QIAGEN GeneRead Panel Analysis Plugin
Contents
1. Read position filter Significance Relative read direction filter Significance Remove pyro error variants In homopolymer regions with minimum length 3 With frequency below 0 8 gt Locked Settings CE mevos gt nee _ Figure 1 11 In this wizard step the parameters for variant detection can be adjusted a cR QIAGEN GeneRead Panel Analysis QC for Target Sequencing Configurable Parameters Choose where to run Select sequencing reads Track of Target Regions NGHS 002X_H Color T z 1000 Genomes population Minimum coverage 30 InDels and Structural Ignore non specific matches s Ignore broken pairs 7 Trim Primers and their Dimer s of Mapped Reads gt Locked Settings Low Frequency Variant Detection QC for Target Sequencing ors ana Figure 1 12 Specify your target regions and adjust the parameters if desired has been selected The reason for this is that many databases do not report a succession of SNVs as one MNV as is the case for the Biomedical Genomics Workbench and as a consequence it is not possible to directly compare variants called with Biomedical Genomics Workbench with these databases In order to support filtering against these databases anyway the option to Automatically join adjacent MNVs and SNVs is enabled This means that an MNV in the experimental data will get an exact match if a set of S2. Primer track NNGHS 002X Human Colorectal Cancer _ 2 3 1000 Genomes population Locked Settings 4 InDels and Structural Variants 5 TrimPrimers and their Dimers of Mapped Reads lies as a ereviouss yuarPatertinns v Erish pad Gonceba Figure 1 10 Select the primer track from the drop down list index php manual Filters html 8 Click on the button labeled Next to go to the next wizard step figure 1 12 In the QC for Target Sequencing step you must specify your target region As the default choice all available target region tracks that were selected under Data Management are selected The number and kind of target regions can be adjusted at this step As already described for the Trim Primers and their Dimers of Mapped Reads wizard step the options you get in the list that is accessed via the plus symbol 4 are the target regions you selected under Data Management Next specify the desired Minimum coverage and whether or not to ignore non specific matches and or broken pairs All parameters in this wizard step are described in detail in the Biomedical Genomics Workbench user manual http www clcsupport com biomedicalgenomicsworkbench current index php manual Running_QC_Target_ sequences_tool html 9 Click on the button labeled Next The next two wizard steps are annotation steps where the detected variants are annotated with information from known databases Actually the
3. experiments with many targets and as a consequence many primers Like the other primer trimming tool in the toolbox the Trim Primers of Mapped Reads tool the Trim CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 16 ly Genome Browse X 21 968 160 21 968 180 21 968 220 l l I Homo_sapiens_ensembl_v74_Genes Gene annotations 2 323 Homo_sapiens_ensembli_v74_mRNA mRNA annotations 5 559 Homo_sapiens_ensembli_v74_CDS CDS annotations 2 945 M54 3_S3_L001_R1_001 paired Reads locally realigned trimmed reads coverage M54 3_S3_L001_R1_001 paired Annotated Variants Variants 1 0 GATCTAAGWT TCCGGAGGTTTCTCAGAGCCTCTCTGGTTCTTTC M54 3_ 3_L001_R1_001 paired GATCTAAGKT TCCIGGAGGTTTCTCAGAGCCTCTCTGGTTCTTTC Reads locally realigned GATCTAAGTTTTCGGAGGTTTCTCAGAGCCTCTCTGGTTCTTTC trimmed reads GATCTAAGTTTCCGGAGGTTTCTCAGAGCCTCTCTGGTTCTTTC 3 315 reads GATCTAAGTTTCCIGGAGGTTTCTCAGAGCCTCTCTGGTTCTTTC 148 Cosmic_v67 Variants 47 341 E o dbsnp_common_v138 Variants 1 151 068 A EA M54 3_53_L001 X Rows 33 Table view Genome Chromosome Region Type Reference Allele Reference Length Zygosity Count Coverage Frequency Probability Forwardre Reversere Forward re Ay 4 46329655 SNV A T No 1 Heterozygous 596 1193 49 96 1 00 596 596 0 50 a 4 46329655 SNV A A Yes 1 Heterozygous 591 1193 49 54 1 00 591 591 0 50 4 46329723 SNV T A No 1 Heterozygous 597 11
4. the region around each variant is particularly relevant when you consider the potential importance of the individual variants A high conservation score could indicate that the variant is located in a region of the genome that is of great importance The annotated variant track can also be shown in table view To open the table double click on the name of the variant track in the left side of the Genome Browser View when opened in the View Area The annotated variant table includes all variants and the added information annotations see 1 18 In figure 1 19 the annotated variant table and the Genome Browser View are shown in split view The annotated variant table and the Genome Browser View are connected and when selecting a variant from the table by clicking on a row in the table the Genome Browser View will automatically put the selected variant into focus In figure 1 19 the Zoom to base level function ha marked with a red arrow in the lower right corner of the View area has been used to zoom in on the variant CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 14 ICR All parameters for QIAGEN GeneRead panel analysis cosmic a Locked Settings value gt gt Cosmic_v67 O WW sequence Locked Settings value 26 Homo_sapiens_sequence_hgi9 ie ae mE value Homo_sapiens_ensembl_v74_CDS 1000_genomes_project Locked Settings value 1000GENOMES_phase_1_EUR genes Locked Setting
