should fit securely Do not twist the fittings or the filters may crimp or tear Once the column is installed select ENTER The screen will read Purge Phosphoramidite lines no yes Choose whether to purge the phosphoramidite and tetrazole delivery lines Press YES if the instru ment has been idle for more than 12 hours more than 6 hours in humid environments or if a phos phoramidite reservoir has not been accessed within 12 hours Press NO if instrument has been running continuously and if all the phosphoramidites have been accessed within 12 hours Upon pressing NO or after the purge is finished the synthesis automati cally b
142. es Yes Yes Yes Yes Appendix A Functions Cycles and Procedures A 9 Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME Low NUMBER OF STEPS 61 TIME 04 24 DATE 05 11 89 STEP FUNCTION STEP ACTIVE FOR BASES NUMBER TIME A G C T X 1 10 18 TO WASTE 2 Yes Yes Yes Yes Yes 2 9 18TOCOLM 15 Yes Yes Yes Yes Yes 3 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 4 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 5 28 PHOS PREP 3 Yes Yes Yes Yes Yes 6 90 TET TO COLUMN 3 Yes Yes Yes Yes Yes 7 19 B TET TO COLM 2 Yes Yes Yes Yes Yes 8 90 TET TO COLUMN 2 Yes Yes Yes Yes Yes 9 19 B TET TO COLM 2 Yes Yes Yes Yes Yes 10 90 TET TO COLUMN 2 Yes Yes Yes Yes Yes 11 4 WAIT 15 Yes Yes Yes Yes Yes 12 16 CAP PREP 3 Yes Yes Yes Yes Yes 13 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 14 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 15 22 CAP TO COLUMN 10 Yes Yes Yes Yes Yes 16 4 WAIT 5 Yes Yes Yes Yes Yes 17 10 18 TO WASTE 3 Yes Yes Yes Yes Yes 18 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 19 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 20 81 15 TO WASTE 3 Yes Yes Yes Yes Yes 21 13 15 TO COLUMN 10 Yes Yes Yes Yes Yes 22 10 18 TO WASTE 5 Yes Yes Yes Yes Yes 23 4 WAIT 15 Yes Yes Yes Yes Yes 24 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 25 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 26 10 18 TO WASTE 5 Yes Yes Yes Yes Yes 27 9 18 TO COLM 10 Yes Yes Yes Yes Yes 28 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 29 9 18 TO COLM 10 Yes Yes Yes Yes Yes 30 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 3
143. es Yes Yes Yes Yes 2 9 18 TO COLM 15 Yes Yes Yes Yes Yes 3 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 4 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 5 28 PHOS PREP 3 Yes Yes Yes Yes Yes 6 90 TET TO COLUMN 3 Yes Yes Yes Yes Yes 7 19 B TET TO COLM 3 Yes Yes Yes Yes Yes 8 90 TET TO COLUMN 2 Yes Yes Yes Yes Yes 9 19 B TET TO COLM 3 Yes Yes Yes Yes Yes 10 90 TET TO COLUMN 2 Yes Yes Yes Yes Yes 11 19 B TET TO COLM 3 Yes Yes Yes Yes Yes 12 90 TET TO COLUMN 2 Yes Yes Yes Yes Yes 13 4 WAIT 15 Yes Yes Yes Yes Yes 14 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 15 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 16 16 CAP PREP 3 Yes Yes Yes Yes Yes 17 22 CAP TO COLUMN 12 Yes Yes Yes Yes Yes 18 4 WAIT 8 Yes Yes Yes Yes Yes 19 10 18 TO WASTE 3 Yes Yes Yes Yes Yes 20 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 21 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 22 81 15 TO WASTE 3 Yes Yes Yes Yes Yes 23 13 15 TO COLUMN 10 Yes Yes Yes Yes Yes 24 10 18 TO WASTE 5 Yes Yes Yes Yes Yes 25 4 WAIT 15 Yes Yes Yes Yes Yes 26 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 27 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 28 10 18 TO WASTE 5 Yes Yes Yes Yes Yes 29 9 18 TO COLM 10 Yes Yes Yes Yes Yes 30 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 31 9 18 TO COLM 10 Yes Yes Yes Yes Yes 32 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 33 9 18 TO COLM 10 Yes Yes Yes Yes Yes 34 2 REVERSE FLUSH 5 Yes Yes Yes Yes Yes 35 1 BLOCK FLUSH 3 Yes Yes Yes Yes Yes 36 33 CYC ENTRY 1 Yes Yes Yes Yes Yes 37 10 18 TO WASTE 3 Yes Yes Yes Yes Yes 38 9 18 TO CO
144. es and Procedures MODEL 391 PCR MATE DNA SYNTHESIZER FUNCTIONS CONTROL 4 Wait 5 Advance Fraction Collector 6 Waste to Port 7 Waste to Bottle 17 Interrupt 31 Recorder On 32 Recorder Off 33 Cycle Entry 34 Cycle End DELIVER TO COLUMN 9 18 to Column 13 4415 to Column 14 14 to Column 19 Base Tetrazole to Column 22 Cap to Column 101 A to Column 102 G to Column 103 Column 104 T to column 105 X to Column 90 Tet to Column 106 11 to Column 107 12 to Column RINSE AND FLUSH 1 Block Flush 2 Reverse Flush 9 18 to Column 10 4418 to Waste 108 Flush to Trit 109 Flush thru Col PREPARE REAGENTS 16 Cap Prep 28 Phosphoramidite Prep 43 18 Prep 5 Tetrazole Prep PRIME DELIVERY LINES 52 A to Waste 53 G to Waste 54 C to Waste 55 T to Waste 56 X to Waste 59 Cap A to Waste 60 Cap B to Waste 61 Tetrazole to Waste 81 15 to Waste 82 14 to Waste ARGON TO RESERVOIRS 62 Flush to A 63 Flush to G 64 Flush to C 65 Flush to T 66 Flush to X 69 Flush to Tetrazole 70 Flush to 18 86 Flush to 14 15 89 Flush to 11 12 ACETONITRILE TO RESERVOIRS 71 18 to 72 18 to G 73 18 to C 74 18 to T 75 18 to X 78 18 to Tetrazole 84 18 to 14 85 18 to 15 87 18 to 11 88 18 to 12 gt Applied KS Biosystems COLUMN VALVE BLOCKS REA
145. essing of the oligonucleotide If additional DNA will be synthesized immediately following installation additional chemicals should also be ordered Chemicals and Accessories Start Up Chemical Kit If an Applied Biosystems service engineer will install your Model 391 or 391 EP a Start Up Chem ical Kit will be sent to you for the installation The kit contains chemicals and reagents enough for at least 100 base additions four synthesis columns and a manual deprotection kit The Start Up Chemical Kit will be used during installation to verify instrument performance Appendix E Warranty 391 Pre Installation Manual E 7 Applied Biosystems If you have purchased a user installed instrument U S only you must order the Start Up Chemi cal Kit P N 400971 The contents of the Start Up Chemical Kit are listed below Part No Description Quantity 001753 Seal 16 07 bottle 2 002267 Seal 8 oz bottle 200140 Septum 13 mm rubber 400257 Manual deprotection kit 400330 CE phosphoramidite A 0 5 g 400331 CE phosphoramidite G 0 5 g 400332 CE phosphoramidite C 0 5 g 400333 CE phosphoramidite T 0 5 g 400443 Acetonitrile 4 L Burdick amp Jackson 400445 Trifluoroacetic acid 10 mL 400613 Triethylamine acetate 2 M 200 mL 400771 Oligo purification cartridge 400852 Kit B CE large bottle reagents includes the following items 400060 Anhydrous acetonitrile 30 mL 400236 Trichloroacetic acid 450 mL 400501 16 07 bottle seals 10 p
146. esults Once a dye is attached reverse phase HPLC may be used to purify the derivatized oligonucleotides Section 2 Operation 2 33 Applied Biosystems Applications General Protocol for Tag Labeling Substrate Described below is a generic protocol from which to extrapolate individual application protocols Note that most commercially available biotinylation reagents come with usage protocols 1 Prepare a solution of Aminolink oligonucleotide at a concentration of 1mM or greater in a 50mM 200mM NaHCO Na5CO Buffer pH 9 2 Adda 50 molar excess of the solid tag labeling substrate NHS Biotin Dye etc and vortex to dissolve If the tag or DMSO is insoluble in aqueous solutions it can be dissolved in dimethylformamide before addition to the Aminolink oligonucleotide The final concentration of organic solvent in the reaction mixture should not exceed 30 3 After several hours reaction time at room temperature the mixture can be purified by gel exclusion in a G 50 or G 25 Sephadex column to remove the excess tag Use 100mM TEAA as the eluant Note Reactions with fluorescent dyes should be done in the dark 2 34 Section 2 Operation Applied Biosystems How to Use OPC Oligonucleotide Purification Cartridge Introduction OPC Part No 400771 is a rapid purification cartridge used specifically for synthetic DNA It pro vides the level of purity required for the common applications of synthetic DNA Using OPC
147. evel of observation or action as follows Note This word is used to call attention to information IMPORTANT This information is given because it is necessary for correct operation of the instrument Caution This word informs the user that damage to the instrument could occur if the user does not comply with this information WARNING Physical injury to the user or other persons could occur it these required precautions are not taken Material Safety Data Sheets MSDS WARNING Some chemicals used with this instrument are hazardous Hazards prominently displayed on the labels of all hazardous chemicals In addition the MSDS provided in the User s Safety Information section of this manual give information on physical characteristics hazards precautions first aid spill clean up and disposal procedures Please familiarize yourself with information in the MSDSs before handling the reagents or operating the instrument Additional free copies of MSDSs are available from Applied Biosystems upon request E 4 Appendix E Warranty 391 Pre Installation Manual Applied Biosystems Waste Profiles WARNING Some chemicals collected in the waste bottle after a normal cycle may be hazardous and or require special handling The waste profiles presented in the User s Safety Information section of this manual give percentage compositions of the reagents and inform the user about waste disposal which must always be in a
148. for 8 to 15 hours Quantitation of the Oligonucleotide Nucleic acids of any variety are most easily quantitated by UV spectroscopy measuring at or near their UV absorbance maxima about 260 nm A dilute aqueous solution of 1 ml or less depending on the cuvette size is measured by either scanning a region of about 200 350 nm or a single wave length measurement A scan of an oligonucleotide will show broad absorbance with a maxima near 260 nm Using Beer s law the concentration of the solution and absolute quantity can be calculated As a useful approximation 1 optical density unit odu of single stranded oligonucleotide consists of about 33 micrograms by mass An approximation to relate absorbance to molar quantities is that a micromole of oligonucleotide has a number of odu equal to 10 times the number of bases For example a micromole of a 20mer would be 200 odu Storage of the Oligonucleotide Most applications for synthetic oligonucleotides require less DNA than a synthesis provides For tunately oligonucleotides can be stored easily with little or no degradation for long periods of time It is probably most convenient to store them refrigerated as a solution in either a crude or purified state The media may be concentrated ammonia used to cleave and deprotect the crude oligonucle otide water or dilute buffer or salt Typical aqueous media may contain ethanol acetonitrile tri 6 20 Section 6 Chemistry for Automated DNA Synt
149. from the Monitor Synthesis Menu 2 From the No Interrupt Set page of the Interrupt Menu press AHEAD Set an Interrupt Ahead to occur at the next Cycle Entry or Cycle End step Refer to table below to determine the exact step number To interrupt at the next base do not enter a base number Note that if an Interrupt Ahead has already been set you can change it by typing over existing entries Synthesis Cycle Entry Cycle End Cycle step number step number 36 63 luM 36 64 Low 34 61 10uM 37 53 3 When the synthesis interrupts the screen will display the Interrupted Status Press ABORT A menu confirming your action appears 4 Press YES to abort the synthesis Once you choose YES the synthesis cannot be resumed If you abort synthesis at a step other than Cycle Entry or Cycle End the lines and valve blocks must be rinsed and dried To do this select Manual Control and activate the following functions for 10 seconds each Function 10 18 TO WASTE Function 9 18 TO COLUMN Function 1 BLOCK FLUSH Function 2 REVERSE FLUSH 2 18 Section 2 Operation Applied Biosystems About the Synthesis Reagents and Solvents chemicals have been thoroughly tested at Applied Biosystems to ensure repeatedly reliable syn theses Each reagent and solvent has a specific position on the instrument and is referred to by the number located above each receptacle Position numbers are also printed on the
150. functions to print std user Follow the prompt and select an option STD Prints the standard functions F 1 through F 90 USER Prints the user functions F 92 User A through F 99 User H TEST Prints the test functions F 101 through F 107 Note that F108 and F109 are printed as test functions but are used in cycles and procedures 3 46 Section 3 Software Menu Descriptions Applied Biosystems Main Menu Option Power Fail The Model 391 automatically resumes synthesis after a power failure Using the Power Fail Menu Youcan program the instrument to remain interrupted and therefore not resume synthesis following power outage When a power failure occurs during an active synthesis the synthesis will be interrupted immedi ately The instrument cannot operate until the main power returns During the outage all synthesis parameters are retained in memory These parameters include the DNA sequences user defined cy cles procedures and functions bottle usage information and the time A maximum power fail time can be set so that if a failure occurs for less than the specified time the synthesis will automatically resume when the main power returns If a failure occurs for longer than the specified time the synthesis will remain interrupted and can only continue when you clear the interrupt After selecting POWER FAIL the screen will read Enter maximum power fail time 0 min 0 means always continue To enter t
151. g step zero pressing PREV previous will show the last step INSERT Select to insert a step in an existing cycle or to enter steps when creating new cycles DELETE Erases the step that is currently showing IMPORTANT All steps in the cycle are erased by selecting DELETE when step 0 is showing When DELETE is chosen a menu confirming the action appears Press yes to delete all steps in Cycle 1 yes Press YES to erase the cycle Press MENU to avoid erasure and to return to the previous menu Editing an Existing Cycle When viewing step zero of an existing cycle press NEXT and step 1 appears It shows the function number and description and the step time In addition it shows that the step will be active for the bases which are listed Fxn 10 18 TO WASTE t 2 AGCTX prev insert delete menu The above display shows Cycle 1 C1 step 1 1 and function 10 Fxn 10 which is 18 TO WASTE The step will occur for 2 seconds t22 and will be performed when synthesizing all bases AGCTX Uo 36 Section 3 Software Menu Descriptions Applied Biosystems When viewing this menu the current step can be edited by changing the function the time and the bases To view another step in the cycle place the cursor under the current step number type the new number and two new menu options JUMP and UNDO will be shown Press JUMP and the screen will show the information pertaining to the new step Press UNDO to return to
152. gle stranded DNA Automated sequencing affinity chromatography Aminolink 2 offers many advantages Because it is a phosphoramidite it reacts like conventional nucleoside phosphoramidites The compound is dissolved in anhydrous acetonitrile and placed on the extra phosphoramidite port bottle position 5 X It is activated with tetrazole and couples with the same high efficiency found in standard oligonucleotide synthesis In addition when using Ami nolink 2 you do not need to modify the synthesis cycle Other features include Solution stability is comparable to nucleoside phosphoramidites at least 2 weeks No special cycles or protocols are required Labeling at the 5 terminal amine does not interfere with hybridization Aminolinked oligonucleotides can be easily labeled with a variety of commercially available reagents such as fluorescein isothiocyanate and biotin NHS ester Chemical Description Aminolink 2 structure shown in Figure 2 2 generates an amino hexyl phosphate linker with a methoxy phosphate protecting group Prior to deprotection the phosphite triester is oxidized to the phosphate triester using standard oxidizing reagents The amine group is protected by a trifluoro acetyl group which is removed during standard ammonia deprotection procedures 2 30 Section 2 Operation Applied Biosystems CH3 CH3 N CH3 H N EA CF3 CH30 O y AMINOLINK 2 CH3 CH3 16TTGcAGCACTGACC
153. h these additional items Part No Description Quantity 254125 RS232 cable 6 ft 1 8 m 1 254132 Null modem 1 254136 RS232 cable 10 ft 3 m 1 602022 PC syncom disk 1 User Supplied Equipment customer supplied items for trityl analysis and post synthesis processing of your oligonucle otides are listed below and should be obtained before the installation The two most critical items are a fraction collector and a spectrophotometer Although measuring trityl cation release is only an approximate indicator of synthesis success it is a convenient assay and so we use it rather than more meaningful HPLC or capillary electrophoresis analysis to confirm instrument performance The following items are supplied by the user Fraction Collector To monitor synthesis efficiency a fraction collector must be adjacent to the synthesizer to collect the trityl solution from the trityl collection port Any commercially available fraction collector with an external advance switch will suffice We recommend that at least one hundred 10 15 mL volumetric tubes be available The fraction collector cable and trityl delivery line are packed with the instrument The fraction collector must be placed within 30 cm 12 in of the left side of the instrument WARNING _ The trityl effluent is composed of trichloroacetic acid and acetonitrile Before you handle chemicals for the instrument read the material safety data sheets MSDS and waste p
154. hane It is easily de tected and quantitated spectrophotometrically To quantitate the trityl cation released at each detritylation step the column effluent from the TCA delivery and the subsequent wash with acetonitrile is collected Instead of the effluent flowing into the waste bottle it is channelled through the trityl collection port into tubes in a fraction collector The Model 391 cycles provide for the collection of trityl effluent fractions and include a signal to advance a fraction collector user provided Next the absorbance of the fractions is measured to quantify the trityl released in each addition cy cle Since the trityl solution is very concentrated it must be diluted before quantitating or significant errors in the readings will occur Typically the trityl fraction is brought up to a volume of 10 mL with 0 1 M p toluenesulfonic acid in acetonitrile The trityl yield is then used to calculate the cou pling efficiency of each addition step by dividing the next step absorbance value from the previous step value From this data an overall stepwise yield can be determined and the expected product yield can be estimated The molar amount of DMT cation can be calculated using Beer s Law A eCl where A absorbance e extinction coefficient C concentration l path length overall yield coupling yield mber of couplings For more details see the trityl assay procedure discussed in User Bulletin 13 Revised in the ap
155. hange Bottles Menu a message will be displayed if the alarm will be triggered during the synthesis For example if bottle 9 tetrazole will empty in 11 cycles the screen will read Bottle 9 will interrupt in 11 cycles begin Check the reagent level of the bottle Replace it with fresh reagent if necessary To do this return to the Main Menu select CHANGE BOTTLES and follow the instructions If the bottle is not emp ty you can reenter an appropriate alarm setting in the Change Bottles Menu Check the reagent level of the other bottles and decide whether to replace them now or wait until the synthesis is interrupted by the alarm When ready to start synthesis press BEGIN The screen will show a display similar to Install T COLUMN then press enter enter Place the correct color coded column on the instrument This column will correspond to the base at the 3 end of your DNA sequence Make sure it matches what is displayed on the screen and is the correct synthesis scale Record the column s serial number to identify the synthesis CPG bound column nucleoside color code A green G yellow C red T blue Small scale 2uM columns have labels with broken colored lines and serial numbers that begin with 2 One micromole columns have labels with solid colored lines and serial numbers that be gin with 3 Ten micromole columns are larger than the others They have labels with solid colored lines and serial numb
