Home

Manual - Gene Bridges

1. Strictly controlled recombination process due to an optimized design of the pRedET expression plasmid The genes for the Recombination proteins are under the control of an inducible promoter and the plasmid carries a temperature sensitive origin of replication for a convenient removal of the plasmid after recombination Two Red ET Recombination protein expression plasmids pRedET tet and pRedET amp Any E coli strain can be made Red ET proficient by transformation with these plasmids FRT flanked Kanamycin resistance template FRT PGK gb2 neo FRT to be used for your own experiments Positive controls to replace the gene for mannose transporter manX on the E coli chromosome Detailed protocols descriptions of plasmids maps and sequences Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 Additional functional cassettes e A001 Pro and Eukaryotic Neomycin Selection Cassette PGK gb2 neo e A002 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette FRT PGK gb2 neo FRT e A003 loxP flanked Pro and Eukaryotic Neomycin Selection Cassette loxP PGK gb2 neo loxP e A004 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette plus loxP site FRT PGK gb2 neo FRT loxP e A005 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette plus loxP site 2 version loxP FRT PGK gb2 neo FRT e A006 FRT flanked Chloramphenicol Selection Cassette FRT cm FRT e A007 loxP flanked Chl
2. M 1 kb ladder from Gibco Lanes 1 to 3 unmodified control BAC resulting in a 1066 bp band Lanes 4 to 12 successfully modified BACs containing the inserted Tn5 Neo cassette resulting in a 1133 bp band Figure 6 Restriction analysis of original and modified BACs after Xhol digestion M 1 kb ladder from Gibco Lanes 1 to 3 unmodified BACs Lanes 4 to 12 successfully modified BACs with the inserted Tn5 neo cassette 16 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 Protocol Preparation of BAC DNA for analytical purposes L Pick colonies and inoculate 2 ml of LB culture containing the appropriate antibiotics Incubate at 37 C over night with shaking at 1100 rpm Next day 2 3 Spin down the 2 ml overnight cultures for 1 min at 13 200 rpm Discard the supernatant and resuspend the cell pellet in 200 ul buffer P1 with RNase from QIAGEN DNA Maxi preparation Kit Add 200 ul of buffer P2 Qiagen and mix by inverting the tube several times Add 200 ul of buffer P3 Qiagen and mix by inverting the tube several times Spin down the white lysate at highest speed for 15 min Transfer the clear supernatant into a new 1 5ml Eppendorf tube and add 0 50 ml of 2 propanol Mix by inverting the tube and spin down the DNA at highest speed for 15 min Discard the supernatant and add 0 5 ml of 70 ethanol to rinse the pellet be careful not to loose the small white pellet 10
3. These two oligos are not supplied with the kit Upper 5 TAGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGCTG GACAGCAAGCGAACCGGAATTGC 3 Lower 5 TACCGAGCTCGAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCCTCG AGTCAGAAGAACTCGTCAAGAAGGCG 3 20 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 7 Troubleshooting Problems with the recombination reaction can be caused by a number of different factors Please review the information below to troubleshoot your experiments We highly recommend performing a positive control experiment using the components provided in the kit For homologous recombination the two DNA molecules must share two regions of perfect sequence identity Several wrong nucleotides in the homology region can completely abolish recombination Since oligonucleotides are used to add the homology regions they have to be synthesized properly and be of excellent quality Take into account that long oligonucleotides especially if they are longer than 80bp require additional purification steps such as HPLC Also note that the electronic sequences provided for BACs may not be 100 correct If you are trying to target a repeated sequence in your BAC you may experience problems because the homology region at the end of the linear fragment can go to more than one site It is therefore best not to target repeats directly Observation No colonies on your plate after Red ET Recombination If you do
4. 70 minutes Recombination will now occur Streak the cultures with a loop 100ul is sufficient if necessary plate all onto LB agar plates containing Chloramphenicol 15 ug ml and Kanamycin 15 ug ml The plates should not contain Tetracycline otherwise the Red ET Recombination protein expression plasmid will either persist or the cells will die Incubate the plates at 37 C over night The Red ET recombination protein expression plasmid pRedET will disappear at 37 C Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 You should obtain gt 500 colonies and the ratio of induced uninduced bacterial colonies should exceed 100 1 An example is shown in Figure 4 Figure 4 Typical result of a Red ET recombination experiment On the left plate the arabinose induced sample was streaked on a LB plated conditioned with Chloramphenicol 15 ug ml and Kanamycin 15 ug ml The right plate shows the result of the uninduced control plate Nearly all colonies growing on the agar plates conditioned with the appropriate antibiotics will have successfully recombined by Red ET Notably although most kanamycin resistant colonies will contain the correct BAC recombinant it is possible that secondary recombination usually deletions between internal repeats in the BAC can also occur The frequency of secondary recombination events varies greatly from one BAC to another To find out which clones have been modifi