5. track Choose where to run Navigation Area Selected elements 1 2 Select read mapping track whole_genome_sequencing a M54 3_53_L001_R1_001 paired Re targeted_amplicon_sequencing example_set demo L gt gene_panel_prostate_cancer results2 4 M54 3_S3_L001_R1_001 paired Reads uw 4 Qr lt enter search term gt Batch Figure 1 20 Select files to import Click on the button labeled Next to go to the next wizard step see figure 1 21 e Primer trim parameters Primer track Click on the folder icon on the right hand side of the wizard to select your primer location file Minimal primer overlap fraction Specifies the fraction of the primer that must overlap with the read s aligned bases in order to record a primer hit Setting the fraction to 0 0 will disable this requirement CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 18 CR Trim Primers and their Dimers from Mapping Specify trim parameters 1 Choose where to run Primer trim parameters i Primer track 2 Select read mapping track Minimal primer overlap fraction 0 5 3 Specty trim parameters E l pady j 7 Only keep reads that have hit a primer Primer dimer trim parameters Reference Minimum primer overlap length 9 3 Allow dangling 3 end base Other parameters Additional bases to trim 0 ZOA epee Figure 1 21 Select your primer location file and choose whether
6. variants are annotated with a range of different data in this ready to use workflow but only databases that provide data from more than one population needs to be specified by the user This is the case for HapMap and the 1000 Genomes Project First the variants are annotated with information from the 1000 Genomes Project see figure 1 13 From the list that can be accessed by clicking on the plus symbol 4 you can choose the population that matches the population your samples are derived from Please note that the populations available from the drop down list can be specified with the Data Management Fy function found in the top right corner of the Workbench see section Under Locked settings you can see that Automatically join adjacent MNVs and SNVs CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 11 i cR QIAGEN GeneRead Panel Analysis Low Frequency Variant Detection Configurable Parameters Choose where to run Select sequencing reads Required significance 1 0 1000 Genomes population Ignore positions with coverage above 1000000000 O InDels and Stuchral Restrict calling to target regions NGHS 002X_Human_Colorectal_Car dr Varinis Ignore broken pairs Trim Primers and their Ignore non specific matches Minimum read length Low Frequency Variant Minimum coverage jare Minimum count Minimum frequency Base quality filter Read direction filter Direction frequency
7. you want to keep or discard reads with no matching primers Read handling configuration If you tick Only keep reads that have hit a primer reads with no matching primers will be discarded e Primer dimer trim parameters Reference Click on the folder icon on the right hand side of the wizard to select your reference location file Minimum primer overlap length The minimum number of bases that needs to bind for primers to dimerize and amplify Allow dangling 3 end base If you tick Allow dangling 3 end base a mismatch is allowed in the primer dimerization at the 3 end e Other parameters Additional bases to trim This number of nucleotides will be trimmed off a read right after the primer This trimming is not done on reads for which primer dimer artifacts were identified Click on the button labeled Next to go to the wizard step shown in figure 1 22 Choose to save the result of the primer trimming and click on the button labeled Finish The output corresponds to the input with the only difference that the primers and their dimers have been trimmed off and that the output file has trimmed reads appended to the name In the wizard step it is also possible to save a track with the primer dimers that were used to trim reads The track contains information on why the primer dimer was predicted and the number of times it was used to partially trim a read or remove a read A read is removed if the read only con
8. 0 000 000 200 090 090 Homo_sapiens_sequence_hg19 78 Homo_sapiens_ensembl_v73_Genes Pere EE ee 412 Homo_sapiens_ensembI_v73_mRNA 0 AEN E A mstl an Lot oe a ia 223 Homo_sapiens_ensembl_v73_CDS A 0 Page FAN es T 2 ERR319087 single Reads locally realigned coverage 0 602 00 ERR319087 single Reads locally realigned 494 reads 0 00 6 ERR319087 single Annotated Variants 0 2 799 Cosmic_v67 Variants 126 891 0 TE EETA E od tase te tolh kahh ahad wllaalatat ClinVar_20130930 Variants 3 496 0 a h dLa L Ii al a JS S ey ie a ols 8 309 1000GENOMES_phase_1_EUR Variants 1 332 748 0 13 978 dbsnp_common_v138 Variants 2 082 727 Phast Cons _conservation_scores _hg19 Graph fae Eg SS Figure 1 17 Genome Browser View to inspect identified variants in the context of the human genome and external databases FS M54 3_S3_L001 X Rows 33 Table view Genome Chromosome Region Type Reference Allele Reference Length Zygosity Count Coverage Frequency Probability Forward re Reverse re Forma 1 160786670 SNV A G No 1 Heterozygous 292 560 52 14 1 00 292 292 a f 160786670 SNV A A Yes 1 Heterozygous 268 560 47 86 1 00 268 268 F 3 178922274 SNV C A No 1 Heterozygous 303 572 52 97 1 00 303 302 3 178922274 SNV E Cc Yes 1 Heterozygous 267 572 46 68 1 00 267 266 3 178941854 Deletion T No 1 Heterozygous 523 1018 51 38 1 00 523 523 3 178941854 SNV T T Y