156. he interrupt set page and CLEAR only from the inter at step base page Interrupt Ahead AHEAD After pressing AHEAD from the interrupt set page the screen displays Interrupt at step 0 base 0 ahead imediat clear By choosing AHEAD you can program an interrupt to occur at a future step anytime during the synthesis This is done by entering the step number and base number where the synthesis should 3 24 Section 3 Software Menu Descriptions Applied Biosystems stop If no base is specified the interrupt will occur at the next base To enter the values move the cursor as necessary and type the desired numbers For example to stop the synthesis the moment it reaches Step 1 of the first addition cycle enter 1 next to step and 2 next to base Remember the support bound nucleotide is base 1 Base 2 is coupled during the first addition cycle The screen will read Interrupt at step 1 base 2 ahead imediat clear When the synthesis actually reaches this point it will stop and the menu displaying the Interrupted Status will be shown Only one interrupt can be set at a time As soon as one has been programmed an asterisk will appear when viewing the Synthesizing and Holding Status Menus intrpt which serves as a re minder Once set an Interrupt Ahead may be changed by typing over the existing entries CLEAR Erases an interrupt MENU Returns to Page 1 of the Synthesizing Sta
157. he 72 mer synthesis OPC purified with and without prior lysine treatment showed no detectable purity difference These results may not apply to all synthesis sequences and lengths but the study dem onstrates Applied Biosystems commitment to synthesis reagent and product quality Protocol for Lysine Pre treatment of Longmers gt 70 bases l 2 Synthesize the oligonucleotide Trityl ON Dry the column by reverse flushing function 2 for 60 seconds with argon or allow the column to air dry Remove the phosphate protecting groups Connect a syringe with plunger to one end of the column In a fume hood fill another syringe with the following solution attach it to the synthesis column and fill the column with the solution For cyanoethyl phosphoramidites add 1 ml of t butylamine pyridine 1 9 v v and treat at room temperature for 1 hour t butylamine Aldrich B8 920 5 and pyridine Aldrich 27 040 7 Periodically circulate the solution by alternately depressing the syringe plungers Note Gently depress the syringe plungers otherwise you risk breaking the filters that hold the CPG Remove the solution and wash 5 times with acetonitrile 5 Allow the column to air dry or blow the column dry with argon oo Prepare a 1M lysine solution pH 9 adjust pH with NaOH if necessary L lysinemonohydrochloride Sigma L5626 Aldrich 1460 5 Place2 ml of the lysine solution into a 16 X 100 mm test tube Co
158. he bottle seems to stick carefully move it side to side while pulling it off Cover or recap the bottle immediately to minimize vapor release Wipe the delivery line with a lint free tissue 2 Dissolve the phosphoramidites as described in How to Prepare Phosphoramidites found in this section Next remove the aluminum cap and the rubber septum from the bottle Wipe any crystals or drops of reagent off the bottle neck 3 To install the bottle firmly push it up around its receptacle while pressing the black button As necessary maneuver the bottle into place by carefully moving it side to side while pushing 4 When the bottle is correctly engaged release the button and it will return to its out position If the button remains in the bottle is not seated properly and must be repositioned Section 2 Operation 2 7 Applied Biosystems How to Install Bottles 9 15 These reservoirs screw directly into a threaded cap mounted on the synthesizer 1 To remove a bottle unscrew it by turning clockwise Remove the disposable polyethylene insert Recap it immediately to minimize vapor release Note disposable insert forms an airtight seal between each cap assembly and bottle It is designed for single use and should be replaced with each bottle change Inserts are supplied at no charge when you order the chemical reagent kits To order inserts separately use the following Part Numbers PN for 450mL bottles 400501 for 200mL bot
159. he column or waste It also directs the flow from the first reagent valve block to the column or waste The column valve block a four port block directs the column effluent to either the waste or the trityl collection port It also controls the argon gas used to remove or flush the reagents from the column and the column valve block The design of the valve blocks provides zero dead volume Delivery lines feed into each valve block and connect to the common pathway in the valve block manifold via a manifold inlet line and a solenoid controlled diaphragm valve See Figure 5 4 The delivery lines enter the valve block through the manifold inlet lines Passage between the man ifold inlet line and the common pathway of the valve block is accomplished by an open solenoid valve When a valve opens the solenoid piston pulls away from a diaphragm located under the pis ton With vacuum assist an open solenoid will cause the diaphragm to form a 2 uL domed chamber The domed chamber creates a passageway between the inlet line and the common pathway The common pathway zigzags through the valve block manifold and passes other closed valves which are unaffected by the flow The direction of flow is determined by the pressures on either side of the valve block During proper operation the flow will be toward the column or one of the exit ports 5 8 Section 5 System Description Hardware Applied Biosystems INLET LI
160. he maximum power fail time move the cursor as necessary and insert the desired value up to a 3 digit number Mistakes can be corrected by typing over an incorrect number Note When zero is entered the synthesis will always continue when the main power returns regardless of the duration of the outage Example 1 If the maximum time is 20 minutes and a power failure occurs for less than that an alarm will sound for 15 seconds when the main power resumes The synthesis will then automatically continue and the following menu will appear Applied Biosystems 391 DNA Synthesizer PCR MATE EP Ver 1 00 start A Note When the instrument is not synthesizing another menu may appear Section 3 Software Menu Descriptions 3 47 Applied Biosystems The blinking in the bottom right corner signifies the alarm has been triggered To stop the ring ing if necessary and to view more information select START and the display will read Down Time 7 08 14 20 34 POWER FAIL Up Time 7 08 15 45 44 main A The down time is the time the power failed The up time is the time the main power resumed Select MAIN to clear this display and return to the Main Menu If desired select Monitor Synth from the Main Menu to view the Synthesizing Status Menu and information about the current step being per formed Example 2 If the maximum power fail time is 20 minutes and a power failure has occurred for longer than that th
161. he oligonucleotide primer a linker and a fluorescent dye The linker bears a highly nucleophilic primary amine group which reacts with the electrophilic N hy droxy succinimide group of the fluorescent dye This linker group is created with AMINOLINK 2 AB Part No 400808 34 Aminolink 2 is a phosphoramidite molecule with a six carbon chain and a protected amine group Figure 6 13 This reagent is handled and used like a phosphoramidite nucleoside Activation with tetrazole forms an active intermediate that couples to the 5 hydroxyl terminus of the support bound oligonucleotide in the final coupling cycle Oxidation and ammonia cleavage deprotection yields the aminolink oligonucleotide in solution Coupling to the fluores cent dye NHS ester or other electrophilic species is conducted in a homogeneous solution 6 28 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems i NGPr 2 CF CNHCH2260 P OCH3 Aminolink 2 HO B tetrazole 1 eee CF 3CNH CH2 g0 P O B oxidation ammonia H HoN CH2 g0 P O B 0 Figure 6 13 Aminolinked oligonucleotide in solution Section 6 Chemistry for Automated DNA Synthesis 6 29 Applied Biosystems References 1 Efcavitch J W Automated System for the Optimized Chemical Synthesis of Oligodeoxyribonucleotides Macromolecular Sequencing and Synthesis Selected Methods and Applications pages 221 234 Alan R Liss Inc 1988 2 Be
162. he pulse time which advances the fraction collector When selected the screen reads Fraction collector pulse time 100 msec Applied Biosystems uses a standard pulse time of 100 milliseconds You can change the time by moving the cursor to the unwanted number and inserting a new one over it When finished return to the Main Menu by selecting MAIN Main Menu Option Procedure Editor Use the Proc procedure Editor Menu to create edit and print the phosphoramidite purge shut down and bottle change procedures Standard procedures further described in this section are au tomatically used during instrument operation You can however edit standard procedures or create new ones Note that the flow test procedure which is accessed from self test cannot be edited or printed 3 42 Section 3 Software Menu Descriptions Applied Biosystems When you select PROC EDITOR the display shows an abbreviated name for the phosphoramidite purge procedure PROS PURGE Edit print procedure PHOS PURGE edit copy print next Select NEXT to view the subsequent procedure name The display will then show 1 BOTTLE CHANGE signifying the bottle change procedure for reservoir 1 which contains A phosphoramid ite Continuing to press NEXT will show the names for all eleven bottle change procedures and then will display SD SHUT DOWN signifying the shut down procedure Press NEXT until the desired procedure is showing Select an action
163. hesis Applied Biosystems ethylammonium acetate TEAA EDTA etc It is important to keep the oligonucleotides cold to minimize degradation and bacterial growth Alternatively oligonucleotides may be stored dried as a pellet in a clean dry vessel such as a microcentrifuge tube The solution used to elute purified oligonucleotides from OPC 20 acetonitrile is a convenient and stable storage media When stored by these means oligonucleotides are stable for over a year Avoid solutions that are mutagen ic oxidizing or outside the pH range of 3 12 Analysis and Purification This section reviews the most common methods for purification of synthetic oligonucleotides HPLC high performance liquid chromatography and PAGE polyacrylamide gel electrophoresis can provide a high level of purity but require initial capital investments and are labor intensive and time consuming A short oligonucleotide 30 bases made with typically high synthesis efficiency gt 98 average DMT yield cycle may only require a less stringent purification with efficient de salting and removal of non nucleoside synthesis by products These methods are elaborated in de tail in User Bulletin No 13 Revised OPC Oligonucleotide Purification Cartridge The Oligonucleotide Purification Cartridge OPC AB part 400771 was designed specifically for rapid easy purification of synthetic oligonucleotides 819 The method is based on a small syringe mounted cartridg
164. hesis protocols Although the cycle is similar in that it contains coupling capping and detritylation steps all reagents are different Section 6 Chemistry for Automated DNA Synthesis 6 25 Applied Biosystems than those used for the phosphoramidite method The synthesis efficiency is routinely less than the phosphoramidite method typically 95 96 trityl yields The primary advantage to the hydrogen phosphonate chemistry is the flexibility for one step post synthesis conversion of the internucleo side hydrogen phosphonate groups to a variety of phosphate species such as phosphodiesters phosphoramidates phosphotriesters and most importantly the phosphorothioates Ee DMTO B gt O Figure 6 11 hydrogen phosphonate monomers Phosphorothioate DNA When the hydrogen phosphonate synthesis of an oligonucleotide is done the column may be re moved and a sulfurizing reagent introduced by the double syringe method All the internucle oside hydrogen phosphonates are rapidly converted to phosphorothioates After regular ammonia cleavage deprotection oligonucleotides bearing phosphorothioate linkages behave chemically sim ilarly to normal phosphodiester DNA They show the same electrophoresis and HPLC behavior This class of phosphate analog DNA has shown activity in anti sense translation arrest experi ments In particular both a sequence and non sequence specific effect has been observed in inhi
165. i 450 kPa WARNING Compressed gas cylinders must be safely attached to the wall or bench by means of approved restraints Failure to do so could cause the cylinders to fall over and explode which could result in physical harm Turn off or cap the cylinders when they are not in use Ventilation Gaseous waste is vented from the waste bottle Your facility must be equipped with a ventilated lab oratory chemical fume hood or the equivaent to remove harmful vapors The waste vent should be routed to the chemical exhaust system by one of the methods shown in the User s Safety Informa tion section at the beginning of this manual E 16 Appendix E Warranty 391 Pre Installation Manual Applied Biosystems Liquid Waste Disposal WARNING Please review the waste profile for information on contents of the Model 391 and 391 EP liquid waste so that it can be disposed of in accordance with all local state and federal health and environmental regulations and laws Please also read the MSDS to determine the protective equipment required to work with and dispose of these chemicals The waste profile and MSDS are in the User s Safety Information section at the beginning of this manual Operator Training at Installation Applied Biosystems Service Installed Instruments Only An important part of in laboratory installation is operator training Those persons who will be op erating the Model 391 or 391 EP should set aside two uninterrupted days to w
166. ication of oligonucleotides One of the advantages of HPLC is a high level of automation Systems are available which allow for repetitive programmed injection anal ysis and data manipulation and storage Two different types of column adsorbents are popular for oligonucleotides reverse phase and ion exchange Reverse phase adsorbents discriminate by the hydrophobic differences between oligonucleotides of varying lengths and sequences When the 5 DMT is on the oligonucleotide this group is dominant in its interaction with the support adsorbent Reverse phase columns also can adequately resolve DMT off oligonucleotides with sufficient capacity The mobile phase is typically a volatile buffer such as 0 1M triethylammonium acetate The oligonucleotides are eluted with a gradient of increas ing organic solvent such as acetonitrile These conditions are non denaturing Occasionally certain sequences can exhibit unpredictable HPLC elution patterns caused by inter or intramolecular sec ondary structure and hydrogen bonding effects Ion exchange adsorbents elute oligonucleotides based on increasing charge i e chain length An increasing salt gradient in the mobile phase is used to displace the oligonucleotide phosphate an ions The salt anions such as ammonium sulfate or sodium phosphate and the DNA pair with the adsorbent bound cation usually alkylated ammonium species Since ion exchange analysis sepa rates only on the basis of increasing charg
167. intensity of the orange color gradually decreases Perform the trityl cation assay to determine the coupling efficiency of the synthesis Refer to User Bulletin 13 Revised Evaluation and Purification of Synthetic Oligonucleotides for instructions Once the column and trityl tubes are removed the instrument is ready to begin another synthesis 3 Perform the Manual Deprotection and Cleavage Procedure described on the next page 4 If desired analyze the crude oligonucleotide mixture by one of the methods such as HPLC or gel electrophoresis described in User Bulletin 13 Revised 5 Prepare the DNA for use in experiments by removing the ammonia and then desalting Purify the product if necessary Applied Biosystems Oligonucleotide Purification Cartridge OPC provides a fast and easy way to purify and desalt in one step An overview of OPC and other purification methods can be found in Chemistry for Automated DNA Synthesis In addition refer to How to Use OPC Oligonucleotide Purification Cartridge found later in this section Refer to User Bulletin 13 Revised for other detailed instructions about analysis and purification Manual Deprotection and Cleavage Introduction After the synthesis of a deoxyoligonucleotide on the Model 391 the DNA produced is not yet bio logically active The phosphate groups and base exocyclic amines are protected to prevent side re actions during synthesis Following synthesis the protecting groups mus
168. ions Applied Biosystems Bottle Usage Data Table 3 1 Bottle Usage Data Synthesis Scale Reagent 0 2uM 1 0uM Low cycles cycles cycles Phosphoramidites 0 25 grams 1 0 grams A G C T Tetrazole 180 mL Acetic anhydride 180 mL NMI 180 mL TCA 450 mL Iodine 200 mL Acetonitrile 4 L 10 00M cycles Section 3 Software Menu Descriptions 3 33 Applied Biosystems Main Menu Option Cycle Editor Introduction Use the Cycle Editor to create edit and print synthesis cycles Four fully programmable synthesis cycle locations are available in RAM Random Access Memory They are named Cycle 1 through Cycle 4 RAM cycles can be created or edited according to your needs Immediately before synthe sis you select the RAM cycle you want to use from the Start Synth Menu Applied Biosystems also supplies four cycles which are permanently stored in ROM Read Only Memory These ROM cycles are optimized for synthesizing on the 2 micromole one micromole and ten micromole scales They are named 2u M luM and 10uM respectively The fourth cycle is named Low It is a low reagent consumption cycle on the 2 micromole scale which uses 33 less phosphoramidites Cycles are further explained in Section 4 To synthesize using a ROM cycle it must be transferred to a programmable RAM cycle location i e Cycle 1 2 3 or 4 Only the RAM cycles appear as choices in the Start Synthesis Menu 2u M luM Low and
169. iosystems The internucleotide linkage is then converted from the phosphite to the more stable phosphotriester Iodine is used as the oxidizing agent and water as the oxygen donor This reaction is complete in less than 30 seconds Figure 6 8 After oxidation the dimethoxytrityl group is removed with a protic acid either trichloroacetic or dichloroacetic acid The cycle is repeated until chain elongation is complete At this point the oli gonucleotide is still bound to the support with protecting groups on the phosphates and the exocy clic amines of the bases A G and C The oligonucleotide is cleaved from the support by a one hour treatment with concentrated ammonium hydroxide Ammonia treatment also removes the cyanoet hyl phosphate protecting groups The crude DNA solution in ammonium hydroxide is then treated at 55 C for 8 to 15 hours to remove the protecting groups on the exocyclic amines of the bases Fig ure 6 9 Note that synthesis can be performed using methyl or the newer cyanoethyl phosphoramidites These two versions of synthesis monomers differ only by the protecting group on the phosphorous oxygen The synthesis chemistry and the resulting oligonucleotide are the same with both Excellent results are obtained with either one The primary difference is that when using methyl phosphora midites thiophenol treatment is required to deprotect the internucleotide methyl phosphotriester groups at the end of synthesis Thiophenol