5. amplification see Figure 3 Each oligonucleotide consists of two or if desired three parts 1 Required Part A A for the other oligonucleotide is the homology region shared by the target molecule and the linear molecule Choose the way you want to engineer your BAC Often you want to delete a section of your BAC This is accomplished by replacing this section with the selectable marker The homology regions are the 50bps directly adjacent to either side of the deleted section You can delete from O bp i e make an insertion to gt 100 kb The exact sequences of the homology regions can be chosen freely according to which position on the target molecule will be modified 2 Optional Part B B for the other oligonucleotide This part of the oligonucleotide allows useful sequences such as HA tags Myc tags His tags or restriction sites multiple cloning sites site specific recombination target sites etc to be incorporated into the recombinant product By design these will be incorporated into the recombinant product exactly where desired If the introduction of such operational sequences is not needed this piece can simply be omitted from the oligonucleotide design 3 Required Part C C for the other oligonucleotide This piece usually 18 to 24 nucleotides long primes the PCR amplification of the selectable marker from the provided template sequences are given on page 20 PCR template with annealed oligos PCR p
6. this plasmid Linear vector carrying a ColE1 origin of replication plus ampicillin resistance gene to be used for the subcloning experiment Positive controls to subclone a 15 kb fragment from a control BAC into the vector delivered with the kit Detailed protocols descriptions of plasmids maps and sequences K004 Quick and Easy Conditional Knockout Kit FRT FLPe and K005 Quick and Easy Conditional Knockout Kit loxP Cre Description This kit is designed to integrate FRT or loxP sites into large vectors at any position within 2 weeks Single FRT or loxP sites are inserted by Red ET recombination of FRT or loxP flanked functional cassettes into any designated locus with subsequent removal of the selection marker by FLPe or Cre recombinases Conditional targeting constructs can be generated either by a repetitive insertion of the functional cassette supplied with the kit or by combination with other functional cassettes offered by Gene Bridges The functional cassette supplied with the kit FRT PGK gb2 neo FRT or loxP PGK gb2 neo loxP combines a prokaryotic promoter gb2 for expression of Kanamycin resistance in E coli with an eukaryotic promoter PGK for expression of Neomycin resistance in mammalian cells High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 27 Conten
7. Also pick one colony from the control plate Puncture a hole in the lid of the tubes for air Incubate the cultures while shaking at 30 C overnight Day 4 Before starting e Chill ddH20 or 10 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap e Cool benchtop centrifuge to 2 C Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 13 The next day set up 4 lid punctured microfuge tubes 2 for your own experiment and 2 for control experiment containing 1 4 ml fresh LB medium conditioned with the same antibiotics as in step 1 Inoculate two of them with 30 ul fresh overnight culture for your experiment the other two with 30 ul of the overnight culture from the control Incubate the tubes at 30 C for 2 h shaking at 1100 rpm until ODgoo 0 3 Add 50 ul 10 L arabinose to one of the tubes for your own experiment and to one of the control tubes giving a final concentration of 0 3 0 4 This will induce the expression of the Red ET Recombination proteins Do not use D arabinose Leave the other tubes without induction as negative controls Incubate all at 37 C shaking for 45 min to 1 h Note It is important that cells are incubated at 37 C the temperature at which all proteins necessary for the subsequent recombination are expressed There are about 5 copies of this temperature sensitive plasmid per cell and during one hour there is approximately 1 doubling step meanin
8. C GAC Tel GGC Cee CIE GGT CIC GOG GAC CEC TAT CAG GAC ATA z05F Gly Phe Ile Asp Oys Gly Arg Leu Gly Val Ala Asp Arg Tyr Gln Asp Ile He GCG TTE GOT ACC CET GAT ATT ECT GRR GRE CIT GSC Get GRE TES ECT GAC zzzkAla Leu Ala Thr Arg Asp Ile Ala Glu Glu Leu Gly Gly Glu Trp Ala Asp 515 Cat TIC CIC eTe CIT TAC GGT ATC GCC GCT OOE GAT Tee CAS Cet ATC BT zach Arg Phe Leu Val Leu Tyr Gly Ile Ala Ala Pro Asp Ser Gin Arg Ile Ala 670 TIC TAT C amp C CIT CIT GRC GRE TIC TIC TEA CICGOAGOGCCACIGARTIGCTAATACEACT z5EbPhe Tyr Arg Leu Leu Asp Glu Phe Phe 1026 CACTATACGOCOCAATICOAECIOSSTA Figure 8 Map of the Tn5 neo selection cassette Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 Oligonucleotides used for the control reaction included in this kit The two oligonucleotides labeled check up and check down are designed for verification of the correctly recombined BAC clones by PCR They are supplied with the kit tubes 6 and 7 check up 5 GTCGATCAGACTATCAGCGTGAG 3 check down 5 TACCGAGCTCGAATTCGCCCTATAG 3 The oligos below were used to add the 50 bp homology regions italics for Red ET recombination to the neomycin kanamycin selection cassette used in the control reaction The parts of the oligos which serve as PCR primers for amplification of the Tn5 neo cassette are underlined An additional Xhol site bold was introduced between the homology region and the PCR primer of the lower oligonucleotide
9. P 2001 Recombination method European Patent Application No 0103276 2 These patents and patent applications are owned by Gene Bridges or owned by the EMBL and exclusively licensed to Gene Bridges 24 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 9 Purchaser Notification Warranty This product is the subject of European Patent No 1034260 issued on 12 of March 2003 or PCT EP98 07945 and United States Patent No 6 355 412 issued on 12 of March 2002 The purchase of this product conveys to the purchaser the non transferable right to use this product for research purposes only The purchaser can not sell or otherwise transfer this product or its components to a third party No rights are conveyed to the purchaser to use this product or its components for a commercial purpose Commercial purposes shall include any activity for which a party receives consideration of any kind These may include but are not limited to use of the product or its components in manufacturing to provide a service information or data use of the product for diagnostic purposes or re sale of the product or its components for any purpose commercial or otherwise The use of homologous recombination for commercial purposes may infringe the intellectual property covered by the EP 419 621 patent family Products containing the araB promoter are sold under patent license for research purposes only and are non transferable Inqui