9. 93 50 04 1 00 596 597 0 50 4 46329723 SNV T T Yes 1 Heterozygous 593 1193 49 71 1 00 591 593 0 50 a 6 152697706 SNV E T No 1 Heterozygous 151 467 32 33 1 00 151 151 0 50 6 152697706 SNV C E Yes 1 Heterozygous 316 467 67 67 1 00 316 316 0 50 8 128750597 SNV A G No 1 Heterozygous 406 791 51 33 1 00 406 406 0 50 8 128750597 SNV A A Yes 1 Heterozygous 384 791 48 55 1 00 384 384 0 50 10 89692732 Deletion T No 1 Heterozygous 46 442 10 41 1 00 46 46 0 50 1n ooo 20609729 CNY T T Vee 1 Heternsuaniie 20c aan 20 27 inn 20c 20c aon ied 4 m als Create Track from Selection als EE Ei Figure 1 19 The annotated variant table and the Genome Browser View shown in split view Primers and their Dimers of Mapped Reads tool makes use of the primer pairs in the trimming process and predicts possible primer dimerizations The prediction is based on the primer pairs the reference and user settings that are described later in this section Trim Primers and their Dimers of Mapped Reads is based on the Trim Primers of Mapped Reads tool with the extension that the Trim Primers and their Dimers of Mapped Reads tool not only trims off primers but also takes into account the situation where primers have formed dimers that have been used for target amplification First the tool trims primers of the reads It then looks for primer dimerization artifacts if it finds any these are trimmed The primer dimer trimming is done in two steps In the first step all primers are com
10. EN GeneRead Panel Analysis ready to use workflow and the Trim Primers and their Dimers of Mapped Reads tool are installed in the toolbox as illustrated in figure 1 1 Toolbox Ready to Use Workflows Preparing Raw Data Wag Whole Genome Sequencing gee Whole Exome Sequencing a my Targeted Amplicon Sequencing ft Annotate Variants TAS Ae Filter Somatic Variants TAS A Identify Known Variants in One Sample TAS oo Identify Somatic Variants from Tumor Normal Pair TAS ce BPE Identify Variants TAS A Identify and Annotate Variants TAS 4 a Whole Transcriptome Sequencing Tools ww Genome Browser Quality Control 4 n Preparing Raw Data e Resequencing Analysis gt Identify Known Mutations from Sample Mappings S Trim Primers and their Dimers of Mapped Reads Figure 1 1 The workflow and tool are found in the toolbox The QIAGEN GeneRead Panel Analysis ready to use workflow covers all steps from read mapping CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 5 to annotation of the variants and therefore performs both secondary and tertiary analysis The first step in the ready to use workflow is mapping of the sequencing reads to the human reference sequence This is followed by a local realignment step which is included to improve the variant detection that follows directly after a primer trimming step After variant detection the variants are annotated with gene names exon numbers am
11. NVs and MNVs in the database can be combined to provide the same allele Note This assumes that SNVs and MNVs in the track of known variants represent the same allele although there is no evidence for this in the track of known variants 10 Click on the button labeled Next and do the same to annotate with information from HapMap figure 1 14 CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 12 E QIAGEN GeneRead Panel Analysis x Add Information from 1000 Genomes Project Configurable Parameters 1 Choose where to run 2 Select sequencing reads Known variants track 1000GENOMES_phase_1_EUR dh 3 1000 Genomes population v Locked Settings 4 InDels and Structural Variants Automatically join adjacent MNVs and SNVs 5 Trim Primers and their Dimers of Mapped Reads 6 Low Frequency Variant Detection 7 QC for Target Sequencing 8 Add Information from 1000 Genomes Project X Cancel Figure 1 13 Select the relevant population from the list or use all three populations that have already been selected QIAGEN GeneRead Panel Analysis aio i Add Information from HapMap t Een Configurable Parameters 2 Select sequencing reads Known variants track HAPMAP_phase_3_CEU dp 3 1000 Genomes population hd Locked Settings 4 InDels and Structural Automatically join adjacent MNVs and SNVs 5 Trim Primers and their Dimers of Mapped Reads 6 Low Frequency Variant Det
12. Open log g Add Information from 1000 Genomes Project 9 Add Information from HapMap 10 Result handling srs X cma Figure 1 15 Check the selected parametes by pressing Preview All Parameters Note We advise you to not delete any of the produced files individually as some of them are linked to each other If you would like to delete an experiment please always delete all of generated files from one experiment at the same time When looking at the results of the analysis a good place to start is the target region coverage report to see whether the coverage is sufficient in the regions of interest e g gt 30 Please also check that at least 90 of the reads are mapped to the human reference sequence and that the majority of the reads map to the targeted region Open the Genome Browser View file fis to get an overview of the identified variants see 1 17 The Genome Browser View includes the annotated variants in context to the human reference sequence genes transcripts coding regions targeted regions mapped sequencing reads clinically relevant variants in the ClinVar database as well as common variants in common dbSNP HapMap and 1000 Genomes databases Finally a track with conservation scores shows the level of nucleotide conservation around each variant The conservation scores are based on a multiple alignment with a range of different vertebrates The conservation in