170. itrile from the reagent valve blocks The Bottle Change Procedure Bottle change procedures are used to remove empty reservoirs and replace them with bottles of fresh reagents They can be performed before beginning a synthesis or when a synthesis is interrupt ed either manually or by the alarm This process is especially important for preventing oxygen and water contamination of atmosphere sensitive phosphoramidites and tetrazole A procedure exists for all 11 bottles and each can be edited using the Procedure Editor Copies of the procedures can be found in Appendix A 4 24 Section 4 Functions Cycles and Procedures Applied Biosystems The Phosphoramidite Bottle Change Procedure STEP FUNCTION FUNCTION TIME NUMBER NUMBER DESCRIPTION SECONDS 1 Fl BLOCK FLUSH 5 F 10 18 TO WASTE 7 The reagent valve blocks are cleared by F1 block flush for 5 seconds and rinsed by F 10 18 to waste for 7 seconds 3 A PHOS F 71 18 TO BOTTLE 5 G PHOS F 72 C PHOS F 73 T PHOS F 74 X PHOS F 75 Old reagent in the delivery line is removed and forced back into the reservoir by an acetonitrile wash via delivering 18 to the designated bottle for 5 seconds 4 A PHOS F 62 FLUSH TO BOTTLE 10 G PHOS F 63 C PHOS F 64 T PHOS F 65 X PHOS F 66 An argon flush clears the lines for 10 seconds 5 INTERRUPT F 17 Remove the bottle place the new bottle on the instrument If you are going to remove the phosphoramidites and save them for later us
171. key erases an entry at the cursor position When the cursor is not under an entry the deletion is made to the left of the cursor Continuously pressing delete will repeatedly erase entries In addition to using the delete key to erase numerical entries mistakes can be corrected by moving the cursor to the incorrect number and typing over it The MAIN and MENU Soft Keys The MAIN and MENU keys appear in the far right positions of most displays MAIN Pressing the MAIN always returns to Page 1 of the Main Menu MENU Pressing MENU returns to the display which was previously shown MENU can be selected repeatedly until the MAIN key appears Section 3 Software Menu Descriptions 3 3 Applied Biosystems Software Abbreviations and Symbols luM 2uM 10uM 1 A PHOS 1 BOTTLE CHANGE C1 CLR Fract pulse Fxn Imediate Intrpt Low Nxt Nxt DNA PP PHOS PURGE Prev Proc RAM ROM SD SHUT DOWN Std Synth number one micromole B cyanoethyl synthesis cycle two tenth micromole B cyanoethyl synthesis cycle ten micromole B cyanoethyl synthesis cycle bottle change for reservoir 1 containing adenosine phosphoramidite as seen in Change Bottles bottle change procedure for reservoir 1 containing adenosine phosphoramidite as seen in the Procedure Editor Menu Cycle 1 clear fraction collector pulse time function immediate interrupt low consumption two tenth micromole B cyanoethyl s
172. kg 400606 Tetrazole acetonitrile 180 mL 400607 Acetic anhydride 180 mL 400753 lodine water pyridine 200 mL 400785 1 methylimidazole 180 mL 400790 200 mL bottle seals 10 pkg 2L n ln onn lx xwm o5 lnl nl lnl l l l nl x o 400953 Small scale A CPG column 400954 Small scale C CPG column 499955 Small scale G CPG column 400956 Small scale T CPG column Note The only additional reagent you will need for installation is concentrated analytical grade ammonium hydroxide Because ammonium hydroxide is a common laboratory reagent Applied Biosystems does not supply it in some countries including the United States If you do not have ammonium hydroxide in your laboratory you can order it from Baker Laboratories Concentrated reagent 29 8 6 Baker P N 9721 1 E 8 Appendix E Warranty 391 Pre Installation Manual Applied Biosystems The Start Up Chemical Kit includes a manual deprotection kit P N 400257 that contains the fol lowing Part No Description Quantity 200243 1 mLdisposablesyringes with luer fiting 110 200244 1 5 in disposable needles with female luer 10 200245 No 10 rubber stopper 1 110127 Male to male luer connector Alltech 86506CTFE 5 400048 DNA collection vial 10 140048 Teflon lined vial cap 10 With the exception of the No 10 rubber stoppers and the luer connectors this equipment is used on a one time basis and should be ordered in sufficient quantities for regular use In addition whe
173. le 3 61 10uM Cycle 4 53 Section 3 Software Menu Descriptions 3 13 Applied Biosystems ON OFF Specifies the desired ending method When one ending method is shown pressing ON OFF will display the other About the Ending Method The 5 terminus of the fully synthesized DNA chain can either remain protected by a dimethoxytrityl group trityl on or can be detritylated to yield 5 hydroxyl trityl off Trityl on is usually selected when purifying by trityl specific OPC or reverse phase HPLC Trityl off is usually chosen when purifying by gel electrophoresis or ion exchange HPLC Note If trityl on is specified the DNA can be manually detritylated by a 15 minute treatment with 80 acetic acid at room temperature This is done following synthesis after base deprotection When all synthesis information is displayed correctly press BEGIN Once pressed you can no longer change the DNA strand and the synthesis cycle selection However cycle step times can be edited during synthesis by using the Cycle Editor Although the ending method is designated before beginning a run it can be changed during a syn thesis until the final addition cycle is complete This is done from Page 4 of the Monitor Synthesis Menu After the last step of the final base addition the ending method cannot be changed After you select BEGIN the screen reads Checking bottle usage for base 1 Please wait Each reagent will be checked for usag
174. lon lined cap Rubber lined caps have contaminants that leach out of the cap liner during base deprotection Teflon lined caps can be ordered from Wheaton Part Number 240408 size 13 425 Repeatthe ammonia treatment 3 more times for 15 to 30 minutes each This ensures complete cleavage and cyanoethyl deprotection IMPORTANT Remember that the product DNA is now in solution and no longer bound to the support Save the column until the cleavage is confirmed To remove the exocyclic amine base protecting groups benzoyl and isobutyryl first bring the volume of the crude DNA solution to 3mL with fresh concentrated ammonium hydroxide Then place the vial of DNA at 55 C for 8 to 15 hours Longer treatment is advisable if the ammonium concentration is questionable This also cleaves the acetyl caps from the failure sequences After completing deprotection cool the ammonium hydroxide DNA solution a When purifying by OPC the oligonucleotide solution is diluted 1 3 with water and then loaded directly on the cartridge with no other preparation needed For details refer to How to Use OPC Oligonucleotide Purification Cartridge found later in this section 2 16 Section 2 Operation Applied Biosystems b If the DMT group was removed previously as a part of the synthesis cycle the DNA is ready for analysis and or purification by PAGE or ion exchange HPLC Analysis and purification procedures are discussed in User Bulleti
175. lumns by Schott The procedure presented here is similar to Dr Schott s with minor variations Reagents solvents and apparatus The manual deprotection kit Part Number 400257 accompanying the installation kit contains the following items for the deprotection 1 Ten 1 mL disposable syringes with Luer fittings Catalog 805602 2 Ten disposable needles with female Luers VWR Catalog 805 167 3 A number 10 rubber stopper VWR Catalog 59580 386 4 Five male to male Luer connectors Alltech Associates Inc Catalog 86506 Items 1 and 2 are used on a one time basis and should be ordered in sufficient quantities for regular use Because it is convenient to perform the deprotection on several oligonucleotides simultaneous ly you should purchase more male to male Luer connectors Reagent grade concentrated ammonium hydroxide is provided in the installation reagent kit Ad ditional quantities should be purchased from a local supplier Small DNA collection vials with a rubber lined screw cap are available from Applied Biosystems Part No 400048 or can be pur chased from a local source However use Teflon lined caps with the vials because the rubber lined caps can leach contaminants into the DNA ammonium hydroxide solution They can be or dered from Wheaton Part Number 240408 size 13 425 2 14 Section 2 Operation Applied Biosystems Syringe gt amp Solution QO Synthesis Column
176. lution In cold climates the tetrazole may precipitate in the delivery lines The resulting repairs are expen sive therefore keep room temperatures above 18 C Store tetrazole at room temperature Bottle 11 Acetic Anhydride Acetic anhydride lutidine tetrahydrofuran THF 1 1 8 is one half of the capping reagent Atmo spheric water will reduce its efficiency Upon opening the bottle quickly place it on the instrument Use in a well ventilated area avoid inhalation Store at room temperature Bottle 12 1 methylimidazole NMI 1 methylimidazole NMI is the second half of the capping reagent Within 24 hours of combining NMI with the acetic anhydride reagent the solution discolors and becomes viscous To prevent this the two reagents are stored in separate reservoirs and are simultaneously added to the column to per form capping Upon opening the bottle quickly place it on the instrument Use in a well ventilated area and avoid inhalation Store at room temperature Bottle 14 Trichloroacetic Acid Trichloroacetic acid TCA dichloromethane 3 wt vol is the detritylating reagent Store at room temperature and use with caution Bottle 15 Iodine Iodine water pyridine THF 0 1M 1 10 40 is the oxidizing reagent It can be stored for up to 6 months from the date of manufacture After this time it may develop a tar visible when the bottle is turned over and should not be used Note the expiration date on the bottle Any
177. midite bottle 3 G phosphoramidite bottle 2 A phosphoramidite bottle 1 Description Directs flow between the reagent valve blocks and the column Directs flow from the reagent valve block to the waste bottle Controls the flow of argon to the column valve block Directs flow from the column valve block to the trityl collection port Directs flow from the column valve block to the waste bottle Valves 17 20 22 23 are pressure valves which control the flow of argon to the following reagent reservolrs Valve 17 18 19 20 22 23 Valve 21 Argon to acetonitrile bottle 18 iodine bottle 15 TCA bottle 14 all phosphoramidite reservoirs simultaneously NMI and acetic anhydride bottles 12 and 11 simultaneously tetrazole bottle 9 Description Vents all phosphoramidite reservoirs simultaneously Note that for flow to actually occur several valves must be opened simultaneously as explained in the function descriptions next Section 4 Functions Cycles and Procedures 4 3 Applied Biosystems GAS 2 GAS GAS 9 6 11 12 s NMI l TCA TET Ac 0 9 USER e SUPPLIED FRACTION COLUMN COLLECTOR VALVE 9 4 o BLOCKS SYNTHESIS COLUMN gt tows 000000 e e e e E e REAGENT
178. mine the gel thickness For UV shadowing 75 1 5 mm is con venient The acrylamide solution is poured in between and allowed to polymerize A comb is also inserted which forms wells where the oligonucleotide is loaded Each well forms a vertical lane during the electrophoresis The plate length should be about 16 40 cm depending on oligonucle otide length The width depends only on the number of samples to be run Dyes such as bromophe nol blue and xylene cyanol are run either in the samples or by themselves as indicators of the migration distance of the oligonucleotides The acrylamide concentration of the gel matrix deter mines the velocity of the oligonucleotides A range of 8 20 is typical Longer oligonucleotides require lower acrylamide concentration When the dyes indicate the appropriate migration distance of the oligonucleotide product the power is turned off and the gel sandwich is disassembled There are several methods of analysis UV shad owing staining and radiolabelling autoradiography UV shadowing This is the simplest easiest and introduces the fewest artifacts into the analysis Depending on oli gonucleotide length from 0 5 to 10 odu are loaded in a well After electrophoresis the gel is trans ferred from the plates to a clear plastic wrapped fluorescent TLC plate most conveniently plastic backed 20x20cm The gel is visualized with a UV lamp at short wavelength The bands appear dark 6 22 Section 6 Chemis
179. n possible it is convenient to carry out the deprotection on several compounds simultaneously ne cessitating additional male to male luer connectors Additional Chemicals and Columns The supplies included in the Start Up Chemical Kit will not last beyond the installation period It is strongly recommended that an additional supply be ordered before installation If you wish to order chemicals and columns for additional syntheses please contact your local salesperson or call Ap plied Biosystems phosphoramidites reagents and synthesis columns should be ordered from Applied Biosystems with two exceptions Ammonium hydroxide for the cleavage deprotection step Order concentrated analytical grade reagent Purchase it in 500 mL bottles keep it sealed tightly and store it at 4 Do not use it for more than two weeks after you have opened a bottle e Acetonitrile HPLC grade for bottle position 18 The Model 391 or 391 is equipped to handle a 4 L bottle The water content must be less than or equal to 300 ppm 0 003 We have had success with Burdick amp Jackson acetonitrile B amp J P N 015 4 If you are unsure of the water content of a local supplier s acetonitrile or if you know that the water content is too high you can control or avoid this problem by 1 checking the acetonitrile by Karl Fischer titration or 2 distilling HPLC grade acetonitrile over P205 Redistill over to remove acid Appendix
180. n 13 Revised j c When purifying by trityl specific reverse phase HPLC cool the ammonium hydroxide DNA solution to prevent losses from bubbling and remove the ammonia by vacuum Keep the solution basic to prevent accidental detritylation by adding one drop of distilled triethylamine every 10 minutes Also avoid heating the sample After collection and concentration of the product from reverse phase HPLC detritylate the dried sample by dissolving it in 200 500 uL of 80 acetic acid Since the acetic acid is an aqueous solution the trityl cation will react with water and form tritanol and will not give an orange color After 20 minutes add an equal volume of 95 ethanol and lyophilize the sample The dried sample is then lyophilized from ethanol until no acetic acid remains The hydrolyzed DMT group can be removed by methods discussed in User Bulletin 13 Revised Section 2 Operation 2 17 Applied Biosystems How to Abort a Synthesis When a synthesis is aborted all valves close and you will not be able to continue the run proce dure for how to abort a synthesis appears below If you need further details refer to The Interrupt Menu in Section 3 Caution Interrupt synthesis at a safe step such as Cycle Entry or Cycle End Otherwise chemicals could be left in valve blocks and delivery lines Salts could then form preventing subsequent deliveries The resulting repairs are expensive To abort synthesis 1 Press INTRPT
181. n Demand following the telephone information below To Contact Technical Support by E Mail Contact technical support by e mail for help in the following product areas Product Area E mail address Genetic Analysis DNA Sequencing galab appliedbiosystems com Sequence Detection Systems and PCR pcrlab appliedbiosystems com Protein Sequencing Peptide and DNA Synthesis corelab appliedbiosystems com Biochromatography PerSeptive DNA PNA and Peptide Synthesis systems CytoFluor FMAT Voyager and Mariner Mass Spectrometers tsupport appliedbiosystems com LC MS Applied Biosystems MDS Sciex apisupport sciex com or api3 support sciex com Chemiluminescence Tropix tropix 9 appliedbiosystems com Hours for Telephone Technical Support In the United States and Canada technical support is available at the following times Product Hours Chemiluminescence 8 30 a m to 5 30 p m Eastern Time Framingham support 8 00 a m to 6 00 p m Eastern Time All Other Products 5 30 a m to 5 00 p m Pacific Time Appendix E Warranty 391 Pre Installation Manual E 19 Applied Biosystems To Contact Technical Support by Telephone or Fax In North America To contact Applied Biosystems Technical Support use the telephone or fax numbers given below To open a service call for other support needs or in case of an emergency di
182. nals Contact the Applied Biosystems Technical Support Department for further information Functions which manipulate chemical pathways The following two functions control the pathway of the column effluent FUNCTION NAME VALVES NUMBER F6 WASTE TO PORT SUBSTITUTE 15 FOR 16 Sends the column effluent to the trityl collection port F7 WASTE TO BOTTLE DEFAULT TO 16 Sends the column effluent to the waste bottle Section 4 Functions Cycles and Procedures 4 11 Applied Biosystems When Function 6 waste to port is activated all subsequent functions using Valve 16 will have Valve 15 opened instead AII deliveries to the column will then exit through the trityl collection port This is done prior to TCA delivery so that the trityl cation released during detritylation can be sent to a fraction collector for subsequent analysis To return the flow of the column effluent to the waste bottle Function 7 waste to bottle 1s activat ed This signals the controller to open Valve 16 again default to Valve 16 Functions which prepare a reagent for delivery The following functions pressurize reagent reservoirs to prepare them for delivery A prep prepa ration function opens the gas valve to the reservoir allowing argon to flow to the headspace of the bottle After several seconds the bottle reaches the correct pressure necessary for proper delivery These functions are used for reagents which are delivered simultaneously and in e
183. nd length are defined by the operator on the synthesizer When the chain is complete the crude DNA oligonucleotide must be cleaved from the support and deprotected Further purification is usually advised When the complete operation becomes routine the synthesis of oligonucleotides becomes reliable and their biological activity is assured Since most laboratories are not interested in this as a research project the goals are for DNA synthesis to become cheaper faster better eas ier and more flexible This chapter will help you understand the synthesis chemistry and how you can attain these goals The phosphoramidite method of oligonucleotide synthesis is the chemistry of choice for most lab oratories because of efficient and rapid coupling and the stability of the starting materials The thesis is performed with the growing DNA chain attached to a solid support so that excess reagents which are in the liquid phase can be removed by filtration Therefore no purification steps are re quired between cycles This support material is a form of silica controlled pore glass CPG beads The particle size and the pore size have been optimized for liquid transfer and mechanical strength The synthesis cycle is depicted in Figure 6 1 The starting material is the solid support de rivatized with the nucleoside which will become the 3 hydroxyl end of the oligonucleotide As shown in Figure 6 2 the nucleoside is bound to the solid support thr
184. ndix E Warranty 391 Pre Installation Manual Applied Biosystems To Obtain Documents on Demand Free 24 hour access to Applied Biosystems technical documents including MSDSs is available by fax or e mail or by download from our Web site To order documents Then by index number a Access the Applied Biosystems Technical Support Web site at http www appliedbiosystems com techsupp Click the Index link for the document type you want then find the document you want and record the index number Use the index number when requesting documents following the procedures below by phone for fax delivery b From the U S or Canada call 1 800 487 6809 or from outside the U S and Canada call 1 858 712 0317 Follow the voice instructions to order the documents you want Note There is a limit of five documents per request through the Internet for fax or e mail delivery a Access the Applied Biosystems Technical Support Web site at http www appliedbiosystems com techsupp Under Resource Libraries click the type of document you want Enter or select the requested information in the displayed form then click Search In the displayed search results select a check box for the method of delivery for each document that matches your criteria then click Deliver Selected Documents Now or click the PDF icon for the document to download it immediately Fill in the information form if you hav