10. Spin down the DNA at highest speed for 10 min 11 Clean the inner wall of the tube with a piece of tissue or cotton stick 12 Dry the pellet under the speed vacuum for 2 min or leave the tube open on the bench for 5 to 10 min until the DNA pellet is completely dry Do not overdry the pellet otherwise the DNA will become difficult to re dissolve 13 Resuspend the dry DNA pellet in 30 ul ddH2O Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 17 6 5 Maps and Sequences pos pRedET 9270 bp repA pSC101 ori Figure 7 Map of the Red ET expression plasmid pRedET tet Transformation of E coli hosts with this plasmid is selected for by acquisition of Tetracycline resistance at 30 C Expression of the Red ET Recombination proteins is induced by L arabinose activation of the BAD promoter at 37 C 18 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 Tn amp pramster 1 TAGARCOGCACIAACCICOGIGTIGCOGITGIARTOCCIGCIGTIGEAIIGCIGCIGZACACGCAAGOGAACCORZ 70 GAATTSITASTTERERIECCETETESTAAGBETIEERAREDILCTETARAETARATTGEATSSTTTICTTG 136 COZCOCRAGGATCIGAIGGCGCAGGGGATCARAGATCIGAICAAZGAGACAGGATGAGGATOGIIICGEC neon cin 205 ATE ATT GAA CRA GAT GGA TTG CAC GOR GET TCT COE EOC GCT Tee GIG GAG F Met Ile Glu Gin Asp Gly Leu His Ala Gly Ser Pro Ala Ala Trp Val Glu 256 AGS CTA TIC Get TAT GAC Tee GOA CAR CAG ACA AIC GEC TEC TCI GAT ECC 16k Arg Leu Phe Gly Tyr Asp Trp Ala Gin Gin Thr Il
11. Y Ki inati THE RECOMBINEERING COMPANY e GENE BRIDGES ion b Version 2 9 May 2014 ion t com Y omm e e LL es ru BE ITI e UH HT gt de e Oo wan MY Ade E AR Il 2 A T 1 m x gt J A t uf Tm sat N LO C001 3 gt gt 2 A E i It x y CONTENTS 1 Quick and Easy BAC Modification Kit uunusesnsnnnannnnannnnnnnnnnnannnnnnnnnannnnnannnnnnnnnnnnnnnannnnnnnnnnnnn 3 2 Experimental Oulline u ee een 5 3 How Red ET Recombination Works uueuusnsannsnannennnnnnnnnnnnnnnnnnannunnnnnnnnnnnnnnnnnnnannnnnnnnnannnnnannnnnnnnn 7 4 Oligonucleotide Design for Red ET Recombination eese 9 5 Media for Antibiotic Selection ususnussssnnnnnnnnnnnnnnnnnnnnnnnnannnnnannnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnannnnn 10 6 Technical PFOtOCOL crece re ERRAR 11 6 1 Generation of a Tn5 neo PCR product flanked by homology arms sess 11 6 2 Transformation with Red ET expression plasmid pRedET sss 12 6 3 Inserting the Tn5 neo cassette into a BAC ssssssssssesssesee ener 13 6 4 Verification of successfully modified BAC by PCR analysis sene 16 7 COD emm 21 8 References and Patents uusuuennnsnannnnnnnnnunnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnannnnnnnnnannnnnnann
12. ackground even if no traces were visible on an agarose gel If the linear DNA fragment was obtained by restriction digestion use less DNA and gel purify the fragment If the linear cassette was obtained by PCR set up a Dpnl digest for your PCR product and gel purify it at the end If you obtain a very low number of colonies on both plates it indicates that the overall efficiency of Red ET Recombination is very low In this case please control all parameters mentioned in the section for no colonies after Red ET Recombination 22 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 8 References and Patents 8 1 References e Angrand P O Daigle N van der Hoeven F Scholer H R and Stewart A F Simplified generation of targeting constructs using ET recombination Nucleic Acids Res 27 e16 1999 e Guzman L M Belin D Carson M J Beckwith J Tight regulation modulation and high level expression by vectors containing the arabinose pBAD promoter J Bacteriol 177 4121 4130 1995 e Hill F Benes V Thomasova D Stewart A F Kafatos F C Ansorge W BAC trimming minimizing clone overlaps Genomics 64 111 113 2000 e Miller C A Ingmer H and Cohen SN Boundaries of the pSC101 Minimal Replicon are Conditional J Bacteriol 177 4865 4871 1995 e Muyrers J P P Zhang Y Testa G Stewart A F Rapid modification of bacterial artificial chromosomes by ET recombination Nucleic Acids Re
13. ble marker e Replacement of genes on the E coli chromosome e Point mutations e Fusions e Introduction of site specific targeting sites loxP FRT etc e Insertion of restriction enzyme recognition sites e Subcloning of DNA pieces up to 60 kb e Transferring DNA fragments into multiple destination vectors e BAC and cosmid stitching e Substitutions Contact our DNA Engineering Service by email to contact genebridges com or go to www genebridges com for details and prices 30 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 This page intentionally left blank Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 31 Gene Bridges GmbH Commercial Centre Im Neuenheimer Feld 584 69120 Heidelberg Tel 49 0 6221 13 70 811 Fax 49 0 6221 13 70 829 contact genebridges com www genebridges com
14. e Gly Oys Ser Asp Ala 307 GCC GIG TIC Cee CIG TCA GOG CAE GGe CGC 006 GIT CIT TTT GIC ARG ACC a5 Ala Val Phe Arg Leu Ser Ala Gln Gly Arg Pro Val Leu Phe Val Lys Thr 45H GAC CTE TOC BET GCC CTE AAT GAA CIG CAG GAC GAG GOA GCE 066 CTA Tre 5zkAsp Leu Ser Gly Ala Leu Asn Glu Leu Gln Asp Glu Ala Ala Arg Leu Ser 2405 TES CIG GCC ACE ACG EEE GIT CCT TEC GCA GCT GTE CIC GAC GIT GTC ACT eo Trp Leu Ala Thr Thr Gly Val Pro Oys Ala Ala Val Leu Asp Val Val Thr 460 GRR GOG GGA AGE CAC Tee CTE CTA TTG GGC GAR ETE OOE Gee CAG EAT CIC fel Glu Ala Gly Arg Asp Trp Leu Leu Leu Gly Glu Val Pro Gly Gin Asp Leu 511 CTE TCA TCT CAC CIT ECT CCT GOC GRE AAA ETA TOC ATC ATE GCT GAT ECA 103 Leu Ser Ser His Leu Ala Pro Ala Glu Lys Val Ser Ile Met Ala Asp Ala az ATE EG COE CIG CAT ACE CIT GAT COE ECT ACC TEC OCA TIC GAC CAC CAA 120kMet Arg Arg Leu His Thr Leu Asp Pro Ala Thr Oys Pro Phe Asp His Gin El GOE ARA CAT CoC ATC GAG CGA GCA CET ACT OGG ATG GAA GCC GGI CIT ETC 137k Ala Lys His Arg lle Glu Arg Ala Arg Thr Arg Met Glu Ala Gly Leu Val 664 EAT CAG GAT GAT CTE CAC GRR GRE CAT CRE 666 CTC EE CCR EOC GAR CTE 154F Asp Gln Asp Asp Leu Asp Glu Glu His Gln Gly Leu Ala Pro Ala Glu Leu 715 TIC GCC AGG CIC ARG GOE Cet ATE OCC GAC BEE GAG GAT CIC ETC ETE ACC 171 Phe Ala Arg Leu Lys Ala Arg Met Pra Asp Gly Glu Asp Leu Val Val Thr 766 CAT GEC GAT ECC Tet TTE COE AAT ATC ATE ETE GAA AAT GGC Cet TIT Ter 188 His Gly Asp Ala Oys Leu Pro Asn Ile Met Val Glu Asn Gly Arg Phe Ser 17 GGA TIC AT