13. P QIAGEN GeneRead Panel Analysis Plugin USER MANUAL User manual for QIAGEN GeneRead Panel Analysis Plugin Windows Mac OS X and Linux November 19 2015 This software is for research purposes only CLC bio a QIAGEN Company Silkeborgvej 2 Prismet DK 8000 Aarhus C Denmark CC big A QIAGEN company Contents 1 1 Specify GeneRead DNAseq Gene Panel Introduction to the QIAGEN GeneRead Panel Analysis Plugin 1 2 How to run the QIAGEN GeneRead Panel Analysis ready to use workflow 1 3 Trim primers and their dimers of mapped reads 2 Installation of the QIAGEN GeneRead Panel Analysis 3 Uninstall 15 20 22 Chapter 1 Introduction to the QIAGEN GeneRead Panel Analysis Plugin The QIAGEN GeneRead Panel Analysis Plugin is a ready to use workflow that can identify and annotate variants in Targeted Amplicon Sequencing data generated with GeneRead DNAseg Gene Panels The GeneRead DNAseq Gene Panels can either be standard panels focused on a specific set of genes or can be customized to include genes tailored to specific research interests The QIAGEN GeneRead Panel Analysis Plugin is bundled with target primers and target regions from QIAGEN GeneRead DNAseq Gene Panels 2 0 but it is also possible to use the QIAGEN GeneRead Panel Analysis Plugin if you are working with customized gene panels Also included is a tool for trimming primers and their dimers This tool is described in section 1 3 The QIAG
14. PTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN f E Create Custom Reference Data Set Name QIAGEN GeneRead Panels hg19 Organism homo_sapiens Chromosomal Extension Full human genome Annotation Type Includes target regions and primers r Select feature tracks Navigation Area Selected elements 1 gt E NGHS 102X_Human_BRCA1_and_BRCA 3E NGHS 003X_Human_Myeloid_Leukemia J target_regions 5 4 giagen_v2 01 E NGHS 00 1X_Human_Breast_Canci gt PE NGHS 002 _Human_Colorectal ye juman_Myeloid_Leukemia d Figure 1 4 Select the relevant target primers and target regions and click OK DNAseq Gene Panels you can choose your customized primers and target regions provided that you had saved them before in your Navigation Area In any case remember that only the gene panels that are selected under Data Management will be available when you run the QIAGEN GeneRead Panel Analysis ready to use workflow Once you have selected the target primers and regions do not forget to edit the name of your Custom Data Set before saving it The new data set now appears under the Custom Reference Data Set tab of the Data Management window figure 1 5 Click on Apply before you close the Manage Reference Data wizard You can always go back and make changes if necessary Manage Reference Data for Installed Workflows Z A Manage Reference Data Locally w Fr
15. Support contact support gnosisda gr Version 1 0 BioSignature Discover is a complete statistical analysis pipeline for p feature selection identifying and interpreting predictive or diagnosti molecular data Plugin requires registration Commercial plugin A commercial license is required nP BioSignature Discover Demo Version Q Advanced Peak Shape Tools The Advanced Peak Shape Tools Plugin provides advanced tools to manipulate peak shapes and find regions in sequencing data that exhibit a distinct shape These tools can be used to interactively refine the results of ChIP Seq Analysis or to perform shape based analyses of sequencing data The Learn Peak Shape Filter tool creates a new peak shape filter from sequencing data and a set of positive and negative regions The Apply Peak Shape Filter tool then applies a peak shape filter to sequencing data to discover regions peaks which match a given peak shape The Score Regions tool scores genomic regions according how well they match a given peak shape Forward and reverse reads shaping a peak Help Proxy Settings Check for Updates Install from File Close Figure 2 1 The plugins that are available for download 21 Chapter 3 Uninstall Plugins are uninstalled using the plugin manager Help in the Menu Bar Plugins 2 or Plugins 4 in the Toolbar This will open the dialog shown in figure 3 1 Manage P
16. ad s unaligned bases are taken into account e g if the primer begins two positions before the read s first aligned base and the read has three unaligned bases the primer is said to begin after the read Similarly a primer that ends before the read at the 3 end is not considered Again unaligned bases are taken into account Removal of primers and their dimers from the mapped reads ensures that no bias is introduced in the variant calling as would be the case if the primers and dimers were considered to be part of the sequencing reads To be able to trim off the primers used in your sequencing experiment you must know the primer sequences as you will need to specify which target primer sequence file to use The tool will trim off the primer dimers it predicts based on the primer pairs the reference and user settings The Trim Primers and their Dimers of Mapped Reads can be found in the toolbox a Toolbox Resequencing Analysis Reads zal Trim Primers and their Dimers of Mapped This will open the wizard shown in figure 1 20 In the first wizard step you are asked to select the read mapping If you would like to analyze more than one read mapping you can choose to run the analysis in batch mode by ticking the Batch box in the lower left corner of the wizard and then selecting the folder that hold the read mappings you want to analyze Trim Primers and their Dimers of Mapped Reads eo mame Select read mapping
