CRISPR/Cas9 Gene Tagging Application Note
Contents
1. homology arm in suitable buffer to a final concentration of 20 200ng ul 4 Please refer to pgs 6 and 7 of the Cold Fusion user manual http www systembio com downloads Manual Cold Fusion 083010 pdf for detail on setting up the cloning reaction 5 Screen colonies for clones with the correct inserts by restriction digestion analysis and sequencing Cloning of the 3 Homology Arm into HR Tagging Vector HR120PA 1 1 Using a miniprepped clone from Step 5 above containing the correct insert linearize 1 2ug of the vector using BamHI enzyme preferably a high fidelity version such as BamHI HF to ensure complete digestion of the vector 2 Clean up the digestion reaction and run out the reaction on a 2 agarose gel Gel purify the insert and quantitate DNA using NanoDrop or other suitable UV Vis spectrophotometric method Dilute the purified DNA to a final concentration of 10 100ng ul 3 Resuspend the 3 homology arm in suitable buffer to a final concentration of 20 200ng ul 4 Please refer to pgs 6 and 7 of the Cold Fusion user manual http www systembio com downloads Manual Cold Fusion 083010 pdf for details on setting up the cloning reaction 5 Screen colonies for clones with the correct inserts by restriction digestion analysis sequencing or PCR You should verify correct insertion of the homology arms at both the 5 and 3 ends before transfection of target cells See Section IV aaa Accelerating discoveries through i2. ATITGOGTGICR gaggccggtg ggtcctaggg ctgggtggca qGgaccgcatc gggtgaagaa Gecccacgtd gcagggcctg Ecagtygaag acogtCgacCcor tatgttaaaa acccoccrge CCCLCLacgCc c ccgggagccg gGAGGACTGC TCATCGGCAT gggcggaggg acugcgececc SGTGCTGETGOU CTCTGGCCAC CGAGGGGGCC TACACGTAGC TOTTALCITTIT GACGGGCCTG GICCCAGGGT CCCAGAGACT CCGTCCTGTG GAGCCGAGTC ALGILGLLTT GAAGGAACAT ggtgtctgag tggggcttgg AGCACACTGA CTCGGGCAGC JogCCqcgce gtgggcaggt LOG CCCCLIGE cggeccacga ggtggaggct LOCaCrtcgtg CagqgcecaLtat LCOOLCaccag cagtggaaaa cgggtggaag tccgaggtgg ELECLIOLO ge aggcecggquc CACCAGAAGA TGCTGCCATC CCLOCECECE CCaccacccL TGTGGCATCC AGGGACCTCT ATCACCGCCT Clot tL lLeci TCAGGGCTGA GGICTTEGCEG BULCIGCCIG CAGCTTGGCC GGCTGCACAG IGIGGGCACT CAACTGTAAT CAGGCATGCT acccaggggt ectcectgtggac Hd kg Goel Ka gl EY AACATCATCA EQaccccccg cacacggcag cagggcetgert ggaaggcagg ctggggggtg ggtgtggacg ageocectgtu cgatcgettta gggcacagtg atvagcaagqcc gtagggggtg daccacggar CoEgaccacgd TCGATGACCT GISGICGUIS GGgCLEGCCCE cctgcagATC GGAACAGCTC GCAGTGCCCC GTIGTATATAA TTOGGOGOTTITI CGTCACATGT ACTGGAGGGC CTCAGCCAGG AACTTGGGGG CICACCI IGI Ci PG LOTTE CACAACATCC ACCAGGCCTG tggccggagg tctgtggggt Exons colored blue introns in black 3 UTR in orange TT TT Accelerating discoveries through innovations CACCTCAGTG GCAACCTCTT GalLgrcccgc Ccecacagqgd ctgctgggag COCCCEGtGG Qgaactcacc GCCCLOGacag qgaagekkce ggggtctagt LOLCCoCCaggc ggcaga
3. Y SBI System Biosciences Application Note Generating GFP Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors Table of Contents Background Pg 1 Il Analysis of Gene Target Pg 2 Ill Guide RNA Design Pg 3 IV Design and Cloning of Homology Arms for HR Tagging Vectors Pg 7 V Protocol for Co Transfection of HR Targeting Vector with Cas9 gRNA Plasmids and Characterization of Cells Pg 13 Cas9 Vectors MRNA Lentivirus l LIDATION SBI System Biosciences I Background The recent discovery of the CRISPR Cas9 complex has provided researchers an invaluable tool to target and modify any genomic sequence with high levels of efficacy and specificity The system consisting of a nuclease Cas9 and a DNA directed guide RNA gRNA allows for sequence specific cleavage of target sequence containing a protospacer adaptor motif NGG Fig 1 By changing the gRNA target sequence virtually any gene sequence upstream of a PAM motif can be targeted by the CRISPR Cas9 system enabling the possibility of systematic targeting of sequences on a genomic scale The CRISPR Cas9 Nuclease Heterocomplex Target Genomic Protospacer Locus a Adjacent Motif Q PAM Wi 3 a Target sequence 1 to cleave 54 Your guide RNA sequence tracrRNA built into vectors Fig 1 Illustration of the CRISPR Cas9 Heterocomplex This app