15. e up a genome and is often called functional genomics Escherichia coli vectors that can contain large inserts such as bacterial artificial chromosomes BACs offer several advantages for functional genomics They can carry sufficient DNA to encompass most eukaryotic genes including all cis acting regulatory elements as well as many eukaryotic gene clusters prokaryotic regulons and many complete viral genomes in a single molecule However conventional cloning methods rely on the use of restriction enzymes and in vitro purification steps which preclude engineering of large molecules Consequently the usefulness of such molecules has been limited until recently Red ET Recombination relies on homologous recombination in vivo in E coli and allows a wide range of modifications of DNA molecules of any size and at any chosen position Homologous recombination is the exchange of genetic material between two DNA molecules in a precise specific and accurate manner These qualities are optimal for engineering a DNA molecule regardless of its size Homologous recombination occurs through homology regions which are stretches of DNA shared by the two molecules that recombine Because the sequence of the homology regions can be chosen freely any position on a target molecule can be specifically altered Zhang and coworkers demonstrated in 1998 for the first time that a pair of phage coded proteins RecE and RecT only need 42 bp long homology arms to med
16. ed without rearrangement isolate the BAC DNA Pick 10 20 colonies from the experiment and 2 from the control Also pick colonies from the original unmodified BAC plates for DNA preparation and comparison Analyze these DNA preparations using a Restriction digestion of mini prep DNA followed by electrophoresis this is our preferred method because secondary recombination events can be detected and or b PCR amplification of the insertion site using externally located primers with subsequent sequencing across the recombination site s As a further control tube 5 contains E coli harboring the correctly modified product of the control reaction Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 15 6 4 Verification of successfully modified BAC by PCR analysis Analyze several colonies by colony PCR e g pick a single colony and resuspend it in 30 ul of sterile water Boil the sample at 98 C for 5 minutes and take an aliquot of 2 ul of the suspension as template for your PCR reaction Two pairs of control primers are included in the kit tube 6 and 7 The primers bind to the pBeloBAC11 backbone and amplify a 1066bp fragment from the unmodified control BAC and a 1133 bp fragment after insertion of the neomycin cassette Figure 5 As a further control restriction digestion of mini prep DNA can be performed Figure 6 M12 3 4 5 6 7 8 9 10 11 12 Figure 5 PCR results verifying the successful Red ET Recombination
17. g any daughter cell will still have on average 2 3 copies left and will also go on expressing the recombination proteins The plasmid is actually lost after electroporation and recombination when cells are incubated at 37 C overnight Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled microfuge benchtop centrifuge at 2 C Discard the supernatant by quickly tipping it out twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH2O pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 ul will be left in the tube with the pellet Resuspend cells and keep the tubes on ice Add 1 2 ul 100 200 ng of the linear Tn5 neo cassette to the pellet to each of the two microfuge tubes induced and uninduced and pipette the mixture into the chilled electroporation cuvettes In parallel pipette 1 ul from tube 3 into each of the two tubes of the control Electroporate at 1350 V 10 uF 600 Ohms This setting applies to an Eppendorf Electroporator 2510 using an electroporation cuvette with a slit of 1 mm Other devices can be used but 1350 V and a 5 ms pulse are recommended Add 1 ml LB medium without antibiotics to the cuvette Mix the cells carefully by pipetting up and down and pipette back into the microfuge tube Incubate the cultures at 37 C with shaking for
18. haft J van der Hoeven F Glaser S Anastassiadis K Zhang Y Hermann T Stremmel W and Stewart A F A reliable lacZ expression reporter cassette for multipurpose knockout first alleles Genesis 38 151 158 2004 Zhang Y Buchholz F Muyrers J P P and Stewart A F A new logic for DNA engineering using recombination in Escherichia coli Nature Genetics 20 123 128 1998 Zhang Y Muyrers J P P Testa G and Stewart A F DNA cloning by homologous recombination in Escherichia coli Nature Biotech 18 1314 1317 2000 Zhang Y Muyrers P P J Rientjes J and Stewart A F Phage annealing proteins promote oligonucleotide directed mutagenesis in Escherichia coli and mouse ES cells BMC Molecular Biology 4 1 14 2003 8 2 Patents Red ET recombination is covered by one or several of the following patents and patent applications Stewart A F Zhang Y and Buchholz F 1998 Novel DNA cloning method European Patent No 1034260 issued on 12 of March 2003 United States Patent No 6 509 156 Stewart A F Zhang Y and Muyrers J P P 1999 Methods and compositions for directed cloning and subcloning using homologous recombination United States Patent No 6 355 412 issued on 12 of March 2002 Youming Zhang A Francis Stewart and Joep P P Muijrers 2001 Improved RecT or RecET cloning and subcloning method European Patent Application No 01 117 529 6 Stewart A F Zhang Y and Muyrers J P