17. button labeled Next 2 After this or if you are not connected to a CLC Server the first wizard step you will be presented with is the step where you can select the sequencing reads that should be analyzed figure 1 6 ss QIAGEN GeneRead panel analysis Select sequencing reads 1 Choose where to run T g Navigation Area Selected elements 1 2 Select sequencing reads E2 Whole _genome_sequendng E HE M54 3_53_L001_R1_001 pai 2 targeted_amplicon_sequencing example_set 3 demo gene_panel_prostate_cancer i gt results2 4 H M54 3_S3_L001_R1_001 paired c aAa A Om LAAS mda ANG fA SV mW p Q lt enter search term gt Batch Previous gt Next X Cancel Figure 1 6 Select the sequencing reads by double clicking on the file name or by clicking once on the file name and then on the arrow pointing to the right hand side 3 Select the sequencing reads and click on the button labeled Next If you would like to analyze more than one sample you can choose to run the analysis in batch mode This is done by ticking Batch in the lower left side of the wizard and selecting the folder s that holds the data you wish to analyze If you have your sequencing data in separate folders you should choose to run the analysis in batch mode You can learn more about batch analysis in the Biomedical Genomics Workbench user manual http www clcsupport com biomedical
18. ection wN QC for Target Sequencing 8 7 Add Information from 1000 Genomes Project 9 Add Information from HapMap aa n axel Figure 1 14 Select the relevant population from the list or use all populations that have already been selected 11 Click on the button labeled Next to go to the last wizard step Shown in figure 1 15 Pressing the button Preview All Parameters allows you to preview all parameters At this step you can only view the parameters it is not possible to make any changes see figure 1 16 Choose to save the results and click on the button labeled Finish Output from the QIAGEN GeneRead Panel Analysis The QIAGEN GeneRead Panel Analysis tool produces six different outputs Target region reads track with the locally realigned trimmed reads gt Target region coverage track 5 Coverage report i Annotated variant track FF Genome Browser View Ly O Oo FB WB N FF Log table CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 13 a QIAGEN GeneRead Panel Analysis Result handling 1 Choose where to run N Select sequencing reads w 1000 Genomes population Workflow parameters InDels and Structural Variants Preview All Parameters a Trim Primers and their Dimers of Mapped Reads Result handling wi o Low Frequency Variant pen Detection Save a QC for Target Sequencing Log handling
19. ee space on CLC_References location 259 65 GB Free space on temporary folder location 259 65 GB Reference Data Library Reference Data Sets 7 El QEN GeneRead Panels hg19 human myeloid leukemia Size on disk Version 1 Reference Data Set 7 me Y gt ce ceed eas nen modes v Ensembl v74 Create Custom Set sd Delete Apply Reference Data included Reference Data i Download Size On Disk Size G Target Primers N A G Target Regions N A Figure 1 5 The newly created Custom Reference Data Set can be seen under the Custom Reference Data Set tab Do not forget to edit the data set a name and to apply it before starting the workflow 1 2 How to run the QIAGEN GeneRead Panel Analysis ready to use workflow The QIAGEN GeneRead Panel Analysis ready to use workflow can be found in the toolbox under Targeted Amplicon Sequencing Toolbox Ready to Use Workflows Targeted Amplicon Sequencing 3 QIAGEN GeneRead Panel Analysis 9 1 Double click on the QIAGEN GeneRead Panel Analysis ready to use workflow figure 1 1 to CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 8 run the analysis If the QIAGEN GeneRead Plugin has been installed on a CLC Server you are connected to via your Workbench then you will be asked where you would like to run the analysis We recommend that you run the analysis on a CLC Server when possible Click on the
20. een generated with the new adapter sequences and have not been trimmed or have been trimmed incompletely the adapter sequences can be removed within the Biomedical Genomics Workbench using the Illumina adapter sequences that can be found here Beto sup roort il lumna o omn downwlocdds lune customer sequence letter html and the tool Trim Sequences that is available in the Toolbox in the Tools section Toolbox Tools Preparing Raw Data gt Trim Sequences 3 1 1 Specify GeneRead DNAseg Gene Panel Before running the QIAGEN GeneRead Panel Analysis ready to use workflow you must first specify which GeneRead DNAseq Gene Panel has been used for targeted sequencing To do this go to CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 6 Toolbar Data Management 7 This will open the wizard shown in figure 1 2 Bx Manage Reference Data for Installed Workflows A Z Manage Reference Data Locally w Free space on CLC_References location 185 74 GB Free space on temporary folder location 185 74 GB QIAGEN Custom Reference Data Library Reference Data Sets v Reference Data Sets QIAGEN GeneRead Panels hg19 Size on disk ea Version 1 Reference Data Set 79m8 38 4 72 dbSNP v142 ClinVar 20150629 Create Custom Set wnload Delete Apply a hg38 4 Ensembl v81 dbSNP w142 ClinVar 20150901 Reference Data induded Reference Data i Download S