185. ng the waste for disposal wear gloves and eye protection and avoid inhalation and skin contact Refer to the Waste Profile and MSDS in the User s Safety Information Section for details Section 2 Operation 2 25 Applied Biosystems 3 After disposal securely screw the cap assembly supplied by Applied Biosystems on an empty waste bottle IMPORTANT The waste bottle is the low pressure side of the delivery system and must always be kept vented to atmosphere Be sure the vent line is properly routed to a fume hood If the vent line is blocked back pres sure will be generated which will decrease the deliveries of reagents and solvents How to Perform the Flow Test Procedure Flow test is an automated procedure used to measure the flow rates through all essential delivery lines It can be used for routine maintenance troubleshooting and recalibration of the instrument if flow related problems are suspected For example if oligonucleotide quality is low the flow test will help determine if instrument performance is a factor If the synthesizer has flow related diffi culties be sure to do the test prior to calling the Applied Biosystems Technical Support Department The flow test has four parts and takes about one hour to perform The first part washes and primes the delivery lines with acetonitrile The second measures the flow of acetonitrile from each bottle position to the lower column Luer fitting The third measures the flow fr
186. nly as a preliminary yet convenient monitor of the synthesizer s performance The assay is useful to aid in the early detection and diag nosis of instrument related problems Many laboratories monitor their trityl fractions only by visual inspection With experience a failed synthesis is detected this way Evaluation of the oligonucle otide by PAGE or HPLC is much more informative than the trityl assay Synthesizer or reagent problems can only be adequately diagnosed by these methods which are direct analyses of the prod uct Depurination Trichloroacetic acid is a very effective protic acid detritylating agent However in the presence of protic acids amine protected purines are susceptible to depurination removal of the purine from its sugar The chemical mechanism is initial protonation at N 7 of the purine ring causing increased lability of the ribose 1 purine N 9 bond Cleavage of adenine and guanine bases yields a 1 hemiacetal ribose ring the result of depurination Oligonucleotides which contain apu rinic sites are cleaved during the ammonium hydroxide treatment Cleavage occurs at the internu cleotide bonds on the 3 hydroxyl side of the apurinic deoxyribose This is similar in effect to the chemistry of Maxam Gilbert sequencing Each purine in the oligonucleotide chain is exposed to acid at each detritylation step Purines near the 3 end will have the longest cumulative exposure time and a greater chance for
187. nnect a single syringe to one side of the synthesis column and a male to male luer fitting AB p n 110127 the other Insert the column syringe luer apparatus into the test tube and draw the lysine solution into the column Incubate at 55 C for 90 minutes by inserting the test tube and contents into a heating block The lysine solution should be periodically circulated every 30 minutes Note The luer fitting of the syringe must be located in the center of the syringe barrel to allow easy insertion into the test tube After incubation in the lysine solution wash the column 5 times with water Complete the Manual Deprotection and Cleavage Procedure described earlier in this section Then follow the OPC purification protocol Section 2 Operation 2 37 Applied Biosystems OPC Purification Protocol Solutions Needed S e HPLC grade acetonitrile 5 mL 2 e 2 0 triethylamine acetate Part No 400613 5 mL a 53 e Deionized water 1 mL or Dilute ammonium hydroxide 15 mL 1 10 dilution of conc ammonium hydroxide deionized water e 2 trifluoroacetic acid in deionized water 10 mL Neat TFA Part No 400137 20 v v acetonitrile in deionized water 1 mL 1 After completion of a Trityl On synthesis cleave the oligonucleotide from the support and deprotect following the Manual Deprotection and Cleavage Procedure found earlier in this section 2 Connect an all polypropylene syringe Aldrich Z1 1
188. nstall your new AB instrument and to comply with your safety rules We require our engineers to take the necessary time to familiarize themselves with the locations of potential hazards exits and safety equipment and steps to be taken during an evacuation or other emergency We request that a representative from your laboratory be in the vicinity and available to our engi neer at all times while he or she is onsite We believe as a minimum available safety equipment should consist of a fire extinguisher Halon eye wash safety shower eye and hand protection adequate ventilation and protection from sources of radiation lasers radioisotopes contaminated equipment radioactive wastes etc that may be present in the area where our engineer will be working We make this request to ensure that both your laboratory and our service personnel have a safe en vironment to work in during the installation and maintenance of your AB instrument system Com pleting this part of the preinstallation procedure as well as the other requirements presented in this manual will help to ensure both the successful installation and safe use of your equipment Appendix E Warranty 391 Pre Installation Manual E 3 Applied Biosystems User Attention Words Material Safety Data Sheets and Waste Profiles User Attention Words Four user attention words appear in the text of Applied Biosystems documents Categorically each word implies a particular l
189. nued on next page A 6 Appendix A Functions Cycles and Procedures Applied Biosystems 391 CYCLE PROCEDURE NAME 2UM NUMBER OF STEPS 63 TIME 04 22 DATE 05 11 89 STEP FUNCTION NUMBER 44 14 14 TO COLUMN 45 108 FLUSH TO TRIT 46 14 14 TO COLUMN 47 108 FLUSH TO TRIT 48 14 14 TO COLUMN 49 108 FLUSH TO TRIT 50 14 14 TO COLUMN 51 108 FLUSH TO TRIT 52 14 14 TO COLUMN 53 108 FLUSH TO TRIT 54 14 14 TO COLUMN 55 108 FLUSH TO TRIT 56 9 18 TO COLM 57 108 FLUSH TO TRIT 58 7 WASTE BOTTLE 59 1 BLOCK FLUSH 60 9 18 TO COLM 61 2 REVERSE FLUSH 62 1 BLOCK FLUSH 63 34 CYC END STEP TIME A ACTIVE FOR BASES G Page 2 X Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Appendix A Functions Cycles and Procedures A 7 Applied Biosystems 391 CYCLE PROCEDURE Page 1 NAME 10M NUMBER OF STEPS 64 TIME 04 23 DATE 05 11 89 STEP FUNCTION STEP ACTIVE FOR BASES NUMBER TIME A G C T X 1 10 18 TO WASTE 2 Y
190. ny reagent or solvent from the column and support argon flows from the column valve block through the column into the reagent valve block and then to waste This forces the reagent out of the column in the reverse direction of normal flow i e it drains the column from the top to the bottom F9 18 TO COLUMN 1 17 12 16 Acetonitrile is delivered to the column This rinses the column and support to remove traces of reagent Argon pressure forces the acetonitrile from its reservoir then through the reagent valve block the column the column valve block and finally to the waste bottle F 10 18 WASTE 1 17 13 Acetonitrile is delivered to the waste bottle Argon pressure forces acetonitrile from its reservoir through the reagent valve blocks to rinse them thoroughly and then to the waste bottle During synthesis these four functions are often performed sequentially For example function 10 can be activated followed by F 9 F 2 and F 1 Function 10 Rinses the reagent valve blocks Function 9 Rinses the column and the column valve block Function 2 Removes the acetonitrile from the column Function 1 Removes the acetonitrile from the reagent valve block and the column valve block Section 4 Functions Cycles and Procedures 4 13 Applied Biosystems Two other functions 108 and 109 flush the column with argon from the bottom to the top F 108 FLUSH TO TRIT 0 12 15 Used following detritylation to flush remaining
191. o acid oxygen and water Once they are in solution and the protective cap is removed quickly put them on the instrument to prevent contamination IMPORTANT Use anhydrous acetonitrile with less than 90 ppm water to dissolve the phosphoramidites Do not use HPLC grade acetonitrile its higher water content will decrease coupling efficiency Anhydrous acetonitrile is available from Applied Biosystems Part Number 400060 Phosphoramidites are stable in powder form for one year and should be stored at room temperature in a desiccator Once they are dissolved they should be used within approximately two weeks After this time coupling efficiencies may decrease If they cannot be used within this time you can freeze store thaw and then reuse the phosphoramidites However they may show a loss of activity For details see How to Prepare Phosphoramidites and How to Store Dissolved Phosphoramidites found earlier in this section 2 20 Section 2 Operation Applied Biosystems Bottle 9 Tetrazole Tetrazole 0 5 M in anhydrous acetonitrile is used as the activator for the phosphoramidites Once the protective seal is removed quickly put the tetrazole on the instrument to prevent atmospheric water contamination IMPORTANT Tetrazole will form a precipitate at approximately 12 Do not put precipitated tetrazole on the instrument Examine each bottle before using it If the tetrazole has precipitated warm it slightly until it is in so
192. oad the appropriate reagents and customize a cycle No hardware changes are needed The PCR MATE EP also includes the computer software program Syncom Syncom electroni cally transfers DNA sequences from an IBM or compatible personal computer PC to your synthe sizer With Syncom you can create a vast library of sequences on a PC then easily transfer a sequence to the instrument for synthesis The program offers the opportunity to link your Model 391 to a network of computers to provide Laboratory Information Management LIM capabilities Applied Biosystems has been perfecting the science of DNA synthesis on automated instruments since 1982 The PCR MATE EP is the latest advance offering the individual laboratory an instru ment system that delivers high quality and reliability at an economical price 1 4 Section 1 Introduction Applied Biosystems How to Get Help Contacting Technical Support You can contact Applied Biosystems for technical support by telephone or fax by e mail or through the Internet You can order Applied Biosystems user documents MSDSs certificates of analysis and other related documents 24 hours a day In addition you can download documents in PDF format from the Applied Biosystems Web site please see the section Obtain Documents on Demand following the telephone information below To Contact Technical Support by E Mail Contact technical support by e mail for help in the following
193. of the Main Menu and follow the prompts An exception is if you are going to store and later reuse the phosphoramidites refer to How to Store Dissolved Phos phoramidites for details WARNING Consider each chemical in the synthesizer potentially harmful Do not inhale vapors Work in a well ventilated area Always use eye protection and wear acid impermeable gloves and a lab coat Do not leave any chemicals uncapped If any chemical is ingested or comes in contact with the eyes immediately consult a physician If there is any physical contact wash immediately with ample water Refer to About the Synthesis Reagents and Solvents and the MSDS for further instructions about storing and handling each reagent Note The phosphoramidites tetrazole and acetonitrile are atmosphere sensitive Upon opening one of these bottles quickly place it on the instrument to prevent contamination How to Install the Phosphoramidites bottles 1 5 These reservoirs are push on bottles that fit around a Teflon insert and silicone O ring to form an airtight seal inside each bottle neck Pressing the appropriate black button above the bottle position releases the grip on the bottle and allows for its removal and subsequent replacement When install ing a bottle the button will return to its out position only when the reservoir is correctly engaged 1 To remove a bottle firmly pull it straight down while pressing the black button above its receptacle If t
194. om bottle 14 to the trityl collection line In the final part all the lines are flushed dry with argon enabling reattachment of the reagents The flow test is not found in the procedure editor and cannot be edited or printed A copy of the procedure can be found in Appendix A How to Do the Flow Test Procedure From the Main Menu select SELF TEST and then press MORE until the display shows Select a test Version 1 00 flowtst more main Press FLOWTST and the screen will read Remove all bottles except 18 before you begin flowtst begin more 2 26 Section 2 Operation Applied Biosystems Follow the instructions and remove all reagents except bottle 18 acetonitrile Do not use the change bottles procedure Any reagents that will be reused should be purged with argon and capped tightly Part 1 Press BEGIN the procedure will start and the screen will show step one WAIT 5 of 5 sec jump intrpt more main The first series of steps 1 through 14 sequentially rinses the lines for each bottle position Use a beaker to collect the acetonitrile rinse starting with position 15 and working backwards Each rinse takes 20 seconds Watch the time on the screen to know when to move the beaker to the next posi tion Step 12 delivers acetonitrile to the column Collect this rinse at the lower Luer fitting remove the column if necessary Inspect the type of flow coming from each delivery line Acetonitrile should flow f
195. on for Cycle 1 63 steps edit copy print next main Follow the prompt and select an action for Cycle 1 EDIT Select to create modify or review the steps of the designated cycle The EDIT key will not function when viewing the ROM cycles 2uM luM Low 10uM To edit these cycles transfer them to a programmable RAM cycle lo cation using the COPY key COPY Select to duplicate the designated cycle into any programmable RAM cycle location 1 2 3 or 4 PRINT Select to print the designated cycle NEXT Select to view the subsequent cycle name and the number of steps in that cycle Press NEXT until the desired cycle is shown The cycles will appear in the fol lowing order 2uM 1i M Low lO0u M Cycle 1 Cycle 2 Cycle 3 Cycle 4 The Edit Key Upon selecting EDIT the screen will display step zero and the total number of steps in the cycle 1 0 of 63 steps in Cycle 1 next prev insert delete menu Section 3 Software Menu Descriptions 3 35 Applied Biosystems An abbreviated cycle name appears on the top left of the display to signify the cycle being viewed C1 Cycle 1 Step zero 0 is not an active step and is not performed during synthesis Because all new steps are added after existing ones it appears so that step 1 can be inserted if necessary NEXT Select to view the subsequent step When viewing the last step pressing NEXT will show step zero PREV Select to view the preceding step When viewin
196. on insert and a silicone O ring to form an airtight seal inside each bottle neck Pressing the appropriate black button above the bottle position releases 5 4 Section 5 System Description Hardware Applied Biosystems the grip on the bottle and allows for its removal and subsequent replacement When replacing a bot tle the button will return to its out position only when the reservoir is correctly engaged Bottles 9 11 12 14 and 15 screw snugly into a threaded cap mounted on the synthesizer A dispos able polyethylene insert forms an airtight seal between each cap and reservoir Note Receptacles 9 15 have a ratchet cap assembly When attaching these bottles you cannot overtighten them Reservoir 18 containing acetonitrile is a 4 Liter bottle that does not attach directly to the instru ment Instead you place it inside a protective carrier and put it into a metal rack that attaches to the left side of the instrument A cap assembly which includes the delivery and gas lines screws onto the bottle and connects to the synthesizer The cap has a teflon insert and a silicone rubber gasket Applied Biosystems provides the cap assembly the carrier the rack and one bottle of acetonitrile The Pressure and Delivery Lines Each bottle has an argon pressure line and a delivery line entering through the cap insert For the phosphoramidites bottles 1 5 the pressure line also functions as a vent line As shown in Figure 5 2 th
197. order documents Then by index number a Access the Applied Biosystems Technical Support Web site at http www appliedbiosystems com techsupp Click the Index link for the document type you want then find the document you want and record the index number Use the index number when requesting documents following the procedures below by phone for fax delivery b From the U S or Canada call 1 800 487 6809 or from outside the U S and Canada call 1 858 712 0317 Follow the voice instructions to order the documents you want Note There is a limit of five documents per request through the Internet for fax or e mail delivery a Access the Applied Biosystems Technical Support Web site at http www appliedbiosystems com techsupp Under Resource Libraries click the type of document you want Enter or select the requested information in the displayed form then click Search In the displayed search results select a check box for the method of delivery for each document that matches your criteria then click Deliver Selected Documents Now or click the PDF icon for the document to download it immediately Fill in the information form if you have not previously done so then click Deliver Selected Documents Now to submit your order Note There is a limit of five documents per request for fax delivery but no limit on the number of documents you can order for e mail delivery Section 1 Int
198. ork with the Applied Biosystems service representative If this is not possible the installation should be rescheduled Proof of Performance Unless previous arrangements have been made an oligonucleotide of less than 25 bases will be syn thesized to demonstrate instrument performance It is necessary to have the fraction collector spec trophotometer and p toluenesulfonic acid solution prepared so that the trityl assay can be performed The passing on site specification is 98 0 0 5 average coupling yield Printer A printer option consisting of a Hewlett Packard Think J et printer and interface cable is available from Applied Biosystems The appropriate part number depends on the site voltage as follows P N 400815 100 Vac P N 400816 120 Vac P N 400817 220 Vac and P N 400818 240 Vac The interface cable P N 100157 may be ordered separately Although the printer uses any standard 8 1 2 x 11 in European size A4 single or fanfold paper best print quality is ensured by using H P specified Ink Jet paper Additional paper stock is available from Hewlett Packard Part No 92261 M Ink Jet paper 500 sheets single sheets Part No 92261 N Ink Jet paper 2500 sheets fanfold Appendix E Warranty 391 Pre Installation Manual E 17 Applied Biosystems Preinstallation Checklist The following checklist is designed to ensure that all necessary preparations have been made prior to installation of the Model 391 or 391 EP If the