4. ctgcacccgcctgttccgaggtgggtagggggtggggggctg ttcccaggattcccctctacgctttctgtggtgaccacggattactgcgtgacaacgggaagccgggagccgaggcccggtccctgaccacgcgtgcc tggccacccctgcagGAGGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGTACCTCATCGGCATTGCT GCCATCGTGGTCGCTGTGATCATGgtgag ggcgggggcggagggcctgctctctgggctgccccttccgcggggcecttgtgctgactg cgccccccaccaccctcctgcagATCTTCGAGAWATCCTGAGCATGGTGCTGTGCTGTGGCATCCGGAACAGCTCCGTG m Accelerating discoveries through innovations 5 Y SBI System Biosciences tgccagtggtgtctgagacctaggggattggocggagggcaggggaatctgacatc ggtggggcttggctctgtggactctgtggggtccagggtgagggt Exons in upper case introns in lower case Note gRNA is complimentary to antisense strand Stop Codon Y Nuclease cut site 5 Clone the gRNA insert into SBI s All in One PrecisionX SmartNuclease cloning vector CMV hspCas9 Hi gRNA catalog CAS940A 1 following the recommended protocols in the user manual http www systembio com downloads Cas9 SmartNuclease user manual pdf aaa Accelerating discoveries through innovations 6 Y SBI System Biosciences IV Design and Cloning of Homology Arms for HR Tagging Vectors SBI has built a line of HR Tagging Vectors http www systembio com genome engineering precisionx HR vectors that leverage the cell s ability to incorporate large exogenous DNA sequences via homologous recombination HR at double stranded DNA breaks DSB The incorporation of fluorescent and or selection markers via HR and tagging of speci
5. e ID or RefSeq accession numbers may also be used for the next step but we find it is helpful to have a copy of the reference genomic sequence available for gRNA and HR tagging vector design aaa Accelerating discoveries through innovations 3 Y SBI System Biosciences 3 Paste the sequence into a plasmid utility program such as the ApE plasmid editor http biologylabs utah edu jorgensen wayned ape to remove any non nucleotide characters and copy the resulting sequence file as input into the CHOPCHOP program by clicking the or paste input sequence link or enter the target Gene ID or MRNA accession number Note The CHOPCHOP program provides options for changing parameters to specify general sequence and algorithm restrictions for identifying gRNAs under the Toggle Advanced Options link For the purposes of this application note the default settings can be used Home Instructions Scoring About Contact H sapiens hg19 GRCh37 or paste input sequence teccacagCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACC CCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACA AGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTC CAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAA ACATTTATTTICATIGC aatgatgtatttaaattatttctgaatattttactaaaaagggaatgtgggaggtcagtgcatttaaaacataaagaa atgaagagctagttcaaacctt CRISPR Cas9 TALEN Find Target Sites Fig 2 Screenshot of pasting genomic DNA sequence