21. en_v2 01 fA dinvar pJ NGHS 001 _Human_Breast_Cancer GP cds SPE NGHS 002 _Human_Colorectal_Cancer H E cosmic BYE NGHS 005 _Human_Lung_Cancer fA 1000_genomes_project l lis NGHS 004_Human_Liver_Cancer BF gene_ontology nH NGHS 003X _Human_Myeloid_Leukemia AS genes FHE NGHS 006 _Human_Ovarian_Cancer m hapmap HVE NGHS 007K_Human_Prostate_Cancer E F mrna E NGHS 008 _Human_Gastric_Cancer iH NGHS 009 _Human_Cardiomyopathy EH NGHS 011 Human_Carrier_ Testing H sequence H dbsnp_common H conservation_scores_phastcons freee JE NGHS 013 _Human_Cancer Predisposition H E dbsnp DE NGHS 101X_Clinically_Relevant_Tumor a f exons JE NGHS 201 _Cancer_Actionable_Mutations iH NGHS 501 _Human_Comprehensive_Cancer H 9 small transcripts a NGHS 102 _Human_BRCA1 and _BRCA Panel H target regions Figure 1 3 The folders target_primers and target_regions are available in your CLC_References data folder To create a Reference Data Set specific to one panel in particular click on Create Custom Set This opens a pop up window where both Target Primers and Target Regions are represented by a drop down menu figure 1 4 Select the option Custom to open another window where you can select the relevant panel from the CLC_References folder It is possible to select multiple target primers or target regions simultaneously if you work with multiple GeneRead DNAseq Gene Panels Similarly if you are using customized GeneRead CHA
22. es 1 Heterozygous 494 1018 48 53 1 00 494 494 4 46329655 SNV A T No 1 Heterozygous 596 1193 49 96 1 00 596 596 4 46329655 SNV A A Yes 1 Heterozygous 591 1193 49 54 1 00 591 591 4 46329723 SNV T A No 1 Heterozygous 597 1193 50 04 1 00 596 597 4 46329723 SNV T F Yes 1 Heterozygous 593 1193 49 71 1 00 591 593 7 6 152697706 SNV cC T No 1 Heterozygous 151 467 32 33 1 00 151 151 6 152697706 SNV C Cc Yes 1 Heterozygous 316 467 67 67 1 00 316 316 8 128750597 SNV A G No 1 Heterozygous 406 791 51 33 1 00 406 406 8 128750597 SNV A A Yes 1 Heterozygous 384 791 48 55 1 00 384 384 9 21968199 SNV Cc G No 1 Homozygous 145 145 100 00 1 00 145 145 10 89692732 Deletion T No 1 Heterozygous 46 442 10 41 1 00 46 46 10 89692732 SNV T T Yes 1 Heterozygous 395 442 89 37 1 00 395 395 i2 6945914 SNV Cc G No 1 Heterozygous 134 225 59 56 1 00 134 134 z 4 atika els Create Track from Selection ah ES Y Figure 1 18 The annotated variant track opened in table view from the Genome Browser View The table makes it easier to inspect identified variants in detail Please note that in case none of the variants are present in ClinVar or doSNP the corresponding annotation column headers are missing from the result 1 3 Trim primers and their dimers of mapped reads The Trim Primers and their Dimers of Mapped Reads tool is used in the QIAGEN GeneRead Panel Analysis ready to use workflow It is also provided as a separate tool to be used for targeted amplicon sequencing
23. genomicsworkbench current index php manual Batching_result_ handlang htmL 4 Inthe next wizard you can specify which of the available 1000 Genomes populations to use in the analysis by clicking on the plus symbol in the right hand side of the wizard Figure 1 7 shows the default settings where all three available 1000 Genomes populations are se lected This is the default setting if all three populations have been selected under Data Man agement as described in the Biomedical Genomics Workbench user manual http www clcsupport com biomedicalgenomicsworkbench current index php manual Download_configure_reference_data html lf you have selected only one population in the Data Management in this example the European population this population will be shown as the default choice figure 1 8 5 Click on the button labeled Next to go to the next wizard step that allows you to restrict the calling of InDels and Structural Variants to the targeted regions figure 1 9 All available gene panels are selected as the default choice By clicking on the plus symbol in the right hand side of the wizard it is possible to adjust the number and type of gene panels to use as target regions and thereby restrict the variant calling to only the sequences that have been targeted in your sequencing experiment CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 9 7 E QIAGEN GeneRead Panel Analysis us 1000 Genomes populat
24. ino acid changes conservation scores information from clinically relevant variants present in the ClinVar database and infor mation from common variants present in the common dbSNP HapMap and 1000 Genomes database Furthermore a detailed target regions mapping report is created that allows inspection of the coverage and mapping specificity in the target regions Adapters and QIAGEN GeneRead Panel Analysis The QIAGEN GeneRead Panel Analysis Plugin assumes that the sequences used as input do not contain adapters The removal of adapters is often done directly on the sequencing machine If adapters have not been trimmed off please do so before proceeding with your analysis The presence of adapters will lead to misleading results If you are working with sequences that still have adapters present they can be trimmed using the tools provided in the Prepare Raw Data folder in the toolbox For a description of how to trim off adapter sequences please see the Biomedical Genomics Workbench manual that can be found here http clcsupport com biomedicalgenomicsworkbench current index php manual Adapter_trimming html Illumina Adapters Illumina recently changed their adapter sequences and this may have consequences for the downstream data analysis if the new adapter sequences were used for the sequencing analysis and the old adapter sequences were used for trimming off the adapter sequences If you have Illumina sequencing data that have b