199. ottle 14 odine bottle 15 Store in a desiccator at room temperature not exceeding 25 C All phosphoramidites bottles 1 to 5 All CPG columns Bulk CPG Tetrazole bottle 9 Anhydrous Acetonitrile Section 2 Operation 2 19 Applied Biosystems Store refrigerated at 4 C Ammonium Hydroxide Note Cooler temperatures may cause crystal formation in the iodine or tetrazole solution which could clog delivery lines Gentle warming and agitation will dissolve these crystals Bottles 1 to 5 Phosphoramidites Reservoirs 1 through 4 contain phosphoramidites dissolved in anhydrous acetonitrile They are used to synthesize single species sequences and mixed sequence probes Contents Reservoir adenosine phosphoramidite A 1 guanosine phosphoramidite 2 cytosine phosphoramidite C 3 thymidine phosphoramidite T 4 Position 5 is a spare phosphoramidite reservoir and can be used for synthesis with modified bases It is referred to as the X port or X reservoir Many useful derivatives such as deoxyinosine are available from Applied Biosystems and can be placed in this position In addition Aminolink 2 a linker for various substrates can be placed in position 5 IMPORTANT Since all phosphoramidite reservoirs are pressurized simultaneously with a single valve all five bottles must be attached to the instrument even if some are empty to perform a synthesis Phosphoramidites are extremely sensitive t
200. ough a linker attached at the 3 hydroxyl The 5 hydroxyl is blocked with a dimethoxytrityl DMT group The first step of the synthesis cycle is treatment of the derivatized solid support with acid to remove the DMT group Figure 6 4 This frees the 5 hydroxyl for the coupling reaction Figure 6 5 An activated intermediate is created by simultaneously adding the phosphoramidite nucleoside mono mer and tetrazole a weak acid to the reaction column The tetrazole protonates the nitrogen of the phosphoramidite making it susceptible to nucleophilic attack This intermediate is so reactive that addition is complete within 30 seconds As shown in Figure 6 5 the phosphoramidite is blocked at the 5 OH with the dimethoxytrityl group The next step capping terminates any chains which did not undergo addition Since the unreacted chains have a free 5 OH they can be terminated or capped by acetylation These unreacted chains are also called failure products Capping is done with acetic anhydride and 1 methylimidazole Since the chains which reacted with the phosphoramidite in the previous step are still blocked with the dimethoxytrityl group they are not affected by this step Although capping is not required for DNA synthesis it is highly recommended because it minimizes the length of the impurities and thus facilitates product identification and purification Figure 6 7 6 2 Section 6 Chemistry for Automated DNA Synthesis Applied B
201. placing Before concluding there is a bad fuse however check if the instrument is properly connected to a functional power source Extra fuses are included in the spare parts kit For further information call the Applied Biosystems Tech nical Support Department 5 14 Section 5 System Description Hardware Section6 Chemistry for Automated DNA Synthesis Introduction le BE Re eidem i o rRNA E UE 6 2 The Sold Support CPG esise deuie meari Ave deh edet sete 6 5 DNA Synthesis Chemistry i e PERPE ees 6 7 Detritylation nile ew Sh e rerTemgve dee REPRE 6 8 Monitoring trityl 8 6 9 Dep rination rd ce boc db vete estu ee ie d 6 11 Coupling oss oh tiie ORE Sees ae EA 6 12 Phosphorarmdites iie play Iu aet ebur beetle var s eade le 6 12 a ees Met es tet s ro exa tota aeo p S 6 15 Oxidation 5 e525 ua eee Pee AH PUR uper Pm epos Ote RI 6 16 Completion of the Synthesis Cycle leere 6 18 Manual Deprotection and Cleavage 6 18 Cleavagexsonils de SRS GB RY ee Oe E 6 18 Phosphate Deprotection 6 18 Base D ptotecti n oe VPE Mp Rune Seba 6 19 Quantitation of the 1
202. pplied Biosystems Table 6 1 Detritylation Steps STEP DESCRIPTION PURPOSE acetonitrile bottle 18 wash column and support remove traces delivery of delivery to column preceding reagent argon reverse flush remove residual acetonitrile from column bottle 14 delivery to detritylate support bound nucleoside column acetonitrile bottle 18 wash column remove traces of TCA delivery to column argon reverse flush remove residual acetonitrile from column Note The complete synthesis cycle contains steps to wash and flush the valve blocks and delivery lines DMTO o HO TCA DCA Oy 0 OCH DMT CATION Figure 6 4 Detritylation TCA or DCA is used to remove the DMT from the 5 end This leaves a 5 hydroxyl to react with the incoming phosphoramidite in the coupling step Quantitating the released trityl cation indicates the step wise yield and can be used to monitor the instrument s performance Monitoring the trityl cation When the dimethoxytrityl also referred to as DMT or trityl protecting group is cleaved from the nucleotide it exists as a cation Figure 6 4 When in acid solution this cation is relatively stable and produces a brilliant orange color It has an absorbance maximum at about 498 nm and extinction Section 6 Chemistry for Automated DNA Synthesis 6 9 Applied Biosystems coefficient of about 70 000 in most solvents such as acetonitrile or dichloromet
203. ppropriate tracking dye or oligonucleotide standard is also present on the gel By any of these techniques the gel pattern of electrophoresis of an oligonucleotide can be very di agnostic about the course of synthesis Many synthesizer and reagent problems can be diagnosed by the appearance and relative amounts of the failure bands Also PAGE has a distinct advantage in that many samples can be analyzed and purified concurrently The equipment is relatively inex pensive and easy to maintain For bigmers PAGE is usually the most efficient purification method and the only analytical method The primary disadvantages of PAGE are that it is labor intensive and dependent on good technique Oligonucleotides can be purified by locating the product band by UV shadowing and excising the gel material therein with a clean razor blade The gel material which is removed should be free of failure bands most typically the lower N 1 band In a preparative electrophoresis run the product is run further on a thicker gel than in an analytical run to maximize the separation of the product band from the N 1 band The excised gel fragment s is soaked in an elution buffer The gel debris is then removed by a desalting method such as with an OPC cartridge Section 6 Chemistry for Automated DNA Synthesis 6 23 Applied Biosystems HPLC High Performance Liquid Chromatography HPLC is another efficient method which combines quantitative analysis and purif
204. product areas Product Area E mail address Genetic Analysis DNA Sequencing galab appliedbiosystems com Sequence Detection Systems and PCR pcrlab appliedbiosystems com Protein Sequencing Peptide and DNA Synthesis corelab appliedbiosystems com Biochromatography PerSeptive DNA PNA and Peptide Synthesis systems CytoFluor FMAT Voyager and Mariner Mass Spectrometers tsupport appliedbiosystems com LC MS Applied Biosystems MDS Sciex apisupport sciex com or api3 support sciex com Chemiluminescence Tropix tropix 9 appliedbiosystems com Hours for Telephone Technical Support In the United States and Canada technical support is available at the following times Product Hours Chemiluminescence 8 30 a m to 5 30 p m Eastern Time Framingham support 8 00 a m to 6 00 p m Eastern Time All Other Products 5 30 a m to 5 00 p m Pacific Time Section 1 Introduction 1 5 Applied Biosystems To Contact Technical Support by Telephone or Fax In North America To contact Applied Biosystems Technical Support use the telephone or fax numbers given below To open a service call for other support needs or in case of an emergency dial 1 800 831 6844 and press 1 Product or Product Area Telephone Dial Fax Dial ABI PRISM 3700 DNA Analyzer 1 800 831 6844 then press 8 1 650 638
205. provide an exit the waste bottle Section 4 Functions Cycles and Procedures 4 5 Applied Biosystems When all four valves are open the argon pressure will force the acetonitrile out of the reservoir through the reagent valve blocks through the column and out of the synthesizer to the waste bottle When Function 9 is deactivated all valves close and the flow stops The pathway created by acti vating Function 9 is traced using the 391 DNA synthesizer schematic and is shown in Figure 4 2 16 hA WASTE USER SUPPLIED COLUMN VALVE 35 TRITYL COLLECTION PORT FRACTION BLOCK 14 Gas COLLECTOR COLUMN REAGENT VALVE BLOCKS 9 0 6 0 vue etm Figure 4 2 Schematic representing the flow of Function 9 18 to column which opens valves 1 12 16 and 17 4 6 Section 4 Functions Cycles and Procedures Figure 4 3 391 FUNCTION LIST VERSION 1 00 TIME 04 27 DATE 05 11 89 FUNCTION FUNCTION FUNCTION NUMBER NAME VALVE LIST 1 BLOCK FLUSH 0 13 14 16 2 REVERSE FLUSH 12 13 14 4 WAIT 5 ADVANCE FC 6 WASTE PORT 7 WASTE BOTTLE 9 18 TO COLM 1 12 16 17 10 18 TO WASTE 1 18 17 13 15 TO COLUMN 2 12 16 18 14 14 TO COLUMN 3 12 16 19 16 CAP PREP 22 17 INTERRUPT 19 TO COLUMN 6 12 16 20 23 22 CAP TO COLUMN 4 5 12 16 22 28 PHOS PREP 20 23 31 RCDR ON 32 RCDR OFF 33 CYC ENTRY 34 CYC END 43 18 PREP 17 51 TET PREP 23 52 A TO WASTE 11 13 20 53 G TO W
206. ptions in detail Main Menu Option DNA 3 7 Main Menu Option Start 1 3 13 About the Ending 3 14 Main Menu Option Monitor Synthesis 3 16 Instrument Status Synthesizing 0 0 ee ec ee 3 17 The Holding Men mx pe mde ote s oa nt uite E we 3 19 The J mp Step Menu Bebe ed EE 3 22 The Interr pt Menu Deer DE eter eg 3 24 Main Menu Option Change Bottles 0 0 0 cece eh 3 29 About the Alarmi ee aes e esta 3 31 Bottle Usage Data yie 3 33 Main Menu Option Cycle e 3 34 The Base Specifier Field ARR CLP eU 3 37 Main Menu Option Manual Control 8 8 eA 3 40 Main Menu Option Fract Pulse cee eects 3 42 Main Menu Option Procedure Editor 3 42 Main Menu Option FXN Editor 3 44 Menu Option Power ee eee ene es 3 47 Menu Option Self ccc eects 3 48 Elow Test s onsec oppeto np ve ete i e ep gore Sat e RAE PP 3 50 Main Menu Option Set Clock 3 51 Main Menu Option Shut
207. purifying by OPC or trityl specific reverse phase HPLC keep the solution basic to prevent accidental detritylation To do this add one drop of distilled triethylamine every 10 minutes Also avoid heating the sample If the 5 DMT group has been left on it can be removed manually by treatment with 80 acetic acid water for 20 minutes at room temperature The acid is then diluted with ethanol and removed by vacuum followed by several rinses with ethanol This procedure is usually done after reverse phase HPLC or before radioactively labeling the 5 end prior to analysis by gel electrophoresis The deprotected detritylated DNA has a free 5 and 3 hydroxyl and is biologically active Desalting and purification may be necessary before use in experiments An overview of these procedures is described later in this section Details can be found in User Bulletin 13 Revised in the appendix of this manual Section 6 Chemistry for Automated DNA Synthesis 6 19 Applied Biosystems m p O O P OCH2CH2CN eet RS i 0 Ot DEPROTECTION O 0 B OCCH2CH2CNHCH5CH5CH2S1 CPO OH 7 NH3 Figure 6 9 Deprotection and cleavage of B cyanoethyl protected oligonucleotides Treatment with concentrated ammonium hydroxide removes the B cyanoethyl protecting groups and cleaves the oligonucleotides from the support The benzoyl and isobutyryl base protecting groups X are removed by heating at 55 in ammonia
208. qual volumes FUNCTION NAME VALVES NUMBER F 16 CAP PREP 22 Capping reagents prep preparation pressurizes the acetic anhydride and NMI reservoirs simultaneously F 28 PHOSPHORAMIDITE PREP 20 23 Phosphoramidite preparation pressurizes the tetrazole and all phosphoramidite reservoirs simultaneously Function 43 and Function 51 are used during the bottle change procedure after fresh tetrazole and acetonitrile are placed on the instrument They pressurize the reservoir and blanket it with argon F 43 18 PREP 17 F51 TET PREP 23 4 12 Section 4 Functions Cycles and Procedures Applied Biosystems Functions used to rinse or flush the chemical pathways Four functions are frequently used throughout the synthesis to clear the valve blocks the column and the interconnecting delivery lines They are performed prior to a chemical delivery to remove residual reagent from a previous delivery Two of the functions 18 to Column and 18 to Waste rinse the pathways with acetonitrile The other two Block Flush and Reverse Flush flush the path ways to remove all liquid A flush uses argon pressure to force the liquid to the waste bottle FUNCTION NAME VALVES NUMBER BLOCK FLUSH 0 13 14 16 Removes any solvent or reagent from the reagent valve blocks and the column valve block argon enters the three valve blocks simultaneously and forces all liquid to the waste bottle F2 REVERSE FLUSH 12 13 14 Removes a
209. quipment you should obtain before you receive the in strument The second part of the manual describes site preparation Careful attention to these re quirements will simplify the installation procedure and ensure that the instrument works correctly The site preparation section concludes with a Preinstallation Checklist The Model 391 391 EP is available with four voltage options It is important that the internal voltage setting for your instrument agree with your site voltage Please see Shipping List on page 10 for specific information If you purchased an Applied Biosystems installed instrument Please do not unpack the crate until your local Applied Biosystems service representative arrives to make the installation The Start Up Chemical Kit will be shipped separately and should be un packed upon arrival This kit contains sufficient chemicals and reagents to demonstrate that the in strument is operating correctly If additional DNA will be synthesized immediately following installation additional chemicals should be ordered If you purchased a user installed instrument U S only The User Installation Manual will be sent to you Please be aware that you will need to order re agents for the installation We recommend that you order the Start Up Chemical Kit P N 400971 which contains sufficient chemicals and reagents for demonstrating that the instrument operates correctly The kit contains additional items for post synthesis proc
210. r support bound nucleoside 2 4 Section 2 Operation Applied Biosystems How to Dissolve Phosphoramidites 1 To prepare the phosphoramidite bottle pull back the aluminum tab in the direction of the arrow Do not yet remove it simply expose the septum Place a needle any gauge without a syringe into the rubber septum This vents the pressure in the bottle when the anhydrous acetonitrile is added Venting also prevents accidental splashing when the phosphoramidite bottle is opened and placed on the instrument Unscrew the cap from the anhydrous acetonitrile bottle and quickly replace it with a clean rubber septum The acetonitrile is bottled under argon Since argon is heavier than air argon should still blanket the acetonitrile after the septum transfer Remove the syringe needle from the oven and allow it to cool to room temperature Pierce the septum of the acetonitrile bottle with the needle and remove the correct amount of acetonitrile Pierce the septum of the phosphoramidite bottle a few millimeters with the needle syringe and slowly add the acetonitrile Make sure the needle does not touch the phosphoramidite powder or solution When finished remove both the venting needle and the needle syringe and gently swirl the bottle to dissolve the phosphoramidites Once dissolved you can place them on the instrument Use the Change Bottles Menu and follow the prompts see Section 3 for details Also refer to How to Ins
211. re are any questions concerning the installation procedure or preparations please contact your local Applied Biosystems service representative Check if ready 1 Preinstallation manual read and understood Chemicals and Equipment 2 Correct plug voltage kit received 3 Start Up Chemical kit received 4 Additional reagents including concentrated ammonium hydroxide and acetonitrile 4 L ordered Fraction collector Spectrophotometer Accessories for reconstituting phoshoramidites Heating block Sample concentrator Toluenesulfonic acid zum owe o All material safety data sheets MSDS and waste profile material read and understood Site Preparation 12 Correct laboratory space 13 Constant laboratory temperature 14 Argon cylinder size 1A regulator and adapter 15 Correct ventilation 16 Waste disposal method established E 18 Appendix E Warranty 391 Pre Installation Manual Applied Biosystems Technical Support Contacting Technical Support You can contact Applied Biosystems for technical support by telephone or fax by e mail or through the Internet You can order Applied Biosystems user documents MSDSs certificates of analysis and other related documents 24 hours a day In addition you can download documents in PDF format from the Applied Biosystems Web site please see the section Obtain Documents o
212. roduction 1 9 Applied Biosystems User Attentions Four user attention words appear in the text of this manual Each one implies a certain level of ob servation or action as follows Note This word is used to call attention to information IMPORTANT This word is used when information is necessary for proper instrument operation Caution This word informs you that damage to the instrument could result if you do not comply with this information WARNING Physical injury to you or other people could result if these required precautions are not taken Material Safety Data Sheets MSDS WARNING Some chemicals used with this instrument are considered hazardous Hazards are prominently displayed on the labels of all hazardous chemicals In addition there are MSDS which provide information about physical characteristics hazards precautions first aid spill cleanup and disposal procedures The MSDS appear in the User s Safety Information Section in the front of this manual Please be sure to familiarize yourself with the information in these documents before attempting to operate the instrument or use the reagents Additional copies of the MSDS are available from Applied Biosystems at no extra cost 1 10 Section 1 Introduction Applied Biosystems Text Conventions Menu displays and keys appear in this manual as follows 1 Menus are boxed and appear centered on the page DNA start change cycle
213. rofile in Appendices A and B of this preinstallation manual Always follow the safety precautions eye protection clothing etc presented in the MSDS Dispose of waste in accord with all local state and federal health and environmental regulations and laws Spectrophotometer To measure absorbance of the diluted trityl solutions you will need a visible spectrophotometer capable of reading at a wavelength of 530 nm Also required are 1 cm cuvettes and a 0 1 M toluene sulfonic acid acetonitrile solution for dilution Accessories for Reconstituting Phosphoramidites 1 Glass syringes 2 5 or 10 mL kept in an oven at 100 110 212 230 F These are used to dispense anhydrous acetonitrile into the phosphoramidite bottles Appendix E Warranty 391 Pre Installation Manual E 11 Applied Biosystems Syringe needles 20 gage that fit the glass syringes and are 5 10 cm 2 4 in long Aldrich P N Z11 711 0 Rubber septa are used to seal the 30 mL bottles of anhydrous acetonitrile Aldrich P N Z10 074 9 Heating Bath or Block The laboratory must have access to a heating bath or block to complete the manual base deprotection of the synthetic oligonucleotides The temperature of this bath or block is typically set at 55 60 131 140 F Sample Concentrator The ammonium hydroxide deprotection solution is evaporated before they DNA is used or purified Any device capable of removing an aqueous solution is acceptable