6. ed DNA TCCCCTCCACOCCACA MAST Tarnet site Figure 4 Schematic Diagram of Homologous Recombination HR Process aaa Accelerating discoveries through innovations 7 3 SBI System Biosciences In Figure 4 a region of the human AAVS1 safe harbor locus in blue is targeted by a gRNA Cas9 in order to insert knock in an EF1a RFP T2A Puro expression cassette in red present in the HR Targeting Vector through homologous recombination HR The HR targeting vector contains homology arms at the 5 and 3 end of the expression cassette which each include 0 8kb of sequence homologous to the genomic DNA surrounding the targeted AAVS1 locus This region of homology is crucial for the success of the homologous recombination reaction as it serves as the guide template for specifically targeting the exogenous cassette into this genomic locus The typical size range for homology arms varies by the application but it should be anywhere from 0 5kb to 1kb for each arm for efficient recombination to occur Please note that the actual regions of recombination Red Xs at the 5 and 3 of the target site can vary widely thus it is difficult to predict the actual sites as this is determined by the cell For gene tagging applications see Fig 5 below the 5 homology arm must consist of 0 5 1kb of genomic sequence Arm1 upstream of the stop codon which is cloned into the HR tagging vector in such a way as to provide a seamless in frame junctio
7. estriction enzyme cloning This process is done sequentially for each homology arm to rapidly and accurately assemble the complete HR tagging vector for delivery into target cells in conjunction with CRISPR Cas9 or TALE Nuclease systems Summary of gRNA Design for Tagging Applications 1 gRNA cutting site should be in the 3 UTR region This avoids the possibility of introducing indels in the exonic sequence which may affect the reading frame of the endogenous gene and tagging vector 2 In frame insertion of 5 homology arm into tagging vector The control of insertion of the 5 homology arm into the tagging vector is crucial for correct expression of the fluorescent tag such that the tag protein e g GFP is in frame with the cloning site e g EcoRI site of the cloning vector GAATTC is in frame with ATG of copGFP please see the figure for HR120PA 1 vector below Gene synthesis of the arms will allow for precise control of the homology arm sequences to avoid frame issues 3 Seamless cloning of homology arms is best done using a combination of gene synthesis and Cold Fusion Cloning By using synthesized homology arms with appropriate end sequences appropriate for Cold Fusion Cloning see 5 and 3 arm design schematics below linearization of the tagging vector is the only step involved for seamless ligation of the synthesized homology arms into the tagging vector without introduction of additional nucleotides aaa Acceleratin
8. fic gene sequences allows researchers to easily generate and identify clones that have the desired features HR Tagging Vectors are quite similar to our HR Targeting Vectors with respect to the homologous recombination process resulting from generation of a DSB in cells They serve as the donor template to induce HR in cells that have been targeted at a specific locus using CRISPR Cas9 or TALE nucleases A general HR vector will contain the following features 1 Homologous sequences to the template with DSBs at 5 and 3 ends of the DSB cutting site 2 An expression cassette bearing a promoter insert CDNA microRNA non coding RNA etc fluorescent marker or selection agent to select cells that have undergone HR 3 In the case of a tagging vector a fluorescent marker e g GFP is included as part of the 5 homologous region that allows for seamless fusion into the last coding exon of the gene to be tagged The 5 and 3 homologous sequences termed homology arms should be exactly homologous to the template genomic sequence with the DSB and preferably directly adjacent to the actual DSB site An example of homology arm design is shown in Figure 4 Genomic DNA C O AANST Target ste Targeting Vector tccccrccaccccacastoccoc METETE ccc 0 8kb y r A Rada psa taAa 0 8kb U Genomic DNA X Targeting Vector tccccrocaccccacacto Scc MEE Homologous Recombination Genomic ONA 1666 TACTAGGGA Excis