19. he y gene together with simultaneous expression of the reda and genes allows efficient homologous recombination between linear DNA fragments and plasmids resident in cells such as DH10B pRedET is a derivative of a thermo sensitive pSC101 replicon which is a low copy number plasmid dependent on oriR101 The RepA protein encoded by plasmid pSC101 is required for plasmid DNA replication and the partitioning of plasmids to daughter cells at division Miller Ingmer and Cohen 1995 Because the RepA protein is temperature sensitive Ts cells have to be cultured at 30 C to maintain the plasmid pSC101 derivatives are easily curable at 37 C to 43 C Experiments have shown that the copy number of the plasmid decreases by about 80 during four generations of bacterial cell growth at 42 C After return of the cultures to 30 C approximately the same number of generations of bacterial cell growth is required for the copy number of the plasmid to return to the level observed before Miller Ingmer and Cohen 1995 Since the plasmid is based on oriR101 it can be propagated in E coli together with most ColE1 derived plasmids 8 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 4 Oligonucleotide Design for Red ET Recombination To target your BAC at the site s you choose you will need to attach short homology regions to a selectable marker This is most conveniently done by ordering two oligonucleotides for use in PCR
20. iate the homologous recombination between a linear DNA molecule e g a PCR product and circular DNA plasmid BAC or E coli chromosome One year later the system was extended by the same group in replacing recE and recT by their respective functional counterparts of phage lambda reda and red Muyrers et al 1999 Red ET Recombination utilizes homologous recombination and represents a revolutionary DNA engineering platform that addresses the limitations found in conventional methods Quick and Easy BAC Modification kit The Quick and Easy BAC Modification kit is designed to introduce basic modifications such as insertions and deletions in any type of bacterial artificial chromosomes BACs within 1 2 weeks Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 3 Contents of the kit 1 2 pRedET tet Red ET expression plasmid 20 ng ul 20 ul In5 neo template DNA PCR template for generating a Tn5 neomycin kanamycin cassette 50 ng ul 20 ul Tn5 neo _PCR product Tn5 neomycin kanamycin cassette flanked by homology arms at the 5 and 3 end for the control experiment 100 ng ul 10 ul control BAC pRedET tet Glycerol stock of E coli strain HS996 harboring the expression plasmid pRedET tet as well as a pBeloBAC11 derivate for the control experiment 500 ul 25 glycerol BAC control neo Glycerol stock of E coli strain HS996 harboring the modified pBeloBAC11 derivate 500 ul 25 glycer
21. igests one strand of the DNA from the DSB leaving the other strand as a 3 ended single stranded DNA overhang Then Red or RecT binds and coats the single strand The protein nucleic acid filament aligns with homologous DNA Once aligned the 3 end becomes a primer for DNA replication The X recombination proteins can be expressed from a plasmid Figure 7 and are therefore transferable to any E coli strain pRedET Figure 7 carries the A phage redyBa operon expressed under the control of the arabinose inducible pBAD promoter Guzman et al 1995 and confers Tetracycline resistance The pBAD promoter is both positively and negatively regulated by the product of the araC gene Schleif 1992 AraC is a transcriptional regulator that forms a complex with L arabinose Arabinose binds to AraC and allows transcription to begin In the presence of glucose or the absence of arabinose transcription is blocked by the AraC dimer The plasmid carries the redo p y genes of the X phage together with the recA gene in a polycistronic operon under the control of an inducible promoter The recombination window is therefore limited by the transient expression of Red proteins Thus the risk of unwanted intra molecular rearrangement is minimized While constitutive expression of the redy gene has a toxic effect in recA cells like DH10B or HS996 under some conditions thus limiting the efficiency of recombination tightly regulated expression of t
22. inal concentration of 10 uM We present as an example a standard PCR protocol for the use of Phusion DNA Polymerase Finnzyme However any other DNA Polymerase together with the corresponding PCR protocol according to the instructions of the manufacturer should yield satisfactory results PCR reaction in 50 ul 34 5 ul dH20 10 0 ul 5 x HF PCR reaction buffer 2 0 pl 5 mM dNTP 1 0 ul upper oligonucleotide 1 0 ul lower oligonucleotide 1 0 ul Tn5 neo PCR template tube 2 0 5 ul Phusion polymerase 5 U ul Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 11 An annealing temperature of 57 62 C is optimal PCR Profile Initial denaturation step 30 sec 98 C thirty cycles 10 sec 98 C 30 sec 55 C 90 sec 72 C final elongation step 10 min 72 C Check a 5 ul aliquot of the PCR product on a gel to ensure the PCR was successful The size of the PCR product for the Tn5 neo cassette is 1082bp Purify the PCR product either by running the whole PCR sample on an agarose gel and subsequent gel extraction or directly by Spin Column e g Min Elute Gel Extraction Kit Qiagen Adjust the DNA concentration to 100 ng ul 6 2 Transformation with Red ET expression plasmid pRedET Before starting with the experiment please streak out the glycerol stock of the BAC clone you obtained from the stock center on LB plates conditioned with Chloramphenicol Day 1 1 Set up an overnight culture Pick one o