25. ion 1 Choose where to run 1000 Genomes 1000GENOMES_phase_1_ EUR 1000GENOMES_phase_1_ AMR 1000GENOMES phase_1 2 Select sequencing reads 3 1000 Genomes population CR Select Workflow Input Available Selected 1000GENOMES _phase_1 EUR 1000GENOMES_phase_1_AMR 1000GENOMES_phase_1_AFR S Previous gt Next Finish X Cancel Figure 1 7 The 1000 Genomes population s that are selected and available as the default choice in the wizard are the population s that have been selected under Data Management To remove populations that are not relevant for this analysis click on the populations that is to be deselected and click on the arrow pointing to the left hand side z ICR QIAGEN GeneRead Panel Analysis 1000 Genomes population 1 Choose where to run 1000 Genomes 1000GENOMES_phase_1 EUR 2 Selectsequencing reads 3 1000 Genomes population Figure 1 8 Which of the 1000 Genomes populations to use in the analysis can be specified at this step In this example we have chosen to use only the European population 6 Click on the button labeled Next to go to the next wizard step figure 1 10 In this dialog the target primers for primer trimming can be specified If you would like to add more GeneRead DNAseq Gene Panel target primers this can be done using Data Management as described in section 1 1 T Click on the bu
26. ize On Disk Size Applied 4 Target Primers 1 3 MB 6 9 MB No hg19 G Ensembl v74 dbSNP w138 ClinVar 20131203 4 Target Regions 223 KB 1012 KB No hg38 4 Ensembl v80 dbSNP v142 ClinVar 20150629 QIAGEN GeneRead Panels hg19 E Ensembl v74 Affects these workflows 0 4 Mouse Does not affect these workflows 69 Ensembl v80 Identify and Interpret Causal Variants in Family of Four using IVA TAS Identify and Interpret Causal Variants in Family of Four using IVA WES A i Identify and Interpret Causal Variants in Family of Four using IVA WGS Identify and Interpret Causal Variants in Trio using IVA TAS Identify and Interpret Causal Variants in Trio using IVA WES ee ee Identify and Interpret Causal Variants in Trio using IVA WGS Add Information from 1000 Genomes Project G 1000 Genomes Project phase_1 E E ey eg ra Add Information from Common dbSNP 4 1000 Genomes Project phase 3 Add Information from COSMIC lL rid Information from dhSNO Figure 1 2 Open the Data Management and download QIAGEN GeneRead Panels hg19 Select QIAGEN GeneRead Panels hg19 and click on the button labeled Download Two extra fold ers are now in the CLC_References homo_sapiens folder target_primers and target_regions see figure 1 3 Each folder contains elements specific to each commercially available QIAGEN GeneRead Panels kit z target_primers GES homo_sapiens EBS giag
27. loaded it from our web site you can install it by clicking the Install from File button at the bottom of the dialog This will open a dialog where you can browse for the plugin The plugin file should be a file of the type cpa When you close the dialog you will be asked whether you wish to restart the Biomedical Genomics Workbench The plugin will not be ready for use until you have restarted tin order to install plugins on Windows the Workbench must be run in administrator mode Right click the program shortcut and choose Run as Administrator Then follow the procedure described below 20 CHAPTER 2 INSTALLATION OF THE QIAGEN GENEREAD PANEL ANALYSIS Download Plugins D Manage Plugins Annotate with GFF file Provider QIAGEN Aarhus Support contact support clcbio com Version 2 2 8 Build 141210 1254 119852 Using this plug in it is possible to annotate a sequence from list of a found in a GFF file Located in the Toolbox Biobase Genome Trax Annotate Provider QIAGEN Aarhus Support contact support clcbio com Version 2 0 18 Build 150729 1130 129513 Create tracks with various data from Biobase Genome Trax Biobase Genome Trax Download Provider QIAGEN Aarhus Support contact support clcbio com Version 2 0 18 Build 150729 1133 129513 Create tracks with various data from Biobase Genome Trax Plugin requires registration BioSignature Discover Basic Version Provider Gnosis Data Analysis
28. lugins B Manage Plugins Download Plugins Additional Alignments Provider QIAGEN Aarhus Support contact support clcbio com Version 1 5 3 Build 141210 1208 119849 Perform alignments with ClustalO ClustalW and MUSCLE Batch Rename Provider QIAGEN Aarhus Support contact support clcbio com Version 1 3 5 Build 150107 1115 120654 Rename files in batch by adding a prefix or a number CLC Workbench Client Plugin Provider QIAGEN Aarhus Support contact support clcbio qiagen com Version 7 5 Build 150907 0800 131303 Client plugin for connecting to a CLC Server Compatible with the CLC Genomics Server 7 x Drug Discovery Server 2 x and Bioinformatics Database 4 6 x Help Proxy Settings Check for Updates Install from File Close Figure 3 1 The plugin manager with plugins installed The installed plugins are shown in this dialog To uninstall Click the QIAGEN GeneRead Panel Analysis Uninstall If you do not wish to completely uninstall the plugin but you don t want it to be used next time 22 CHAPTER 3 UNINSTALL 23 you start the Workbench click the Disable button When you close the dialog you will be asked whether you wish to restart the workbench The plugin will not be uninstalled until the workbench is restarted