9. g discoveries through innovations 9 System Biosciences 4 gRNA PAM motif site should be mutated or deleted in the completed tagging vector In order to prevent targeting of the completed tagging vector by CRISPR Cas9 the gRNA PAM site should be mutated or deleted which can be done during the synthesis of the 3 homology arm which will contain the PAM site Final Homology Arm Design for GFP tagged CD81 Protein Compatible with Cold Fusion Cloning System Using HR120PA 1 vector 5 Arm Design Cloning of the 5 Homology Arm into HR Tagging Vector HR120PA 1 The completed 5 homology arm can be readily cloned into our HR Tagging Vector e g HR120PA 1 using SBI s Cold Fusion Cloning Kit EcoRI Bambi Sal Xbal Not IL M cri RFP T2A Puro PolyA gt mcs and A Kawala ad MCS Multiple Cloning Sites HR 20PA 1 bp LoxP Sites 7672 bp GFP PolyA ig Insulator Sequences aaa Accelerating discoveries through innovations 10 Y SBI System Biosciences 1 Linearize 1 2ug of the HR120PA 1 vector using EcoRI enzyme preferably a high fidelity version such as EcoRI HF to ensure complete digestion of the vector 2 Clean up the digestion reaction and run out the reaction on a 2 agarose gel Gel purify the insert and quantitate DNA using NanoDrop or other suitable UV Vis spectrophotometric method Dilute the purified DNA to a final concentration of 10 100ng ul 3 Resuspend the 5
10. ggcc gggggctgtt Lactocoguga COLIOCCLOGS GCTICICCGOGGG TGATCATGgt ECCCUCYT Ya TTCGAGATGA CGTGTA CTAAGTGACC CGTTTCCGGT BITTTITCTIC AGGTGGCGTG AGGGGTCCTT CCTCTCCTGG GCTGTGTCCA TOOTOO ATGCACCTGT TGACTCCGTC TGCAGTCCCT gcaggggaat ccagggtgag 2417146 2417196 2417246 2A172296 2417346 2AT 396 2417446 2417496 2417546 2417596 2417646 24176096 2417746 2411796 2417846 2411696 2417946 Za 7996 2418046 2418096 2418146 2418196 2418246 2418296 2418346 AB S96 2418446 2418496 2418546 2418596 2418646 2418696 2418746 3 SBI System Biosciences lll Guide RNA Design A single gRNA targeting the 3 UTR region of Human CD81 has been selected using the CHOPCHOP CRISPR gRNA algorithm https chopchop rc fas harvard edu which identifies and ranks gRNA targets using an evidence based scoring algorithm incorporating the of potential off target hits as well as GC content Home Instructions Scoring About Contact CHOPCHOP wu gt lt D rerio danRer7 Zv9 or paste input sequence CRISPR Cas9 TALEN Find Target Sites Reset options Toggle advanced options Fig 1 Screenshot of CHOPCHOP CRISPR gRNA design utility 1 Open the CHOPCHOP CRISPR gRNA design tool https chopchop rc fas harvard edu 2 Grab the genomic DNA sequence of human CD81 gene from Exon 6 8 to the end of the 3 UTR region include introns using genome browser utilities such as UCSC Genome Browser http genome ucsc edu Gen
11. into CHOPCHOP program 4 Click on Find Target Sites to get a ranked list of suitable gRNA targets Fig 3 on next page We chose a guide RNA targeting the 3 UTR region with the highest possible ranking to limit potential off target cutting and which is consistent with our tagging strategy to generate a C terminal fusion more information in Section Ill TT TT Accelerating discoveries through innovations 4 SBI System Biosciences Scroll to zoom Drag to move left an Download results Please select one senomic location xon Strand content 70 ona Fig 3 Screenshot of CHOPCHOP gRNA output gRNA ID Location of gRNA Target Sequence Protospacer Adaptor Motif gRNA CD81 3 UTR chr11 2418113 5 GGGCACTGCAGAGGTCCCTG 3 The gRNA will target the corresponding sequence in the CD81 3 UTR region as shown below agCTTGACTGCTGTGGCTCCAGCACACTGACTGCTTTGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGG CAGCAACATCATCAGCAACCTCTTCAAGgtgcgcgageccegtggggccececctgaccccccgcatgtcccgcccctggetggestcc taggggtgggcaggtcacacggcagccccacagggagcgaccacactgggtggcatggcccctgtcagggctgctctgctgggagggttggggtgg gaccgcatctggcccacgaggaaggcaggcgccctgtgctgcgcattccgggtgaagaaggtggaggctctggggggtgggaactcacctgcaccc ccagctccacgtgtgcactcgtgggtgtggacgcccctgacagcctgtagctggcagggcctgcaggccatatagtgccctgtggaagtttcctgctg aggcctcagtggaagtcgtcatcagtgatgctttaggggtctagtgacaccaatgaccgtgatctcagtggaaaagggcacagtgtgtcccaggcat ttcgcgtttatgttaaaacgggtggaagatagcaagccggcagaggccgggccg