214. roliters per odu of crude RNA oligo of 1 molar tetrabutylammonium flu oride THF for 6 hours An equivalent volume of 0 1M TEAA is added mixed and evaporated to near dryness 1 ml of 0 1 M TEAA is again added mixed and applied to an OPC cartridge following the desalting protocol 1 pre wash the cartridge with 5 ml acetonitrile then 5 ml TEAA 2 load the RNA oligo recycling it through the cartridge twice at 1 2 drops second 3 wash the OPC cartridge with 5 ml 0 1M TEAA then 10 ml water 4 elute the desalted oligo up to 50 with 1 m1 50 acetonitrile This OPC procedure replaces a long and troublesome Sephadex column to remove the tetrabuty lammonium salts which complicate further analysis and purification The RNA oligo is then ready for PAGE or HPLC purification analysis RNase degradation is not a significant problem except when handling less than 0 1 odu Note RNA synthesis monomers are available from Peninsula Laboratories 611 Taylor Way Belmont CA 94002 USA Telephone 1 650 592 5392 FAX 650 595 4071 PEN LABS BLMT BA 5 C U DMTO B OSi CH3 otBu iProN P 2 2 Figure 6 10 RNA phosphoramidites Hydrogen Phosphonate Chemistry The hydrogen phosphonate chemistry is useful and effective for preparing either normal phos phodiester oligonucleotides or phosphate analog oligonucleotides User Bulletin No 44 provides full details on using the synthesis reagents and the post synt
215. rom positions 15 14 12 and 11 and should drip steadily from positions 1 through 5 and 9 If the flows are not as described retest each faulty position by using the JUMP key Refer to Section 3 Main Menu Op tion Monitor Synthesis for details on how to use JUMP At step 14 the procedure is interrupted and the screen reads Step 14 INTERRUPT 1 of 1 sec resume jump abort more main Part 2 This pause is used to prepare for steps 15 through 43 part two of the procedure During this part the flow rate from each reservoir is measured for 2 minutes at the lower column Luer fitting Before beginning attach a clean bottle filled with HPLC grade acetonitrile to each bottle position A set of clean empty bottles is shipped with the instrument Next remove the column if necessary and place a 10 mL graduated cylinder under the lower column Luer fitting When ready press RE SUME and the procedure will continue At step 17 acetonitrile will flow from Reservoir 1 A phosphoramidite to the lower Luer for ex actly 2 minutes Carefully collect the flow A 20 second WAIT step immediately follows Use this time to read and record the measurement In addition empty the cylinder and replace it under the lower Luer for the next reading If 20 seconds is too short simply press HOLD during the WAIT step Then when you are ready to continue select RESUME Repeat this procedure until all mea Section 2 Operation 2 27 Applied Biosystems s
216. rophoresis or ion exchange HPLC The trityl groups are usu ally left intact when purifying by OPC or trityl specific reverse phase HPLC The ending method trityl on or trityl off is generally chosen before beginning a synthesis Manual Deprotection and Cleavage When the synthesis is finished the product and capped failure sequences still attached to the sup port exist as phosphate protected base protected phosphotriesters Complete deprotection is nec essary to produce biologically active DNA In addition the oligonucleotides must be cleaved from the support These steps are performed manually after removing the column from the instrument For complete instructions refer to the Manual Deprotection and Cleavage in Section 2 Cleavage Following synthesis the DNA remains covalently attached to the support The diester oligonucle otides are then cleaved from the support by a one hour treatment with fresh concentrated ammoni um hydroxide The double syringe method is a convenient technique for cleavage As seen in Figure 6 9 the cleavage occurs at the base labile ester linkage between the linker of the support and the 3 hydroxyl of the initial nucleoside The cleaved DNA has a free 3 hydroxyl The DNA now in solution is collected in a vial fitted with a Teflon lined cap The vial contains the crude mix product and failure sequences of base protected oligonucleotides in ammonium hydrox ide Then the protecting groups on the exo
217. rs 29 861 864 1988 27 Froehler B C Tetrahedron Letters 27 5575 5578 1986 28 Andrus A and Zon G Nucleic Acids Research Symposium Series No 20 121 122 1988 Applied Biosystems User Bulletin No 44 Oligonucleotide Synthesis with Hydrogen Phosphonate Monomers 29 Matsukura M Shinozuka K Zon G Mitsuya H Reitz M Cohen J S and Broder S Proc Natl Acad Sci USA 84 7706 7710 1987 Stein C A Subsinghe C Shinozuka K and Cohen J S Nucleic Acids Research 16 3209 3221 1988 30 Smith L M et al Nature 321 674 679 1986 Section 6 Chemistry for Automated DNA Synthesis 6 31 Applied Biosystems 31 Chu B C F and Orgel L E DNA 4 327 331 1985 Chollet A and Kawashima E H Nucleic Acids Research 15 1529 1541 1985 Agrawal S Christodoulou C and Gait M J Nucleic Acids Research 14 6227 6245 1986 32 14 P Medon P P Skingle D C Lanser J A and Symons R H Nucleic Acids Research 15 5275 5287 1987 Chu and Orgel LE Nucleic Acids Research 16 3671 3691 1988 Zuckermann R N Corey D R and Schultz P G 1614 1615 1988 Zuckermann and Schultz P G J Am Chem Soc 110 6592 6594 1988 33 Ghosh S S and Musso Nucleic Acids Research 15 5353 5372 1987 34 Applied Biosystems User Bulletin No 49 Aminolink 2 6 32 Section 6 Chemistry for Automated DNA Synthesis Appendix A Functions Cycl
218. rts for the Instrument that are listed in the Instrument Operator s Manual AB s obligation under this warranty is limited to repairs or replacements that AB deems necessary to correct covered defects or failures of which AB is notified prior to expiration of the Warranty Period repairs and replacements under this Warranty shall be performed by AB onsite at the Customer s location at AB s expense No agent employee or representative of AB has any authority to bind AB to any affirmation rep resentation or warranty concerning the Instrument that is not contained in the printed product liter ature or this Warranty Statement Any such affirmation representation or warranty made by any agent employee or representative of AB shall not be binding on AB AB shall not be liable for any incidental special or consequential loss damage or expense directly or indirectly arising from the use of the Instrument AB makes no warranty whatsoever in regard to products or parts furnished by third parties such products or parts will be subject to the warranties if any of their respective manufacturers This Warranty is limited to the original Customer and is not transferable THIS WARRANTY IS THE SOLE AND EXCLUSIVE WARRANTY AS TO THE INSTRU MENT AND IS EXPRESSLY IN LIEU OF ANY OTHER EXPRESS OR IMPLIED WARRAN TIES INCLUDING WITHOUT LIMITATION ANY IMPLIED WARRANTY OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE AND OF ANY OTHER OBLIGAT
219. s Instead follow the protocol below 1 Using MANUAL CONTROL activate the appropriate functions F62 to F66 for 10 seconds then deactivate them Argon to Reservoirs F 62 Flush to A F 63 Flush to G F 64 Flush to C F 65 Flush to T F 66 Flush to X 2 Remove the bottles without using the change bottles procedure and quickly cap with previously unused rubber septa Aldrich catalog number Z10 074 9 3 Rinse the delivery lines with acetonitrile by activating the appropriate functions F71 to F75 for 10 seconds Flush the lines with argon by activating the appropriate functions F62 to F66 for 10 seconds Acetonitrile to Reservoirs F71 18 72 18toG F73 18toG 74 18toT F75 18toX Argon to Reservoirs F62 Flush to A F63 Flush to G F64 Flush to C F65 Flush to T F66 Flush to X 4 Sealthe bottles with Paraffin film place in a desiccator containing Drierite and put in a freezer at 20 5 When ready to synthesize thaw the phosphoramidites remove them from the desiccator and place them on the instrument using the Change Bottles Menu Be sure to enter an appropriate alarm setting 2 6 Section 2 Operation Applied Biosystems How to Install Reagent Bottles A reagent bottle can be changed before beginning a synthesis or when an active synthesis has been stopped by setting an interrupt or by the alarm When removing and replacing bottles always select CHANGE BOTTLES from page 1
220. s They are stored permanently in the ROM cycle locations of the Cycle Editor They cannot be changed or deleted The cycles are used for synthesizing on the ten micromole one micromole and small scales 0 2 micromole and are named 10uM 1u M and 2 respec tively A low reagent consumption cycle on the 0 2uM scale has also been developed which uses 33 less phosphoramidites This cycle is called Low When the instrument s main power is first turned on all ROM cycles 2u M Iu M Low 10uM are automatically loaded into the four RAM cycle locations of the Cycle Editor See Table 4 1 for the exact locations Once in a RAM location any cycle can be edited and all changes will be stored in memory even if the power is turned off In the Start Synthesis Menu you must choose a RAM cycle 4 18 Section 4 Functions Cycles and Procedures Applied Biosystems for use in DNA synthesis the ROM cycles do not appear as options Note that at any time you can copy a ROM cycle into a RAM cycle location by using the Cycle Editor You can also create en tirely new cycles in any RAM location ROM RAM Total crude synthesis cycle Number yield O D cycle location of steps 20mer 2uM Cycle 1 63 5 5 20 25 luM Cycle 2 64 5 5 100 120 Low Cycle 3 61 5 5 20 25 10uM Cycle 4 53 25 800 1000 Yield figures based on a 20mer sequence Absorbance measured at 260nm Assuming 33 micrograms O D unit Low is a low consumption cy
221. scribed below Section 4 Functions Cycles and Procedures contains information about valves functions synthe sis cycles and procedures e g the bottle change procedure Pages 4 5 and 4 6 describe functions and show an example of how to use the DNA Synthesizer Schematic Pages 4 18 and 4 19 describe the synthesis cycles Section 5 System Description Hardware describes the components of the synthesizer and ex plains the chemical delivery system Section 6 Chemistry for Automated DNA Synthesis explains the DNA synthesis chemistry In ad dition it contains an overview of oligonucleotide analysis and purification procedures a description of alternative chemistries and 5 attachments and information about quantifying and storing oligo nucleotides 1 2 Section 1 Introduction Applied Biosystems General Introduction The Applied Biosystems Model 391 DNA Synthesizer automatically performs all steps for DNA synthesis to produce the highest quality oligonucleotides possible When used as a system includ ing AB reagents and columns the PCR MATE EP delivers high reliability ease of operation and efficient use of your time The Model 391 uses the phosphoramidite method of oligonucleotide synthesis because of its inher ently high coupling efficiency and the stability of the starting materials The synthesis begins with the 3 terminal nucleoside attached to a solid support which is contained within a column the reac tion cham
222. sential chemical reactions necessary for synthesis are listed below with their correspond ing cycle step numbers 2uM 1 Detritylation Steps 36 63 2 Coupling Steps 1 15 3 Capping Steps 16 21 4 Oxidation Steps 22 35 Although each reaction requires different treatment the following generalizations can be made Prior to the chemical reaction The valve blocks the column and the interconnecting delivery lines are rinsed and flushed dry and The reagent reservoir s is prepared for delivery To perform the chemical reaction The reagent s is delivered to the column often followed by a Wait step to complete the reaction 4 20 Section 4 Functions Cycles and Procedures Applied Biosystems Figure 4 5 21 B cyanoethyl synthesis cycle STEP FUNCTION STEP ACTIVE FOR BASES NUMBER T X 1 10 18 TO WASTE Yes Yes Yes Yes Yes 2 9 18 TO COLM 5 Yes Yes Yes Yes Yes 3 2 REVERSE FLUSH Yes Yes Yes Yes Yes 4 1 BLOCK FLUSH Yes Yes Yes Yes Yes 5 28 PHOS PREP Yes Yes Yes Yes Yes 6 90 TET TO COLUMN Yes Yes Yes Yes Yes 7 19 B TET TO COLM Yes Yes Yes Yes Yes 8 90 TET TO COLUMN Yes Yes Yes Yes Yes 9 19 B TET TO COLM Yes Yes Yes Yes Yes 10 90 TET TO COLUMN Yes Yes Yes Yes Yes 11 19 B TET TO COLM Yes Yes Yes Yes Yes 12 90 TET TO COLUMN Yes Yes Yes Yes Yes 13 4 WAIT 5 Yes Yes Yes Yes Yes 14 16 CAP PREP Yes Yes Yes Yes Yes 15 2 REVERSE FLUSH Yes Yes Yes Yes Yes 16 1 BLOCK FLUSH Yes Yes Yes Yes Yes
223. sequence is correct If possible print and verify it When finished return to the Main Menu by selecting MENU and then MAIN Note that any combination of phosphoramidites can be inserted in any position except the 3 termi nus for synthesizing mixed sequence probes This is done by pressing the left open parenthesis typing the desired base keys and pressing the right close parenthesis Multiple bases are added to the support bound nucleoside by simultaneous delivery of the specified phosphoramidites 3 From the Main Menu select START SYNTH Make DNA 1 12 Cycle 1 63 Trityl OFF begin nxt DNA nxt cyc ON OFF main Configure the synthesis a Press NXT DNA until the correct DNA strand to be synthesized is showing The most recently edited strand will automatically appear The above example shows DNA 1 which is a 12 base sequence b Press NXT CYC until the desired synthesis cycle is shown When the main power is first turned on all Applied Biosystems ROM cycles are automatically loaded into the correct RAM cycle location as shown below For example to synthesize using the 2uM cycle Section 2 Operation 2 9 Applied Biosystems Cycle 1 63 should be displayed You can create your own cycles by editing a RAM cycle Once you change a RAM cycle the edited version will appear in the Start Synthesis Menu You can however copy a ROM cycle back into a RAM cycle location at any time Refer to Section 3 Main Menu
224. servoirs Pressure valves are further discussed in Section 4 Valves and are shown in Figure 4 1 In addition the regulator supplies argon to the column valve block and the reagent valve blocks The phosphoramidites have one pressure valve which supplies argon to a manifold pressurizing all five phosphoramidite bottles simultaneously For proper pressurization bottles must be attached to all five positions even if some are empty The two capping reagents 1 methylimidazole NMI and acetic anhydride share a pressure valve which channels the argon to a tee to pressurize both bottles All other reagent reservoirs tetrazole trichloroacetic acid iodine and acetonitrile are pressurized using a single valve for each bottle The regulator is adjusted so that acetonitrile from bottle 18 has a flow rate of 2 80 to 3 20 mL min measured at the lower Luer fitting of the column The pressure gauge should read approximately 4 0 psi For details on how to adjust flow rates refer to Section 2 How to Perform the Flow Test Procedure Reagent and Solvent Reservoirs Each reservoir has a unique position on the instrument and is referred to by the number located above each receptacle Position numbers are also printed on the bottle labels The position or reser voir numbers are 1 5 9 11 12 14 15 and 18 These numbers correspond to those on other Applied Biosystems DNA synthesizers which have 18 positions Reservoirs 1 5 are pushed upward around a Tefl
225. sis the START SYNTH synthesis key is displayed on Page 1 of the Main Menu Upon selection the screen shows the Configure Synthesis Menu Use it to choose the DNA strand to be made and the synthesis cycle and ending method to be performed Make DNA 1 12 Cycle 1 63 Trityl OFF begin nxt DNA nxt cyc ON OFF main The above example shows DNA 1 which has a 12 base sequence DNA 1 12 Cycle 1 which has 63 steps Cycle 1 63 and the ending method which is trityl off Note that the most recently edited DNA strand and cycle are automatically displayed If the menu shows the correct information synthesis can begin Any incorrect information must be changed using the following keys NXT DNA Specifies the subsequent DNA strand Continue to press this key until the cor rect DNA strand is displayed NXT CYC Specifies the subsequent synthesis cycle Continue to press this key until the correct cycle is displayed Note When the main power is first turned on the Applied Biosystems ROM cycles are automatically loaded into the correct RAM cycle locations as shown on the next page For example to synthesize using the 2uM cycle simply display Cycle 1 63 You can create your own cycles by editing a RAM cycle Once you change a cycle the edited version will appear in the Start Synthesis Menu Refer to The Cycle Editor Menu for instructions ROM cycle name RAM Cyclelocation Number of steps 2uM Cycle 1 63 luM Cycle 2 64 Low Cyc
226. sphate triester This is shown in Figure 6 8 Oxidation follows capping to eliminate the possibility of traces of water from the oxidizing solution causing acetic anhydride to form acetic acid during capping This would expose the oligonucle 6 16 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems otides to acid as well as make capping less effective Also scientists at Applied Biosystems have elucidated the complex chemical pathway whereby a small side reaction the phosphitylation of the 0 6 position of guanosine can be minimized when capping immediately follows coupling 15 The enzymatic digestion base composition assay on oligonucleotides made with different cycle order capping then oxidation and oxidation then capping shows markedly different results The Applied Biosystems standard capping then oxidation gives far less usually undetectable amounts of base modified nucleosides Cycles with oxidation then capping give high levels of the mutagenic modi fied nucleoside 2 6 diaminopurine Iodine is used as a mild oxidant in a basic tetrahydrofuran THF solution with water as the oxygen donor When the iodine water pyridine THF mixture bottle 15 is delivered to the column an io dine pyridine complex forms an adduct with the trivalent phosphorous This adduct is decomposed by water with production of a pentavalent phosphotriester internucleotide group This is an ex tremely fast reaction being quantitative in 3
227. sssesseeeeeeeeennenen nennen nennen nennen nnne 3 44 teorie 3 45 The Print Key eite Ec n e Ee dii RU UR Ed de 3 46 Main Menu Option Power nennen nnne nnne nnns 3 47 Main Menu Option Self ener enne 3 48 Main Menu Option Set nnne nennen nennen 3 51 Main Menu Option Shut Down 4 nnns en rennen nnne nnns 3 52 Section 4 Functions Cycles and Procedures Introduction ta ete tee 4 2 uini reet et desit eite sss eis vM 4 2 FUNCIONS itae ere casks ac 4 5 Synthesis Cycle Functions 4 10 Proce dure Functlons eo tic RE 4 15 Test Functions ertet Ee cures me e oed dd 4 18 Synthesis Cycles ede dme E eet Pda a Pepe rente 4 18 More About the 2UM 1 enne enne nennen nnns nnns 4 20 tee Ef 4 23 The Phosphoramidite Purge 4 23 The Bottle Change Procedure seen 4 24 The Shut Down Procedure 4 27 The Flow Test Procedure 2 iSi a dot dues 4 28 iii Applied Biosystems Section 5 System Description Hardware
228. stems Photo Number Part Number Description Power Cords 254184 120 V 50 60 Hz 254185 220 V 50 Hz 254187 240 V 50 Hz 254186 240 V 60 Hz 254239 100 V 50 60 Hz 18 600509T Valve control PCB assembly analog 19 600811 Controller PCB assembly digital behind panel 19a 601087 Cable assembly 20 pin to analog PCB 19b 601864 Cable assembly 40 pin to keyboard 19c 295014 Relays 19d 100170 Battery 19e 100167 5 supply 20 600501 Delivery valve assembly 8 port 2 21 600500 Delivery valve assembly 4 port 22 601862 Pressure vent valve assembly 23 600344 Solenoid valve assembly Angar 7 24 601927 Base tetrazole delivery line 6 25 601947 Capping reagent delivery line 5 26 295007 Fuse 0 75 A all voltage options 27 295018 Fuse 10 A slow blow 1 4 in x 1 1 4 in 100 V and 120 V two fuses for part No 600507T power supply two fuses for part No 601960T power supply Fuse 5A slow blow 100 V and 120 V two fuses for 295074 part No 602590T power supply Fuse 5A slow blow 25 mm 220 V and 240 V two 200213 fuses for part No 600507T power supply two fuses for part No 601960T power supply 295078 Fuse 3A slow blow 220 V and 240 V two fuses for part No 602590T power supply 28 601854 PCR MATE memory module version 1 00 601929 PCR MATE EP memory module ver 1 00 29 100176 Fan 3 15 in x 3 15 in x 1 5 in 200215 Fan filter 80 mm 30 003020 Manifold 8 port teflon 110019 Plug 1 4