23. ke sure you use L arabinose some strains e g JM109 DH5alpha are less efficient in Red ET Recombination than others DH10B HS996 GeneHogs or TOP10 are our preferred strains in very rare cases an elongation of the reaction time for the recombination from 70 min incubation of electroporation to up to four hours is necessary for successful recombination 4 Problems with and after the electroporation cells are not competent enough to take up the linear DNA fragment Please make sure that the cells were kept on ice and that the water respectively 10 glycerol is sufficiently cold Linear DNA has been shown to be about 10 fold less active than DNA transformed in circular form Eppendorf Operation Manual Electroporator 2510 version 1 0 Make sure that the time constant is around 5 ms please make sure that there is no arching during the electroporation process please make sure that after electroporation the cells are plated on the appropriate concentration of antibiotics depending on the copy number of the plasmid or BAC see page 9 Similar number of colonies on both plates the induced and the un induced one If you obtain a high number of colonies on both plates it indicates that there are still traces of the circular or supercoiled plasmid used to prepare the linear fragment left in the sample Since the transformation efficiency of linear fragments is 10 fold less than of circular DNA molecules you may obtain a b
24. lution per 1 4 ml LB for induction of recombination protein expression from pRedET Frozen aliquots should not undergo more than three freeze thaw cycles 10 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 6 Technical Protocol 6 1 Generation of a Tn5 neo PCR product flanked by homology arms Oligo design Please follow the advice in Oligonucleotide Design page 9 for Red ET Recombination The example used for the positive control reaction included in this kit is presented i Choose 50 nucleotides directly adjacent to the left of the site you want to change Order an oligonucleotide with this sequence at the 5 end At the 3 end of this oligo include the PCR primer sequence for amplification of the Tn5 neo selection cassette given in italics below Upper oligonucleotide 5 N so TGGACAGCAAGCGAACCGGAATTGC 3 ii Choose 50 nucleotides directly adjacent to the right of the site you want to change and transfer them into the reverse complement orientation Order an oligonucleotide with this sequence at the 5 end At the 3 end of this oligo include the 3 PCR primer sequence for the Tn5 neo selection cassette given in italics below Lower oligonucleotide 5 N so TCAGAAGAACTCGTCAAGAAGGCOG 3 If desired include restriction sites or other short sequences in the ordered oligo s between the 5 homology regions and the 3 PCR primer sequences PCR The oligonucleotides are suspended in ddH5O at a f
25. nnnn 23 8 1 IINe IMP 23 8 2 uic 24 9 Purchaser Notification Warranty e eeeeeeeeeees esee eee en nenne seen nnn nnn rr 25 10 Other products available from Gene Bridges essere 26 11 DNA Engineering Services Available from Gene Bridges esses 30 Please read The products listed in this manual are for research purposes only They are not designed for diagnostic or therapeutic use in humans animals or plants Success depends on following the protocols exactly as they are described Do read the trouble shooting guide before beginning your experiments Red ET Recombination is the intellectual property of Gene Bridges GmbH Safety Some chemical reagents used with this system are dangerous if handled carelessly Take care when using chemical reagents such as isopropanol and ethidium bromide and electrical apparatus high voltage power supplies gel electrophoresis and electroporation apparatus Follow the manufacturers safety recommendations 2 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 1 Quick and Easy BAC Modification Kit Introduction The completion of large DNA sequencing projects including the Human Genome Project has generated an extraordinary amount of primary sequence data The next major challenge is to investigate the components that mak
26. not obtain any colonies after recombination the following parameters should be checked 1 The PCR product could be wrong check it by restriction digest or sequencing could be degraded check an aliquot on an agarose gel could have incorrect homology arms Please double check the oligonucleotides used to generate the homology arms for quality and correctness If necessary verify the sequence by sequencing of the PCR product may not be enough increase the amount of PCR product from approximately 200 ng up to 500 ng Please take into consideration that you may also increase non specific background 2 The BAC may be instable and may have rearranged Digest the BAC and run on a gel preferably PFGE to confirm the approximate size may contain some repeats in the region you are targeting Re check sequence could be wrong make sure that you have the right BAC by isolating DNA and checking the region of the homology arms by PCR If necessary sequence the PCR product to verify the region of homology Some BACs are wrongly annotated inherently instable or a mixture of more than one BAC Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 21 3 The Red ET reaction did not take place because there was no expression plasmid present in the cells e g the cells were grown at 37 C instead of 30 C check for tet resistance no or the wrong type of arabinose was used for induction please ma
27. nsertion or deletion of non selectable marker genes fragment exchange without leaving a selection marker or any unwanted sequences The included counter selection cassette pRpsL neo is based on Streptomycin selection which shows a much higher efficiency than pSacB neo or comparable systems This kit can also be used to work on bacterial chromosomes and common ColE1 origin plasmids High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid BAC host E coli strain HS996 already carrying the Red ET plasmid pRpsL neomycin template to be used for your own experiments Positive controls to introduce a point mutation in a 150 kb BAC Detailed protocols descriptions of plasmids maps and sequences Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 K003 BAC Subcloning Kit Description Contents This kitis optimized for subcloning of DNA fragments from BACs and cosmids No restriction sites necessary Fragments up to 20 kb can be subcloned High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with