29. pared against each other for possible primer dimerization The user may specify the minimum number of bases that needs to bind for primers to dimerize and amplify After the first step a list of possible primer dimerizations have been compiled for each primer In the second step the actual trimming is performed All reads are examined and if the read was trimmed by a primer p and the read starts with the sequence predicted by one of p s possible primer dimerizations it is assumed that the read has a primer dimer artifact The tool proceeds to trim the read so the artifact is unaligned In the case where the read only consists of the primer dimer artifact sequence the read will be discarded CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 17 Compared to the Trim Primers of Mapped Reads tool the primer trimming in this tool has been extended so the user can specify the fraction of the primer that must overlap with a read s aligned bases in order to record a primer hit Another difference between the two tools is that primers are trimmed slightly differently with the Trim primers and their dimers of mapped reads tool compared to trimming performed with the Trim Primers of Mapped Reads tool The Trim primers and their dimers of mapped reads is more strict regarding primer position If a primer begins after the read at the 5 end the primer is not considered by the Trim primers and their dimers of mapped reads tool The re
30. s value Homo_sapiens_ensembl_v74_Genes conservation_scores_phastcons Locked Settings value la PhastCons_conservation_scores_hg19 Map Reads to Reference Locked Settings References 2 Homo_sapiens_sequence_hg19 sE Masking mode No masking Masking track ie Mismatch cost Treertan renct Export to Excel 2010 v iS Export Parameters Figure 1 16 Preview all parameters At this step it is not possible to introduce any changes it is only possible to view the settings The added information can support identification of candidate variants for further research For example can common genetic variants present in the HapMap database or variants known to play a role in drug response or other clinical relevant phenotypes present in the ClinVar database easily be seen Identified variants that are unknown in the ClinVar database can for example be prioritized based on amino acid changes A high conservation level on the position of the variant between many vertebrates or mammals can also be a hint that this region could have an important functional role and variants with a conservation score of more than 0 9 PhastCons score should be prioritized higher Filtering of the variants based on their annotations can be facilitated using the table filter in the top right side of the table CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 15 iy Genome Browse X 30 000 000 100 000 000 13
31. sists of the primer dimer CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN Result handling 1 Choose where to run 2 Select read mapping track Output options 3 Specify trim parameters V Create primer dimer trim usage track 4 Result handling Result handling Open Save Log handling Z Open log cai ee cone Figure 1 22 Select output options Chapter 2 Installation of the QIAGEN GeneRead Panel Analysis The QIAGEN GeneRead Panel Analysis is installed as a plugin Plugins are installed using the plugin manager Help in the Menu Bar Plugins 2 or Plugins 4 in the Toolbar The plugin manager has two tabs at the top e Manage Plugins This is an overview of plugins that are installed e Download Plugins This is an overview of available plugins on CLC bio s server To install a plugin click the Download Plugins tab This will display an overview of the plugins that are available for download and installation see figure 2 1 Clicking a plugin will display additional information at the right side of the dialog This will also display a button Download and Install Click the QIAGEN GeneRead Panel Analysis and press Download and Install A dialog displaying progress is now shown and the plugin is downloaded and installed If the QIAGEN GeneRead Panel Analysis is not shown on the server and you have it on your computer e g if you have down
32. tton labeled Next In the next wizard step figure 1 11 you can specify the parameters for variant detection Please see the Biomedical Genomics Workbench user manual for a description of the differ ent parameters that can be adjusted in the variant detection step A description of the Low Frequency Variant Detection tool can be found in the Biomedical Genomics Workbench user manual http www clcsupport com biomedicalgenomicsworkbench current index php manual Low_Frequency_Variant_Detection html As general fil ters are applied to the different variant detectors that are available in Biomedical Genomics Workbench the description of the filters are found in a separate section called Filters see http www clcsupport com biomedicalgenomicsworkbench current CHAPTER 1 INTRODUCTION TO THE QIAGEN GENEREAD PANEL ANALYSIS PLUGIN 10 QIAGEN GeneRead Panel Analysis InDels and Structural Variants 1 Choose where to run a ae E D E EA 2 Select sequencing reads Restrict calling to target regions NGHS 002X_Human_Colorectal_Cancer cP 3 1000 Genomes population gt Locked Settings 4 6 InDels and Structural Variants aj E previous Figure 1 9 In this wizard step you can specify the targeted regions matching your read mapping QIAGEN GeneRead Panel Analysis Trim Primers and their Dimers of Mapped Reads Configurable Parameters 1 Choose where to run Select sequencing reads
Download Pdf Manuals
Related Search