229. t ERR RR eee E 15 Cooling Requirements is an 0 0 0 cee cece cette enna E 16 ATS ONL 22 os eie eet eate ae eus is ni danse ts ded eae E 16 Ventilation 3 ob uie i E 16 Liquid Waste 1 llle E 17 Operator Training at Installation E 17 Proof of Performance 2 2 17 Pintet Ree eo at e bee 17 Preinstallation eee 18 Technical Support Bee os 19 Contacting Technical Support 8 E 19 To Contact Technical Support by E Mail E 19 Hours for Telephone Technical Support E 19 To Contact Technical Support by Telephone or E 20 To Reach Technical Support Through the Internet E 22 To Obtain Documents on E 23 AB LIMITED WARRANTY e E 24 Applied Biosystems Safety First Safety is everyone s concern Your laboratory has specific safety practices and policies designed to protect laboratory personnel from the potential hazards both obvious and hidden that are present The AB service engineer assigned to your laboratory has been trained to safely i
230. t action for function s edit print Follow the prompt and select an action EDIT Choose to create and modify user functions PRINT Prints the complete list of standard user and test functions when a printer is connected to the instrument The Edit Key When you press EDIT the screen displays the first user function which is F 92 User A off all off menu NEXT Shows the subsequent user function ON Enters a specified valve in the function For instructions refer to the example below Note The on key enters the valve number but does not activate the valve OFF Deletes a valve number from the function ALL OFF Deletes all valves listed for the function Example To create a function which would open valves 1 13 and 17 first press the gray key labeled 1 The screen will then display the valve number in both the on and off keys Section 3 Software Menu Descriptions 3 45 Applied Biosystems 1_ on 1 off all off Next press the 1_ on key and the specified valve number will be entered and shown on the top line of the display 92 User A 1 Continue to enter all the valves to be activated by this function up to a maximum of 10 valves To delete a valve from the function type the valve number e g 1 and press 1 off To clear all valves simultaneously simply select the ALL OFF key The Print Key Upon selecting PRINT the screen will display Select
231. t be removed In addition the DNA must be hydrolyzed or cleaved from the solid support There are three types of protecting groups 1 5 protecting group dimethoxytrityl DMT 2 B cyanoethyl phosphate protecting groups 3 base protecting groups benzoyl on dA and dC and isobutyryl on dG The 5 protecting group dimethoxytrityl is attached to each nucleoside phosphoramidite and is cleaved from the growing oligonucleotide chain during each cycle of base addition You can pro gram the 391 to remove the ast DMT to yield a 5 hydroxyl by choosing the ending method Trityl off or leave the DMT on by choosing the ending method Trityl on When purifying by polyacryla Section 2 Operation 2 13 Applied Biosystems mide gel electrophoresis PAGE or ion exchange HPLC the last DMT group should be removed When purifying by trityl specific OPC or reverse phase HPLC the last DMT group should be left on After the synthesis is complete either Trityl on or Trityl off remove the column from the instru ment The oligonucleotides are then simultaneously decyanoethylated and cleaved from the support using concentrated ammonium hydroxide Next the base protecting groups are removed by the ad dition of fresh concentrated ammonia and incubation at 55 Materials and Methods The recommended method for manual deprotection and cleavage was developed by Tanaka and Letzinger and later adapted for use with Applied Biosystems synthesis co
232. tall Reagent Bottles for instructions on attaching the bottles to the instrument The anhydrous acetonitrile bottle must now be blanketed with argon To do so place a needle on the upper male Luer fitting on the front of the synthesizer remove the column if necessary Select MANUAL CONTROL from the Main Menu and activate function 2 a reverse flush Argon will then flow out of the needle Next push the acetonitrile bottle onto the needle so that the needle pierces the bottle s septum Hold it for 5 seconds and then remove the bottle and the needle simultaneously The pressure will immediately be released through the needle but the bottle will remain blanketed with argon Remove the needle from the bottle and continue dissolving additional phosphoramidites as necessary Once in solution phosphoramidites are stable for about two weeks After this time coupling effi ciencies may slowly begin to decrease If phosphoramidites cannot be used within this time it is possible to freeze store thaw and reuse them Although the stored phosphoramidites may show some slight loss of activity they should be adequate for synthesizing sequences of approximately 20 bases Section 2 Operation 2 5 Applied Biosystems How to Store Dissolved Phosphoramidites If you cannot use the phosphoramidites within about two weeks you can remove them from the in strument store them and reuse them later Do not use the Change Bottles Procedure for thi
233. te purge procedure Prior to synthe sis these functions fill the phosphoramidite and tetrazole lines with fresh reagent In addition Func tions 61 81 and 82 are used during the synthesis cycle to fill the reagent valve block prior to column delivery The following functions deliver the contents of the designated reservoir to the waste bottle For ex ample Function 52 A to waste delivers adenosine phosphoramidite to the waste bottle Section 4 Functions Cycles and Procedures 4 15 Applied Biosystems FUNCTION NAME VALVES NUMBER F 52 A TO WASTE 11 13 20 F 53 G TO WASTE 10 13 20 F54 C TO WASTE 9 13 20 F 55 T TO WASTE 8 13 20 F 56 X TO WASTE 7 13 20 F 59 CAP A TO WASTE 5 13 22 acetic anhydride to waste F 60 CAP B TO WASTE 4 13 22 NMI to waste F 61 TET TO WASTE 6 13 23 81 15 TO WASTE 2 13 18 F 82 14 TO WASTE 3 13 19 Functions which deliver acetonitrile to a reservoir Before removing an empty phosphoramidite or tetrazole bottle the old reagent in the delivery line is forced back into the reservoir and the line is rinsed This is done during the bottle change proce dure by delivering acetonitrile through the reagent valve block to the empty reservoir In addition functions delivering acetonitrile to bottle positions 11 12 14 and 15 are used during the shut down and flow test procedures to remove the reagents from the delivery lines The following functions deliver acetonitrile to the
234. ted Parts List Applied Biosystems Photo Number Part Number Description 1 601379 Power switch assembly 200023 Rocker switch on off 2 000951 Drip tray 3 602279 Keyboard display assembly Model 391 4 000592 Luer connector male 1 4 28 F 5 601440 Lower luer line 1 16 in o d x 0 5 mm i d x 5 in 6 200019 Luer connector 2 in tube 7 630008 Bottle 10 mL 7b 630003 Bottle 8 oz 200 mL 400790 Bottle seals 200 mL box of 10 Ic 630004 Bottle 16 oz 450 mL 400501 Bottle seals 450 mL 8 110026 Bulkhead union 1 4 T 1 4 T argon inlet 9 600513 Particle filter assembly 10 600574 24 V pressure valve assembly 11 600309 Mini vacuum pump assembly 12 600511 24 V vacuum valve assembly 13 600792 Vacuum assist cable assembly 14 600497 Vacuum ballast assembly 14a 200325 Vacuum switch 14b 160003 Vacuum gage 30 in of mercury 15 601861 Regulator gage assembly 15a 160010 Gage 0 15 psi 15b 160005 Pressure regulator 0 15 psi 16 000198 Vent manifold fitting 3 000276 Vent manifold sleeve 000928 Waste manifold 3 port 110003 Elbow 1 8 MP 1 4T teflon 17 600507 old Model 381A power supply shown Voltage Select Modules 17a 600284 100 V module 600286 120 V module 600288 220 V module 600289 240 V module 17 601960 not shown Model 391 power supply 600284 100 V module 600286 120 V module 600288 220 V module 600289 240 V module 17 602590 not shown Model 391 power supply Appendix D 391 Illustrated Parts List Applied Biosy
235. tems 5 gt _ lt 3 select 5 gt _ lt 3 press C T 5 gt AA AGCT_ 3 select S gt AA AGCT _ lt 3 continue entering the sequence Multiple bases are added to the support bound nucleotide by simultaneous delivery of the specified phosphoramidites They can be placed in any position except the 3 terminus SPACE Inserts a space to the left of the cursor position For example to insert a space following C in the sequence 5 3 5 gt AGC_ 3 press space 5 gt _ lt 3 To insert a space between C and T in the sequence 5 AGCTAG 3 5 gt AGCTAG lt 3 press space 5 gt TAG lt 3 Spaces inserted every three bases allow the sequence to be entered as triplet codons Also placing spaces at specified intervals simplifies verification of the sequence This is for convenience only and has no effect on the synthesis ERASE Select to delete all entries from the DNA strand being edited Upon selecting ERASE the following display appears 1 To erase DNA strand press yes no yes YES Deletes the DNA strand designated in the menu and returns to the previous menu Returns to the previous menu without deleting the sequence Section 3 Software Menu Descriptions 3 9 Applied Biosystems How to Insert a Base Insertions are made at or to the left of the cursor For example to insert T in the third position in the sequence 5 AAA 3 S gt AAA lt 3 select T 5 gt AATA lt
236. the original step NEXT and PREV can also be used to view subsequent and preceding steps To change the function move the cursor under the existing function number and type the desired number over it The function description corresponding to the new number will automatically be displayed Similarly to change the step time move the cursor to the existing time and type a new one over it Time is displayed in seconds with a maximum entry of 999 seconds The function number and time can also be erased by placing the cursor under the existing number and pressing the gray delete key on the fixed keyboard The Base Specifier Field When a base is listed in the base specifier field located in the top right corner of the display the step will be active when synthesizing that base Since most syntheses are performed so that all steps are active for all bases every base AGCTX is automatically listed for each step and therefore needs no adjustment However to execute a step for only certain bases the unwanted bases must be deleted from the base specifies field To indicate that a step should not be performed for a par ticular base first move the cursor to the unwanted base e g X When the cursor is under a base two new menu options YES and NO appear C1 1 Fxn 10 18 TO WASTE gt next prev insert yes no Erases the specified base and the step will not occur when synthesizing that base YES If a base has already been erased
237. thesizers 1 800 899 5858 then press 15 1 508 383 7855 PNA Custom and Synthesis 1 800 899 5858 then press 15 1 508 383 7855 1 6 Section 1 Introduction Applied Biosystems Product or Product Area Telephone Dial Fax Dial FMAT 8100 HTS System and Cytofluor 4000 Fluorescence Plate Reader 1 800 899 5858 then press 16 1 508 383 7855 Chemiluminescence Tropix 1 800 542 2369 U S only or 1 781 271 0045 1 781 275 8581 Applied Biosystems MDS Sciex 1 800 952 4716 1 650 638 6223 Outside North America Region Telephone Dial Fax Dial Africa and the Middle East Africa English Speaking and West Asia Fairlands South Africa 27 11 478 0411 27 11 478 0349 South Africa Johannesburg 27 11 478 0411 27 11 478 0349 Middle Eastern Countries and North Africa Monza Italia 39 0 39 8389 481 39 0 39 8389 493 Eastern Asia China Oceania Australia Scoresby Victoria 61 3 9730 8600 61 3 9730 8799 China Beijing 86 10 64106608 86 10 64106617 Hong Kong 852 2756 6928 852 2756 6968 Korea Seoul 82 2 593 6470 6471 82 2 593 6472 Malaysia Petaling Jaya 60 3 758 8268 60 3 754 9043 Singapore 65 896 2168 65 896 2147 Taiwan Taipei Hsien 886 2 22358 2838 886 2 2358 2839 Thailand Bangkok 66 2 719 6405 66 2 319 9788 Europe Austria Wien
238. tion Note that the MORE key does not operate from this menu While performing the flow test you can access the Main Menu by pressing MAIN To view the flow test procedure again select MONITOR SYNTH from the Main Menu Steps 1 through 14 sequentially rinse and prime the lines for each bottle position Use a beaker to collect the acetonitrile rinse starting with position 15 and working backwards At step 14 the pro cedure is interrupted and the screen reads Step 14 INTERRUPT 1 of 1 sec resume jump abort more main The RESUME JUMP and ABORT keys operate as they do in Monitor Synthesis This pause is used to prepare for steps 15 through 43 Atthis time place bottles filled with acetonitrile on all positions When ready press RESUME to continue the procedure Carefully measure the flow from each bot tle beginning with position 1 Adenosine phosphoramidite After the final measurement the procedure is interrupted at step 43 Use this pause to prepare to measure the flow from bottle 14 through the trityl collection line When ready press RESUME and collect the flow At step 46 the procedure is interrupted again The last series of steps flushes the delivery lines with argon When ready press RESUME Once completed chemicals can be reattached using the Change Bottles Menu and synthesis can begin Main Menu Option Set Clock Use the Set Clock Menu to enter the current time and date The time is used to record when a power failure
239. tion of most chemical deliveries is the waste bottle The bottle is a free stand ing four liter polyethylene container which should be placed on the floor near the synthesizer or on a nearby bench ower than the instrument The bottle can be kept inside a protective bottle carrier to contain accidental spillage A one gallon carrier is sufficient and can be purchased from VWR Part Number 56609 186 or Nalge Part Number 6501 0010 Section 5 System Description Hardware 5 11 Applied Biosystems WARNING Synthesizer waste must be handled and disposed of properly and carefully Depending on the synthesis cycle used the instrument generates 1 to 2 liters of hazardous halogenated organic liquid waste per 100 cycles of operation When handling the waste for disposal wear gloves a lab coat and eye protection and avoid inhalation and skin contact Place the liquid in a sealed container labeled FLAMMABLE POISON B N O S or absorb in vermiculite dry sand or earth Dispose of properly according to the appropriate local government regulations A waste line and vent line enter the cap of the waste bottle Be sure this cap is always securely tight ened The waste line carries liquid waste from the synthesizer to the bottle Be sure the line slopes downward toward the bottle and has no troughs that can collect waste and block the line The vent line carries gaseous waste to a suitable exhaust such as a fume hood Applied Biosystems
240. tles 400790 2 Open the full bottle Place a new polyethylene insert inside the bottle neck Screw the bottle snugly into its threaded cap on the instrument by turning it counterclockwise Note Receptacles 9 15 have a ratchet cap assembly When attaching these bottles you cannot overtighten them How to Install Bottle 18 Reservoir 18 acetonitrile is a 4 Liter bottle that is placed on the left side of the instrument inside a protective carrier and metal rack To replace the bottle slowly unscrew the cap assembly to re lease pressure Remove it and then screw it on a fresh acetonitrile bottle IMPORTANT Use HPLC or UV grade acetonitrile with a specification of less than 300 ppm of water Water contamination of even 1000 ppm will lead to a 1 to 2 6 decrease in coupling efficiency 2 8 Section 2 Operation Applied Biosystems How to Begin a Synthesis After completing the pre synthesis check list perform the following steps to begin a synthesis As questions arise refer to Section 3 Software Menu Descriptions for further instructions and expla nations 1 View Page 1 of the Main Menu DNA start change cycle editor synth bottles editor 2 From the Main Menu select DNA EDITOR Select action for DNA 1 edit copy print next Press NEXT until the desired DNA strand is in view then press EDIT Enter the sequence 5 to 3 using the A G C T and X keys Be sure the
241. to 3 the DNA chain is synthesized 3 to 5 In all menus selected from Monitor Synthesis the 3 terminus is shown as base number 1 and subsequent bases are numbered 3 to 5 Summary of Synthesizing Status Menu Options HOLD When you press HOLD the current step will be executed indefinitely See The Holding Menu for details and then continue with the synthesis See The Jump Step Menu for details JUMP Allows you to perform an out of sequence step before or after the current step INTRPT Allows you to stop a synthesis immediately and then continue it program a fu ture interrupt or abort a run See The Interrupt Menu for details Section 3 Software Menu Descriptions 3 17 Applied Biosystems MORE Displays additional information about the synthesis See below Synthesizing Status Menu options in detail The MORE key Selecting MORE from page 1 of the Synthesizing Status Menu displays Page 2 It shows additional information about the synthesis including which step and function are being performed and the to tal time of duration and time remaining for that step For example during step 1 shown below ac etonitrile bottle 18 is delivered to waste for a total of 5 seconds with 3 seconds remaining until completion 18 TO WASTE 3 OF 5 SEC jump intrpt more main Selecting MORE again displays Page 3 which shows the base currently being coupled as denoted by the blinking box and which bases will be subsequently ad
242. tor menu Moting ON OFF 1 5 gt AAA GEN SYNTHE SITENG Step 1 3 18 TOWASTE STATUS MENU SYNTHESIZING base 2 of 12 boses hold Dintrpt TO HOLDING TO INTERRUPT MENU MENU Enter step 1 TO WASTE enter inert prev E imenu UMP STEP MENU Figure 3 3 The Jump Step Menu 3 23 Section 3 Software Menu Descriptions Applied Biosystems The Interrupt Menu Selecting INTRPT interrupt allows you to stop a run at a specified step mid synthesis Using In terrupt a synthesis can be aborted stopped immediately and then continued or programmed to stop at any future step in the synthesis Once a run has been interrupted a jump step can also be per formed The set of interrupt menus and their relationship to the Synthesizing Status Menu are shown in Figure 3 4 IMPORTANT Interrupt synthesis at a safe step such as Cycle Entry or Cycle End so that the DNA is left chemically stable Upon selecting INTERRUPT one of two menu pages will be displayed This does not yet interrupt the synthesis 1 Whenan interrupt has been programmed to occur in the future the screen shows when it will happen For example Interrupt at step 1 base 2 ahead imediat clear menu 2 When an interrupt has not been programmed the screen reads No interrupt set ahead imediat clear Note The IMEDIAT immediate and MENU keys operate from both pages AHEAD only operates from t
243. try for Automated DNA Synthesis Applied Biosystems against a fluorescent green background A permanent record can be made by photography through a green filter Staining Many dyes and intercalating agents such as methylene blue ethidium bromide Stains All and oth ers will visualize oligonucleotides in a polyacrylamide matrix After electrophoresis the gel is transferred to a pan containing the staining agent and let soak for some time period This technique is more sensitive than UV shadowing but is more time consuming and uncertain than UV shadow ing Radiolabelling This is the most sensitive but most laborious method of analysis of oligonucleotides Typically about 0 01 odu is phosphorylated enzymatically with T4 polynucleotide kinase and gamma P to give 5 32 phosphorylated oligonucleotides Alternatively 35 ATP can be used and the oligonucleotides can be labelled at either the 5 or 3 termini The radiolabelled samples are electro phoresed on the gel The gel is wrapped in plastic and exposed to X ray film in a dark room An autoradiogram is generated in a time period ranging from minutes to days depending on the specific activity of the ATP and other radiolabelling parameters The film has a finite capacity for develop ment and exposure time must be carefully monitored usually by taking several exposures The gel pattern on the film may be quantitated by densitometry Product identification is obvious when the a