28. ntegration of the selection cassette will be monitored by PCR or DNA mini preparation 6 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 3 How Red ET Recombination Works In Red ET Recombination also referred to as 2 mediated recombination target DNA molecules are precisely altered by homologous recombination in E coli which express the phage derived protein pairs either RecE RecT from the Rac prophage or Reda Red from phage These protein pairs are functionally and operationally equivalent RecE and Reda are 5 3 exonucleases and RecT and Red are DNA annealing proteins A functional interaction between RecE and RecT or between Reda and Red is also required in order to catalyze the homologous recombination reaction Recombination occurs through homology regions which are stretches of DNA shared by the two molecules that recombine Figure 2 The recombination is further assisted by X encoded Gam protein which inhibits the RecBCD exonuclease activity of E coli Double stranded break 3 5 DL ai exonuclease 5 3 3 OOOOO icd Single strand ln binding proteins 5 3 3 Joint molecule formation DNA replication Figure 2 Mechanism of Red ET Recombination Double stranded break repair DSBR is initiated by the recombinase protein pairs RecE RecT or Reda Red Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 7 First Reda or RecE d
29. ol PCR primer oligo check up Amplification primer to confirm the correct recombination in the control experiment 10 uM 20 pl PCR primer oligo check down Amplification primer to confirm the correct recombination in the control experiment 10 uM 20 pl Please store tubes 1 3 and 6 7 at 20 C store tubes 4 and 5 at 80 C Kit manual with protocols maps and sequences Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 2 Experimental Outline step 1 A pBAC step 2 Sy OH L Arabinose O 30 gt 37 HO OH neo PCR product hm hm pBAC neo Figure 1 Flowchart of the experimental outline for the insertion of a selectable marker gene e g Tn5 neomycin kanamycin into a BAC step 3 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 Step 1 The E coli strain carrying the BAC which is to be modified is transformed with the expression plasmid pRedET Step 2 The expression of genes mediating Red ET is induced by the addition of L arabinose and a temperature shift from 30 C to 37 C After induction the cells are prepared for electroporation and the linear Tn5 neo cassette PCR product flanked by homology arms hm is electroporated Red ET recombination inserts the functional cassette into the target locus Only colonies carrying the modified BAC will survive Kanamycin selection on the agar plates Step 3 The successful i
30. oramphenicol Selection Cassette loxP cm loxP e A008 FRT flanked Ampicillin Selection Cassette FRT amp FRT e A009 loxP flanked Ampicillin Selection Cassette loxP amp loxP e A010 FRT flanked Pro and Eukaryotic Hygromycin Selection Cassette FRT PGK gb2 hygro FRT e A011 loxP flanked Pro and Eukaryotic Hygromycin Selection Cassette loxP PGK gb2 hygro loxP Additional strains and plasmids e A104 Enhanced FLP Expression Plasmid 707 FLPe with tetracycline resistance marker for use in E coli only e A105 Enhanced FLP Expression Plasmid 708 FLPe with chloramphenicol resistance marker for use in E coli only e A112 Cre Expression Plasmid 705 Cre cm resistance marker e A113 Cre Expression Plasmid 706 Cre tet resistance marker e A201 Enhanced Eukaryotic FLP Expression Plasmid PCAGGS FLPe Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 29 11 DNA Engineering Services Available from Gene Bridges Instead of performing your own DNA manipulations let the Gene Bridges DNA Engineering Service do the work for you We work for many commercial and research organisations across the world to provide DNA modifications in low or high copy plasmids cosmids BACs and the E coli chromosome The available DNA modifications are e Insertion of a selectable or non selectable marker cassette e Deletion of sequences of any size ranging from 1 bp up to more than 100 kb with or without leaving a selecta
31. r two colonies and inoculate them in microfuge tubes containing 1 0 ml LB medium with appropriate antibiotics to select for your BAC Puncture a hole in the lid for air Incubate at 37 C overnight with shaking Day 2 1 Before starting e Chill ddH2O or 10 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap e Cool benchtop centrifuge to 2 C Set up one or two microfuge tubes containing fresh 1 4 ml LB medium with appropriate antibiotics and inoculate with 30 ul of fresh overnight culture Culture for 2 3 h at 37 C shaking at 1000 rpm Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled microfuge benchtop centrifuge at 2 C Discard the supernatant by quickly tipping out the supernatant twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH2O pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 ul will be left in the tube with the pellet Resuspend cells and keep the tube on ice Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 Take the Red ET Recombination protein expression plasmid pRedET tube 1 Add 1 ul to your cell pellet Mix briefly Keep the tube on ice Transfer the cell suspension from the tube to the chilled electroporation cuvette Electroporate at 1350 V 10uF 600 Ohms This set
32. ries for any commercial use including production of material to be sold commercially or used in production or in product development efforts which includes efforts toward regulatory approval should be made directly to Xoma Corporation Berkeley California Xoma Corporation 2910 Seventh Street Berkeley CA 94710 Limited Warranty Gene Bridges is committed to providing customers with high quality goods and services Gene Bridges assumes no responsibility or liability for any special indirect incidental or consequential loss or damage whatsoever This warranty limits Gene Bridges GmbH s liability only to the cost of the product Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 25 10 Other products available from Gene Bridges General information e Kits are available for non commercial research organizations Commercial companies or for profit organizations require a sub license to use Red ET Recombination The complete product list as well as the all information how to order the kits in your country is given on our website www genebridges com K002 Counter Selection BAC Modification Kit Description Contents 26 This kit is designed to modify any type of bacterial artificial chromosomes BACs within 2 3 weeks by using a counter selection cassette The kit is designed for advanced BAC modification such as introducing short sequences e g point mutations loxP sites restriction sites etc i