12. lication note is designed for first time and experienced users of the CRISPR Cas9 system to learn how to create an endogenous GFP tagged version of human CD81 tetraspanin protein using a combination of SBI s PrecisionX Cas9 SmartNuclease and Homologous Recombination HR Tagging vectors The CD81 tetraspanin protein has been found to be preferentially localized to extracellular microvesicles EMVs such as exosomes and may be utilized as a marker for tracking the location of exosomes for in vitro and in vivo applications The protocol is designed for use of the CAS940A 1 CMV hspCas9 H1 gRNA cloning vector and HR120PA 1 EcoRI copGFP loxP EF1a RFP T2A Puro LoxP MCS HR Tagging vector to generate a C terminal fusion of CD81 protein to GFP Other combinations of Cas9 SmartNuclease Vectors and HR tagging vectors may be substituted as well TT TT Accelerating discoveries through innovations 1 ll Analysis of Gene Target Y SBI System Biosciences Human CD81 Tetraspanin Genomic Sequence covering Exon 6 7 8 and 3 UTR region agCTTGACTG CTCAAGAACA CAAGgtgcgc ccctgggtgg agcgaccaca ggttggggtg LGCOGCaLece LOoCcacCCe cca CCLeotagctg EC Qadgcee dacaccaatg aLlUTCYCgtEtE gggccgctgc cocaggarte Caacgggaag CaCCcecregca AAGCTGTACC GAYCYYYCYY CCELYLYCEO TCCTGAGCAT GGCCCCGCAG CGGACACTTC ATTACTCTGC TGAACTTTCC TATGAGTGGA CIGCCCTSGG GAGCCACTCG CCCAGCCCGC CCCGGTTCGA CCTTTCTAAC ATTTAATAAA CAGtgccagt Ctugacartcgg ggt he Gresik ae
13. n between the end of the target coding sequence and the GFP marker or T2A GFP marker in the tagging vector The 3 homology arm Arm2 is cloned into the HR tagging vector based on sequence downstream of the target cutting site to complete the tagging vector for use in HR as mediated by a suitable Cas9 gRNA or TALE Nuclease The end result is an endogenous C terminal fusion or T2A linked protein depending on the tagging vector that can be tracked within the cells of interest for dynamic spatial studies without resorting to traditional overexpression approaches resulting in the study of the tagged protein in a biologically relevant context ARMT E aed Le RFP T2A Puro PolyA r Donor vector Target Gene GFP PolyA EF1 gt RFP T2A Puro PolyA WB Exon MOS Figure 5 Schematic Representation of Gene Tagging using Homologous Recombination HR Tagging Vector With the CRISPR Cas9 system the cleavage site is 2 3bp upstream of the protospacer adaptor motif PAM immediately following the guide RNA sequence therefore homology arms should be designed to be as close as possible to this cut site lt 10bp at both ends for efficient HR reaction For TALEN aaa Accelerating discoveries through innovations 8 3 SBI System Biosciences mediated cleavage homology arms are designed to be adjacent to the spacer region between TALEN binding sites which spans 15 30bp and is the site of the DSB Important Caution when Desig