244. turn Using JUMP perform the delivery step for the faulty position for at least 90 seconds to equilibrate the pressure For example if the A phosphoramidite flow rate is too slow increase the pressure as just described and jump to step 17 A to column for equilibration Next using JUMP again repeat the delivery step i e step 17 A to column and remeasure the flow rate for 2 minutes Similarly if the flow is too fast decrease the regulator setting by turning the knob counterclockwise about 1 8th of a turn Next remove the bottle to relieve the excess pressure and then replace it As above equilibrate the bottle pressure for 90 seconds and remeasure the flow rate for two minutes Once the pressure has been changed remeasure each position to be sure all flow rates are within specification If all flow rates cannot be adjusted to specification or if you do not feel comfortable adjusting flow rates please call the Technical Support Department Do not use the synthesizer until all flow rates are correct 2 28 Section 2 Operation Applied Biosystems Part 3 At step 43 the procedure is interrupted again Use this time to prepare for part three steps 44 to 46 Connect the upper and lower column Luer fittings with the clear plastic shipping tube provided with the instrument Place the trityl collection line inside a beaker Place a 10 mL graduated cylinder next to the beaker When you are ready select RESUME This step is timed for
245. tus Menu Interrupt Immediate IMEDIAT Closes all valves instantly and stops the synthesis The screen will display the interrupted Status and will show when the synthesis was stopped For example Interrupted at base 2 of 12 bases resume jump abort Section 3 Software Menu Descriptions 3 25 Applied Biosystems Select MORE for additional information Note that the time remaining for the current step freezes when a synthesis is immediately interrupted STEP 1 18 TO WASTE 3of 5 SEC resume jump abort more main Select MORE for further information 1 5 gt AAA GCT 3 resume jump abort more main Select MORE for further information Making DNA 1 12 Cycle 1 63 Trityl OFF ON OFF more main To summarize the above example The synthesis was interrupted by pressing IMEDIAT when it was coupling base number 2 which is C It was stopped after performing step 1 18 to waste for 2 seconds 3 seconds remain There are a total of 12 bases in this sequence DNA 1 12 Cycle 1 is being performed and the ending method is trityl off IMPORTANT Interrupt synthesis at a safe step such as Cycle Entry or Cycle End so that the DNA is left chemically stable Note The resume jump and abort keys operate from Pages 1 2 and 3 The ON OFF key operates from Page 4 RESUME Continues synthesis from the beginning of the interrupted step The screen then returns to the Synthesizing Status Men
246. u JUMP Shows the Jump Step Menu allowing you to continue the synthesis before or after the interrupted step The synthesis remains interrupted until the jump is activated Refer to The Jump Step Menu for instructions ABORT Select to end a synthesis prematurely This might be done if a sequence was entered incorrectly When pressed the display reads 3 26 Section 3 Software Menu Descriptions Applied Biosystems To abort synthesis press yes no yes Follow the instructions and choose yes or no YES Ends the synthesis permanently Once you press YES the synthesis cannot be resumed The display will then read Synthesis Aborted main Prevents aborting the synthesis The interrupt is not affected and the display re turns to the Interrupted Status Menu Section 3 Software Menu Descriptions 3 27 Applied Biosystems nwan 4 nuaw 9318089 nuajy pajdnisajuy 81 nuaw sak ssasd sak ou Sisaysuds 12090 01 bow 288 NNJN 4318 en n OL aow viu 10w 12040 s0809 2j jo 2780410 Q31d BH31N dunt S Hg 15 019 pi deis io evv vvv vvv s i 330 9 i 9022 1 1 330 N0 ANIN Snivig ONIZISAHINAS 2 9504
247. uences 240 bases add this step Flush cartridge with 1 x 5 mL dilute ammonium hydroxide then 2 x 5 mL deionized water 11 Elute the purified detritylated oligonucleotide by flushing the cartridge with 1 mL of the 20 acetonitrile solution 12 Evaporate to dryness an aliquot of the eluate step 10 and dissolve in water to determine the OD units at A 260 13 Store any unused OPC purified oligonucleotide as a dry solid at 20 C Section 2 Operation 2 39 Applied Biosystems References Evaluation and Purification of Synthetic Oligonucleotides Applied Biosystems User Bulletin 13 Revised 1987 Gait M J and Sheppard R C Nucleic Acids Research 4 4391 1977 3 Tanaka T and Letsinger R L Nucleic Acids Research 10 3249 1982 9 Schott M E A simple manual method for oligonucleotide synthesis American Biotechnology Laboratory 3 20 23 1985 McBride L J Eadie J S Efcavitch J W and Andrus W A Base modification and the phosphoramidite approach Proceedings of the 7th International Round Table on Nucleosides Nucleotides and Their Biological Applications 1986 Martin F M Castro N M Aboula ela F Tinoco I Base Pairing Involving Deoxyinosine Implications for Probe Design Nucleic Acids Research 13 89277 8938 1985 Ohtsuka E Matsuki S Ikehara M Takahashi Y and Matsubara K An Alternate approach to Deoxyoligonucleotides Hybridi
248. ul for physical studies such as X ray crystallography or nmr Wide pore CPG supports are only available on the 0 2 mi cromole level The loading of nucleoside is lower about 15 umol gm of 1000 support For the synthesis of long oligonucleotides bigmers it has been shown that a lower loading of nucleoside and larger CPG pore size are critical requirements for success Section 6 Chemistry for Automated DNA Synthesis 6 5 Applied Biosystems Typical quantities of oligonucleotide obtained from the different synthesis scales are given below crude yield O D synthesis cycle 20mer 2UM 20 25 luM 100 120 Low 20 25 10uM 800 1000 Yield figures based on a 20mer sequence Absorbance measured at 260nm Assuming 33 micrograms O D unit Low is a low consumption cycle on the 2gM scale With automated synthesis the DNA is built from 3 to 5 Before beginning a synthesis one of four support bound nucleosides A C G or T contained within a column is placed on the instrument This nucleoside is the 3 terminus of the sequence 5 O ED D il BS A M CEA MI E Vi OCH OL LINKER DMT CPG Figure 6 2 The DMT protected nucleoside is attached to the controlled pore glass CPG support B Base A C T 6 6 Section 6 Chemistry for Automated DNA Synthesis Applied Biosystems D NH lt lt 9 N 2 ulcus N Adenosine benzoyl protected
249. uo Ku Tokyo 81 3 5566 6230 81 3 5566 6507 Latin America Del A Obregon Mexico 305 670 4350 305 670 4349 To Reach Technical Support Through the Internet We strongly encourage you to visit our Web site for answers to frequently asked questions and for more information about our products You can also order technical documents or an index of avail able documents and have them faxed or e mailed to you through our site The Applied Biosystems Web site address is http www appliedbiosystems com techsupp To submit technical questions from North America or Europe hours Step Action 1 Access the Applied Biosystems Technical Support Web site 2 Under the Troubleshooting heading click Support Request Forms then select the relevant support region for the product area of interest 3 Enter the requested information and your question in the displayed form then click Ask Us RIGHT NOW blue button with yellow text 4 Enter the required information in the next form if you have not already done so then click Ask Us RIGHT NOW You will receive an e mail reply to your question from one of our technical experts within 24 to 48 1 8 Section 1 Introduction Applied Biosystems To Obtain Documents on Demand Free 24 hour access to Applied Biosystems technical documents including MSDSs is available by fax or e mail or by download from our Web site To
250. urements are taken Please note that step 40 18 to waste is used during manufacturing and does not require measurement Calculate the flow rate in milliliters per minute Remember you are collecting for 2 minutes so you must divide the mL amount by 2 to get mL min The correct flow rates are listed below If they are not within specification the argon pressure regulator must be adjusted and the flows remeasured BOTTLE POSITION FLOW RATE mL min 1to 5 9 1 90 to 2 10 11 12 2 80 to 3 00 14 2 70 to 3 10 15 2 80 to 3 00 18 2 80 to 3 20 Note that since the phosphoramidite reservoirs are pressurized simultaneously their flow rates should be quite similar If one flow rate is very different the delivery line for that phosphoramidite may be clogged If you suspect this do not change the pressure setting Be sure to measure all flow rates and then call the Applied Biosystems Technical Support Department To adjust the pressure regulator first remove the left side panel of the instrument The regulator knob is located to the left of the top of the ballast assembly The ballast assembly is shown as item 14 in Figure D 2 in Appendix D To access the regulator gauge remove the back panel of the in strument The gauge is shown as item 15a in Figure D 3 in Appendix D The regulator is usually set at approximately 4 0 psi If the flow rate is too slow increase the regulator setting by turning the knob clockwise approxi mately 1 8th of a
251. ver a lab bench because it allows access to the rear of the instrument Specifically we recommend an open bench with plastic laminate top which can be ordered from Bay Products 8701 Torresdale Avenue Philadelphia PA 19136 800 523 3434 or 215 338 7300 The Bay Products catalog number is 6303B34 Sufficient room must be provided for the user supplied external fraction collector and the 4 L ace tonitrile bottle container which will be positioned to the left of the synthesizer A space within ap proximately 5 ft 1 5 m of the instrument must also be provided for safely securing an argon gas cylinder size 1A The dimensions and height of the Model 391 or 391 EP are as follows Width Depth Height Weight 52 cm 38 41 cm 29 kg 20 5 in 15 0 in 16 0 in 65 Ib Figure E 1 Laboratory Space Requirement Appendix E Warranty 391 Pre Installation Manual E 13 Applied Biosystems Electrical Requirements Power The Model 391 or 391 EP requires a dedicated electrical line with a circuit breaker Figure E 2 and power rating of at least 1 25 The outlet must be located close to the instrument The supplied power cord is 8 ft 2 5 m Grounding Certain types of electrical noise are exaggerated by poor or improper electrical round connections To prevent these problems the installation site should have a dedicated 1 25 KV A power line and isolated ground between the instrument and building main electrical
252. wer Fail for further instructions 5 12 Section 5 System Description Hardware Applied Biosystems The battery s voltage is checked during the system self test of the electronic components It should operate for several years When it needs replacing the display screen will show a battery low mes sage WARNING used lithium battery must be replaced and disposed of properly For further information consult the Applied Biosystems Technical Support Department The Controller The controller directs and initiates all synthesizer activity Its major components are the software the microprocessor the display screen the keyboard and associated electronics The software defines all necessary operations for synthesis and is interpreted and executed by the microprocessor The software is contained within a removable memory cartridge which plugs into the rear of the instrument Updated software supplied by Applied Biosystems can be easily installed by removing the old cartridge and replacing it with the new one IMPORTANT Before removing the memory cartridge be sure the main power is off Synthesis information is shown on a two line liquid crystal display LCD The display can be ad justed for optimal viewing by turning the knob at the left of the screen You interact with the instrument by selecting keys on the keyboard The keyboard consists of five soft keys located below the screen and several labeled keys 0 9 A
253. wing the Swagelock fitting Remove the regulator from the empty tank clean the threads on the fittings and install the regulator on a full tank Turn the tank on and check for leaks at the connection of the tank to the regulator 5 Open the needle valve Note You may hear a hissing sound while the new argon supply is recharging the vacuum assist WARNING sure to anchor the cylinder securely and follow required safety practices when handling gas cylinders How to Change the Waste Bottle The synthesizer generates 1 to 2 liters of hazardous halogenated organic liquid waste per 100 base additions The waste is collected in a 4 liter polyethylene bottle which is placed on the floor or on a nearby bench lower than the instrument The bottle can be kept inside a protective carrier to con tain accidental spillage A one gallon carrier is sufficient and can be purchased from VWR Part Number 56609 186 or Nalge Part Number 6501 0010 When the bottle is full it must be emptied as follows 1 Unscrew the cap assembly and immediately recap the bottle to prevent the release of vapors Save and reuse old bottle caps Discard the waste Place the liquid in a sealed container labeled FLAMMABLE POISON B N O S or absorb in vermiculite dry sand or earth Dispose of the waste following applicable government regulations WARNING Synthesizer waste must be disposed of properly and carefully When handli
254. ycles procedures and functions After pressing RESET the ROM cycles are reloaded into the RAM cycle locations When you press RESET a menu confirming the action appears RESET erases ALL user entries edits and resets the time gt RESET menu Press RESET to clear all RAM Press MENU to retain all user memory and to return to the previous menu Select MORE from page 4 of the Self Test Menu to view an additional test option Select a test Version 1 00 flowtst more main Flow Test FLOWTST Choose to perform the flow test procedure which measures flow rates through all essential delivery lines Before doing this procedure refer to Section 2 How to Perform the Flow Test Procedure for com plete details When you choose FLOWTST the following display is shown Remove all bottles except 18 before you begin flowtest begin more main Follow the instructions and remove all the reagent bottles except bottle 18 acetonitrile Be sure to properly reseal any chemicals that you will reuse Press BEGIN and the flow test procedure will automatically start The display will then show the current step being performed and its correspond ing time WAIT 5 of 5 sec jump intrpt more main 3 50 Section 3 Software Menu Descriptions Applied Biosystems This menu is identical to Monitor Synthesis For details on how to use the HOLD JUMP and IN TRPT keys refer to the Monitor Synthesis Menu found earlier in this sec
255. ynthesis cycle next cycle next DNA strand phosphoramidite purge procedure previous procedure random access memory read only memory shut down procedure standard synthesis Section 3 Software Menu Descriptions Applied Biosystems The Main Menu Once the instrument is connected to a power source and the power is turned on the following dis play appears Applied Biosystems 391 DNA Synthesizer PCR MATE EP Ver 1 00 Select START and the screen will display Page 1 of the Main Menu which presents five options DNA start change cycle more editor synth bottles editor menu Selecting MORE displays Page 2 of the Main Menu and shows additional options manual start proc fxn control pulse editor editor menu Selecting MORE again displays Page 3 of the Main Menu and shows additional options power self set shut more fail test clock down menu Selecting MORE again returns to Page 1 of the Main Menu All other menus or menu pages are accessed by selecting the appropriate key from Page 1 2 or 3 of the Main Menu To move from one menu e g DNA EDITOR to another e g START SYNTH requires returning to the Main Menu by pressing the MAIN key Note that sometimes MENU is shown instead of MAIN Pressing MENU will return to the previous menu Continue to press MENU until the MAIN key is displayed Section 3 Software Menu Descriptions 3 5 Applie
256. you stop the purge the configure synthesis menu is shown and a new synthesis can begin Main Menu Option Monitor Synthesis When you select MONITOR SYNTH synthesis the instrument status is displayed and one of the following five menus is shown Synthesizing status is shown during an active synthesis SYNTHESIZING base x of xx bases hold jump intrpt more x the number of the base currently being coupled as counted from the 3 terminus the total number of bases in the sequence Interrupted status is shown when a run has been temporarily stopped mid synthesis INTERRUPTED at base x of xx bases resume jump abort more main Holding status is shown when an individual synthesis step is being executed indefinitely HOLDING base x of xx bases resume jump intrpt more main 3 16 Section 3 Software Menu Descriptions Applied Biosystems Synthesis Complete is shown when a synthesis is finished SYNTHESIS COMPLETE Synthesis Aborted is shown after permanently ending a run mid synthesis SYNTHESIS ABORTED Instrument Status Synthesizing When you press MONITOR SYNTHESIS during a run Page 1 of the Synthesizing Status Menu is displayed SYNTHESIZING base x of xx bases hold jump intrpt more It shows the total number of bases in the sequence xx and the number of the base currently being synthesized as counted from the 3 terminus x IMPORTANT Although the DNA sequence is entered 5
257. ysia Petaling Jaya 60 3 758 8268 60 3 754 9043 Singapore 65 896 2168 65 896 2147 Taiwan Taipei Hsien 886 2 22358 2838 886 2 2358 2839 Thailand Bangkok 66 2 719 6405 66 2 319 9788 Europe Austria Wien 43 0 1 867 35 750 43 0 1 867 35 75 11 Belgium 32 0 2 712 5555 32 0 2 712 5516 Czech Republic and Slovakia Praha 420 2 61 222 164 420 2 61 222 168 Denmark Naerum 45 45 58 60 00 45 45 58 60 01 Finland Espoo 358 0 9 251 24 250 358 0 9 251 24 243 France Paris 33 0 1 69 59 85 85 33 0 1 69 59 85 00 Germany Weiterstadt 49 0 6150 101 0 49 0 6150 101 101 Hungary Budapest 36 0 1 270 8398 36 0 1 270 8288 Italy Milano 39 0 39 83891 39 0 39 838 9492 Norway Oslo 47 23 12 06 05 47 23 12 05 75 Poland Lithuania Latvia and Estonia Warszawa 48 22 866 40 10 48 22 866 40 20 Portugal Lisboa 351 0 22 605 33 14 351 0 22 605 33 15 Appendix E Warranty 391 Pre Installation Manual E 21 Applied Biosystems Telephone Fax Region Dial Dial Russia Moskva 7 095 935 8888 7 095 564 8787 South East Europe Zagreb Croatia 385 1 34 91 927 385 1 34 91 840 Spain Tres Cantos 34 0 91 806 1210 34 0 91 806 1206 Sweden Stockholm 46 0 8 619 4400 46 0 8 619 4401 Switzerland Rotkreuz 41 0 41 799 7777 41 0 41 790 0676 The Netherlands Nieuwerkerk IJssel 31 0 180 331400 31
258. zation Probes by Insertion of Deoxyinosine at Ambiguous Codon Positions J Biol Chem 260 5 2605 2608 1985 Takahashi Y Kato K Hayashizaki Y Wakabayashi T Ohtsuka E Matsuka S Ikehara M and Matsubura K Molecular Cloning of Human Cholecytokinin Gene by Use of a Synthetic Probe Containing Deoxyinosine PNAS 82 1931 1935 1985 B C F Chu and L E Orgel DNA 4 327 331 1985 10 A Chollet and Kawashima Nucleic Acids Research 13 1529 1541 1985 11 L M Smith et al Nature 321 647 679 1986 12 G B Dreyer Dervan Proc Natl Acad Sci USA 82 968 972 1985 13 E Jablonski et al Nucleic Acids Research 14 6115 6128 1986 14 B A Connolly Nucleic Acids Research 15 3131 3137 1987 15 Horn T and Urdea M S Nuc Acids Res 16 24 11559 11574 1988 2 40 Section 2 Operation Section3 Software Menu Descriptions This section describes each menu in detail The most frequently used menus are the DNA Editor Start Synthesis Monitor Synthesis and Change Bottles Be sure you carefully read about these menus You can use this section while viewing the synthesizer Introduction qe esed NUS RA e ge 3 2 Software Abbreviations and 3 4 The Main Men i ramps gee nce Dawe aad 3 5 Summary of Main Menu Options sse 3 6 Main menu o

ABI 391 manual

Contents

Download Pdf Manuals

Related Search

Related Contents