33. roduct amp Vector Targeting construct N B C 3 A A Sm Sm Sm 3 C A A B Ds 4 N A A a N Vector Figure 3 Practical steps involved in Red ET Fig 3 illustrates the principle for modifying episomes such as bacterial artificial chromosomes BACs See text above for further details Sm selectable marker the small blue arrow indicates a prokaryotic promoter Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 9 5 Media for Antibiotic Selection All antibiotics are available from Sigma Stock solutions should be stored at 20 C For selective LB medium the antibiotic is dissolved in LB medium to the indicated working concentration 1 Chloramphenicol stock solution c 30 mg ml dissolved in ethanol Working concentration 15 ug ml for BACs 50 ug ml for high copy plasmids 2 Tetracycline stock solution c 10 mg ml dissolved in 75 ethanol Working concentration for pRedET is 3 ug ml Tetracycline is light sensitive 3 Kanamycin stock solution c 30 mg ml dissolved in ddH20 Working concentration 15 ug ml for BACs 50 ug ml for high copy plasmids Selective LB plates are made by adding 15 g agar to 1 L LB medium After boiling cool to approx 50 C add the required antibiotics to yield the appropriate working concentrations and pour into petri dishes L arabinose stock solution Use 10 L arabinose Sigma A 3256 in ddH2O fresh or frozen in small aliquots at 20 C Use 50 yl stock so
34. s 27 1555 1557 1999 e Muyrers J P P Zhang Y Buchholz F Stewart A F RecE RecT and Redo Red initiate double stranded break repair by specifically interacting with their respective partners Genes Dev 14 1971 1982 2000 e Muyrers J P P Zhang Y Benes V Testa G Ansorge W Stewart A F Point mutation of bacterial artificial chromosomes by ET recombination EMBO Reports 1 239 243 2000 e Muyrers J P P Zhang Y Stewart A F ET cloning Think recombination first Genetic Engineering Principles and Methods Ed J K Setlow 22 77 98 Kluwer Academic Plenum Publishers NY 2000 e Muyrers J P P Zhang Y and Stewart A F Recombinogenic engineering new options for cloning and manipulating DNA Trends in Bioch Sci 26 325 31 2001 e Narayanan K Williamson R Zhang Y Stewart A F loannou P A Efficient and precise engineering of a 200 kb beta globin human bacterial artificial chromosome in E coli DH10B using an inducible homologous recombination system Gene Ther 6 442 447 1999 e Schleif R S DNA Looping Annu Rev Biochem 61 199 223 1992 e Testa G Zhang Y Vintersten K Benes V Pijnappel P Chambers l Smith A J H Smith A G and Stewart A F Engineering of mouse genome with bacterial artificial chromosomes to create multipurpose alleles Nature Biotechnology 21 443 7 2003 Gene Bridges Quick and Easy BAC Modification Kit Version 2 9 May 2014 23 Testa G Sc
35. ting applies to an Eppendorf Electroporator 2510 using a 1 mm electroporation cuvette Other devices can be used but 1350 V and a 5 ms pulse are recommended Resuspend the electroporated cells in 1 ml LB medium without antibiotics and return them to the microfuge tube Incubate at 30 C for 70 min shaking at 1000 rpm The Red ET expression plasmid pRedET will be lost at 37 C Using a small loop plate 100 yl cells on LB agar plates containing Tetracycline 3 ug ml plus Chloramphenicol 15 ug ml for the BAC Incubate the plates at 30 C overnight or for at least 15 h Protect the plates from light by wrapping them up because Tetracycline is sensitive to light Make sure the cells stay at 30 C otherwise the Red ET plasmid will be lost 6 3 Inserting the Tn5 neo cassette into a BAC In the next step prepare electro competent cells from the BAC hosts that contain the Red ET expression plasmid shortly after inducing the expression of the recombination proteins In advance prepare the linear DNA fragment the Tn5 neo selection cassette with homology arms that you will insert into your BAC Use tube 3 Tn5 neo PCR product and tube 4 control BAC pRedET to perform a control experiment in parallel Day 3 1 To start overnight cultures pick one colony from the plate you obtained in 6 2 step 8 and inoculate one microfuge tube containing 1 0 ml LB medium plus Tetracycline 3 ug ml and Chloramphenicol 15 ug ml for the BAC
36. ts Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid FRT or loxP flanked Kan Neo resistance template FRT PGK gb2 neo FRT or loxP PGK gb2 neo loxP to be used for your own experiments Expression plasmid for FLPe or Cre site specific recombinase in E coli cells Positive controls to introduce a single FRT site into a 15 kb high copy plasmid Detailed protocols descriptions of plasmids maps and sequences K006 Quick and Easy E coli Gene Deletion Kit Description Contents 28 This kit is designed to knock out or alter genes on the E coli chromosome in less than one week Red ET recombination allows the exchange of genetic information in a base pair precise specific and faithful manner An FRT flanked Kanamycin resistance marker cassette is supplied with the kit which can be used to replace a gene on the E coli chromosome Red ET recombination can replace fragments as large as 30kb from the chromosome The use of a FRT flanked resistance cassette for the replacement of the targeted gene allows the subsequent removal of the selection marker by a FLP recombinase step if required FLP expression plasmids can be purchased from Gene Bridges Multiple knock outs can be generated either by a repetitive insertion of the functional cassette supplied with the kit or by combination with other functional cassettes offered by Gene Bridges

Manual - Gene Bridges

Contents

Download Pdf Manuals

Related Search

Related Contents