14. ning Homology Arms for Use with CRISPR Cas9 It is best practice to avoid including the full target sequence gRNA sequence PAM in the HR Tagging Vector to ensure that the donor vector is not targeted for cleavage by the Cas9 gRNA complex For tagging vectors it may be difficult to avoid adding the full sequence particularly when using a gRNA targeting an exon since the homology arm sequence must seamlessly fuse to the tag in the HR tagging vector It is easier to delete or modify the gRNA sequence from the homology arms when targeting a 3 UTR or intron We would highly recommend gene synthesis approaches as opposed to direct PCR from genomic DNA to clone in HR arms into our tagging vector which allows the user to control the exact sequence cloned into the arms This will allow the user to mutate the obligate PAM site proximal to the gRNA target site or use silent mutations to prevent cutting of the donor vector by Cas9 gRNA complex For gene tagging the most straightforward approach to construct homology arms is to use a combination of gene synthesis of the 5 and 3 homology arms and SBI s Cold Fusion Cloning system http www systembio com molecular tools cold fusion cloning overview By synthesizing sequences that have partial homology to the cloning vector and the genomic DNA both 5 and 3 homology arms can be fused into the cloning vector without the hassles and extraneous nucleotides required of traditional ligase r
15. nnovations 11 Y SBI System Biosciences The final HR tagging vector after cloning of the HR arms would look similar to the following copGFP LoxP Ins1 EF1a RFP T2A Puro Ins2 LoxP GGCCCCGCAGCTCTGGTC PAM site Cells which are successfully targeted will have GFP fused to the last coding exon of human CD81 as well as the rest of the donor cassette LoxP Ins1 EF1a RFP T2A Puro Ins2 LoxP downstream The elements between the loxP sites can be readily excised out by transfecting targeted cells with Cre recombinase Cat CRE100A 1 aaa Accelerating discoveries through innovations 12 SBI System Biosciences V Protocol for Co Transfection of HR120PA 1 Tagging Vector with Cas9 gRNA plasmids and Characterization of Cells 1 Plate 200 000 to 300 000 cells e g 293T cells into a single well of a 12 well plate in 1 ml of appropriate growth medium Include a single well of cells as negative control which can be non relevant plasmid DNA 2 Next day or when cells are 50 6096 confluent co transfect target cells with Cas9 plasmid s and the HR targeting vector using a suitable transfection reagent following the manufacturer s recommended protocol for 12 well plates The use of reduced or serum free media containing no antibiotics to dilute the vector transfection complex is highly recommended Note For 293T cells we suggest 0 5 ug of SBI s Cas9 SmartNuclease vector in conjunction with 0 5 yg of the HR tagging vecto
16. r into cells for efficient cleavage and HR reaction For other cell types we suggest optimizing the amounts and ratios of Cas9 plasmid to targeting vector for optimal results 3 Allow at least 12 hours before changing transfection media to complete growth media 4 Assay for positive HR events 96 hours after co transfection Select cells with insertion of tagging vector using fluorescent or antibiotic selection If using selection by Puromycin select cells for a minimum of 5 7 days prior to further characterization Cutting efficiency of Cas9 can be measured by Surveyor Nuclease Assay and HR efficiency by 96 of fluorescence signal via FACS sorting 5 After selection of cells in Puro remaining colonies can be propagated for further characterization by PCR genotyping and Sanger sequencing to confirm tagging of one or both alleles SBI offers the EZ oo Pe kit for fast characterization of engineered cells 6 Colonies possessing the desired tagged allele s can be subsequently passaged and clonally propagated 7 If desired the remaining cells can be transfected with the Cre recombinase to excise the cassette inserted into the genome This will preserve the GFP tag but will remove the Puro and RFP cassettes present in the HR120PA 1 backbone Copyright System Biosciences 2014 aaa Accelerating discoveries through innovations 13
Download Pdf Manuals
Related Search